miRTarBase - #MIRT000853


—
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BRF09H miR-15a Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Ovarian granulosa cells Quantitative polymerase chain reaction
BIGS20 miR-15a-5p Predictive Biomarker (PRD) Clinical/Experimental Data Expression Higher Saliva Quantitative real-time PCR
BIGS20 miR-15a-5p Predictive Biomarker (PRD) Transcriptomic Data . . . .
Gene Information
Gene Symbol H3F3B   
Synonyms H3.3B
Description H3 histone family member 3B
Transcript NM_005324   
Expression
Putative miRNA Targets on H3F3B
3'UTR of H3F3B
(miRNA target sites are highlighted)		 
>H3F3B|NM_005324|3'UTR
   1 GTGAAGGCAGTTTTTATGGCGTTTTGTAGTAAATTCTGTAAAATACTTTGGTTTAATTTGTGACTTTTTTTGTAAGAAAT
  81 TGTTTATAATATGTTGCATTTGTACTTAAGTCATTCCATCTTTCACTCAGGATGAATGCGAAAAGTGACTGTTCACAGAC
 161 CTCAGTGATGTGAGCACTGTTGCTCAGGAGTGACAAGTTGCTAATATGCAGAAGGGATGGGTGATACTTCTTGCTTCTCA
 241 TGATGCATGTTTCTGTATGTTAATGACTTGTTGGGTAGCTATTAAGGTACTAGAGTTGATAAATGTGTACAGGGTCCTTT
 321 TGCAATAAAACTGGTTATGACTTGATCCAAGTGTTTAACAATTGGGGCTGTTAAGTCTGACCATACATCACTGTGATAGA
 401 ATGTGGGCTTTTTCAAGGGTGAAGATACAAGTCTTAACCACAGTGTAACTTACAGTTTCCTTTAAAAAAAAAAAAAGTAA
 481 ACCTGGCAGCTATAGAATACACTATGTGCATTTATAATAGCTATTTTATATATTGTAGTATCAACATTTTTAAATTAAAT
 561 GTTTTACATTCACAAGTGGTGGGGAGTCTTGTCATTAAGGTGTGTGTAATTTAGAGTCCAGTTGGTTTTCTTCTGACTGC
 641 ACTTGTTCTCATAGTAGTAAAATGCTATGCGCATTTATACCTTGCATAAGTCCTCATTCTACCACATGTTAACCCTCTAG
 721 CTGATAATGCAAACACTAACTGGGGGATTTTATTTATAAGGGCTCTAGAAAAAACGAGTTATTCACACCAGCATCATCTT
 801 AACTAACATTCTGAACTAGTTAGTGCAGCTTTTCATTGTGTTGTGTGGTTGGTCTCATAACTAGGTTGAGTTTTTCTCCT
 881 CTGCTGAGGAAACAGTACCGAAGTTCTTTTTCTTGTGGCATTTGTATTATAAAAACTTGGTGTGGGGGAGGAGCACAAAA
 961 CTCCAGCCCACTGAACCTCTGCCAATTAAGATGGTGTTGGGTTAGGTTACATCTGGTTACTGTCCTGGGAAAATCATTTT
1041 TATAGAGATGGCCTTCCAAGTGGTTTTAAAATTTACTGAAGTTTTTAGGTCAATTATGTATGTTGACTAAATTTACAAAT
1121 AAACTTGTTTATCCAACTAAGTGTCCAAAACCTAAATTGAATGTACTAAGTTTTCACATGTCCCATTATCTAGGTCCTTG
1201 TATACTAATGTTTTGAACTTAGATCATTTCAGGTGTTGTTTGGTGGATAAAGGAACCTTTTATTTATAAAGATACTGTAG
1281 AAAGCATGTGAACAGCTCTCTGCTTGATTAAGATGCCATAATAGTGCTGTATTTGCAGTGTGGGCTAAGACAAAGTATAT
1361 TAATAAGCTTTTCAGCCCCCCCACTCCCGTTCCGTAGTGTAGAAGCCCACAGGTGTAGAACTCAGTCTTAAACTTCAGTA
1441 TGAAACCAGTTTCCTTGTGCGATGATGGCCACTAAAGCATAGTACGTGGATGTCAGTGAGACAGCATGAGAGCCAGCAGT
1521 CATCAAAGCGTTCCACGTTTGAAGTTAGCAACTGCTTAAAGTTATGCCCCATTAAAATTGCTTTCTCAAAAGTTTGGGTT
1601 AGTTTCAAATGTGATATTTTGGAGGGAAGGTAAAGTAGGTATCTTTCAGGTCGTGATAATGAGCTCCTATGAAAGGATGC
1681 AATATAATGACCCGCTTTTCTAGAAAGTTCATAATCAGCTCTGGAACAAGCACACTTGATTCCTCACTGTGCTTCAGAAT
1761 GAGATTAAGATCAGATGTTGGAACGTGCTATGCTGTAGCGTGTCTGGAAACAAAGTACACAAACCTGGCTACGGTGATGA
1841 GTTAGCTTCTGCTTACTACCTGTGACAACCCAAGTGGGTGACACTAGTGAACCTTCTCCAGTCTGCAGGCTGGCATAGAA
1921 GGCTCTTAGATTATATTGGGCAGCTTGCAATCTGCCGAAGCAGTGACTTGCATTTCCACACTTGGCTTGAGCACTCAACC
2001 CAGAAGGCGAAGATAGCTTTTGGTTGTAGGCGGCTTCCTGTATGGGATATCCCTCGGTAAGGGTAAAGGAGCAGAGGCAA
2081 AGGAGAAAAGCAGAAGTTGCAGCTGATGCAGGTATCCTATGCCCTTGATGGATGAGACTAAAATAAAATTTTTGAAGTTA
2161 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' guGUUUGGUAA--UACACGACGAu 5'
            :|:|:||||  | |||:||:| 
Target 5' ctTAGATCATTTCAGGTGTTGTTt 3'
 1218 - 1241 138.00 -15.30
2 
miRNA  3' guGUUUGG---UAAUAC-------ACGACGAu 5'
            ||:|||   :| |||       ||:|||| 
Target 5' caCAGACCTCAGTGATGTGAGCACTGTTGCTc 3'
 154 - 185 136.00 -18.60
3 
miRNA  3' guGUUUGGU-AAUACACGACGAu 5'
            ::|||:| ||| |||| ||| 
Target 5' tcTGAACTAGTTA-GTGCAGCTt 3'
 810 - 831 135.00 -10.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
1183985 1 ClinVar
COSN30467033 2 COSMIC
COSN32070596 3 COSMIC
COSN22551114 9 COSMIC
COSN30735960 11 COSMIC
COSN30479665 15 COSMIC
COSN30501031 27 COSMIC
COSN30517580 43 COSMIC
COSN31523344 45 COSMIC
COSN18741229 48 COSMIC
COSN30110408 64 COSMIC
COSN30485169 69 COSMIC
COSN30126296 76 COSMIC
COSN31495834 76 COSMIC
COSN31609921 76 COSMIC
COSN30153592 116 COSMIC
COSN30458390 117 COSMIC
COSN18720425 199 COSMIC
COSN9322834 268 COSMIC
COSN31611061 388 COSMIC
COSN31924568 406 COSMIC
COSN31522501 407 COSMIC
COSN15662896 463 COSMIC
COSN20114440 463 COSMIC
COSN31570510 473 COSMIC
COSN26641157 478 COSMIC
COSN31524247 544 COSMIC
COSN7455529 689 COSMIC
COSN1729006 768 COSMIC
COSN31596003 768 COSMIC
COSN31588912 961 COSMIC
COSN29850659 1188 COSMIC
COSN31557674 1234 COSMIC
COSN31541042 1300 COSMIC
COSN26609466 1389 COSMIC
COSN15193828 1462 COSMIC
COSN1729005 1678 COSMIC
COSN19447407 1784 COSMIC
COSN26193227 1784 COSMIC
COSN26339913 1832 COSMIC
COSN31961380 1957 COSMIC
COSN27458771 1964 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs138810132 1 dbSNP
rs1182538481 2 dbSNP
rs1188312979 2 dbSNP
rs755819816 5 dbSNP
rs748559822 6 dbSNP
rs763854444 7 dbSNP
rs1232517058 8 dbSNP
rs781596034 11 dbSNP
rs755459492 12 dbSNP
rs752064798 15 dbSNP
rs1371001805 16 dbSNP
rs1424496890 16 dbSNP
rs543139829 17 dbSNP
rs1408187459 18 dbSNP
rs750488329 18 dbSNP
rs201839248 20 dbSNP
rs2410866 21 dbSNP
rs561174639 25 dbSNP
rs1308045282 32 dbSNP
rs1393589851 33 dbSNP
rs767295247 34 dbSNP
rs201242876 36 dbSNP
rs759426610 41 dbSNP
rs554802496 43 dbSNP
rs199968433 45 dbSNP
rs772814402 46 dbSNP
rs747751713 49 dbSNP
rs775393952 50 dbSNP
rs781439708 51 dbSNP
rs897593860 52 dbSNP
rs1035996187 53 dbSNP
rs2410865 59 dbSNP
rs1194085512 60 dbSNP
rs944391475 64 dbSNP
rs758290706 65 dbSNP
rs1388519224 67 dbSNP
rs1470232394 69 dbSNP
rs540874657 71 dbSNP
rs35916120 72 dbSNP
rs538957901 72 dbSNP
rs1427888785 73 dbSNP
rs1190043220 78 dbSNP
rs931793764 79 dbSNP
rs1488430684 85 dbSNP
rs373063808 86 dbSNP
rs925810921 88 dbSNP
rs1245670600 89 dbSNP
rs572158192 96 dbSNP
rs114101069 97 dbSNP
rs946105503 98 dbSNP
rs913325178 101 dbSNP
rs1289693840 104 dbSNP
rs993195985 105 dbSNP
rs1201922842 107 dbSNP
rs1269632574 111 dbSNP
rs1238617880 113 dbSNP
rs1271977133 116 dbSNP
rs545288184 117 dbSNP
rs577343148 118 dbSNP
rs1158927362 120 dbSNP
rs750599478 128 dbSNP
rs1304607345 130 dbSNP
rs528335709 130 dbSNP
rs1365585534 131 dbSNP
rs1390325122 134 dbSNP
rs1304304766 137 dbSNP
rs1338043925 139 dbSNP
rs952960863 142 dbSNP
rs1283946940 149 dbSNP
rs1027128866 150 dbSNP
rs765077919 152 dbSNP
rs994348179 153 dbSNP
rs2410864 154 dbSNP
rs1194142029 156 dbSNP
rs1014721696 161 dbSNP
rs1439460707 163 dbSNP
rs1008973830 164 dbSNP
rs1182498355 165 dbSNP
rs1384328406 166 dbSNP
rs1442578593 166 dbSNP
rs1165023345 167 dbSNP
rs1368975062 167 dbSNP
