>MYB|NM_001130172|3'UTR
   1 GACATTTCCAGAAAAGCATTATGGTTTTCAGAACACTTCAAGTTGACTTGGGATATATCATTCCTCAACATGAAACTTTT
  81 CATGAATGGGAGAAGAACCTATTTTTGTTGTGGTACAACAGTTGAGAGCAGCACCAAGTGCATTTAGTTGAATGAAGTCT
 161 TCTTGGATTTCACCCAACTAAAAGGATTTTTAAAAATAAATAACAGTCTTACCTAAATTATTAGGTAATGAATTGTAGCC
 241 AGTTGTTAATATCTTAATGCAGATTTTTTTAAAAAAAACATAAAATGATTTATCTGTATTTTAAAGGATCCAACAGATCA
 321 GTATTTTTTCCTGTGATGGGTTTTTTGAAATTTGACACATTAAAAGGTACTCCAGTATTTCACTTTTCTCGATCACTAAA
 401 CATATGCATATATTTTTAAAAATCAGTAAAAGCATTACTCTAAGTGTAGACTTAATACCATGTGACATTTAATCCAGATT
 481 GTAAATGCTCATTTATGGTTAATGACATTGAAGGTACATTTATTGTACCAAACCATTTTATGAGTTTTCTGTTAGCTTGC
 561 TTTAAAAATTATTACTGTAAGAAATAGTTTTATAAAAAATTATATTTTTATTCAGTAATTTAATTTTGTAAATGCCAAAT
 641 GAAAAACGTTTTTTGCTGCTATGGTCTTAGCCTGTAGACATGCTGCTAGTATCAGAGGGGCAGTAGAGCTTGGACAGAAA
 721 GAAAAGAAACTTGGTGTTAGGTAATTGACTATGCACTAGTATTTCAGACTTTTTAATTTTATATATATATACATTTTTTT
 801 TCCTTCTGCAATACATTTGAAAACTTGTTTGGGAGACTCTGCATTTTTTATTGTGGTTTTTTTGTTATTGTTGGTTTATA
 881 CAAGCATGCGTTGCACTTCTTTTTTGGGAGATGTGTGTTGTTGATGTTCTATGTTTTGTTTTGAGTGTAGCCTGACTGTT
 961 TTATAATTTGGGAGTTCTGCATTTGATCCGCATCCCCTGTGGTTTCTAAGTGTATGGTCTCAGAACTGTTGCATGGATCC
1041 TGTGTTTGCAACTGGGGAGACAGAAACTGTGGTTGATAGCCAGTCACTGCCTTAAGAACATTTGATGCAAGATGGCCAGC
1121 ACTGAACTTTTGAGATATGACGGTGTACTTACTGCCTTGTAGCAAAATAAAGATGTGCCCTTATTTTACCTACAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' guGAC--CAUGUUCCCAACCCUCu 5' ||| ||:|| ||||||| Target 5' gaCTGTTTTATAA--TTTGGGAGt 3'	954 - 975	150.00	-13.90
2	miRNA 3' gugACCAUGUUCCCAACCCUCu 5' |||||||| |||| ||| Target 5' ttgTGGTACAACAGTTGAGAGc 3'	108 - 129	147.00	-17.10
3	miRNA 3' gugaccauguucCCAACCCUCu 5' | ||||||| Target 5' atttgaaaacttGTTTGGGAGa 3'	815 - 836	142.00	-11.51

