miRTarBase - #MIRT000660


—
pre-miRNA Information
pre-miRNA hsa-mir-424   
Genomic Coordinates chrX: 134546614 - 134546711
Synonyms MIR322, MIRN424, hsa-mir-424, miRNA424, MIR424
Description Homo sapiens miR-424 stem-loop
Comment This hairpin precursor expresses a 5' arm product, named miR-424, in human promyelocytic leukemia (HL-60) cells . The level of expression of miR-424 was shown to be up-regulated 48 hours after TPA-induction. The sequence is orthologous to the experimentally verified rat miR-322 locus (MIR:MI0000589), which expresses its mature product from the 3' arm of the hairpin. The human miR-424 hairpin does not appear to contain the miR-322 sequence.
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-424-5p
Sequence 11| CAGCAGCAAUUCAUGUUUUGAA |32
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 5 X - 134546697 29233923 MiREDiBase
A-to-I 8 X - 134546694 17604727 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs888095819 1 dbSNP
rs1486362336 18 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ANLN   
Synonyms FSGS8, Scraps, scra
Description anillin actin binding protein
Transcript NM_018685   
Expression
Putative miRNA Targets on ANLN
3'UTR of ANLN
(miRNA target sites are highlighted)		 
>ANLN|NM_018685|3'UTR
   1 ACCGGGAAATTTCCATGCTATCTAGAGGTTTTTGATGTCATCTTAAGAAACACACTTAAGAGCATCAGATTTACTGATTG
  81 CATTTTATGCTTTAAGTACGAAAGGGTTTGTGCCAATATTCACTACGTATTATGCAGTATTTATATCTTTTGTATGTAAA
 161 ACTTTAACTGATTTCTGTCATTCATCAATGAGTAGAAGTAAATACATTATAGTTGATTTTGCTAAATCTTAATTTAAAAG
 241 CCTCATTTTCCTAGAAATCTAATTATTCAGTTATTCATGACAATATTTTTTTAAAAGTAAGAAATTCTGAGTTGTCTTCT
 321 TGGAGCTGTAGGTCTTGAAGCAGCAACGTCTTTCAGGGGTTGGAGACAGAAACCCATTCTCCAATCTCAGTAGTTTTTTC
 401 GAAAGGCTGTGATCATTTATTGATCGTGATATGACTTGTTACTAGGGTACTGAAAAAAATGTCTAAGGCCTTTACAGAAA
 481 CATTTTTAGTAATGAGGATGAGAACTTTTTCAAATAGCAAATATATATTGGCTTAAAGCATGAGGCTGTCTTCAGAAAAG
 561 TGATGTGGACATAGGAGGCAATGTGTGAGACTTGGGGGTTCAATATTTTATATAGAAGAGTTAATAAGCACATGGTTTAC
 641 ATTTACTCAGCTACTATATATGCAGTGTGGTGCACATTTTCACAGAATTCTGGCTTCATTAAGATCATTATTTTTGCTGC
 721 GTAGCTTACAGACTTAGCATATTAGTTTTTTCTACTCCTACAAGTGTAAATTGAAAAATCTTTATATTAAAAAAGTAAAC
 801 TGTTATGAAGCTGCTATGTACTAATAATACTTTGCTTGCCAAAGTGTTTGGGTTTTGTTGTTGTTTGTTTGTTTGTTTGT
 881 TTTTGGTTCATGAACAACAGTGTCTAGAAACCCATTTTGAAAGTGGAAAATTATTAAGTCACCTATCACCTTTAAACGCC
 961 TTTTTTTAAAATTATAAAATATTGTAAAGCAGGGTCTCAACTTTTAAATACACTTTGAACTTCTTCTCTGAATTATTAAA
1041 GTTCTTTATGACCTCATTTATAAACACTAAATTCTGTCACCTCCTGTCATTTTATTTTTTATTCATTCAAATGTATTTTT
1121 TCTTGTGCATATTATAAAAATATATTTTATGAGCTCTTACTCAAATAAATACCTGTAAATGTCTAAAGGAAAAAAAAAAA
1201 AAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' aaGUUUU-GUACU--UAACGACGac 5'
            :||:| ||| |   |||||||  
Target 5' atTAAGATCATTATTTTTGCTGCgt 3'
 698 - 722 138.00 -10.80
2 
miRNA  3' aaguUUUG----UACUUAACGACGAc 5'
              ||||    |||||  |||||| 
Target 5' aagtAAACTGTTATGAA--GCTGCTa 3'
 793 - 816 135.00 -10.00
3 
miRNA  3' aaGUUUUGU--ACUU--AACGACGAc 5'
            ||||:::  ||::  |||:||:| 
Target 5' gcCAAAGTGTTTGGGTTTTGTTGTTg 3'
 838 - 863 128.00 -13.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN15315348 4 COSMIC
COSN19660712 10 COSMIC
COSN30464236 14 COSMIC
COSN30145196 18 COSMIC
COSN32053540 61 COSMIC
COSN30102790 67 COSMIC
COSN30103880 74 COSMIC
COSN14286946 100 COSMIC
COSN31574864 101 COSMIC
COSN30144557 128 COSMIC
COSN30522880 128 COSMIC
COSN31582633 220 COSMIC
COSN30544296 241 COSMIC
COSN8300849 630 COSMIC
COSN14816476 948 COSMIC
COSN17129219 959 COSMIC
COSN23683557 969 COSMIC
COSN14441740 1158 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs771395026 2 dbSNP
rs2052197 4 dbSNP
rs115284398 5 dbSNP
rs373847797 12 dbSNP
rs763098311 16 dbSNP
rs763876476 18 dbSNP
rs1159545952 19 dbSNP
rs751569219 21 dbSNP
rs756995024 25 dbSNP
rs781079189 27 dbSNP
rs1375465091 28 dbSNP
rs750243624 36 dbSNP
rs779689611 41 dbSNP
rs748738653 46 dbSNP
rs1224038728 47 dbSNP
rs768270767 53 dbSNP
rs1190957263 56 dbSNP
rs929955305 61 dbSNP
rs904905437 76 dbSNP
rs1417105668 82 dbSNP
rs11550331 88 dbSNP
rs1183852166 95 dbSNP
rs1256721701 96 dbSNP
rs1364280339 98 dbSNP
rs774918777 101 dbSNP
rs1299518539 106 dbSNP
rs1228806328 107 dbSNP
rs1381811000 119 dbSNP
rs1171193382 120 dbSNP
rs944160405 126 dbSNP
rs1402282388 128 dbSNP
rs1039877277 137 dbSNP
rs1001712052 141 dbSNP
rs1034556405 146 dbSNP
rs900030004 147 dbSNP
rs1372079393 148 dbSNP
rs75513850 149 dbSNP
rs1450401404 163 dbSNP
rs1368263658 166 dbSNP
rs1043305528 168 dbSNP
rs376969147 170 dbSNP
rs903435877 175 dbSNP
rs566130635 176 dbSNP
rs1307046925 178 dbSNP
rs1394733159 181 dbSNP
rs537120117 189 dbSNP
rs1276990562 191 dbSNP
rs1206142992 203 dbSNP
rs1358393419 205 dbSNP
rs1282272385 214 dbSNP
rs1246898725 216 dbSNP
rs550684105 251 dbSNP
rs1026285901 252 dbSNP
rs1371871125 258 dbSNP
rs759802169 277 dbSNP
rs951430168 294 dbSNP
rs567115961 302 dbSNP
rs1161868319 305 dbSNP
rs1459876248 312 dbSNP
rs1369502104 324 dbSNP
rs1012641567 325 dbSNP
rs1471612852 326 dbSNP
rs1254087594 340 dbSNP
rs536267167 341 dbSNP
rs1183149163 343 dbSNP
rs984046147 347 dbSNP
rs553350497 348 dbSNP
rs973215501 349 dbSNP
rs1481767049 351 dbSNP
rs78095444 357 dbSNP
rs1226507881 377 dbSNP
rs1351782882 380 dbSNP
rs538995013 382 dbSNP
rs1251049513 385 dbSNP
rs950727999 390 dbSNP
rs1450893421 392 dbSNP
rs1191679761 393 dbSNP
rs572676873 394 dbSNP
rs912578324 395 dbSNP
rs1159003847 400 dbSNP
rs79021133 401 dbSNP
rs1370961918 407 dbSNP
rs1463252784 409 dbSNP
rs1477811581 426 dbSNP
rs186967801 427 dbSNP
rs1390473509 430 dbSNP
rs975465948 434 dbSNP
rs921367187 435 dbSNP
rs1247244828 445 dbSNP
rs922486792 446 dbSNP
rs3801301 448 dbSNP
rs1268180767 453 dbSNP
rs1218077094 462 dbSNP
rs1342298715 464 dbSNP
rs561457367 464 dbSNP
rs1328545703 466 dbSNP
rs1371773911 492 dbSNP
rs374416142 497 dbSNP
rs1433491298 500 dbSNP
rs191232097 511 dbSNP
rs1293589213 514 dbSNP
rs1309471647 520 dbSNP
rs1413943778 524 dbSNP
rs1423165950 525 dbSNP
rs1228432093 526 dbSNP
rs1478516100 528 dbSNP
rs946368152 540 dbSNP
rs903425976 541 dbSNP
rs934944801 542 dbSNP
rs1056779900 555 dbSNP
rs895497530 566 dbSNP
rs755053292 573 dbSNP
rs1280200383 581 dbSNP
rs1043378430 584 dbSNP
rs1022632397 594 dbSNP
rs1341072577 598 dbSNP
rs1297297018 606 dbSNP
rs904851727 609 dbSNP
rs898929168 612 dbSNP
rs1271221947 613 dbSNP
rs1254782095 614 dbSNP
rs1357493499 621 dbSNP
rs1336287352 622 dbSNP
rs1468897502 649 dbSNP
rs1415232039 653 dbSNP
rs1187373052 654 dbSNP
rs1166981922 655 dbSNP
rs761179663 657 dbSNP
rs1451026227 664 dbSNP
rs1429859616 673 dbSNP
rs1170727546 684 dbSNP
rs994623678 688 dbSNP
rs1238671871 690 dbSNP
rs1210272840 695 dbSNP
rs1482456911 697 dbSNP
rs764174126 699 dbSNP
rs540627847 700 dbSNP
rs567366512 704 dbSNP
rs1344736574 718 dbSNP
rs17170597 721 dbSNP
rs370683847 722 dbSNP
rs1377684351 727 dbSNP
rs1435088791 734 dbSNP
rs1018876319 736 dbSNP
rs79876784 738 dbSNP
rs1431924447 740 dbSNP
rs1370937132 742 dbSNP
rs557443836 742 dbSNP
rs1163861716 755 dbSNP
rs1403515529 760 dbSNP
rs1415816913 763 dbSNP
rs1182411159 771 dbSNP
rs1382939320 774 dbSNP
rs183038631 780 dbSNP
rs1333010690 785 dbSNP
rs1249006532 795 dbSNP
rs1183888277 807 dbSNP
rs975413392 816 dbSNP
rs1320324251 819 dbSNP
rs951596635 825 dbSNP
rs1005749258 830 dbSNP
rs1016927737 831 dbSNP
rs1335385719 832 dbSNP
rs978947859 843 dbSNP
rs1214991132 845 dbSNP
rs924795292 855 dbSNP
rs1374405105 860 dbSNP
rs1057499449 861 dbSNP
rs781540611 861 dbSNP
rs1351432961 868 dbSNP
rs1165494446 900 dbSNP
rs373269537 901 dbSNP
rs1409128177 906 dbSNP