rs1307594871 169 dbSNP
rs118084969 170 dbSNP
rs2410863 172 dbSNP
rs1295911380 174 dbSNP
rs1392427685 175 dbSNP
rs781292335 175 dbSNP
rs890157652 176 dbSNP
rs182896596 185 dbSNP
rs1316247751 186 dbSNP
rs1341721678 190 dbSNP
rs1253129510 194 dbSNP
rs2410862 201 dbSNP
rs931893215 206 dbSNP
rs546663912 207 dbSNP
rs1309327823 210 dbSNP
rs2410861 211 dbSNP
rs1242470253 213 dbSNP
rs1459969948 214 dbSNP
rs757317532 215 dbSNP
rs751657487 217 dbSNP
rs2898588 220 dbSNP
rs1243570881 221 dbSNP
rs2410860 227 dbSNP
rs1182295673 228 dbSNP
rs1042837021 230 dbSNP
rs945883483 231 dbSNP
rs1462052444 233 dbSNP
rs913313886 233 dbSNP
rs1404523867 237 dbSNP
rs192562237 237 dbSNP
rs992959632 239 dbSNP
rs1337771822 240 dbSNP
rs938666284 243 dbSNP
rs566237569 252 dbSNP
rs1207723204 253 dbSNP
rs749315761 259 dbSNP
rs927295352 260 dbSNP
rs980525446 267 dbSNP
rs1321296752 270 dbSNP
rs142703331 270 dbSNP
rs1263471979 274 dbSNP
rs767908458 274 dbSNP
rs1348643532 277 dbSNP
rs1485438074 278 dbSNP
rs762139309 279 dbSNP
rs1263429270 281 dbSNP
rs552468682 285 dbSNP
rs1287808367 288 dbSNP
rs1428811168 290 dbSNP
rs1198065717 293 dbSNP
rs1426650183 293 dbSNP
rs1471230347 305 dbSNP
rs1396874379 310 dbSNP
rs3073415 312 dbSNP
rs1344937350 313 dbSNP
rs961572866 316 dbSNP
rs371218957 317 dbSNP
rs1465811438 326 dbSNP
rs1404609322 330 dbSNP
rs1008670376 337 dbSNP
rs1347488706 339 dbSNP
rs1225219244 347 dbSNP
rs1161918120 348 dbSNP
rs1301897113 357 dbSNP
rs1316054554 360 dbSNP
rs1213372249 361 dbSNP
rs1262343353 361 dbSNP
rs1485974919 362 dbSNP
rs1221348432 363 dbSNP
rs1266088921 373 dbSNP
rs1481150192 373 dbSNP
rs569355801 376 dbSNP
rs188328930 377 dbSNP
rs1456106675 380 dbSNP
rs1409206103 383 dbSNP
rs1180437823 384 dbSNP
rs1161691324 385 dbSNP
rs1346209223 386 dbSNP
rs1424200957 387 dbSNP
rs1028629532 389 dbSNP
rs1424072964 395 dbSNP
rs1257785898 396 dbSNP
rs1405641655 399 dbSNP
rs769865571 399 dbSNP
rs1179925179 402 dbSNP
rs1372525387 408 dbSNP
rs1482774209 411 dbSNP
rs11547398 414 dbSNP
rs1308856920 415 dbSNP
rs1354178355 416 dbSNP
rs1244739411 419 dbSNP
rs1289149457 424 dbSNP
rs996252077 428 dbSNP
rs1231850835 431 dbSNP
rs529649213 433 dbSNP
rs1479930676 436 dbSNP
rs904407168 443 dbSNP
rs1042991255 447 dbSNP
rs1444400173 449 dbSNP
rs1161838916 452 dbSNP
rs1387296387 453 dbSNP
rs527889044 453 dbSNP
rs370608501 455 dbSNP
rs938753455 457 dbSNP
rs1299848875 458 dbSNP
rs1267626913 459 dbSNP
rs1451667916 461 dbSNP
rs927380180 462 dbSNP
rs1426904957 463 dbSNP
rs1044366202 464 dbSNP
rs1271618660 476 dbSNP
rs1239331055 477 dbSNP
rs1305289412 477 dbSNP
rs1383269566 477 dbSNP
rs1461307664 477 dbSNP
rs535901088 477 dbSNP
rs931341408 477 dbSNP
rs920167858 478 dbSNP
rs1411735881 479 dbSNP
rs1417417077 479 dbSNP
rs973009796 479 dbSNP
rs1400929231 481 dbSNP
rs1156393161 482 dbSNP
rs961521244 482 dbSNP
rs1384750320 483 dbSNP
rs1448244074 489 dbSNP
rs1269233555 492 dbSNP
rs182451090 493 dbSNP
rs987387328 494 dbSNP
rs1258216051 497 dbSNP
rs527508453 500 dbSNP
rs1395812094 502 dbSNP
rs1366459854 503 dbSNP
rs1192666067 505 dbSNP
rs1443385064 505 dbSNP
rs781613779 506 dbSNP
rs1476548049 508 dbSNP
rs1029161909 510 dbSNP
rs1469181457 511 dbSNP
rs139736898 516 dbSNP
rs1407935512 517 dbSNP
rs1388507818 520 dbSNP
rs1157518408 521 dbSNP
rs968387582 523 dbSNP
rs1432511812 528 dbSNP
rs1278255677 529 dbSNP
rs1021482311 530 dbSNP
rs1222178706 532 dbSNP
rs1010131420 534 dbSNP
rs1346085988 535 dbSNP
rs1056934542 537 dbSNP
rs1448932327 538 dbSNP
rs1003123791 540 dbSNP
rs1443632380 541 dbSNP
rs1248480567 542 dbSNP
rs1479497932 544 dbSNP
rs545351800 545 dbSNP
rs905944631 549 dbSNP
rs1463512070 552 dbSNP
rs1379284906 553 dbSNP
rs1044909594 554 dbSNP
rs759530137 556 dbSNP
rs1157747342 558 dbSNP
rs1382578505 560 dbSNP
rs1358476593 561 dbSNP
rs1263754775 563 dbSNP
rs1244411493 566 dbSNP
rs1343111054 567 dbSNP
rs1363872155 568 dbSNP
rs1402577819 571 dbSNP
rs1304494347 575 dbSNP
rs1300316465 578 dbSNP
rs1332178283 579 dbSNP
rs931290526 580 dbSNP
rs919950080 583 dbSNP
rs1353323341 585 dbSNP
rs1241054153 588 dbSNP
rs1291328825 590 dbSNP
rs576403103 593 dbSNP
rs1224808748 598 dbSNP
rs1268194588 602 dbSNP
rs912813366 608 dbSNP
rs940225654 608 dbSNP
rs1425902625 611 dbSNP
rs1324722276 612 dbSNP
rs1386852842 613 dbSNP
rs1158818503 616 dbSNP
rs1384212818 617 dbSNP
rs986948067 619 dbSNP
rs954394396 622 dbSNP
rs1291279555 630 dbSNP
rs1423646584 633 dbSNP
rs921693204 635 dbSNP
rs1170273794 638 dbSNP
rs974491375 640 dbSNP
rs1314871764 641 dbSNP
rs1357510328 646 dbSNP
rs1266059737 648 dbSNP
rs1338862585 650 dbSNP
rs968335437 653 dbSNP
rs1021219030 654 dbSNP
rs1160795647 654 dbSNP
rs563713434 654 dbSNP
rs1242345866 660 dbSNP
rs955945971 660 dbSNP
rs1199574500 661 dbSNP
rs1036059078 663 dbSNP
rs1368469724 665 dbSNP
rs1461053833 666 dbSNP
rs1002702243 667 dbSNP
rs1403079999 669 dbSNP
rs1336458302 670 dbSNP
rs905721363 676 dbSNP
rs1397967920 678 dbSNP
rs1044482437 681 dbSNP
rs191137407 686 dbSNP
rs1483522990 689 dbSNP
rs571764753 690 dbSNP
rs1203474020 691 dbSNP
rs1341817752 692 dbSNP
rs1036999435 693 dbSNP
rs1199249435 705 dbSNP
rs1275809804 706 dbSNP
rs1459816168 707 dbSNP
rs144191240 708 dbSNP
rs554790121 709 dbSNP
rs1256402312 713 dbSNP
rs551679545 713 dbSNP
rs932820956 714 dbSNP
rs535085963 715 dbSNP
rs1176377791 718 dbSNP
rs1370798523 726 dbSNP
rs979587307 735 dbSNP
rs1303852199 736 dbSNP
rs1384526145 738 dbSNP
rs914327706 743 dbSNP
rs947105409 743 dbSNP
rs572341391 747 dbSNP
rs1309396271 752 dbSNP
rs558721711 755 dbSNP
rs1282573862 756 dbSNP
rs1427416861 758 dbSNP
rs1310425131 761 dbSNP
rs1211963088 763 dbSNP
rs1256408526 764 dbSNP
rs1203027782 765 dbSNP
rs1264655789 766 dbSNP
rs988435719 767 dbSNP
rs955935196 769 dbSNP
rs1427800842 770 dbSNP
rs1035599632 775 dbSNP
rs1363636987 775 dbSNP
rs1451838913 781 dbSNP
rs1300280892 789 dbSNP
rs772054158 790 dbSNP
rs981789590 791 dbSNP
rs1404394008 794 dbSNP
rs1301442949 796 dbSNP
rs538985013 798 dbSNP
rs1365367174 799 dbSNP
rs186388763 799 dbSNP
rs1301657337 800 dbSNP
rs1237423857 802 dbSNP
rs1316151668 802 dbSNP
rs1287736446 803 dbSNP
rs1488446196 804 dbSNP
rs1221087839 805 dbSNP
rs1266204596 807 dbSNP
rs746302089 808 dbSNP
rs1192311326 809 dbSNP
rs1250213402 810 dbSNP
rs1198819552 817 dbSNP
rs35754993 818 dbSNP
rs1160881098 819 dbSNP
rs550012587 822 dbSNP
rs756850181 826 dbSNP
rs1424304681 829 dbSNP
rs1161722851 831 dbSNP
rs1472927251 834 dbSNP
rs1254253039 835 dbSNP