Mutant ID	Mutant Position	Mutant Source
COSN14197211	3	COSMIC
COSN30455529	51	COSMIC
COSN30116111	59	COSMIC
COSN30155858	67	COSMIC
COSN31525023	82	COSMIC
COSN30149252	96	COSMIC
COSN31530083	106	COSMIC
COSN31597759	167	COSMIC
COSN26818630	271	COSMIC
COSN21961385	272	COSMIC
COSN20103388	279	COSMIC
COSN16131885	370	COSMIC
COSN26669616	392	COSMIC
COSN31541822	665	COSMIC
COSN7690475	727	COSMIC
COSN26506750	868	COSMIC
COSN26601736	890	COSMIC
COSN26676977	916	COSMIC
COSN31662526	950	COSMIC
COSN31662077	986	COSMIC
COSN19190598	1070	COSMIC
COSN26647396	1080	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1457644081	2	dbSNP
rs761806864	4	dbSNP
rs1387237273	12	dbSNP
rs1399422192	16	dbSNP
rs747809460	19	dbSNP
rs765136014	20	dbSNP
rs761848825	22	dbSNP
rs1042371	37	dbSNP
rs202144270	42	dbSNP
rs371994822	45	dbSNP
rs1404287153	48	dbSNP
rs751266789	48	dbSNP
rs1480356922	51	dbSNP
rs1466705848	52	dbSNP
rs754377040	53	dbSNP
rs142843096	61	dbSNP
rs1049788717	62	dbSNP
rs909854589	67	dbSNP
rs1421014027	71	dbSNP
rs1382089296	85	dbSNP
rs941953392	96	dbSNP
rs1443944466	99	dbSNP
rs1412444215	107	dbSNP
rs980357860	125	dbSNP
rs1201996884	137	dbSNP
rs552220856	138	dbSNP
rs1483355172	139	dbSNP
rs927535213	140	dbSNP
rs1348121000	141	dbSNP
rs938908809	144	dbSNP
rs1355317005	149	dbSNP
rs1309360702	153	dbSNP
rs1245815528	158	dbSNP
rs1057212671	161	dbSNP
rs751717701	162	dbSNP
rs1397020970	164	dbSNP
rs1199574922	174	dbSNP
rs897721533	176	dbSNP
rs1421757017	177	dbSNP
rs1361181615	183	dbSNP
rs1163032110	186	dbSNP
rs759673901	197	dbSNP
rs370151079	198	dbSNP
rs1383351327	201	dbSNP
rs1439043737	203	dbSNP
rs1057334807	212	dbSNP
rs895601393	216	dbSNP
rs1424238866	219	dbSNP
rs1260607905	222	dbSNP
rs1184521611	226	dbSNP
rs1013079189	227	dbSNP
rs1489076141	231	dbSNP
rs1286051824	232	dbSNP
rs1221136961	233	dbSNP
rs945800550	238	dbSNP
rs1267812620	250	dbSNP
rs1245978922	251	dbSNP
rs112250530	263	dbSNP
rs1402026833	264	dbSNP
rs200493203	264	dbSNP
rs1341395891	269	dbSNP
rs1302596024	270	dbSNP
rs536173968	270	dbSNP
rs1458354581	271	dbSNP
rs3216774	271	dbSNP
rs74299305	271	dbSNP
rs869233628	271	dbSNP
rs55938804	272	dbSNP
rs201841211	275	dbSNP
rs1031884623	276	dbSNP
rs397807155	279	dbSNP
rs544771312	279	dbSNP
rs56040798	280	dbSNP
rs113427245	282	dbSNP
rs1400075188	285	dbSNP
rs1249935768	292	dbSNP
rs536544816	295	dbSNP
rs1220889492	310	dbSNP
rs1318844547	318	dbSNP
rs1282948470	321	dbSNP
rs1403179441	322	dbSNP
rs976979845	323	dbSNP
rs1329691068	324	dbSNP
rs922756590	325	dbSNP
rs1395728910	326	dbSNP
rs954177763	332	dbSNP
rs147011819	341	dbSNP
rs1305336373	343	dbSNP
rs909939541	355	dbSNP
rs1476844176	360	dbSNP
rs941359120	368	dbSNP
rs960584925	374	dbSNP
rs972689695	385	dbSNP
rs1249098362	391	dbSNP
rs186588575	392	dbSNP
rs112293547	403	dbSNP
rs1458547552	407	dbSNP
rs538759439	411	dbSNP
rs929201056	412	dbSNP
rs912915967	413	dbSNP
rs1057004804	429	dbSNP
rs945686194	432	dbSNP
rs895622879	442	dbSNP
rs1457691963	460	dbSNP
rs1335077869	481	dbSNP
rs1448908637	483	dbSNP
rs1400681039	485	dbSNP
rs1335865258	491	dbSNP