rs975500870 915 dbSNP
rs578076576 939 dbSNP
rs1160823181 949 dbSNP
rs530740238 958 dbSNP
rs377036089 959 dbSNP
rs111612280 968 dbSNP
rs11550332 969 dbSNP
rs1487682471 971 dbSNP
rs913827281 971 dbSNP
rs1474051586 984 dbSNP
rs994570042 991 dbSNP
rs946649559 995 dbSNP
rs1214830337 997 dbSNP
rs1190500455 998 dbSNP
rs1266301033 1006 dbSNP
rs1230240795 1013 dbSNP
rs539129451 1020 dbSNP
rs1300797486 1025 dbSNP
rs188113765 1027 dbSNP
rs1369432336 1029 dbSNP
rs926305239 1032 dbSNP
rs1157580194 1039 dbSNP
rs1386295210 1048 dbSNP
rs1322475843 1051 dbSNP
rs937631575 1052 dbSNP
rs1376598935 1056 dbSNP
rs1173491798 1068 dbSNP
rs192941144 1069 dbSNP
rs1056233979 1074 dbSNP
rs1008749217 1075 dbSNP
rs185408168 1079 dbSNP
rs1454343365 1080 dbSNP
rs116795060 1087 dbSNP
rs1211156768 1089 dbSNP
rs1486205468 1090 dbSNP
rs538933525 1090 dbSNP
rs554236064 1091 dbSNP
rs1208238906 1092 dbSNP
rs964630657 1124 dbSNP
rs1014430658 1127 dbSNP
rs996841452 1133 dbSNP
rs1227314390 1140 dbSNP
rs1362809706 1141 dbSNP
rs1299669134 1143 dbSNP
rs1047709670 1159 dbSNP
rs1400835317 1159 dbSNP
rs571938964 1165 dbSNP
rs1300637507 1170 dbSNP
rs1467248084 1174 dbSNP
rs879325514 1178 dbSNP
rs887272707 1179 dbSNP
rs1028365638 1182 dbSNP
rs117648797 1190 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HeLa
Disease WEE1;
Location of target site 3'UTR
Tools used in this research EIMMO , TargetScan
Original Description (Extracted from the article) ... "we 茂卢聛nd the following: mir-424 targets ANLN ...

- Forrest AR; Kanamori-Katayama M; Tomaru Y; et al., 2010, Leukemia.

Article - Forrest AR; Kanamori-Katayama M; Tomaru Y; et al.
- Leukemia, 2010
Acute myeloid leukemia (AML) involves a block in terminal differentiation of the myeloid lineage and uncontrolled proliferation of a progenitor state. Using phorbol myristate acetate (PMA), it is possible to overcome this block in THP-1 cells (an M5-AML containing the MLL-MLLT3 fusion), resulting in differentiation to an adherent monocytic phenotype. As part of FANTOM4, we used microarrays to identify 23 microRNAs that are regulated by PMA. We identify four PMA-induced microRNAs (mir-155, mir-222, mir-424 and mir-503) that when overexpressed cause cell-cycle arrest and partial differentiation and when used in combination induce additional changes not seen by any individual microRNA. We further characterize these pro-differentiative microRNAs and show that mir-155 and mir-222 induce G2 arrest and apoptosis, respectively. We find mir-424 and mir-503 are derived from a polycistronic precursor mir-424-503 that is under repression by the MLL-MLLT3 leukemogenic fusion. Both of these microRNAs directly target cell-cycle regulators and induce G1 cell-cycle arrest when overexpressed in THP-1. We also find that the pro-differentiative mir-424 and mir-503 downregulate the anti-differentiative mir-9 by targeting a site in its primary transcript. Our study highlights the combinatorial effects of multiple microRNAs within cellular systems.
LinkOut: [PMID: 19956200]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE32688 Pancreatic cancer 0.453 4.6e-3 0.308 4.3e-2 32 Click to see details
GSE17306 Multiple myeloma 0.303 1.7e-2 0.331 1.0e-2 49 Click to see details
GSE42095 Differentiated embryonic stem cells -0.371 4.1e-2 -0.398 3.0e-2 23 Click to see details
GSE28260 Renal cortex and medulla -0.493 4.3e-2 -0.571 2.1e-2 13 Click to see details
GSE19536 Breast cancer -0.142 7.9e-2 -0.148 7.1e-2 100 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.474 9.9e-2 0.300 2.2e-1 9 Click to see details
GSE19783 ER- ER- breast cancer -0.139 1.1e-1 -0.187 4.9e-2 79 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.273 1.2e-1 0.439 2.6e-2 20 Click to see details
GSE19783 ER+ ER+ breast cancer -0.273 1.2e-1 -0.373 5.3e-2 20 Click to see details
GSE27834 Pluripotent stem cells -0.304 1.3e-1 -0.365 8.2e-2 16 Click to see details
GSE26953 Aortic valvular endothelial cells -0.221 1.5e-1 -0.112 3.0e-1 24 Click to see details
GSE38226 Liver fibrosis -0.21 1.8e-1 -0.088 3.5e-1 21 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.189 1.8e-1 0.209 1.6e-1 25 Click to see details
GSE21032 Prostate cancer -0.095 2.0e-1 -0.013 4.5e-1 83 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.158 2.3e-1 0.303 7.0e-2 25 Click to see details
GSE21687 Ependynoma primary tumors 0.093 2.3e-1 -0.063 3.1e-1 64 Click to see details
GSE28544 Breast cancer -0.079 3.6e-1 -0.066 3.8e-1 24 Click to see details
GSE14794 Lymphoblastoid cells -0.039 3.6e-1 -0.213 2.2e-2 90 Click to see details
GSE19350 CNS germ cell tumors 0.003 5.0e-1 -0.156 3.1e-1 12 Click to see details
GSE19350 CNS germ cell tumors 0.003 5.0e-1 -0.156 3.1e-1 12 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC -0.458 0 -0.420 0 49 Click to see details
LUSC 0.467 0 0.429 0 38 Click to see details
STAD 0.471 0 0.464 0 32 Click to see details
BRCA 0.235 0.02 0.241 0.01 84 Click to see details
PAAD -0.952 0.02 -0.800 0.1 4 Click to see details
KICH 0.299 0.07 -0.040 0.42 25 Click to see details
CESC 0.973 0.07 1.000 0.5 3 Click to see details
KIRP 0.246 0.09 0.292 0.05 32 Click to see details
COAD -0.492 0.2 -0.200 0.37 5 Click to see details
LUAD 0.261 0.21 0.028 0.47 12 Click to see details
UCEC 0.181 0.23 0.209 0.2 19 Click to see details
ESCA -0.203 0.27 -0.173 0.31 11 Click to see details
PRAD 0.078 0.3 0.046 0.38 50 Click to see details
HNSC 0.08 0.31 0.013 0.47 42 Click to see details
KIRC 0.029 0.41 0.114 0.18 68 Click to see details
THCA -0.029 0.41 0.005 0.49 59 Click to see details
BLCA -0.051 0.42 -0.131 0.3 18 Click to see details
CHOL -0.047 0.45 -0.217 0.29 9 Click to see details
PCPG 0.075 0.48 0.500 0.33 3 Click to see details
PCPG 0.075 0.48 0.500 0.33 3 Click to see details
PCPG 0.075 0.48 0.500 0.33 3 Click to see details
451 hsa-miR-424-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000653 CCNF cyclin F 2 1
MIRT000654 CDC14A cell division cycle 14A 2 1
MIRT000655 CDC25A cell division cycle 25A 4 3
MIRT000656 CHEK1 checkpoint kinase 1 5 4
MIRT000657 KIF23 kinesin family member 23 4 7
MIRT000658 ATF6 activating transcription factor 6 2 1
MIRT000659 WEE1 WEE1 G2 checkpoint kinase 6 7
MIRT000660 ANLN anillin actin binding protein 2 1
MIRT000696 PLAG1 PLAG1 zinc finger 6 10
MIRT000936 CCNE1 cyclin E1 6 7
MIRT000937 CCND3 cyclin D3 4 1
MIRT000938 CDK6 cyclin dependent kinase 6 6 3
MIRT000941 CCND1 cyclin D1 6 4
MIRT003225 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 2 1
MIRT003226 MAP2K1 mitogen-activated protein kinase kinase 1 4 2
MIRT003227 PIAS1 protein inhibitor of activated STAT 1 2 1
MIRT003228 FGFR1 fibroblast growth factor receptor 1 5 3
MIRT003928 NFIA nuclear factor I A 3 2
MIRT005886 MYB MYB proto-oncogene, transcription factor 3 2
MIRT005887 SIAH1 siah E3 ubiquitin protein ligase 1 3 1
MIRT005926 HIF1A hypoxia inducible factor 1 alpha subunit 5 1
MIRT005927 CUL2 cullin 2 5 1
MIRT005928 SPI1 Spi-1 proto-oncogene 5 1
MIRT042434 CCIN calicin 1 1
MIRT042435 TTC39A tetratricopeptide repeat domain 39A 1 1
MIRT042436 TMF1 TATA element modulatory factor 1 1 1
MIRT042437 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT042438 PNISR PNN interacting serine and arginine rich protein 2 3
MIRT042439 IARS isoleucyl-tRNA synthetase 1 1
MIRT042440 HIST2H2AA3 histone cluster 2 H2A family member a3 1 1
MIRT042441 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 2 3
MIRT042442 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT042443 MAGED1 MAGE family member D1 1 1