rs1203366413 839 dbSNP
rs1022775161 844 dbSNP
rs746646268 847 dbSNP
rs751462814 854 dbSNP
rs531850959 857 dbSNP
rs995346132 859 dbSNP
rs1202499003 865 dbSNP
rs748072205 868 dbSNP
rs1287072115 870 dbSNP
rs1323034304 872 dbSNP
rs545585635 878 dbSNP
rs1251229006 881 dbSNP
rs1255858892 882 dbSNP
rs1222377193 883 dbSNP
rs766127594 883 dbSNP
rs1444184213 884 dbSNP
rs1182009528 885 dbSNP
rs1415966128 887 dbSNP
rs1350644396 893 dbSNP
rs1353854381 893 dbSNP
rs1464036822 894 dbSNP
rs1333097662 896 dbSNP
rs535889922 899 dbSNP
rs1407665615 900 dbSNP
rs1282075560 905 dbSNP
rs1380960890 906 dbSNP
rs576605441 909 dbSNP
rs1271721680 912 dbSNP
rs1316566891 912 dbSNP
rs891146876 915 dbSNP
rs1461147727 916 dbSNP
rs1208210905 917 dbSNP
rs1051333636 919 dbSNP
rs932871613 920 dbSNP
rs778811000 921 dbSNP
rs1185973393 924 dbSNP
rs562827225 925 dbSNP
rs900103151 926 dbSNP
rs1334773297 929 dbSNP
rs1043836642 930 dbSNP
rs1400679196 932 dbSNP
rs1334605754 935 dbSNP
rs567219126 936 dbSNP
rs201309741 939 dbSNP
rs36091349 941 dbSNP
rs988549010 941 dbSNP
rs1337813569 942 dbSNP
rs1220931347 944 dbSNP
rs934326618 946 dbSNP
rs1323518285 947 dbSNP
rs928266741 949 dbSNP
rs1281221049 957 dbSNP
rs188384328 960 dbSNP
rs1215363451 961 dbSNP
rs527358352 963 dbSNP
rs1022889910 964 dbSNP
rs565124576 967 dbSNP
rs962571118 970 dbSNP
rs1015671412 972 dbSNP
rs551593420 976 dbSNP
rs749834690 977 dbSNP
rs531494583 979 dbSNP
rs955500876 982 dbSNP
rs1030046870 983 dbSNP
rs560423997 985 dbSNP
rs1345401627 988 dbSNP
rs771594844 991 dbSNP
rs1043991140 995 dbSNP
rs1223368980 996 dbSNP
rs1284168456 997 dbSNP
rs1356199372 1001 dbSNP
rs1217387408 1003 dbSNP
rs1268328890 1004 dbSNP
rs1450910876 1004 dbSNP
rs1011019448 1006 dbSNP
rs542883100 1008 dbSNP
rs59093579 1009 dbSNP
rs1378093984 1010 dbSNP
rs1052636383 1019 dbSNP
rs1389418142 1021 dbSNP
rs1385557888 1024 dbSNP
rs561322563 1025 dbSNP
rs540684838 1034 dbSNP
rs1441921629 1038 dbSNP
rs928411475 1040 dbSNP
rs1349534472 1043 dbSNP
rs1379363905 1043 dbSNP
rs1241176308 1044 dbSNP
rs1284366372 1045 dbSNP
rs1291077514 1052 dbSNP
rs542787775 1053 dbSNP
rs1338555302 1056 dbSNP
rs541212160 1057 dbSNP
rs1291920055 1061 dbSNP
rs1335828982 1073 dbSNP
rs572195958 1078 dbSNP
rs773839037 1080 dbSNP
rs1157056964 1081 dbSNP
rs34473854 1082 dbSNP
rs35451907 1087 dbSNP
rs948406776 1088 dbSNP
rs1367315430 1090 dbSNP
rs1400128621 1091 dbSNP
rs1455948941 1092 dbSNP
rs915822390 1096 dbSNP
rs574058943 1097 dbSNP
rs1165285920 1101 dbSNP
rs1471924628 1104 dbSNP
rs1329665483 1111 dbSNP
rs558584141 1116 dbSNP
rs1447708822 1117 dbSNP
rs1314645689 1118 dbSNP
rs1338984873 1124 dbSNP
rs757422438 1124 dbSNP
rs78740696 1127 dbSNP
rs576201516 1129 dbSNP
rs1356937157 1134 dbSNP
rs1197961409 1135 dbSNP
rs536861519 1137 dbSNP
rs1458932487 1138 dbSNP
rs1255036220 1140 dbSNP
rs749728569 1141 dbSNP
rs566206800 1142 dbSNP
rs1368557399 1143 dbSNP
rs1477756417 1143 dbSNP
rs982648932 1146 dbSNP
rs1402833400 1147 dbSNP
rs1466455939 1147 dbSNP
rs536935512 1151 dbSNP
rs1400295772 1152 dbSNP
rs1445853003 1156 dbSNP
rs1029787598 1160 dbSNP
rs1339983580 1163 dbSNP
rs1055454038 1165 dbSNP
rs997247397 1166 dbSNP
rs567176982 1167 dbSNP
rs1319995766 1168 dbSNP
rs553727177 1168 dbSNP
rs113796231 1175 dbSNP
rs1482041068 1177 dbSNP
rs1356799738 1180 dbSNP
rs1022487401 1182 dbSNP
rs867228682 1183 dbSNP
rs1256159123 1185 dbSNP
rs183539335 1189 dbSNP
rs888248821 1191 dbSNP
rs796209643 1196 dbSNP
rs1190946471 1197 dbSNP
rs1228821336 1200 dbSNP
rs1426405174 1200 dbSNP
rs1367276426 1203 dbSNP
rs1286990876 1204 dbSNP
rs1376308114 1205 dbSNP
rs892734709 1207 dbSNP
rs1046896554 1209 dbSNP
rs1398218688 1210 dbSNP
rs551449287 1218 dbSNP
rs929854598 1220 dbSNP
rs1003715931 1222 dbSNP
rs1310220167 1224 dbSNP
rs1234886365 1225 dbSNP
rs141398190 1225 dbSNP
rs1325574398 1226 dbSNP
rs148328528 1236 dbSNP
rs549043561 1241 dbSNP
rs571557075 1241 dbSNP
rs911249506 1242 dbSNP
rs1191156717 1244 dbSNP
rs1265629474 1256 dbSNP
rs1384791301 1256 dbSNP
rs948352227 1257 dbSNP
rs1177326065 1259 dbSNP
rs529166672 1261 dbSNP
rs989535883 1262 dbSNP
rs1418147959 1263 dbSNP
rs1038060357 1264 dbSNP
rs1451647251 1266 dbSNP
rs1361278412 1271 dbSNP
rs554524395 1275 dbSNP
rs1365473429 1279 dbSNP
rs1388291170 1281 dbSNP
rs1303930253 1284 dbSNP
rs924068300 1288 dbSNP
rs751885940 1290 dbSNP
rs1478639621 1297 dbSNP
rs544402505 1298 dbSNP
rs865878517 1300 dbSNP
rs983020816 1306 dbSNP
rs1238009163 1307 dbSNP
rs371007292 1310 dbSNP
rs1205630112 1311 dbSNP
rs575636767 1313 dbSNP
rs1344123555 1316 dbSNP
rs991108421 1317 dbSNP
rs958599973 1318 dbSNP
rs190612804 1320 dbSNP
rs964116686 1321 dbSNP
rs1459424363 1324 dbSNP
rs185898507 1328 dbSNP
rs1005237395 1332 dbSNP
rs1444036841 1336 dbSNP
rs989449669 1338 dbSNP
rs1403137475 1339 dbSNP
rs1373682799 1340 dbSNP
rs1227242167 1345 dbSNP
rs73997619 1349 dbSNP
rs1308802084 1355 dbSNP
rs200686344 1363 dbSNP
rs398100626 1367 dbSNP
rs59192178 1367 dbSNP
rs1004110816 1368 dbSNP
rs1025399067 1369 dbSNP
rs906728508 1376 dbSNP
rs994400082 1377 dbSNP
rs1416080083 1380 dbSNP
rs1425444767 1381 dbSNP
rs565057306 1382 dbSNP
rs1422583645 1383 dbSNP
rs377180726 1383 dbSNP
rs1333200490 1384 dbSNP
rs1170146975 1386 dbSNP
rs73997618 1387 dbSNP
rs576262530 1388 dbSNP
rs1300521981 1389 dbSNP
rs1427805509 1393 dbSNP
rs1192455229 1394 dbSNP
rs753782833 1394 dbSNP
rs1234372346 1396 dbSNP
rs1479139658 1398 dbSNP
rs1316663469 1401 dbSNP
rs1267545273 1408 dbSNP
rs181998744 1409 dbSNP
rs1208322494 1410 dbSNP
rs760709905 1414 dbSNP
rs941046056 1421 dbSNP
rs887019071 1422 dbSNP
rs1476837303 1424 dbSNP
rs1419976135 1425 dbSNP
rs1483815825 1425 dbSNP
rs542996424 1431 dbSNP
rs1413482159 1433 dbSNP
rs1047003350 1434 dbSNP
rs189426472 1440 dbSNP
rs922439586 1445 dbSNP
rs1414836284 1447 dbSNP
rs767405548 1449 dbSNP
rs936704519 1452 dbSNP
rs942756376 1453 dbSNP
rs924012881 1454 dbSNP
rs1271069005 1460 dbSNP
rs554130593 1460 dbSNP
rs1312733023 1461 dbSNP
rs949562814 1464 dbSNP
rs1348916936 1465 dbSNP
rs918118380 1469 dbSNP
rs991452990 1471 dbSNP
rs1487232664 1472 dbSNP
rs1195239710 1473 dbSNP
rs1242440937 1478 dbSNP
rs1477564038 1481 dbSNP
rs959670146 1482 dbSNP
rs1396505780 1483 dbSNP
rs1435014648 1484 dbSNP
rs1033939621 1485 dbSNP
rs1289060856 1486 dbSNP
rs1358079949 1496 dbSNP
rs1422015284 1498 dbSNP
rs1411942207 1500 dbSNP
rs1331083362 1501 dbSNP
rs1434723303 1501 dbSNP
rs1277039777 1504 dbSNP
rs1371981032 1504 dbSNP