rs1412359780	500	dbSNP
rs948528579	506	dbSNP
rs779724172	507	dbSNP
rs558712123	508	dbSNP
rs1403955946	510	dbSNP
rs1255239390	514	dbSNP
rs575282702	515	dbSNP
rs1180983669	518	dbSNP
rs942392789	533	dbSNP
rs1242870012	541	dbSNP
rs1039956672	542	dbSNP
rs1376119110	566	dbSNP
rs1476552069	574	dbSNP
rs543911268	579	dbSNP
rs1348543480	580	dbSNP
rs554544217	581	dbSNP
rs1311568881	589	dbSNP
rs1168541733	594	dbSNP
rs1377592427	595	dbSNP
rs900982185	603	dbSNP
rs756417588	609	dbSNP
rs746661993	611	dbSNP
rs1423072822	614	dbSNP
rs1341880318	626	dbSNP
rs1046963813	629	dbSNP
rs1463959766	648	dbSNP
rs1358010410	649	dbSNP
rs1159957209	661	dbSNP
rs1327885452	674	dbSNP
rs886478060	680	dbSNP
rs575032658	681	dbSNP
rs1394868821	686	dbSNP
rs79468771	688	dbSNP
rs1004839271	689	dbSNP
rs963440512	690	dbSNP
rs1192667372	696	dbSNP
rs1321418627	699	dbSNP
rs1001601280	700	dbSNP
rs1327795569	705	dbSNP
rs1288203438	721	dbSNP
rs1217488038	755	dbSNP
rs778139617	762	dbSNP
rs374620401	765	dbSNP
rs1034951802	773	dbSNP
rs1276964126	778	dbSNP
rs960219997	780	dbSNP
rs1226396978	782	dbSNP
rs999823879	784	dbSNP
rs1315562816	788	dbSNP
rs1217267997	789	dbSNP
rs138229891	790	dbSNP
rs560328112	792	dbSNP
rs1489127218	793	dbSNP
rs1299466210	794	dbSNP
rs993518495	794	dbSNP
rs913482399	809	dbSNP
rs1365497917	816	dbSNP
rs532542952	819	dbSNP
rs1209613421	820	dbSNP
rs1163204604	832	dbSNP
rs397718007	837	dbSNP
rs56268608	837	dbSNP
rs978431208	838	dbSNP
rs892084018	840	dbSNP
rs998824935	841	dbSNP
rs1476945469	846	dbSNP
rs377628025	850	dbSNP
rs550590800	853	dbSNP
rs1194462207	857	dbSNP
rs954367288	857	dbSNP
rs985622997	858	dbSNP
rs1219213110	868	dbSNP
rs1262519912	868	dbSNP
rs1290282206	873	dbSNP
rs1017033185	875	dbSNP
rs562879021	876	dbSNP
rs922457189	882	dbSNP
rs933834145	887	dbSNP
rs972763290	890	dbSNP
rs1161217533	896	dbSNP
rs1386895030	902	dbSNP
rs1351014737	905	dbSNP
rs1328576554	918	dbSNP
rs887031151	921	dbSNP
rs1426044533	924	dbSNP
rs1005392961	930	dbSNP
rs1037682559	934	dbSNP
rs1480241019	936	dbSNP
rs918590226	939	dbSNP
rs1193026146	951	dbSNP
rs1489406493	952	dbSNP
rs531826017	956	dbSNP
rs1416076570	959	dbSNP
rs1293448895	964	dbSNP
rs1002053524	973	dbSNP
rs1259763490	976	dbSNP
rs1218805534	990	dbSNP
rs190986138	991	dbSNP
rs757843333	998	dbSNP
rs1275642853	999	dbSNP
rs1220501496	1000	dbSNP
rs1368899428	1007	dbSNP
rs1279556251	1010	dbSNP
rs1445220601	1013	dbSNP
rs917146702	1015	dbSNP
rs1332492231	1020	dbSNP
rs948580635	1027	dbSNP
rs1178303207	1033	dbSNP
rs1433907254	1034	dbSNP
rs367902794	1041	dbSNP
rs1014425740	1042	dbSNP
rs1217540178	1052	dbSNP
rs1482814869	1067	dbSNP
rs1199080191	1069	dbSNP
rs1262722466	1074	dbSNP
rs1253938080	1084	dbSNP
rs1211613118	1087	dbSNP
rs778285146	1090	dbSNP
rs1284703284	1095	dbSNP
rs967635543	1096	dbSNP
rs1379805401	1101	dbSNP
rs112386587	1105	dbSNP
rs111741587	1130	dbSNP
rs891448132	1133	dbSNP
rs997831376	1138	dbSNP
rs753169543	1139	dbSNP
rs975603296	1142	dbSNP
rs546882985	1143	dbSNP
rs1344630326	1176	dbSNP
rs1156960578	1177	dbSNP
rs1417749852	1185	dbSNP
rs1365258788	1191	dbSNP