MIRT042444 CNIH4 cornichon family AMPA receptor auxiliary protein 4 1 1
MIRT042445 ANKHD1 ankyrin repeat and KH domain containing 1 1 1
MIRT042446 EIF4G2 eukaryotic translation initiation factor 4 gamma 2 1 1
MIRT042447 BAZ2B bromodomain adjacent to zinc finger domain 2B 1 1
MIRT042448 APBB2 amyloid beta precursor protein binding family B member 2 1 1
MIRT042449 ANKRD17 ankyrin repeat domain 17 1 1
MIRT042450 RBM4B RNA binding motif protein 4B 1 1
MIRT042451 LAMTOR4 late endosomal/lysosomal adaptor, MAPK and MTOR activator 4 1 1
MIRT042452 TRAP1 TNF receptor associated protein 1 1 1
MIRT042453 SCOC short coiled-coil protein 1 1
MIRT042454 SACS sacsin molecular chaperone 1 1
MIRT042455 IFIH1 interferon induced with helicase C domain 1 1 1
MIRT042456 TBPL1 TATA-box binding protein like 1 2 3
MIRT042457 SMARCA5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 1 1
MIRT042458 GTF2A1 general transcription factor IIA subunit 1 1 1
MIRT053106 FASN fatty acid synthase 4 5
MIRT053149 SOCS6 suppressor of cytokine signaling 6 2 1
MIRT053379 CDX2 caudal type homeobox 2 3 1
MIRT055427 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 10
MIRT055818 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT057518 CEP55 centrosomal protein 55 2 8
MIRT057737 ZDHHC16 zinc finger DHHC-type containing 16 2 2
MIRT061008 C1ORF21 chromosome 1 open reading frame 21 2 6
MIRT061250 AMOTL1 angiomotin like 1 2 12
MIRT064689 CCND2 cyclin D2 2 4
MIRT065719 TARBP2 TARBP2, RISC loading complex RNA binding subunit 2 4
MIRT066297 MTFR1L mitochondrial fission regulator 1 like 2 2
MIRT066316 USP15 ubiquitin specific peptidase 15 2 2
MIRT071212 FCF1 FCF1, rRNA-processing protein 2 2
MIRT072826 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 4
MIRT074534 PAGR1 PAXIP1 associated glutamate rich protein 1 2 4
MIRT075256 SNTB2 syntrophin beta 2 2 4
MIRT075278 VPS4A vacuolar protein sorting 4 homolog A 2 8
MIRT075897 C16ORF72 chromosome 16 open reading frame 72 2 6
MIRT076796 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT078287 RPS6KB1 ribosomal protein S6 kinase B1 2 2
MIRT079659 NAPG NSF attachment protein gamma 2 12
MIRT080016 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 2 4
MIRT082989 PNPLA6 patatin like phospholipase domain containing 6 2 2
MIRT083270 ZCCHC3 zinc finger CCHC-type containing 3 2 6
MIRT084466 SOWAHC sosondowah ankyrin repeat domain family member C 2 4
MIRT086013 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 2 2
MIRT087428 ZNRF3 zinc and ring finger 3 2 2
MIRT087559 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 2 2
MIRT089112 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 2 4
MIRT089212 ACTR2 ARP2 actin related protein 2 homolog 2 2
MIRT091674 RARB retinoic acid receptor beta 2 6
MIRT093688 PI4K2B phosphatidylinositol 4-kinase type 2 beta 2 6
MIRT096239 CANX calnexin 2 2
MIRT100211 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 2 2
MIRT100369 HSPA1B heat shock protein family A (Hsp70) member 1B 2 6
MIRT100572 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 2 2
MIRT100741 VEGFA vascular endothelial growth factor A 2 12
MIRT100900 CD2AP CD2 associated protein 2 2
MIRT102441 CALU calumenin 2 2
MIRT102636 UBN2 ubinuclein 2 2 10
MIRT102974 EN2 engrailed homeobox 2 2 6
MIRT103097 MAFK MAF bZIP transcription factor K 2 4
MIRT103859 FOXK1 forkhead box K1 2 2
MIRT104020 USP42 ubiquitin specific peptidase 42 2 6
MIRT104236 DMTF1 cyclin D binding myb like transcription factor 1 2 2
MIRT106300 ZFHX4 zinc finger homeobox 4 2 6
MIRT106737 RAD23B RAD23 homolog B, nucleotide excision repair protein 2 2
MIRT107222 ZBTB34 zinc finger and BTB domain containing 34 2 2
MIRT107689 RECK reversion inducing cysteine rich protein with kazal motifs 2 2
MIRT109245 ZNF275 zinc finger protein 275 2 2
MIRT110057 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 5 7
MIRT112976 LUZP1 leucine zipper protein 1 2 6
MIRT114929 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT117660 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT120684 PAK2 p21 (RAC1) activated kinase 2 2 2
MIRT127740 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 2
MIRT133776 SKI SKI proto-oncogene 2 2
MIRT140152 SPRED1 sprouty related EVH1 domain containing 1 2 2
MIRT142247 DCTN5 dynactin subunit 5 2 8
MIRT152287 TNFSF9 TNF superfamily member 9 2 2
MIRT154054 RASSF2 Ras association domain family member 2 2 2
MIRT156468 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 2 2
MIRT158533 TNRC6B trinucleotide repeat containing 6B 2 4
MIRT165183 GRAMD3 GRAM domain containing 2B 2 2
MIRT165904 CREBRF CREB3 regulatory factor 2 2
MIRT175237 PSAT1 phosphoserine aminotransferase 1 2 6
MIRT179014 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 2
MIRT180914 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 8
MIRT186375 PNRC2 proline rich nuclear receptor coactivator 2 2 2
MIRT189764 CDADC1 cytidine and dCMP deaminase domain containing 1 2 2
MIRT189965 AGO4 argonaute 4, RISC catalytic component 2 2
MIRT190188 GPR180 G protein-coupled receptor 180 2 6
MIRT191460 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 2 2
MIRT191629 SLC39A9 solute carrier family 39 member 9 2 6
MIRT194242 FAM103A1 family with sequence similarity 103 member A1 2 6
MIRT194909 RBBP6 RB binding protein 6, ubiquitin ligase 2 8
MIRT196457 TAOK1 TAO kinase 1 2 2
MIRT201460 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 2 8
MIRT204597 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 8
MIRT204628 MOB4 MOB family member 4, phocein 2 8
MIRT204744 BZW1 basic leucine zipper and W2 domains 1 2 12
MIRT206023 NUP50 nucleoporin 50 2 6
MIRT211201 FGF2 fibroblast growth factor 2 5 5
MIRT211317 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 4
MIRT212611 RBPJ recombination signal binding protein for immunoglobulin kappa J region 2 8
MIRT223695 FZD6 frizzled class receptor 6 2 6
MIRT224969 BAG4 BCL2 associated athanogene 4 2 2
MIRT229350 ZNF449 zinc finger protein 449 2 2
MIRT229864 YIPF6 Yip1 domain family member 6 2 2
MIRT234346 MSL1 male specific lethal 1 homolog 2 8
MIRT247241 ELK4 ELK4, ETS transcription factor 2 4
MIRT247371 GABARAPL1 GABA type A receptor associated protein like 1 2 6
MIRT248769 ATXN7L3B ataxin 7 like 3B 2 4
MIRT249453 ZNF691 zinc finger protein 691 2 4
MIRT251497 DYNLL2 dynein light chain LC8-type 2 2 4
MIRT255339 SRPRB SRP receptor beta subunit 2 4
MIRT256311 CDC42SE2 CDC42 small effector 2 2 2
MIRT258414 WIPI2 WD repeat domain, phosphoinositide interacting 2 2 2
MIRT265059 TBRG1 transforming growth factor beta regulator 1 2 2
MIRT267532 C1ORF226 chromosome 1 open reading frame 226 2 2
MIRT270556 SETD1B SET domain containing 1B 2 2
MIRT273669 HOXC8 homeobox C8 2 2
MIRT274745 RAB3IP RAB3A interacting protein 2 2
MIRT277509 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 2 4
MIRT282538 SLCO3A1 solute carrier organic anion transporter family member 3A1 2 2
MIRT289635 CBX2 chromobox 2 2 2
MIRT294287 ZFP28 ZFP28 zinc finger protein 2 2
MIRT295815 CHMP4B charged multivesicular body protein 4B 2 2
MIRT297782 GABPA GA binding protein transcription factor alpha subunit 2 4
MIRT300110 STRADB STE20-related kinase adaptor beta 2 2
MIRT300998 MTMR3 myotubularin related protein 3 2 2
MIRT302619 CRIM1 cysteine rich transmembrane BMP regulator 1 2 6
MIRT302829 SOCS5 suppressor of cytokine signaling 5 2 2
MIRT307145 CTDSPL CTD small phosphatase like 2 4
MIRT313679 ITGA2 integrin subunit alpha 2 2 2