rs983761452 1505 dbSNP
rs952415951 1513 dbSNP
rs1031655853 1515 dbSNP
rs1361424128 1516 dbSNP
rs1025345577 1517 dbSNP
rs1060113 1521 dbSNP
rs1428039893 1523 dbSNP
rs571237598 1524 dbSNP
rs865869239 1529 dbSNP
rs1454395270 1536 dbSNP
rs557906001 1537 dbSNP
rs1176415770 1541 dbSNP
rs1483421785 1544 dbSNP
rs1470865990 1547 dbSNP
rs1158682388 1548 dbSNP
rs186693140 1551 dbSNP
rs1404154098 1558 dbSNP
rs796815716 1558 dbSNP
rs1395672202 1561 dbSNP
rs1446265983 1563 dbSNP
rs1005210287 1565 dbSNP
rs4567786 1566 dbSNP
rs1283734272 1567 dbSNP
rs1268898693 1568 dbSNP
rs1047188128 1569 dbSNP
rs10338 1570 dbSNP
rs754804938 1571 dbSNP
rs1039474495 1572 dbSNP
rs1235943177 1576 dbSNP
rs942574662 1579 dbSNP
rs915317102 1585 dbSNP
rs763523003 1587 dbSNP
rs1396818984 1588 dbSNP
rs1167773618 1589 dbSNP
rs1418962134 1593 dbSNP
rs989550331 1595 dbSNP
rs1329820294 1597 dbSNP
rs762471508 1598 dbSNP
rs1392198991 1599 dbSNP
rs1333515435 1602 dbSNP
rs1452615057 1605 dbSNP
rs539492251 1609 dbSNP
rs923941233 1610 dbSNP
rs1335434051 1612 dbSNP
rs1217779962 1614 dbSNP
rs529037656 1614 dbSNP
rs1159301235 1615 dbSNP
rs770167972 1617 dbSNP
rs1454832956 1622 dbSNP
rs1196018343 1628 dbSNP
rs769892483 1628 dbSNP
rs1042850881 1632 dbSNP
rs566759562 1634 dbSNP
rs1258826953 1636 dbSNP
rs753628824 1638 dbSNP
rs918058070 1639 dbSNP
rs1477815429 1642 dbSNP
rs1055302412 1643 dbSNP
rs1168911146 1646 dbSNP
rs146252863 1650 dbSNP
rs1462653625 1652 dbSNP
rs1424023889 1655 dbSNP
rs1415742192 1656 dbSNP
rs1172235762 1664 dbSNP
rs1400396029 1666 dbSNP
rs1181499406 1667 dbSNP
rs1416665987 1669 dbSNP
rs909462180 1669 dbSNP
rs990979563 1670 dbSNP
rs963569250 1671 dbSNP
rs985048668 1674 dbSNP
rs1328010094 1675 dbSNP
rs1060120 1676 dbSNP
rs1255026888 1678 dbSNP
rs1342526388 1680 dbSNP
rs1212391757 1681 dbSNP
rs1210671555 1684 dbSNP
rs115820619 1685 dbSNP
rs1192167874 1686 dbSNP
rs951220870 1691 dbSNP
rs74318232 1692 dbSNP
rs1198646723 1693 dbSNP
rs386799262 1693 dbSNP
rs965158777 1694 dbSNP
rs1436878005 1695 dbSNP
rs1019832359 1706 dbSNP
rs1359982591 1708 dbSNP
rs1039629049 1710 dbSNP
rs1364047215 1713 dbSNP
rs1006663660 1716 dbSNP
rs1006716191 1717 dbSNP
rs180811424 1719 dbSNP
rs569258160 1720 dbSNP
rs1236051935 1733 dbSNP
rs1323071179 1734 dbSNP
rs369382254 1735 dbSNP
rs1381009558 1736 dbSNP
rs1213093507 1738 dbSNP
rs1382225964 1741 dbSNP
rs539366979 1742 dbSNP
rs1486517462 1745 dbSNP
rs902483231 1747 dbSNP
rs369278122 1752 dbSNP
rs1265721351 1753 dbSNP
rs1042412431 1759 dbSNP
rs1366997933 1761 dbSNP
rs1194535139 1763 dbSNP
rs1000847097 1767 dbSNP
rs1437876393 1767 dbSNP
rs1161420696 1768 dbSNP
rs1014049473 1772 dbSNP
rs147629116 1773 dbSNP
rs1454263462 1776 dbSNP
rs949453186 1777 dbSNP
rs916822678 1779 dbSNP
rs896578760 1784 dbSNP
rs1375746560 1785 dbSNP
rs1055653918 1790 dbSNP
rs1308589596 1792 dbSNP
rs1317984391 1794 dbSNP
rs1244704206 1797 dbSNP
rs1390721045 1797 dbSNP
rs1195329584 1798 dbSNP
rs554470678 1799 dbSNP
rs909409900 1800 dbSNP
rs766994134 1801 dbSNP
rs1261191190 1808 dbSNP
rs1049288784 1812 dbSNP
rs373251506 1815 dbSNP
rs568271588 1815 dbSNP
rs796132453 1815 dbSNP
rs951126003 1815 dbSNP
rs1210460808 1817 dbSNP
rs1164025166 1818 dbSNP
rs929573402 1819 dbSNP
rs7342 1820 dbSNP
rs1462790807 1825 dbSNP
rs1018127028 1828 dbSNP
rs972433534 1832 dbSNP
rs965450701 1833 dbSNP
rs1299318904 1834 dbSNP
rs1373464998 1837 dbSNP
rs1395905732 1839 dbSNP
rs150303133 1841 dbSNP
rs796339408 1842 dbSNP
rs557767082 1844 dbSNP
rs893737061 1845 dbSNP
rs1257839746 1846 dbSNP
rs1305919817 1849 dbSNP
rs1053517111 1852 dbSNP
rs912311193 1856 dbSNP
rs537988512 1859 dbSNP
rs1300263287 1861 dbSNP
rs953843821 1862 dbSNP
rs1476179030 1863 dbSNP
rs1165305095 1868 dbSNP
rs575304869 1869 dbSNP
rs1407816235 1872 dbSNP
rs1326333449 1875 dbSNP
rs1354799519 1880 dbSNP
rs1465078043 1885 dbSNP
rs566888123 1885 dbSNP
rs1046947846 1886 dbSNP
rs555121221 1892 dbSNP
rs1386804143 1893 dbSNP
rs1479005899 1896 dbSNP
rs1415946054 1898 dbSNP
rs1277921672 1899 dbSNP
rs1367052794 1900 dbSNP
rs1360344338 1909 dbSNP
rs1300833358 1915 dbSNP
rs1000757772 1919 dbSNP
rs949396268 1922 dbSNP
rs1208802648 1930 dbSNP
rs758515415 1936 dbSNP
rs1169411266 1941 dbSNP
rs1188613138 1943 dbSNP
rs1241255174 1944 dbSNP
rs1021342192 1948 dbSNP
rs1013582190 1950 dbSNP
rs1188087643 1953 dbSNP
rs1055143525 1954 dbSNP
rs115789147 1956 dbSNP
rs1171129059 1957 dbSNP
rs140058830 1963 dbSNP
rs748212257 1966 dbSNP
rs1002274019 1970 dbSNP
rs887917782 1971 dbSNP
rs1433319557 1972 dbSNP
rs1271198950 1977 dbSNP
rs918327804 1980 dbSNP
rs1232374375 1981 dbSNP
rs976929872 1982 dbSNP
rs1049221793 1984 dbSNP
rs929525696 1992 dbSNP
rs898068627 1993 dbSNP
rs1194386002 1998 dbSNP
rs1041064770 2000 dbSNP
rs1217658656 2002 dbSNP
rs1017864181 2006 dbSNP
rs546523278 2007 dbSNP
rs570446529 2008 dbSNP
rs943698333 2009 dbSNP
rs1257029960 2012 dbSNP
rs985099457 2014 dbSNP
rs957910614 2017 dbSNP
rs1346905244 2022 dbSNP
rs1402968212 2026 dbSNP
rs779101310 2031 dbSNP
rs371761862 2032 dbSNP
rs932406225 2034 dbSNP
rs1328143664 2036 dbSNP
rs755995390 2037 dbSNP
rs925070565 2039 dbSNP
rs750442967 2042 dbSNP
rs1239507752 2043 dbSNP
rs1277912511 2045 dbSNP
rs1032711929 2047 dbSNP
rs1284637883 2047 dbSNP
rs1330679719 2050 dbSNP
rs1389394635 2051 dbSNP
rs979269277 2052 dbSNP
rs571353465 2053 dbSNP
rs1180392078 2055 dbSNP
rs999357371 2056 dbSNP
rs1159677093 2057 dbSNP
rs551350802 2059 dbSNP
rs750398070 2060 dbSNP
rs1167630223 2062 dbSNP
rs1395473721 2063 dbSNP
rs1020870035 2065 dbSNP
rs1391049790 2069 dbSNP
rs1427337064 2077 dbSNP
rs992510421 2078 dbSNP
rs3687 2086 dbSNP
rs1473053391 2089 dbSNP
rs1034110975 2091 dbSNP
rs1002220375 2092 dbSNP
rs1443091186 2093 dbSNP
rs887870356 2101 dbSNP
rs1334153388 2102 dbSNP
rs757058599 2103 dbSNP
rs1048481580 2109 dbSNP
rs546807197 2109 dbSNP
rs1194902351 2111 dbSNP
rs1247740280 2115 dbSNP
rs993622329 2116 dbSNP
rs751164941 2117 dbSNP
rs1474543999 2119 dbSNP
rs1206171924 2121 dbSNP
rs1040614626 2123 dbSNP
rs976287954 2124 dbSNP
rs1461629127 2140 dbSNP
rs1166351935 2141 dbSNP
rs944964038 2144 dbSNP
rs1222334015 2147 dbSNP
rs1329436111 2148 dbSNP
rs1312414912 2149 dbSNP
rs1354676764 2150 dbSNP
rs890771042 2150 dbSNP
rs1294858495 2154 dbSNP
rs753360333 2156 dbSNP
rs1226483811 2162 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Location of target site 3'UTR
Article - Calin GA; Cimmino A; Fabbri M; Ferracin M; et al.
- Proceedings of the National Academy of Sciences of the United States of America, 2008
MicroRNAs (miRNAs) are short noncoding RNAs regulating gene expression that play roles in human diseases, including cancer. Each miRNA is predicted to regulate hundreds of transcripts, but only few have experimental validation. In chronic lymphocytic leukemia (CLL), the most common adult human leukemia, miR-15a and miR-16-1 are lost or down-regulated in the majority of cases. After our previous work indicating a tumor suppressor function of miR-15a/16-1 by targeting the BCL2 oncogene, here, we produced a high-throughput profiling of genes modulated by miR-15a/16-1 in a leukemic cell line model (MEG-01) and in primary CLL samples. By combining experimental and bioinformatics data, we identified a miR-15a/16-1-gene signature in leukemic cells. Among the components of the miR-15a/16-1 signature, we observed a statistically significant enrichment in AU-rich elements (AREs). By examining the Gene Ontology (GO) database, a significant enrichment in cancer genes (such as MCL1, BCL2, ETS1, or JUN) that directly or indirectly affect apoptosis and cell cycle was found.
LinkOut: [PMID: 18362358]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.732 3.6e-5 0.705 8.6e-5 23 Click to see details
GSE21032 Prostate cancer 0.377 2.2e-4 0.385 1.6e-4 83 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.706 2.5e-4 0.800 1.1e-5 20 Click to see details
GSE21687 Ependynoma primary tumors 0.361 1.7e-3 0.396 6.0e-4 64 Click to see details
GSE26953 Aortic valvular endothelial cells 0.504 6.0e-3 0.491 7.4e-3 24 Click to see details
GSE19783 ER+ ER+ breast cancer -0.427 3.0e-2 -0.415 3.4e-2 20 Click to see details
GSE19783 ER- ER- breast cancer 0.18 5.6e-2 0.196 4.2e-2 79 Click to see details
GSE38226 Liver fibrosis -0.27 1.2e-1 -0.214 1.8e-1 21 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.188 1.8e-1 0.193 1.8e-1 25 Click to see details
GSE17306 Multiple myeloma -0.101 2.4e-1 -0.096 2.6e-1 49 Click to see details
GSE17498 Multiple myeloma 0.104 2.6e-1 0.187 1.2e-1 40 Click to see details
GSE14794 Lymphoblastoid cells -0.065 2.7e-1 -0.039 3.6e-1 90 Click to see details
GSE32688 Pancreatic cancer -0.11 2.7e-1 0.047 4.0e-1 32 Click to see details
GSE21849 B cell lymphoma 0.113 2.8e-1 0.507 2.5e-3 29 Click to see details
GSE28260 Renal cortex and medulla -0.156 3.1e-1 -0.132 3.3e-1 13 Click to see details
GSE28544 Breast cancer -0.095 3.3e-1 -0.424 1.9e-2 24 Click to see details
GSE19350 CNS germ cell tumors -0.104 3.7e-1 -0.182 2.9e-1 12 Click to see details
GSE27834 Pluripotent stem cells 0.036 4.5e-1 -0.038 4.4e-1 16 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.025 4.5e-1 0.096 3.2e-1 25 Click to see details
GSE19536 Breast cancer -0.01 4.6e-1 0.018 4.3e-1 100 Click to see details
GSE19536 Breast cancer -0.01 4.6e-1 0.018 4.3e-1 100 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LUAD 0.64 0.01 0.692 0.01 12 Click to see details
BRCA -0.24 0.01 -0.211 0.03 84 Click to see details
BLCA 0.451 0.03 0.432 0.04 18 Click to see details
STAD -0.298 0.05 -0.306 0.04 32 Click to see details
CHOL 0.543 0.07 0.417 0.13 9 Click to see details
LUSC 0.221 0.09 0.240 0.07 38 Click to see details
KIRC -0.09 0.23 -0.049 0.35 68 Click to see details
PAAD -0.481 0.26 -0.800 0.1 4 Click to see details
KIRP -0.108 0.28 -0.015 0.47 32 Click to see details
KICH 0.108 0.3 0.067 0.38 25 Click to see details
CESC 0.503 0.33 0.500 0.33 3 Click to see details
THCA -0.049 0.36 0.072 0.29 59 Click to see details
LIHC -0.05 0.37 -0.011 0.47 49 Click to see details
PCPG 0.39 0.37 0.500 0.33 3 Click to see details
ESCA -0.108 0.38 -0.200 0.28 11 Click to see details
PRAD 0.042 0.39 0.083 0.28 50 Click to see details
HNSC 0.035 0.41 0.100 0.26 42 Click to see details
UCEC 0.049 0.42 0.198 0.21 19 Click to see details
COAD 0.083 0.42 -0.262 0.27 8 Click to see details
COAD 0.083 0.42 -0.262 0.27 8 Click to see details
COAD 0.083 0.42 -0.262 0.27 8 Click to see details
694 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 6 5
MIRT000285 CCND2 cyclin D2 6 8
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 4 5
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 6 8
MIRT001228 CCNE1 cyclin E1 7 10
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 4 4
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 3 6
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 4 3
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 9 18
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 6 3
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 2 2
MIRT006801 HMGA1 high mobility group AT-hook 1 6 3
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 4 3
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 2 5
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 2 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 11
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT057514 CEP55 centrosomal protein 55 2 8
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 2 2
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 2 6
MIRT061244 AMOTL1 angiomotin like 1 2 12
MIRT061529 BTG2 BTG anti-proliferation factor 2 4 2
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 2 4
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 2 2
MIRT066312 USP15 ubiquitin specific peptidase 15 2 2
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 2 2
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 5
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 2 4
MIRT075249 SNTB2 syntrophin beta 2 2 4
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 2 8
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 2 7
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 2 2
MIRT079655 NAPG NSF attachment protein gamma 2 12
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 2 4
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 2 2
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 2 6
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 2 4
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 2 2
MIRT087424 ZNRF3 zinc and ring finger 3 2 2
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 2 2
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 2 4
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 2 3
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 2 6
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 2 6
MIRT096234 CANX calnexin 2 2
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 2 2
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 3 8
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 2 2
MIRT100896 CD2AP CD2 associated protein 2 2
MIRT102434 CALU calumenin 2 3
MIRT102632 UBN2 ubinuclein 2 2 11
MIRT102971 EN2 engrailed homeobox 2 2 6
MIRT103092 MAFK MAF bZIP transcription factor K 2 5
MIRT103856 FOXK1 forkhead box K1 2 3
MIRT104015 USP42 ubiquitin specific peptidase 42 2 6
MIRT106292 ZFHX4 zinc finger homeobox 4 2 6
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 2 3
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 2 2
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 2 2
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 2 7
MIRT112969 LUZP1 leucine zipper protein 1 2 6
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT117655 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 2 2
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 3
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 2 3
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 2 3
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 2 9
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 2 3
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 2 3
MIRT154043 RASSF2 Ras association domain family member 2 2 2
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 2 2
MIRT158519 TNRC6B trinucleotide repeat containing 6B 2 5
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 2 3
MIRT165883 CREBRF CREB3 regulatory factor 2 3
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 2 7
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 2
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 8
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 2 2
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 2 2
MIRT189961 AGO4 argonaute 4, RISC catalytic component 2 2
MIRT190184 GPR180 G protein-coupled receptor 180 2 6
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 2 2
MIRT191625 SLC39A9 solute carrier family 39 member 9 2 6
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 2 6
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 2 8
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 2 2
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 2 8
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 8
MIRT204623 MOB4 MOB family member 4, phocein 2 8
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 2 12
MIRT206020 NUP50 nucleoporin 50 2 7
MIRT211199 FGF2 fibroblast growth factor 2 2 4
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 4
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 2 8
MIRT217743 TBPL1 TATA-box binding protein like 1 2 3
MIRT223681 FZD6 frizzled class receptor 6 2 6
MIRT224965 BAG4 BCL2 associated athanogene 4 2 2
MIRT229343 ZNF449 zinc finger protein 449 2 2
MIRT229860 YIPF6 Yip1 domain family member 6 2 2
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 2 8
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 2 4
MIRT247236 ELK4 ELK4, ETS transcription factor 2 4
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 2 6
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 2 4
MIRT249449 ZNF691 zinc finger protein 691 2 4
MIRT251487 DYNLL2 dynein light chain LC8-type 2 2 4
MIRT255333 SRPRB SRP receptor beta subunit 2 5
MIRT256305 CDC42SE2 CDC42 small effector 2 2 2
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 2 3