MIRT314055 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 2 8
MIRT317725 PPIL1 peptidylprolyl isomerase like 1 2 6
MIRT319335 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 2 2
MIRT320631 ZNRF2 zinc and ring finger 2 2 2
MIRT326306 OCRL OCRL, inositol polyphosphate-5-phosphatase 2 2
MIRT327967 CHIC1 cysteine rich hydrophobic domain 1 2 6
MIRT367269 CRKL CRK like proto-oncogene, adaptor protein 2 2
MIRT438750 PTCH1 patched 1 1 1
MIRT443811 SIDT2 SID1 transmembrane family member 2 2 2
MIRT446504 ASCC1 activating signal cointegrator 1 complex subunit 1 2 2
MIRT447774 DMRT2 doublesex and mab-3 related transcription factor 2 2 2
MIRT448443 TLL1 tolloid like 1 2 2
MIRT449186 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 2 2
MIRT451835 ALDH3B1 aldehyde dehydrogenase 3 family member B1 2 2
MIRT453284 EFTUD2 elongation factor Tu GTP binding domain containing 2 2 2
MIRT453750 CSNK1E casein kinase 1 epsilon 2 2
MIRT454966 TPM2 tropomyosin 2 2 2
MIRT456863 ZNF460 zinc finger protein 460 2 10
MIRT460220 FGFR4 fibroblast growth factor receptor 4 2 2
MIRT460434 DOCK11 dedicator of cytokinesis 11 2 2
MIRT461560 ACTR3B ARP3 actin related protein 3 homolog B 2 2
MIRT463168 ZNF367 zinc finger protein 367 2 10
MIRT464666 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 8
MIRT464752 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 2 2
MIRT465167 TSC22D2 TSC22 domain family member 2 2 2
MIRT465566 TOB2 transducer of ERBB2, 2 2 2
MIRT465930 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 8
MIRT466009 TMEM189 transmembrane protein 189 2 8
MIRT466294 TM4SF1 transmembrane 4 L six family member 1 2 2
MIRT466433 TFAP2A transcription factor AP-2 alpha 2 8
MIRT466920 STK38 serine/threonine kinase 38 2 10
MIRT466998 SSRP1 structure specific recognition protein 1 2 4
MIRT468055 SIK1 salt inducible kinase 1 2 2
MIRT468147 SH3BP4 SH3 domain binding protein 4 2 2
MIRT468673 SEC24A SEC24 homolog A, COPII coat complex component 2 4
MIRT469086 RNF168 ring finger protein 168 2 2
MIRT469411 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT471035 PISD phosphatidylserine decarboxylase 2 10
MIRT471492 PDE4D phosphodiesterase 4D 2 4
MIRT471952 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT472269 NFIC nuclear factor I C 2 2
MIRT472661 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 2 4
MIRT474314 LAMC1 laminin subunit gamma 1 2 2
MIRT474829 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 2 2
MIRT475065 IVNS1ABP influenza virus NS1A binding protein 2 6
MIRT475119 IPPK inositol-pentakisphosphate 2-kinase 2 2
MIRT475535 HOXA3 homeobox A3 4 8
MIRT475716 HEYL hes related family bHLH transcription factor with YRPW motif-like 2 2
MIRT475841 HDGF heparin binding growth factor 2 4
MIRT476256 GNB1 G protein subunit beta 1 2 6
MIRT476273 GNAL G protein subunit alpha L 2 6
MIRT476696 FURIN furin, paired basic amino acid cleaving enzyme 2 2
MIRT477561 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 8
MIRT477845 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 2 2
MIRT478908 CPSF7 cleavage and polyadenylation specific factor 7 2 6
MIRT479989 CARD10 caspase recruitment domain family member 10 2 2
MIRT481185 AVL9 AVL9 cell migration associated 2 6
MIRT482117 AKT3 AKT serine/threonine kinase 3 5 4
MIRT482373 AGO2 argonaute 2, RISC catalytic component 2 2
MIRT482553 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 10
MIRT482578 ABHD2 abhydrolase domain containing 2 2 2
MIRT484774 ABCC6 ATP binding cassette subfamily C member 6 2 4
MIRT485216 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 2 8
MIRT487390 C10orf54 V-set immunoregulatory receptor 2 2
MIRT492711 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 2 2
MIRT494353 CASKIN1 CASK interacting protein 1 2 2
MIRT495143 ZNRF1 zinc and ring finger 1 2 2
MIRT496015 CD180 CD180 molecule 2 2
MIRT497772 KIAA0895 KIAA0895 2 2
MIRT498980 ORC4 origin recognition complex subunit 4 2 8
MIRT499452 ODF2L outer dense fiber of sperm tails 2 like 2 8
MIRT499616 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 2 8
MIRT500093 L2HGDH L-2-hydroxyglutarate dehydrogenase 2 8
MIRT500324 ZNF622 zinc finger protein 622 2 8
MIRT500422 ZMAT3 zinc finger matrin-type 3 2 4
MIRT500576 USP53 ubiquitin specific peptidase 53 2 2
MIRT500864 SYPL1 synaptophysin like 1 2 8
MIRT500935 SRPR SRP receptor alpha subunit 2 6
MIRT500949 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 2 8
MIRT501088 SMAD7 SMAD family member 7 5 9
MIRT501502 PRICKLE2 prickle planar cell polarity protein 2 2 2
MIRT502036 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 2
MIRT502148 KIF5B kinesin family member 5B 2 8
MIRT502498 FAM122B family with sequence similarity 122B 2 8
MIRT502571 E2F7 E2F transcription factor 7 2 10
MIRT502646 DDX3X DEAD-box helicase 3, X-linked 2 8
MIRT502919 CDCA4 cell division cycle associated 4 2 8
MIRT502948 CDC37L1 cell division cycle 37 like 1 2 8
MIRT503143 ATG9A autophagy related 9A 2 6
MIRT504334 ASGR2 asialoglycoprotein receptor 2 2 6
MIRT504536 ZNF620 zinc finger protein 620 2 6
MIRT504852 HAUS3 HAUS augmin like complex subunit 3 2 6
MIRT505114 YTHDC1 YTH domain containing 1 2 6
MIRT505346 TMEM245 transmembrane protein 245 2 6
MIRT505396 TMEM100 transmembrane protein 100 2 2
MIRT505502 SRSF1 serine and arginine rich splicing factor 1 2 6
MIRT505546 SNX16 sorting nexin 16 2 6
MIRT505690 SESTD1 SEC14 and spectrin domain containing 1 2 6
MIRT505908 RIMS3 regulating synaptic membrane exocytosis 3 2 6
MIRT505926 RCAN3 RCAN family member 3 2 4
MIRT506108 PPIG peptidylprolyl isomerase G 2 6
MIRT506139 PLRG1 pleiotropic regulator 1 2 4
MIRT506192 PHKA1 phosphorylase kinase regulatory subunit alpha 1 2 6
MIRT506486 MYO5A myosin VA 2 6
MIRT506999 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 2 6
MIRT507819 CDK1 cyclin dependent kinase 1 2 6
MIRT507850 CCNE2 cyclin E2 2 6
MIRT507882 CBX6 chromobox 6 2 2
MIRT508036 AXIN2 axin 2 2 6
MIRT508641 CASK calcium/calmodulin dependent serine protein kinase 2 5
MIRT509364 DMPK DM1 protein kinase 2 11
MIRT509690 ATAD5 ATPase family, AAA domain containing 5 2 4
MIRT510043 AKR1B10 aldo-keto reductase family 1 member B10 2 4
MIRT511845 GPATCH8 G-patch domain containing 8 2 4
MIRT512285 ARHGDIA Rho GDP dissociation inhibitor alpha 2 6
MIRT512642 CPEB3 cytoplasmic polyadenylation element binding protein 3 2 4
MIRT513856 JARID2 jumonji and AT-rich interaction domain containing 2 2 8
MIRT514022 CAMSAP1 calmodulin regulated spectrin associated protein 1 2 4
MIRT514043 ATG14 autophagy related 14 2 2
MIRT518091 TRIM35 tripartite motif containing 35 2 2
MIRT518530 FLCN folliculin 2 6
MIRT518994 NNT nicotinamide nucleotide transhydrogenase 2 4
MIRT521056 SLC2A3 solute carrier family 2 member 3 2 4
MIRT521203 SBNO1 strawberry notch homolog 1 2 6
MIRT521814 POM121C POM121 transmembrane nucleoporin C 2 2
MIRT522100 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 4
MIRT522775 LAMP2 lysosomal associated membrane protein 2 2 6
MIRT537817 EFNB2 ephrin B2 2 4
MIRT539899 RPL14 ribosomal protein L14 2 4
MIRT540843 GNAT1 G protein subunit alpha transducin 1 2 4
MIRT541216 HOXA10 homeobox A10 2 2
MIRT541434 CBX4 chromobox 4 2 2
MIRT542808 PHC3 polyhomeotic homolog 3 2 2
MIRT542836 PDCD1 programmed cell death 1 2 7
MIRT543059 BAZ2A bromodomain adjacent to zinc finger domain 2A 2 2
MIRT543079 APP amyloid beta precursor protein 2 2
MIRT543306 ZNF585B zinc finger protein 585B 2 2