MIRT265056 TBRG1 transforming growth factor beta regulator 1 2 2
MIRT265076 CHEK1 checkpoint kinase 1 2 3
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 2 2
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 2 2
MIRT273665 HOXC8 homeobox C8 2 2
MIRT274741 RAB3IP RAB3A interacting protein 2 2
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 2 4
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 2 2
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 2 2
MIRT294283 ZFP28 ZFP28 zinc finger protein 2 2
MIRT295810 CHMP4B charged multivesicular body protein 4B 2 2
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 2 4
MIRT300100 STRADB STE20-related kinase adaptor beta 2 2
MIRT300992 MTMR3 myotubularin related protein 3 2 2
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 2 6
MIRT302825 SOCS5 suppressor of cytokine signaling 5 2 2
MIRT307141 CTDSPL CTD small phosphatase like 2 4
MIRT313675 ITGA2 integrin subunit alpha 2 2 2
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 2 8
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 2 7
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 2 2
MIRT320626 ZNRF2 zinc and ring finger 2 2 2
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 2 2
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 2 6
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 3 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 2
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 2 2
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 2 2
MIRT448440 TLL1 tolloid like 1 2 2
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 2 2
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 2 2
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 2 2
MIRT453754 CSNK1E casein kinase 1 epsilon 2 2
MIRT454970 TPM2 tropomyosin 2 2 2
MIRT456867 ZNF460 zinc finger protein 460 2 10
MIRT460224 FGFR4 fibroblast growth factor receptor 4 2 2
MIRT460438 DOCK11 dedicator of cytokinesis 11 2 2
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 2 2
MIRT463167 ZNF367 zinc finger protein 367 2 10
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 8
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 2 3
MIRT465165 TSC22D2 TSC22 domain family member 2 2 2
MIRT465570 TOB2 transducer of ERBB2, 2 2 2
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 8
MIRT466008 TMEM189 transmembrane protein 189 2 8
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 2 2
MIRT466436 TFAP2A transcription factor AP-2 alpha 2 8
MIRT466917 STK38 serine/threonine kinase 38 2 10
MIRT467002 SSRP1 structure specific recognition protein 1 2 5
MIRT468052 SIK1 salt inducible kinase 1 2 3
MIRT468151 SH3BP4 SH3 domain binding protein 4 2 2
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 2 4
MIRT469090 RNF168 ring finger protein 168 2 2
MIRT469415 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT471038 PISD phosphatidylserine decarboxylase 2 10
MIRT471495 PDE4D phosphodiesterase 4D 2 4
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT472263 NFIC nuclear factor I C 2 2
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 2 4
MIRT474318 LAMC1 laminin subunit gamma 1 2 2
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 2 2
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 2 6
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 2 2
MIRT475539 HOXA3 homeobox A3 2 8
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 2 2
MIRT475843 HDGF heparin binding growth factor 2 4
MIRT476259 GNB1 G protein subunit beta 1 2 7
MIRT476276 GNAL G protein subunit alpha L 2 6
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 2 2
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 8
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 2 2
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 2 6
MIRT479457 CDK6 cyclin dependent kinase 6 2 2
MIRT479988 CARD10 caspase recruitment domain family member 10 2 2
MIRT481181 AVL9 AVL9 cell migration associated 2 6
MIRT482370 AGO2 argonaute 2, RISC catalytic component 2 2
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 10
MIRT482581 ABHD2 abhydrolase domain containing 2 2 2
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 2 4
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 2 8
MIRT487394 C10orf54 V-set immunoregulatory receptor 2 2
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 2 2
MIRT494354 CASKIN1 CASK interacting protein 1 2 2
MIRT495146 ZNRF1 zinc and ring finger 1 2 2
MIRT496019 CD180 CD180 molecule 2 2
MIRT497776 KIAA0895 KIAA0895 2 2
MIRT498984 ORC4 origin recognition complex subunit 4 2 8
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 2 8
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 2 8
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 2 8
MIRT500321 ZNF622 zinc finger protein 622 2 9
MIRT500425 ZMAT3 zinc finger matrin-type 3 2 4
MIRT500580 USP53 ubiquitin specific peptidase 53 2 2
MIRT500860 SYPL1 synaptophysin like 1 2 8
MIRT500936 SRPR SRP receptor alpha subunit 2 7
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 2 8
MIRT501089 SMAD7 SMAD family member 7 2 8
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 2 2
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 2
MIRT502151 KIF5B kinesin family member 5B 2 9
MIRT502496 FAM122B family with sequence similarity 122B 2 8
MIRT502570 E2F7 E2F transcription factor 7 2 11
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 2 8
MIRT502922 CDCA4 cell division cycle associated 4 4 9
MIRT502950 CDC37L1 cell division cycle 37 like 1 2 9
MIRT503140 ATG9A autophagy related 9A 2 7
MIRT504338 ASGR2 asialoglycoprotein receptor 2 2 6
MIRT504540 ZNF620 zinc finger protein 620 2 6
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 2 6
MIRT505116 YTHDC1 YTH domain containing 1 2 6
MIRT505349 TMEM245 transmembrane protein 245 2 6
MIRT505398 TMEM100 transmembrane protein 100 2 2
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 2 6
MIRT505549 SNX16 sorting nexin 16 2 6
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 2 6
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 2 6
MIRT505930 RCAN3 RCAN family member 3 2 4
MIRT506112 PPIG peptidylprolyl isomerase G 2 6
MIRT506138 PLRG1 pleiotropic regulator 1 2 4
MIRT506166 PLAG1 PLAG1 zinc finger 2 9
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 2 6
MIRT506487 MYO5A myosin VA 2 7
MIRT506854 KIF23 kinesin family member 23 2 7
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 2 6
MIRT507820 CDK1 cyclin dependent kinase 1 2 6
MIRT507853 CCNE2 cyclin E2 2 6
MIRT507877 CBX6 chromobox 6 2 2
MIRT508041 AXIN2 axin 2 2 6
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 2 5
MIRT509368 DMPK DM1 protein kinase 2 11
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 2 4
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 2 4
MIRT511847 GPATCH8 G-patch domain containing 8 2 5
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 2 7
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 2 5
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 2 8
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 2 5
MIRT514042 ATG14 autophagy related 14 2 2
MIRT518095 TRIM35 tripartite motif containing 35 2 2
MIRT518533 FLCN folliculin 2 6
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 2 4
MIRT521055 SLC2A3 solute carrier family 2 member 3 2 4
MIRT521207 SBNO1 strawberry notch homolog 1 2 6
MIRT521818 POM121C POM121 transmembrane nucleoporin C 2 2
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 5
MIRT522778 LAMP2 lysosomal associated membrane protein 2 2 6
MIRT537815 EFNB2 ephrin B2 2 4
MIRT539902 RPL14 ribosomal protein L14 2 4
MIRT540847 GNAT1 G protein subunit alpha transducin 1 2 4
MIRT541217 HOXA10 homeobox A10 2 2
MIRT541432 CBX4 chromobox 4 2 3
MIRT542810 PHC3 polyhomeotic homolog 3 2 3
MIRT542837 PDCD1 programmed cell death 1 2 7
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 2 2
MIRT543310 ZNF585B zinc finger protein 585B 2 2
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 2 2
MIRT543529 PRSS21 protease, serine 21 2 2
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 2 4
MIRT543839 GSG1 germ cell associated 1 2 2
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 2 2
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 2 4
MIRT544916 CLSPN claspin 2 2
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 2
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 4
MIRT545351 CCDC83 coiled-coil domain containing 83 2 2
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 2 2
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 2 2
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 2 2
MIRT546118 USP48 ubiquitin specific peptidase 48 2 4
MIRT546611 SALL1 spalt like transcription factor 1 2 4
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 2 2
MIRT546640 RTN4 reticulon 4 2 2
MIRT547069 PNISR PNN interacting serine and arginine rich protein 2 3
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 2 2
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 2 4
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 2 3
MIRT547406 MKX mohawk homeobox 2 2
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 2 2
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 2 4
MIRT547661 KPNA3 karyopherin subunit alpha 3 2 2
MIRT547702 KPNA1 karyopherin subunit alpha 1 2 4
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 2 4
MIRT548001 HCFC2 host cell factor C2 2 4
MIRT548018 GRB2 growth factor receptor bound protein 2 2 4
MIRT548219 FKBP1A FK506 binding protein 1A 2 2
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT548727 CRK CRK proto-oncogene, adaptor protein 2 2
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 2 4
MIRT548946 CDK17 cyclin dependent kinase 17 2 3
MIRT549076 CACUL1 CDK2 associated cullin domain 1 2 2
MIRT549123 C11orf24 chromosome 11 open reading frame 24 2 4
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 2 3
MIRT549389 AMOT angiomotin 2 2
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 2 4
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 2 4
MIRT550619 MTHFR methylenetetrahydrofolate reductase 2 2
MIRT550827 FAM229B family with sequence similarity 229 member B 2 2
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 2 2
MIRT551621 ZNF267 zinc finger protein 267 2 2
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 2 2
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT552348 ZNF704 zinc finger protein 704 2 2
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 2 2
MIRT553442 TPM3 tropomyosin 3 2 2
MIRT553565 TMEM161B transmembrane protein 161B 2 2
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 2 2
MIRT553777 TAF13 TATA-box binding protein associated factor 13 2 4
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 2 4
MIRT554702 RNF149 ring finger protein 149 2 2
MIRT554965 RACGAP1 Rac GTPase activating protein 1 2 2
MIRT555035 RAB23 RAB23, member RAS oncogene family 2 2
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 2 2
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 2 4
MIRT555278 PRDM4 PR/SET domain 4 2 2
MIRT555431 PPAP2B phospholipid phosphatase 3 2 2
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 2 2
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 2 4
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 2 2
MIRT557484 GPR27 G protein-coupled receptor 27 2 4
MIRT558041 EXT1 exostosin glycosyltransferase 1 2 2
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 2 4
MIRT558664 CNKSR3 CNKSR family member 3 2 2
MIRT559006 CA8 carbonic anhydrase 8 2 2
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 2 2
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 2 5
MIRT560855 OSBPL3 oxysterol binding protein like 3 2 2
MIRT561153 KRT33B keratin 33B 2 2
MIRT561404 TUBB2A tubulin beta 2A class IIa 2 2
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT562031 LANCL1 LanC like 1 2 2
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 2 2
MIRT562881 KIAA1456 KIAA1456 2 2
MIRT563090 SLC25A12 solute carrier family 25 member 12 2 3
MIRT563507 DLGAP3 DLG associated protein 3 2 2
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 2 2
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 2 2
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 2 2
MIRT564336 CCNT1 cyclin T1 2 2
MIRT564482 ZNF391 zinc finger protein 391 2 2
MIRT564556 CCDC80 coiled-coil domain containing 80 2 2
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 2 2
MIRT564954 XKR7 XK related 7 2 2
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 2 2
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 2 2
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT566122 RASEF RAS and EF-hand domain containing 2 2
MIRT566654 NCKAP1 NCK associated protein 1 2 2
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 2 2
MIRT567017 KLHL15 kelch like family member 15 2 2
MIRT567450 GNG12 G protein subunit gamma 12 2 2
MIRT567482 FZD9 frizzled class receptor 9 2 2
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 2 2
MIRT568143 CCDC88C coiled-coil domain containing 88C 2 2
MIRT568477 ARMC12 armadillo repeat containing 12 2 2
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 2 2
MIRT568621 ACVR2A activin A receptor type 2A 2 2
MIRT570464 TLK1 tousled like kinase 1 2 3
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 2 2
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 2 2
MIRT571431 RIF1 replication timing regulatory factor 1 2 2
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 2 2
MIRT571824 PHF19 PHD finger protein 19 5 2
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 2 3
MIRT574062 PROSC pyridoxal phosphate binding protein 2 2
MIRT574207 CLEC2D C-type lectin domain family 2 member D 2 2
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 2 4
MIRT574595 N4BP1 NEDD4 binding protein 1 2 3
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 2 4
MIRT575928 Dmpk dystrophia myotonica-protein kinase 2 7
MIRT576100 Pdcd1 programmed cell death 1 2 5
MIRT576593 Npepps aminopeptidase puromycin sensitive 2 2
MIRT614697 TRAK1 trafficking kinesin protein 1 2 2
MIRT616471 ADRA2B adrenoceptor alpha 2B 2 2
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 2 2
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 2 4
MIRT640542 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT645514 BSPRY B-box and SPRY domain containing 2 2
MIRT646599 ANKRD36 ankyrin repeat domain 36 2 2
MIRT648788 KLHL40 kelch like family member 40 2 2
MIRT655815 NOTCH2 notch 2 2 3
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 2 2
MIRT659260 CUL3 cullin 3 5 2
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 2 2
MIRT682280 RS1 retinoschisin 1 2 2
MIRT682518 GLP2R glucagon like peptide 2 receptor 2 2
MIRT691713 FLOT2 flotillin 2 2 3
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 2 2
MIRT701510 NEGR1 neuronal growth regulator 1 2 2
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 2 2
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT713423 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 2 2
MIRT716436 RAB15 RAB15, member RAS oncogene family 2 2
MIRT717465 ADORA3 adenosine A3 receptor 2 2
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 2 2
MIRT725130 SYNRG synergin gamma 2 2
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
MIRT735131 GSDMB gasdermin B 2 0
MIRT736201 DRD1 dopamine receptor D1 3 0
MIRT755619 Il7r interleukin 7 receptor 2 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-15a Calcitriol approved 5280453 Quantitative real-time PCR human umbilical vein endothelial cells 24397367 2014 up-regulated
miR-15a Benzo(a)pyrene NULL 2336 Microarray MM plasma cells 24798859 2014 up-regulated
miR-15a All-trans-retinoic acid (ATRA) approved 444795 Microarray acute promyelocytic leukemia 17260024 2008 up-regulated
miR-15a Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 down-regulated
miR-15a Curcumin NULL 969516 Quantitative real-time PCR MCF-7 cells 19908170 2010 up-regulated
miR-15a Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-15a 5-Fluorouracil approved 3385 Microarray MCF-7 breast cancer cells 21506117 2011 down-regulated
miR-15a 5-Fluorouracil approved 3385 Quantitative real-time PCR MCF-7 breast cancer cells 21506117 2011 down-regulated
miR-15a Bortezomib approved 387447 Quantitative real-time PCR multiple myeloma 21534877 2011 up-regulated
miR-15a 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer HB2 22076154 2011 down-regulated
miR-15a 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer MDA-MB231 22076154 2011 down-regulated
miR-15a 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer SKBR3 22076154 2011 down-regulated
miR-15a Curcumin NULL 969516 Quantitative real-time PCR Leukemia K562 and HL-60 cells 22449094 2012 down-regulated
miR-15a Bortezomib approved 387447 Quantitative real-time PCR bone marrow stromal cells (BMSCs) 22781767 2012 up-regulated
miR-15a Melphalan approved 460612 Quantitative real-time PCR bone marrow stromal cells (BMSCs) 22781767 2012 up-regulated
miR-15a Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 down-regulated
miR-15a Tamoxifen approved 2733526 Microarray rat liver 17343880 2007 up-regulated
miR-15a Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-15a Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse liver 19270793 2009 up-regulated
miR-15a Phenethyl isothiocyanate(PEITC) NULL 16741 Microarray neonatal mice lung 20145010 2010 up-regulated
miR-15a Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 down-regulated
miR-15a 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) NULL 15625 Microarray embryos 22921993 2012 down-regulated
miR-15a 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) NULL 15625 Next-generation sequencing embryos 22921993 2012 up-regulated
miR-15a Trenbolone acetate (TBA) + 17beta-estradiol (E2) NULL NULL Quantitative real-time PCR bovine liver 21212882 2011 down-regulated
miR-15a Curcumin NULL 969516 Quantitative real-time PCR K562 and HL-60 cells 22449094 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-15a Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-mir-15a Fluorouracil 3385 NSC19893 approved sensitive cell line (OE19)
hsa-mir-15a Tamoxifen 2733525 NSC180973 approved sensitive cell line (MCF7)
hsa-mir-15a Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-mir-15a Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-mir-15a Docetaxel+Cisplatin+5-Fluorouracil sensitive tissue (hypopharyngeal squamous cell carcinoma)
hsa-mir-15a Decitabine 451668 approved sensitive tissue (esopheageal cancer)
hsa-miR-15a-5p (-)7,8-dihydrocalanolide a 383107 NSC682400 sensitive
hsa-miR-15a-5p (1'S,8'R)-9',10'-dibromospiro[1,3-dithiolane-2,11'-tricyclo[6.3.1.02,7]dodeca-2,4,6,9-tetraene] 389921 NSC686573 sensitive
hsa-miR-15a-5p (1-(((2-amino-6-chloro-4-pyrimidinyl)amino)methyl)-3-isopropylcyclobutyl)methanol 385230 NSC676343 sensitive
hsa-miR-15a-5p (1,1,3-trioxo-1,2-benzothiazol-2-yl)methyl 4-methylpiperazine-1-carbodithioate 16072473 NSC735181 sensitive
hsa-miR-15a-5p (10,13-dimethyl-3-oxo-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-17-yl) 3-methylidene-2-oxo-6-oxabicyclo[3.1.0]hexane-1-carboxylate 495432 NSC654893 sensitive
hsa-miR-15a-5p (10Z)-10-[bromo(iodo)methylidene]phenanthren-9-one 3005079 NSC670789 sensitive
hsa-miR-15a-5p (1R)-4-methyl-7-oxo-1,6-diphenyl-5,6-diazaspiro[2.4]hept-4-ene-2,2-dicarbonitrile 366094 NSC634353 sensitive
hsa-miR-15a-5p (1R,2S,7S,13R,15S)-2,15-bis[[tert-butyl(dimethyl)silyl]oxy]-3,4,11,12-tetrahydroxy-7-methyl-6-oxabicyclo[11.3.0]hexadecan-5-one 24202575 NSC694611 resistant
hsa-miR-15a-5p (2-methoxyphenyl) (e)-3-(4-methoxyphenyl)prop-2-enoate 5928358 NSC700136 sensitive
hsa-miR-15a-5p (2E)-2-[(2-methoxyphenyl)methylidene]-5-(morpholin-4-ylmethyl)cyclopentan-1-one;hydrochloride 6516827 NSC639520 sensitive