MIRT543408 ANAPC13 anaphase promoting complex subunit 13 2 2
MIRT543525 PRSS21 protease, serine 21 2 2
MIRT543797 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 2 4
MIRT543835 GSG1 germ cell associated 1 2 2
MIRT544571 POLDIP3 DNA polymerase delta interacting protein 3 2 2
MIRT544589 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 2 4
MIRT544912 CLSPN claspin 2 2
MIRT544965 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 2
MIRT545186 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 4
MIRT545347 CCDC83 coiled-coil domain containing 83 2 2
MIRT545682 DECR1 2,4-dienoyl-CoA reductase 1 2 2
MIRT545959 ZBTB10 zinc finger and BTB domain containing 10 2 2
MIRT546114 USP48 ubiquitin specific peptidase 48 2 4
MIRT546610 SALL1 spalt like transcription factor 1 2 4
MIRT546623 RUNX1T1 RUNX1 translocation partner 1 2 2
MIRT546639 RTN4 reticulon 4 2 2
MIRT547132 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 2 2
MIRT547234 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 2 4
MIRT547306 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 2 2
MIRT547411 MKX mohawk homeobox 2 2
MIRT547462 MBD4 methyl-CpG binding domain 4, DNA glycosylase 2 2
MIRT547549 LRRFIP2 LRR binding FLII interacting protein 2 2 4
MIRT547663 KPNA3 karyopherin subunit alpha 3 2 2
MIRT547700 KPNA1 karyopherin subunit alpha 1 2 4
MIRT547970 HIGD1A HIG1 hypoxia inducible domain family member 1A 2 4
MIRT547996 HCFC2 host cell factor C2 2 4
MIRT548015 GRB2 growth factor receptor bound protein 2 2 4
MIRT548223 FKBP1A FK506 binding protein 1A 2 2
MIRT548273 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT548729 CRK CRK proto-oncogene, adaptor protein 2 2
MIRT548806 CLIP4 CAP-Gly domain containing linker protein family member 4 2 4
MIRT548949 CDK17 cyclin dependent kinase 17 2 2
MIRT549074 CACUL1 CDK2 associated cullin domain 1 2 2
MIRT549121 C11orf24 chromosome 11 open reading frame 24 2 4
MIRT549276 ASH1L ASH1 like histone lysine methyltransferase 2 2
MIRT549390 AMOT angiomotin 2 2
MIRT550402 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 2 4
MIRT550466 OSCAR osteoclast associated, immunoglobulin-like receptor 2 4
MIRT550615 MTHFR methylenetetrahydrofolate reductase 2 2
MIRT550823 FAM229B family with sequence similarity 229 member B 2 2
MIRT551379 EPM2AIP1 EPM2A interacting protein 1 2 2
MIRT551617 ZNF267 zinc finger protein 267 2 2
MIRT551737 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 2 2
MIRT552035 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT552344 ZNF704 zinc finger protein 704 2 2
MIRT552749 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 2 2
MIRT553439 TPM3 tropomyosin 3 2 2
MIRT553561 TMEM161B transmembrane protein 161B 2 2
MIRT553618 TM7SF3 transmembrane 7 superfamily member 3 2 2
MIRT553772 TAF13 TATA-box binding protein associated factor 13 2 4
MIRT553809 SZRD1 SUZ RNA binding domain containing 1 2 4
MIRT554700 RNF149 ring finger protein 149 2 2
MIRT554962 RACGAP1 Rac GTPase activating protein 1 2 2
MIRT555032 RAB23 RAB23, member RAS oncogene family 2 2
MIRT555142 PTPRD protein tyrosine phosphatase, receptor type D 2 2
MIRT555225 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 2 4
MIRT555275 PRDM4 PR/SET domain 4 2 2
MIRT555432 PPAP2B phospholipid phosphatase 3 2 2
MIRT556387 LURAP1L leucine rich adaptor protein 1 like 2 2
MIRT556855 KANK1 KN motif and ankyrin repeat domains 1 2 4
MIRT557281 HIST2H2BE histone cluster 2 H2B family member e 2 2
MIRT557480 GPR27 G protein-coupled receptor 27 2 4
MIRT558037 EXT1 exostosin glycosyltransferase 1 2 2
MIRT558507 CYP26B1 cytochrome P450 family 26 subfamily B member 1 2 4
MIRT558589 CREBL2 cAMP responsive element binding protein like 2 2 4
MIRT558662 CNKSR3 CNKSR family member 3 2 2
MIRT559011 CA8 carbonic anhydrase 8 2 2
MIRT559158 BTN3A3 butyrophilin subfamily 3 member A3 2 2
MIRT559531 ARHGAP12 Rho GTPase activating protein 12 2 4
MIRT560852 OSBPL3 oxysterol binding protein like 3 2 2
MIRT561149 KRT33B keratin 33B 2 2
MIRT561400 TUBB2A tubulin beta 2A class IIa 2 2
MIRT561874 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT562027 LANCL1 LanC like 1 2 2
MIRT562201 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 2 2
MIRT562877 KIAA1456 KIAA1456 2 2
MIRT563086 SLC25A12 solute carrier family 25 member 12 2 2
MIRT563503 DLGAP3 DLG associated protein 3 2 2
MIRT563701 THRAP3 thyroid hormone receptor associated protein 3 2 2
MIRT563845 SMDT1 single-pass membrane protein with aspartate rich tail 1 2 2
MIRT563896 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 2 2
MIRT564332 CCNT1 cyclin T1 2 2
MIRT564478 ZNF391 zinc finger protein 391 2 2
MIRT564552 CCDC80 coiled-coil domain containing 80 2 2
MIRT564836 ZBTB16 zinc finger and BTB domain containing 16 2 2
MIRT564950 XKR7 XK related 7 2 2
MIRT564989 WNK3 WNK lysine deficient protein kinase 3 2 2
MIRT565044 VAV2 vav guanine nucleotide exchange factor 2 2 2
MIRT565401 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT566120 RASEF RAS and EF-hand domain containing 2 2
MIRT566650 NCKAP1 NCK associated protein 1 2 2
MIRT566831 MAP3K7 mitogen-activated protein kinase kinase kinase 7 2 2
MIRT567021 KLHL15 kelch like family member 15 2 2
MIRT567446 GNG12 G protein subunit gamma 12 2 2
MIRT567477 FZD9 frizzled class receptor 9 2 2
MIRT568021 CMTM4 CKLF like MARVEL transmembrane domain containing 4 2 2
MIRT568142 CCDC88C coiled-coil domain containing 88C 2 2
MIRT568474 ARMC12 armadillo repeat containing 12 2 2
MIRT568574 AHNAK2 AHNAK nucleoprotein 2 2 2
MIRT568625 ACVR2A activin A receptor type 2A 5 3
MIRT570466 TLK1 tousled like kinase 1 2 2
MIRT571119 UBE2H ubiquitin conjugating enzyme E2 H 2 2
MIRT571283 TTLL5 tubulin tyrosine ligase like 5 2 2
MIRT571428 RIF1 replication timing regulatory factor 1 2 2
MIRT571660 SERBP1 SERPINE1 mRNA binding protein 1 2 2
MIRT571828 PHF19 PHD finger protein 19 2 2
MIRT571928 LSM11 LSM11, U7 small nuclear RNA associated 2 2
MIRT574057 PROSC pyridoxal phosphate binding protein 2 2
MIRT574202 CLEC2D C-type lectin domain family 2 member D 2 2
MIRT574539 PDIA6 protein disulfide isomerase family A member 6 2 4
MIRT574594 N4BP1 NEDD4 binding protein 1 2 2
MIRT575882 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 2 4
MIRT575924 Dmpk dystrophia myotonica-protein kinase 2 7
MIRT576099 Pdcd1 programmed cell death 1 2 5
MIRT576591 Npepps aminopeptidase puromycin sensitive 2 2
MIRT614698 TRAK1 trafficking kinesin protein 1 2 2
MIRT616467 ADRA2B adrenoceptor alpha 2B 2 2
MIRT618896 ANKMY1 ankyrin repeat and MYND domain containing 1 2 2
MIRT621498 GPRC5A G protein-coupled receptor class C group 5 member A 2 4
MIRT640538 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT645510 BSPRY B-box and SPRY domain containing 2 2
MIRT646595 ANKRD36 ankyrin repeat domain 36 2 2
MIRT648784 KLHL40 kelch like family member 40 2 2
MIRT655812 NOTCH2 notch 2 2 2
MIRT658793 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 2 2
MIRT659256 CUL3 cullin 3 2 2
MIRT680982 DCAF17 DDB1 and CUL4 associated factor 17 2 2
MIRT682285 RS1 retinoschisin 1 2 2
MIRT682514 GLP2R glucagon like peptide 2 receptor 2 2
MIRT691709 FLOT2 flotillin 2 2 2
MIRT693930 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 2 2
MIRT701506 NEGR1 neuronal growth regulator 1 2 2
MIRT702092 MCFD2 multiple coagulation factor deficiency 2 2 2
MIRT702877 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT713419 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT714438 ARHGAP32 Rho GTPase activating protein 32 2 2