hsa-miR-15a-5p (2E)-2-[(3,4-dichlorophenyl)methylidene]-6-[(dimethylamino)methyl]cyclohexan-1-one;hydrochloride 5468455 NSC670688 sensitive
hsa-miR-15a-5p (2E)-2-[2-[4-(2-methylpropyl)phenyl]propylidene]-5-(morpholin-4-ylmethyl)cyclopentan-1-one;hydrochloride 21141970 NSC639976 sensitive
hsa-miR-15a-5p (2e)-2-butylidene-5-[(dimethylamino)methyl]cyclopentan-1-one;hydrochloride 5467289 NSC649903 sensitive
hsa-miR-15a-5p (2E)-2-pentylidene-5-(piperidin-1-ylmethyl)cyclopentan-1-one;hydrochloride 54608096 NSC639501 sensitive
hsa-miR-15a-5p (2e,4e,6z,8e)-n-(1,3-benzodioxol-5-yl)-3,7-dimethyl-9-(2,6,6-trimethylcyclohexen-1-yl)nona-2,4,6,8-tetraenamide 24202490 NSC672131 sensitive
hsa-miR-15a-5p (2r,13r,17s,18s)-7-(4-fluorophenyl)-2,18-dimethyl-6,7,9-triazapentacyclo[11.7.0.02,10.04,8.014,18]icosa-4(8),5-dien-17-ol 376242 NSC656925 sensitive
hsa-miR-15a-5p (2s)-1-[(2-phenylmethoxynaphtho[1,2-f][1,3]benzodioxol-5-yl)methyl]piperidine-2-carboxylic acid 24205345 NSC735209 resistant
hsa-miR-15a-5p (2s)-2-[2,2-bis(4-chlorophenyl)ethyl]-2-(4-chlorophenyl)-1,3-thiazolidin-4-one 402438 NSC716408 sensitive
hsa-miR-15a-5p (2S,10R,11R,15R)-13-methyl-3-(trifluoromethylsulfonyl)-3,13,23-triazahexacyclo[14.7.0.02,10.04,9.011,15.017,22]tricosa-1(16),4,6,8,17,19,21-heptaene-12,14-dione 392225 NSC692358 sensitive
hsa-miR-15a-5p (2Z,6Z)-2,6-bis[[3-[(dimethylamino)methyl]-4-hydroxyphenyl]methylidene]cyclohexan-1-one 6067712 NSC683834 sensitive
hsa-miR-15a-5p (3e)-3-[(2-chloro-1-phenylindol-3-yl)methylidene]-5-methoxy-6-methyl-1h-indol-2-one 5471471 NSC711611 sensitive
hsa-miR-15a-5p (3e)-3-[(3,4-dihydroxyphenyl)methylidene]-6-phenylchromen-4-one 45029091 NSC745449 sensitive
hsa-miR-15a-5p (3E)-3-[[3-[1-(4-fluorophenyl)sulfonylpiperidin-4-yl]imidazo[1,5-a]pyridin-1-yl]methylidene]-1H-indol-2-one 54613720 NSC750970 resistant
hsa-miR-15a-5p (3s,6s)-3,6-bis(5-bromo-1h-indol-3-yl)piperazine-2,5-dione 6712394 NSC679833 sensitive
hsa-miR-15a-5p (3s,8r,9s,10r,13s,14s,16e)-3-hydroxy-10,13-dimethyl-16-[(4-nitrophenyl)methylidene]-2,3,4,7,8,9,11,12,14,15-decahydro-1h-cyclopenta[a]phenanthren-17-one 5472098 NSC716261 resistant
hsa-miR-15a-5p (3z,5z)-3,5-bis[(4-methoxyphenyl)methylidene]-1,1-dimethylpiperidin-1-ium-4-one;iodide 54608638 NSC634792 sensitive
hsa-miR-15a-5p (4-nitrophenyl) (3E,5E)-3,5-dibenzylidene-4-oxopiperidine-1-carboxylate 5388007 NSC630608 sensitive
hsa-miR-15a-5p (4aR,9aR)-9-(4-methylphenyl)sulfonyl-3,4,4a,9a-tetrahydrocarbazole 372866 NSC648556 sensitive
hsa-miR-15a-5p (4e)-4-(3h-1,3-benzothiazol-2-ylidene)-1-[4-(difluoromethylsulfanyl)phenyl]-5-iminopyrrolidin-2-one 135543874 NSC744116 sensitive
hsa-miR-15a-5p (4e)-4-(3h-1,3-benzothiazol-2-ylidene)-5-imino-1-(3-methoxyphenyl)pyrrolidin-2-one 135892287 NSC744115 sensitive
hsa-miR-15a-5p (4s,8s,12s,16s)-4,8,12,16-tetrabenzyl-1,9-bis(prop-2-enyl)-1,5,9,13-tetrazacyclohexadecane-2,6,10,14-tetrone 403842 NSC719376 sensitive
hsa-miR-15a-5p (4z,5z)-1-[(e)-(2-hydroxyphenyl)methyleneamino]-3-phenyl-4,5-bis(phenylimino)imidazolidine-2-thione 135509182 NSC671409 resistant
hsa-miR-15a-5p (4Z,9Z,14Z)-2,2,7,7,12,12,17,17-octamethyl-21-oxabicyclo[16.2.1]henicosa-1(20),4,9,14,18-pentaene-3,6,8,11,13,16-hexone 5387611 NSC625154 sensitive
hsa-miR-15a-5p (5E)-2-(morpholin-4-ylmethyl)-5-nonylidenecyclopentan-1-one;hydrochloride 54612513 NSC639505 sensitive
hsa-miR-15a-5p (5e)-2-[(4-ethoxyanilino)methyl]-5-[(2-methoxyphenyl)methylidene]cyclopentan-1-one 5915890 NSC639539 sensitive
hsa-miR-15a-5p (5E)-2-[(dimethylamino)methyl]-5-heptylidenecyclopentan-1-one;hydrochloride 5387764 NSC626879 sensitive
hsa-miR-15a-5p (5e)-3-benzyl-5-benzylidene-2-(3,4,5-trimethoxyphenyl)-1,3-thiazolidin-4-one 5470510 NSC702359 sensitive
hsa-miR-15a-5p (5z)-3-[4-benzoyl-2-[(4z)-5-oxo-2-phenyl-4-[(3,4,5-trimethoxyphenyl)methylidene]imidazol-1-yl]phenyl]-2-phenyl-5-[(3,4,5-trimethoxyphenyl)methylidene]imidazol-4-one NSC711885 sensitive
hsa-miR-15a-5p (6aS)-3-[5-[4-(2-diethoxyphosphorylethyl)piperazin-1-yl]pentoxy]-2-methoxy-6a,7,8,9-tetrahydropyrrolo[2,1-c][1,4]benzodiazepin-11-one 25113728 NSC744025 sensitive
hsa-miR-15a-5p (6E)-2-[(dimethylamino)methyl]-6-[(4-methoxyphenyl)methylidene]cyclohexan-1-one;hydrochloride 5468453 NSC670687 sensitive
hsa-miR-15a-5p (6Z,10E)-5-hydroxy-6-methyl-3-methylidene-2-oxo-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-10-carbaldehyde 6477353 NSC645998 sensitive
hsa-miR-15a-5p (7ar)-1,6-bis(4-methoxyphenyl)-7a-phenyltetrahydroimidazo[1,5-b][1,2,4]oxadiazol-2(1h)-one 402882 NSC717189 sensitive
hsa-miR-15a-5p (8e)-2-amino-4-(3,4-dimethoxyphenyl)-8-[(3,4-dimethoxyphenyl)methylidene]-5-methyl-6,7-dihydro-5h-quinoline-3-carbonitrile NSC690754 sensitive
hsa-miR-15a-5p (8r,9s,10r,13s,14s,16r)-16-imidazol-1-yl-10,13-dimethyl-3-pyrrolidin-1-yl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1h-cyclopenta[a]phenanthren-17-ol 390532 NSC687980 sensitive
hsa-miR-15a-5p (9,10-dioxoanthracen-2-yl)methyl 3-benzamido-2-hydroxy-3-phenylpropanoate 361915 NSC625350 resistant
hsa-miR-15a-5p (e)-(5,7-dimethyl-3,6-dihydro-2h-1,4-diazepin-6-yl)-(2-methyl-3h-benzimidazol-5-yl)diazene 396642 NSC703141 sensitive
hsa-miR-15a-5p (e)-1-(2,5-dihydroxyphenyl)ethene-2-isonitrile NSC632129 sensitive
hsa-miR-15a-5p (e)-1-(3,5-ditert-butyl-4-hydroxyphenyl)-3-(3,4-dimethoxyphenyl)prop-2-en-1-one 5471156 NSC709100 sensitive
hsa-miR-15a-5p (E)-1-(7-fluoro-3-methylquinoxalin-2-yl)-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 45029310 NSC746087 sensitive
hsa-miR-15a-5p (E)-1-(7-methoxy-3-methyl-4-oxido-1-oxoquinoxalin-1-ium-2-yl)-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 54612660 NSC741738 resistant
hsa-miR-15a-5p (e)-1-[3-[(4,6-dianilino-1,3,5-triazin-2-yl)amino]phenyl]-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 45028636 NSC743530 sensitive
hsa-miR-15a-5p (E)-1-[4-[(E)-4,4-dimethyl-3-oxo-5-piperidin-1-ylpent-1-enyl]phenyl]-4,4-dimethyl-5-piperidin-1-ylpent-1-en-3-one;hydrobromide 5386918 NSC618759 sensitive
hsa-miR-15a-5p (e)-1-[4-[[4-(4-chloroanilino)-6-(4-fluoroanilino)-1,3,5-triazin-2-yl]amino]phenyl]-3-[4-(dimethylamino)phenyl]prop-2-en-1-one 45028715 NSC743884 sensitive
hsa-miR-15a-5p (e)-1-[4-[[4-anilino-6-(4-chloroanilino)-1,3,5-triazin-2-yl]amino]phenyl]-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 54613477 NSC749379 sensitive
hsa-miR-15a-5p (e)-1-[4-[[4,6-bis(4-fluoroanilino)-1,3,5-triazin-2-yl]amino]phenyl]-3-(2-methoxyphenyl)prop-2-en-1-one 24205906 NSC737225 sensitive
hsa-miR-15a-5p (e)-1-[4-[[4,6-bis(4-fluoroanilino)-1,3,5-triazin-2-yl]amino]phenyl]-3-(4-methoxyphenyl)prop-2-en-1-one 24205905 NSC737224 sensitive
hsa-miR-15a-5p (e)-3-(4-hydroxyphenyl)-1-[5-methyl-1-[8-(trifluoromethyl)quinolin-4-yl]triazol-4-yl]prop-2-en-1-one NSC736153 sensitive
hsa-miR-15a-5p (E)-3-(4-methoxyphenyl)-2-(4-oxo-3H-quinazolin-2-yl)prop-2-enenitrile 135454458 NSC684969 resistant
hsa-miR-15a-5p (E)-3-[2-(4-methoxyphenyl)imidazo[1,2-a]pyridin-3-yl]-1-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 54613570 NSC750335 resistant
hsa-miR-15a-5p (E)-3-[4-(dimethylamino)phenyl]-1-(4-hydroxyphenyl)prop-2-en-1-one 5468166 NSC665694 sensitive
hsa-miR-15a-5p (E)-5-(diethylamino)-1-[4-[(E)-5-(diethylamino)-4,4-dimethyl-3-oxopent-1-enyl]phenyl]-4,4-dimethylpent-1-en-3-one 5916501 NSC602066 sensitive
hsa-miR-15a-5p (e)-5-(diethylamino)-1-phenylpent-1-en-3-one;hydrochloride 6519127 NSC678343 sensitive
hsa-miR-15a-5p (E)-but-2-enedioic acid;2-[4-tert-butyl-1-[(4-methylphenyl)methyl]cyclohexyl]oxy-N,N-dimethylethanamine 5351426 NSC670225 sensitive
hsa-miR-15a-5p (E)-N-[[(17S)-3,17-dihydroxy-13-methyl-7,8,9,11,12,14,15,16-octahydro-6H-cyclopenta[a]phenanthren-17-yl]methyl]-3-(4-hydroxy-3-methoxyphenyl)prop-2-enamide 24205473 NSC735946 sensitive
hsa-miR-15a-5p (ne)-n-[1-[4-(furo[3,2-c]quinolin-4-ylamino)phenyl]ethylidene]hydroxylamine 9572572 NSC720561 sensitive
hsa-miR-15a-5p (nz)-n-[1-[4-[(4-imidazol-1-ylquinolin-2-yl)amino]phenyl]ethylidene]hydroxylamine 24204871 NSC733301 sensitive
hsa-miR-15a-5p (z)-3-(2,6-dichlorophenyl)-2-phenyl-prop-2-enenitrile 5388794 NSC638623 sensitive
hsa-miR-15a-5p .alpha.-sarcin NSC46401 resistant
hsa-miR-15a-5p .beta.-phenylethyl 2,4,5-trihydroxycinnamate 5933247 NSC666592 sensitive
hsa-miR-15a-5p [(10R,13S,16E)-16-[[3-methoxy-4-(2-pyrrolidin-1-ylethoxy)phenyl]methylidene]-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 24203499 NSC728323 sensitive
hsa-miR-15a-5p [(1r,2r,3r,4r,6r,8s,9e,12s,13s,14r,15s)-3,4,6,12,13-pentaacetyloxy-4,8,11,11-tetramethyl-14-(2-methylpropoxy)-7,18-dioxo-19-oxatricyclo[13.4.0.02,6]nonadec-9-en-15-yl] benzoate 5469441 NSC688228 sensitive
hsa-miR-15a-5p [(1s,2s,3r,4r,7r,8r,11s,14r,15r,17s)-15-hydroxy-14-methoxy-4,8,11,15-tetramethyl-9-oxo-10,18-dioxatetracyclo[9.7.0.02,7.03,17]octadecan-4-yl] butanoate 11015858 NSC737077 sensitive
hsa-miR-15a-5p [(1s,2s,3r,4s,7r,9s,10s,12r,15s)-4,12-diacetyloxy-1,9-dihydroxy-15-[(2r,3s)-2-hydroxy-3-(3-methylbutanoylamino)-3-phenylpropanoyl]oxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10.04,7]h 6712271 NSC664404 sensitive
hsa-miR-15a-5p [(2r,4r,6s,10s,11s)-2,8-diacetyloxy-6-hydroxy-5,5,9-trimethyl-14-methylidene-3,15-dioxo-11-tetracyclo[11.2.1.01,10.04,9]hexadecanyl] acetate 377385 NSC658828 sensitive
hsa-miR-15a-5p [(3bR,9aS,11aS)-2-(2-hydroxy-5-oxo-2H-furan-3-yl)-3b,6,6,9a-tetramethyl-2,3,3a,4,5,5a,7,8,9,9b,10,11-dodecahydronaphtho[2,1-e][1]benzofuran-11a-yl]methyl acetate 378635 NSC661428 sensitive
hsa-miR-15a-5p [(3S,10R,13S,16E)-16-[[3-methoxy-4-(2-piperidin-1-ylethoxy)phenyl]methylidene]-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 24203176 NSC727082 sensitive
hsa-miR-15a-5p [(3s,8r,9s,10r,13s,14s,16e)-16-(1-acetyloxy-2,2,2-trifluoroethylidene)-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1h-cyclopenta[a]phenanthren-3-yl] acetate 5351782 NSC45238 sensitive