MIRT716432 RAB15 RAB15, member RAS oncogene family 2 2
MIRT717461 ADORA3 adenosine A3 receptor 2 2
MIRT720149 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 2 2
MIRT725132 SYNRG synergin gamma 2 2
MIRT731524 SOCS2 suppressor of cytokine signaling 2 1 1
MIRT731954 KDM5B lysine demethylase 5B 1 1
MIRT732455 LINC00922 long intergenic non-protein coding RNA 922 2 0
MIRT734001 BFAR bifunctional apoptosis regulator 3 0
MIRT734203 APLNR apelin receptor 3 0
MIRT734275 APLN apelin 3 0
MIRT735229 KCNQ1OT1 KCNQ1 opposite strand/antisense transcript 1 (non-protein coding) 0 0
MIRT737161 LINC00324 long intergenic non-protein coding RNA 324 1 0
MIRT737429 CADM1 cell adhesion molecule 1 2 0
MIRT756449 NUAK1 NUAK family kinase 1 1 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-424 Tamoxifen approved 2733526 Microarray rat liver 17343880 2007 up-regulated
miR-424 Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 down-regulated
miR-424 Medpor NULL NULL Microarray osteoblast-like cells line (MG-63) 18408260 2008 up-regulated
miR-424 17beta-estradiol (E2) approved 5757 Microarray MCF-7 breast cancer cells 19528081 2009 up-regulated
miR-424 Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-424 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer SKBR3 22076154 2011 up-regulated
miR-424 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-424 Vitamin D3 approved 5280795 Quantitative real-time PCR Plasma 22594500 2012 down-regulated
miR-424 Bicalutamide approved 2375 Microarray prostate 22674191 2012 up-regulated
miR-424 Ginsenoside Rh2 NULL 119307 Microarray NSCLC cell line A549 23152132 2013 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-424 Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (BGC823)
hsa-mir-424 Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (SGC-7901)
hsa-mir-424 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-424 Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer tissue
hsa-mir-424 Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer tissue
hsa-mir-424 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-424 Methotrexate 126941 NSC740 approved resistant cell line (W1)
hsa-mir-424 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-mir-424 Androstenedione 6128 NSC9563 sensitive cell line (MCF-7)
hsa-mir-424 Androstenedione+Anastrozole sensitive cell line (MCF-7)
hsa-mir-424 Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-424 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-mir-424 Cisplatin 5460033 NSC119875 approved sensitive cell line (SGC-7901)
hsa-mir-424 Cisplatin 5460033 NSC119875 approved sensitive cell line (BGC-823)
hsa-miR-424-5p (-)-huprine y 54608866 NSC720262 resistant
hsa-miR-424-5p (-)7,8-dihydrocalanolide a 383107 NSC682400 sensitive
hsa-miR-424-5p (3e)-3-[(2,6-dimethylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1-methylindol-2-one 24205817 NSC736793 resistant
hsa-miR-424-5p (3e)-3-[(2,6-dimethylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1h-indol-2-one 5471419 NSC711074 resistant
hsa-miR-424-5p (3z,5z)-3,5-bis[(4-fluorophenyl)methylidene]-1,1-dimethylpiperidin-1-ium-4-one;iodide 54608810 NSC634794 sensitive
hsa-miR-424-5p (4E)-2-(2-hydroxybenzoyl)-5-methyl-4-[(4-nitrophenyl)methylidene]pyrazol-3-one 5467414 NSC652175 sensitive
hsa-miR-424-5p (5R,5aS)-5-[2-(dimethylamino)ethoxy]-9-(4-hydroxy-3,5-dimethoxyphenyl)-5a,6,8a,9-tetrahydro-5H-[2]benzofuro[5,6-f][1,3]benzodioxol-8-one;hydrochloride 371049 NSC644945 sensitive
hsa-miR-424-5p (5s,5as)-5-[3-(dimethylamino)propylamino]-9-(4-hydroxy-3,5-dimethoxyphenyl)-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[6,5-f][1,3]benzodioxol-8-one 375034 NSC653860 sensitive
hsa-miR-424-5p (E)-3-[2-(4-methoxyphenyl)imidazo[1,2-a]pyridin-3-yl]-1-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 54613570 NSC750335 resistant
hsa-miR-424-5p (E)-but-2-enedioic acid;2-[4-tert-butyl-1-[(4-fluorophenyl)methyl]cyclohexyl]oxy-N,N-dimethylethanamine 5351427 NSC670226 resistant
hsa-miR-424-5p (z)-3-iodo-1,2-diphenyl-2-propen-1-one 5468683 NSC674454 resistant
hsa-miR-424-5p [1-[(2-bromo-5-hydroxy-4-methoxyphenyl)methyl]spiro[1,3,4,5,7,8-hexahydroisoquinoline-6,2'-1,3-dioxolane]-2-yl]-cyclobutylmethanone 401792 NSC715522 resistant
hsa-miR-424-5p [2-[[3-(3-aminopropoxy)naphthalene-2-carbonyl]amino]-5-chlorophenyl] 3-(3-aminopropoxy)naphthalene-2-carboxylate;hydrochloride 54613723 NSC751300 resistant
hsa-miR-424-5p [4-fluoro-5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-2-(hydroxymethyl)oxolan-3-yl] butanoate 380992 NSC666869 sensitive
hsa-miR-424-5p 1-(2-hydroxybenzoyl)-3-methyl-4-(4-methoxybenzylidene)-1h-pyrazole-5(4h)-one 5351408 NSC652174 sensitive
hsa-miR-424-5p 1-(5,8-dimethyl-6-nitro-9h-carbazol-3-yl)ethanone hydrazone 6078917 NSC652561 sensitive
hsa-miR-424-5p 1-[(2S)-3-[[2,7-di(piperidin-1-yl)-2,3,4a,5,7,7a-hexahydrofuro[3,4-b][1,4]dioxin-3-yl]oxy]oxolan-2-yl]piperidine 253322 NSC76150 sensitive
hsa-miR-424-5p 1-[(z)-(5-chloro-2-hydroxyphenyl)methylideneamino]-3-[(e)-(5-chloro-2-hydroxyphenyl)methylideneamino]urea 135408530 NSC48238 resistant
hsa-miR-424-5p 1-[5-[(e)-2-[4-(dimethylamino)phenyl]ethenyl]-6-methyl-1,2,4-triazin-3-yl]-6-hydroxy-3-phenyl-2-sulfanylidenepyrimidin-4-one 6412312 NSC698031 resistant
hsa-miR-424-5p 1-[8-(3-methoxyphenyl)-6,7-dimethyl-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-6-yl]pyrrolidine 382365 NSC669884 resistant
hsa-miR-424-5p 10,11-methylenedioxycamptothecin 72403 NSC634724 sensitive
hsa-miR-424-5p 15-[2-(dimethylamino)ethyl]-10-[2-(2-hydroxyethylamino)ethylamino]-1,15-diazatetracyclo[7.7.1.02,7.013,17]heptadeca-2,4,6,9,11,13(17)-hexaene-8,14,16-trione;hydrochloride 392057 NSC691849 sensitive
hsa-miR-424-5p 15-[2-(dimethylamino)ethyl]-10-[2-(dimethylamino)ethyl-methylamino]-1,15-diazatetracyclo[7.7.1.02,7.013,17]heptadeca-2,4,6,9,11,13(17)-hexaene-8,14,16-trione 392571 NSC693118 sensitive
hsa-miR-424-5p 2-(2-ethyl-6-propan-2-ylanilino)-3-(4-methylpyridin-1-ium-1-yl)naphthalene-1,4-dione;perchlorate 24202023 NSC618659 sensitive
hsa-miR-424-5p 2-(dipentylamino)-1-(1,2,3,4-tetrahydrophenanthren-9-yl)ethanol;hydrochloride 24181846 NSC62485 resistant
hsa-miR-424-5p 2-[[1-(chloromethoxy)-2-(dimethylamino)ethyl]amino]-n-[2-[[4-[2-[[2-[[1-(chloromethoxy)-2-(dimethylamino)ethyl]amino]-2-(sulfanylmethylamino)acetyl]amino]ethylamino]-5,8-dihydroxy-9,10-dioxoanthracen- 438971 NSC692228 sensitive
hsa-miR-424-5p 2-[[4-[(2-amino-4-oxo-3H-quinazolin-6-yl)methyl-prop-2-ynylamino]benzoyl]amino]pentanedioic acid 135402053 NSC327182 sensitive
hsa-miR-424-5p 2-[16-(3,4-dimethoxyphenyl)-12,14-diphenyl-10-oxa-3,5,6,8,12,13-hexazatetracyclo[7.7.0.02,6.011,15]hexadeca-1(9),2,4,7,11(15),13-hexaen-4-yl]acetonitrile 391834 NSC691421 sensitive
hsa-miR-424-5p 2-[2-[5-(ethoxycarbonylcarbamoyl)-3-methyl-2,4-dioxopyrimidin-1-yl]ethylsulfanyl]ethyl n-[6-[2-[2-[5-(ethoxycarbonylcarbamoyl)-3-methyl-2,4-dioxopyrimidin-1-yl]ethylsulfanyl]ethoxycarbonylamino]hexyl] 367630 NSC637505 sensitive
hsa-miR-424-5p 2-[3-[1-(4-chlorophenyl)-1-methyl-3-oxo-isoindolin-2-yl]propyl]isoindoline-1,3-dione 395648 NSC700430 resistant
hsa-miR-424-5p 2-amino-6-(benzylamino)-4-(2-chlorophenyl)pyridine-3,5-dicarbonitrile 24205132 NSC734396 sensitive
hsa-miR-424-5p 2-bromo-4-(5-fluoro-1,3-benzothiazol-2-yl)aniline 399248 NSC709925 resistant
hsa-miR-424-5p 2-chloro-3-phenoxy-1,4-naphthoquinone NSC1507 resistant
hsa-miR-424-5p 2-hydroxy-3-[(8-hydroxyquinolin-7-yl)-(4-methoxyphenyl)methyl]-6-propan-2-ylcyclohepta-2,4,6-trien-1-one 361375 NSC624401 sensitive
hsa-miR-424-5p 2-methoxy-5,7,8,13,13a,14-hexahydroisoquino[3,2-b][3]benzazepine 392606 NSC693146 resistant
hsa-miR-424-5p 2-phenyl-3a,3b,4,5,6,7,8,8a,13,13b-decahydro-1h-cyclohepta[c]pyrrolo[3,4-a]carbazole-1,3(2h)-dione 362439 NSC626388 sensitive
hsa-miR-424-5p 2-thienyl-[3-(thiophene-2-carbonyl)-2-thioxo-imidazolidin-1-yl]methanone 396758 NSC703468 sensitive
hsa-miR-424-5p 2,2,2-trifluoro-N-[3-[naphthalen-2-ylmethyl-[4-[naphthalen-2-ylmethyl-[3-[(2,2,2-trifluoroacetyl)amino]propyl]amino]butyl]amino]propyl]acetamide 389638 NSC685981 resistant
hsa-miR-424-5p 2,4-quinazolinediamine, 6,6'-thiobis- 393413 NSC695267 sensitive
hsa-miR-424-5p 2,5,11-trimethyl-9-phenoxy-6h-pyrido[4,3-b]carbazol-2-ium;acetate 10431819 NSC650269 sensitive
hsa-miR-424-5p 20-[3-(1,4-diazepan-1-yl)propyl]-15,16-dimethoxy-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaene-11,19-dione;hydrochloride 45027855 NSC728319 sensitive
hsa-miR-424-5p 3-[(4-chlorophenyl)methyl]-4-[(e)-(3-methoxyphenyl)methylideneamino]-1h-1,2,4-triazol-5-one 9556356 NSC698065 sensitive
hsa-miR-424-5p 3-[(e)-carbazol-9-yliminomethyl]-4-hydroxy-5-methoxybenzaldehyde 135436314 NSC718153 sensitive
hsa-miR-424-5p 3-amino-N-(4-benzylphenyl)-5-chloroindazole-1-carboxamide 51033073 NSC749550 resistant
hsa-miR-424-5p 4'-(9-acridinylamino)sulfanilanilide, monohydrochloride 148802 NSC140701 sensitive
hsa-miR-424-5p 4-(2-azidophenothiazin-10-yl)-N,N-dimethylbutan-1-amine;oxalic acid 385933 NSC677395 resistant
hsa-miR-424-5p 4-[(1-benzyl-4-chloro-2,5-dioxopyrrol-3-yl)amino]-N-(4-fluorophenyl)benzamide 1194957 NSC732830 sensitive
hsa-miR-424-5p 4-[[3-[(4-carbamimidoylphenoxy)methyl]phenyl]methoxy]benzenecarboximidamide;hydrochloride 24203365 NSC727667 sensitive
hsa-miR-424-5p 4-[6-[4-(4,6-diamino-2,2-dimethyl-1,3,5-triazin-1-yl)phenyl]hexyl]benzenesulfonyl fluoride;ethanesulfonic acid 280526 NSC132279 sensitive
hsa-miR-424-5p 4-amino-8-chloro-2-(4-methoxyphenyl)iminopyrimido[2,1-b][1,3]benzothiazole-3-carbonitrile 45029232 NSC745677 resistant
hsa-miR-424-5p 4-n-(7-chloro-3-phenylquinolin-4-yl)-1-n,1-n-diethylpentane-1,4-diamine;hydroiodide 24182056 NSC13477 resistant
hsa-miR-424-5p 4-n-(7-chloroquinolin-4-yl)-1-n-cyclohexylcyclohexane-1,4-diamine NSC3618 resistant
hsa-miR-424-5p 5-(3-phenyl-3-oxo-1-propynyl)pyrimidine-2,4(1h,3h)-dione 359098 NSC619674 sensitive
hsa-miR-424-5p 5-(4-methoxyphenyl)-3-(3,4,5-trimethoxyphenyl)-4,5-dihydro-1h-pyrazole 49865894 NSC748404 resistant
hsa-miR-424-5p 5-[(E)-2-(5-ethyl-1-methylpyridin-1-ium-2-yl)ethenyl]quinolin-8-ol;iodide 135534376 NSC79543 sensitive
hsa-miR-424-5p 5-amino-2-(4-chloroanilino)-1,3-thiazole-4-carbonitrile 367981 NSC638199 sensitive
hsa-miR-424-5p 5-phenyl-2,3-bis(2-thienyl)thiophene 395510 NSC700200 resistant
hsa-miR-424-5p 6-[2-[2-[2-[2-(5,11-dioxoindeno[1,2-c]isoquinolin-6-yl)ethylamino]ethylamino]ethylamino]ethyl]indeno[1,2-c]isoquinoline-5,11-dione;2,2,2-trifluoroacetic acid 45027880 NSC730870 sensitive
hsa-miR-424-5p 6-[2-[3-[2-(5,11-dioxoindeno[1,2-c]isoquinolin-6-yl)ethylamino]propylamino]ethyl]indeno[1,2-c]isoquinoline-5,11-dione;2,2,2-trifluoroacetic acid 45027847 NSC728087 sensitive
hsa-miR-424-5p 6-[3-[(4-fluorophenyl)methoxy]phenyl]-5-(2-methylsulfonylpyrimidin-4-yl)imidazo[2,1-b][1,3]thiazole 155811287 NSC763232 resistant
hsa-miR-424-5p 6-chloro-1-[2-[ethyl-(2-hydroxy-2-methylpropyl)amino]ethylamino]-4-methylthioxanthen-9-one;hydrochloride 24182355 NSC15795 resistant
hsa-miR-424-5p 6-chloro-9-[4-(4-methylphenoxy)-5-[(4-methylphenoxy)methyl]oxolan-2-yl]purine 389530 NSC685827 resistant
hsa-miR-424-5p 7-phenyl-5h-pyrazolo[3,4-e][1,2,4]triazin-3-ylamine 6399307 NSC629487 sensitive
hsa-miR-424-5p 7h-5,6-dithioleno[4,3-d]uracil 388876 NSC684074 sensitive
hsa-miR-424-5p 9,10-anthracenedione, 1-[(oxiranylmethyl)amino]- 384119 NSC673348 sensitive
hsa-miR-424-5p 9.beta.-d-arabinofuranosyl-2-chloroadenine 235481 NSC76356 sensitive
hsa-miR-424-5p Acetylmarinobufogenin 282302 NSC135687 sensitive
hsa-miR-424-5p Aclarubicin 308141 NSC208734 sensitive
hsa-miR-424-5p Acovenoside b 272418 NSC116789 sensitive
hsa-miR-424-5p Anthraquinone, 1-hydroxy-4-[p-(2-hydroxyethyl)anilino]- 291365 NSC156565 resistant
hsa-miR-424-5p Arq monoacetate 385441 NSC676676 sensitive
hsa-miR-424-5p Azane;dichloroplatinum;2-(3,4-dimethoxyphenyl)ethanamine 498557 NSC631304 sensitive
hsa-miR-424-5p Azq 42616 NSC182986 sensitive
hsa-miR-424-5p Bafilomycin deriv 5385089 NSC381866 resistant
hsa-miR-424-5p Benzene, 1,1'-(1,2-ethanediyl)bis[2,5-dimethoxy- 297389 NSC168516 resistant
hsa-miR-424-5p Betuletol 5459196 NSC641548 sensitive
hsa-miR-424-5p Bialamicol 10304 NSC6386 resistant
hsa-miR-424-5p Biantrazole 54607781 NSC357885 sensitive
hsa-miR-424-5p Bn-2629 393111 NSC694501 sensitive
hsa-miR-424-5p Calactin 30100 NSC650471 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin 24360 NSC94600 sensitive
hsa-miR-424-5p Camptothecin 24360 NSC94600 sensitive
hsa-miR-424-5p Cardenolide 2 388098 NSC682561 sensitive
hsa-miR-424-5p Ci-921: amsacrine derivative 157348 NSC343499 sensitive
hsa-miR-424-5p Cladribine 1546 NSC105014 sensitive
hsa-miR-424-5p Digitoxigenin glycoside NSC267713 sensitive
hsa-miR-424-5p Digoxin 2724385 NSC95100 approved sensitive
hsa-miR-424-5p Dimethyl (Z)-2-(2,3,4,6,8-pentamethylazulen-1-yl)but-2-enedioate 5468314 NSC668419 resistant
hsa-miR-424-5p Echujetin 274159 NSC407806 sensitive
hsa-miR-424-5p Fagaronine chloride 40304 NSC157995 sensitive
hsa-miR-424-5p Faradiol 397486 NSC705534 sensitive
hsa-miR-424-5p Ferric-taxol 54612932 NSC749908 resistant
hsa-miR-424-5p Fludarabine 657237 NSC118218 approved sensitive
hsa-miR-424-5p Gnmlngdfmleynr-uhfffaoysa-n 402862 NSC717147 resistant
hsa-miR-424-5p Gw876790x 25023715 NSC756413 resistant
hsa-miR-424-5p Homohalichondrin b 6711269 NSC609394 resistant
hsa-miR-424-5p Hopeaphenol 495605 NSC661748 resistant
hsa-miR-424-5p Irinotecan 60838 NSC728073 approved sensitive
hsa-miR-424-5p Irinotecan 60838 NSC728073 approved sensitive
hsa-miR-424-5p Isopinnatal 390665 NSC688277 sensitive
hsa-miR-424-5p Lmp-400 11533060 NSC724998 sensitive
hsa-miR-424-5p Lunatin 5351204 NSC89671 resistant
hsa-miR-424-5p M-amsa 148674 NSC154948 sensitive
hsa-miR-424-5p Melphalan 460612 NSC8806 approved sensitive
hsa-miR-424-5p Merophan 9571 NSC57199 sensitive
hsa-miR-424-5p Methyl (2s)-2-[[4-[[[(e)-2-methyl-3-phenylprop-2-enoyl]amino]methyl]benzoyl]amino]-4-methylsulfanylbutanoate 5470461 NSC702106 resistant
hsa-miR-424-5p Mitoxantrone 4212 NSC279836 approved sensitive
hsa-miR-424-5p Mitoxantrone 4212 NSC279836 approved sensitive
hsa-miR-424-5p N-((3-benzoyl-2-thioxo-1-imidazolidinyl)carbothioyl)-n-phenylbenzamide 396960 NSC704180 sensitive
hsa-miR-424-5p N-(3,5-dimethoxybenzyl)-4-methoxyaniline 364713 NSC631371 resistant
hsa-miR-424-5p N-[(5s,8ar,9r)-9-(4-hydroxy-3,5-dimethoxyphenyl)-8-oxo-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[5,6-f][1,3]benzodioxol-5-yl]-3-cyanobenzamide 369926 NSC642293 sensitive
hsa-miR-424-5p N-[4-[[[2-(4-chloroanilino)pyridine-3-carbonyl]amino]sulfamoyl]phenyl]acetamide 16126694 NSC737147 resistant
hsa-miR-424-5p N-[bis(aziridin-1-yl)phosphoryl]adamantan-1-amine 64376 NSC166199 sensitive
hsa-miR-424-5p N,n-bis{[(4-chlorophenyl)sulfanyl]methyl}-4-methylaniline 248767 NSC66211 sensitive
hsa-miR-424-5p Navan 941650 NSC108165 resistant
hsa-miR-424-5p Ncs-665564 380161 NSC665564 sensitive
hsa-miR-424-5p Neriifolin 276293 NSC123976 sensitive
hsa-miR-424-5p NSC623283 NSC623283 sensitive
hsa-miR-424-5p NSC763857 NSC763857 resistant
hsa-miR-424-5p Oxanthrazole 59916 NSC349174 sensitive
hsa-miR-424-5p Pcnu 26328 NSC95466 sensitive
hsa-miR-424-5p Phenylbenzophenone 407452 NSC5639 resistant
hsa-miR-424-5p S-(6-oxo-1,3,5-triphenyl-2-thioxo-1,2,3,6-tetrahydro-4-pyrimidinyl) 4-methoxybenzenecarbothioate 383063 NSC671107 sensitive
hsa-miR-424-5p S-(dimethylarsino)-3-mercapto-1,2-propanediol 406475 NSC724596 sensitive
hsa-miR-424-5p Stk716556 342450 NSC379399 resistant
hsa-miR-424-5p Tamoxifen 2733525 NSC180973 approved resistant
hsa-miR-424-5p Tetramethyl (1R,5R,6S,9S)-3-(4-chlorobenzoyl)oxy-5-hydroxy-7-[2-(trifluoromethyl)phenyl]bicyclo[3.3.1]non-2-ene-2,4,6,9-tetracarboxylate 24204894 NSC733348 sensitive
hsa-miR-424-5p Thevetin 5458241 NSC123979 sensitive
hsa-miR-424-5p Toddalin 5351594 NSC76023 resistant
hsa-miR-424-5p Topotecan 60699 NSC609699 approved sensitive
hsa-miR-424-5p Topotecan 60699 NSC609699 approved sensitive
hsa-miR-424-5p Venenatine 272417 NSC116787 sensitive
hsa-miR-424-5p Yoshi 864 18949 NSC102627 sensitive
hsa-miR-424-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-424-5p Docetaxel 148124 NSC628503 approved resistant High Non-Small Cell Lung Cancer cell line (SPC-A1)
hsa-miR-424-5p Doxorubicin 31703 NSC123127 approved resistant High Leukemia cell line (K562)
hsa-miR-424-5p 10-Hydroxycamptothecin 97226 NSC107124 sensitive High Gastric Cancer cell line (BGC823, SGC-7901, MGC-803, HGC-27, NCI-N87, AGS)
hsa-miR-424-5p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (SUIT-2, CAPAN-1)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved sensitive High Germ Cell Tumor cell line (NTERA-2)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved sensitive Low Epidermoid Carcinoma cell line (KB-3-1, KB-CP.5, KB-CP20)
hsa-miR-424-5p Chemotherapy sensitive High Epithelial Ovarian Cancer tissue
hsa-miR-424-5p Etoposide 36462 NSC141540 approved resistant Low melanoma tissue and cell line (A375)
hsa-miR-424-5p Doxorubicin 31703 NSC123127 approved resistant Low Colorectal Cancer tissue and cell line (HCT-116)
hsa-miR-424-5p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-424-5p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-424-5p Fluorouracil 3385 NSC19893 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-424-5p Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-424-5p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (HCT-116)
hsa-miR-424-5p Vincristine 5978 approved sensitive High Colorectal Cancer cell line (HCT-8)
hsa-miR-424-5p Gefitinib 123631 NSC715055 approved sensitive High Lung Adenocarcinoma cell line (A549)
hsa-miR-424-5p Doxorubicin 31703 NSC123127 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-424-5p Docetaxel 148124 NSC628503 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-424-5p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-424-5p Imatinib 5291 NSC743414 approved sensitive Low Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-424-5p Taxane 9548828 resistant High Prostate Cancer cell line (PC-3, PR20
hsa-miR-424-5p Plx-4720 24180719 NSC757438 sensitive High Thyroid Cancer cell line (8505c, BCPAP)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-424-5p Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-424-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-424-5p Trail sensitive Low Acute Myeloid Leukemia tissue and cell line (HL-60, K562, NB4)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer cell line (ID8)
hsa-miR-424-5p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (TAMR4, TAMR8)
hsa-miR-424-5p Paclitaxel 36314 NSC125973 approved sensitive Low Breast Cancer tissue and cell line
hsa-miR-424-5p Curcumin 969516 NSC32982 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-424-5p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-424-5p Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-424-5p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-424-5p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-424-5p Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (WM266) (1uM)
hsa-miR-424-5p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (WM266) (1uM)
hsa-miR-424-5p Fluorouracil 3385 NSC19893 approved resistant High Colorectal Cancer cell line (HT-29)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved resistant Low Bladder Cancer cell line (5637, J82, BIU87, T24)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved sensitive High Bladder Cancer cell line (CDDP-R-BOY, CDDP-R-T24)
hsa-miR-424-5p Taxol 36314 NSC125973 approved sensitive Low Breast Cancer cell line (MDA-MB-231)
hsa-miR-424-5p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375)
hsa-miR-424-5p Fluorouracil 3385 NSC19893 approved sensitive Low Colon Cancer cell line (HT-29)
hsa-miR-424-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-424-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-424-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-424-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-424-5p Palbociclib 5330286 NSC758247 approved resistant tissue (breast cancer)
hsa-miR-424-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (SKVO3ip1)
hsa-miR-424-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM11)
hsa-miR-424-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-424-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-424-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM43)
hsa-miR-424-5p Exemestane 60198 NSC713563 approved resistant cell line (MCF-7)
hsa-miR-424-5p Testosterone+Anastrozole resistant cell line (MCF-7)
hsa-miR-424-5p Testosterone+Exemestane resistant cell line (MCF-7)
hsa-miR-424-5p Testosterone+Tamoxifen resistant cell line (MCF-7)
hsa-miR-424-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-424-5p 4-Hydroxytamoxifen+Tamoxifen resistant cell line (LY2)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-424-5p Sunitinib 5329102 NSC750690 approved sensitive tissue (CardA)
hsa-miR-424-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-424-5p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-424-5p Tamoxifen 2733525 NSC180973 approved sensitive cell line (TamR4)
hsa-miR-424-5p Paclitaxel 36314 NSC125973 approved resistant cell line (PC3PR20)
hsa-miR-424-5p Paclitaxel 36314 NSC125973 approved resistant cell line (PC3PR70)
hsa-miR-424-5p Paclitaxel 36314 NSC125973 approved resistant cell line (PC3PR200)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-424-5p Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-miR-424-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (100 ng/ml)
hsa-miR-424-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-424-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR1)
hsa-miR-424-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)
hsa-miR-424-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR3)
hsa-miR-424-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (OVCAR3)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-424-5p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)
hsa-miR-424-5p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine resistant cell line (Bats-72)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved resistant cell line (OVSAHO)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (TOV-112D)

Error report submission