- Cell, 2007

MiR-150 is a microRNA (miRNA) specifically expressed in mature lymphocytes, but not their progenitors. A top predicted target of miR-150 is c-Myb, a transcription factor controlling multiple steps of lymphocyte development. Combining loss- and gain-of-function gene targeting approaches for miR-150 with conditional and partial ablation of c-Myb, we show that miR-150 indeed controls c-Myb expression in vivo in a dose-dependent manner over a narrow range of miRNA and c-Myb concentrations and that this dramatically affects lymphocyte development and response. Our results identify a key transcription factor as a critical target of a stage-specifically expressed miRNA in lymphocytes and suggest that this and perhaps other miRNAs have evolved to control the expression of just a few critical target proteins in particular cellular contexts.

- Developmental cell, 2008

Lineage specification is a critical issue in developmental and regenerative biology. We hypothesized that microRNAs (miRNAs) are important participants in those processes and used the poorly understood regulation of megakaryocyte-erythrocyte progenitors (MEPs) in hematopoiesis as a model system. We report here that miR-150 modulates lineage fate in MEPs. Using a novel methodology capable of profiling miRNA expression in small numbers of primary cells, we identify miR-150 as preferentially expressed in the megakaryocytic lineage. Through gain- and loss-of-function experiments, we demonstrate that miR-150 drives MEP differentiation toward megakaryocytes at the expense of erythroid cells in vitro and in vivo. Moreover, we identify the transcription factor MYB as a critical target of miR-150 in this regulation. These experiments show that miR-150 regulates MEP fate, and thus establish a role for miRNAs in lineage specification of mammalian multipotent cells.

- Molecular biology and evolution, 2008

Human c-Myb proto-oncogene is highly expressed in hematopoietic progenitors as well as leukemia and certain solid tumor. However, the regulatory mechanisms of its expression and biological functions remain largely unclear. Recently, c-Myb has been shown to be targeted by microRNA-150 (miR-150) which thereby controls B cell differentiation in mice. In this study, we demonstrated that c-Myb is an evolutionary conserved target of miR-150 in human and zebrafish, using reporter assays. Ectopic expression of miR-150 in breast cancer and leukemic cells repressed endogenous c-Myb at both messenger RNA (mRNA) and protein levels. Among several leukemia cell lines, primary leukemia cells, and normal lymphocytes, expression levels of miR-150 inversely correlated with c-Myb. The miR-150 overexpression or c-Myb silencing in zebrafish zygotes led to similar and serious phenotypic defects in zebrafish, and the phenotypic aberrations induced by miR-150 could be reversed by coinjection of c-Myb mRNA. Our findings suggest that c-Myb is an evolutionally conserved target of miR-150 and miR-150/c-Myb interaction is important for embryonic development and possibly oncogenesis.

- Experimental hematology, 2008

OBJECTIVE: Mice harboring c-Myb hypomorphic mutations display enhanced thrombopoiesis because of increased numbers of megakaryocytes and their progenitors. Thrombopoietin induces these same effects, which lead us to hypothesize that the hormone acts through modulation of c-Myb expression, as c-Myb levels falls during thrombopoietin-induced megakaryocyte (MK) maturation. Micro RNAs (miRs) downregulate gene expression by binding to the 3' untranslated region (UTR) of specific messenger RNAs (mRNAs); we noted that the 3'UTR of c-Myb contains four miR-150 binding sites. MATERIALS AND METHODS: We used quantitative reverse transcriptase polymerase chain reaction, Western blotting, and reporter gene analyses to assess the response of c-Myb to thrombopoietin stimulation and to gain of and loss of miR-150 expression. RESULTS: We found that thrombopoietin reduced c-Myb mRNA and protein levels within 7 hours in megakaryocytes and UT7/thrombopoietin (TPO) cells. Using a reporter gene containing the c-Myb 3'UTR region, including its four miR150 binding sites, we found that expression of miR150 reduced luciferase expression to 50% of baseline at 24 hours and to 25% at 48 hours in UT7/TPO cells. Quantitative polymerase chain reaction and Western blotting also revealed that miR-150 reduced endogenous c-Myb mRNA and protein to 50% in UT7/TPO cells, and to 65% in mature megakaryocytes. Converse experiments utilizing anti-miR150 increased luciferase activity twofold over control anti-miR. Finally, TPO increased miR150 expression 1.8-fold within 24 hours and 3.4-fold within 48 hours. CONCLUSIONS: These findings establish that miR150 downmodulates c-Myb levels, and because TPO affects miR150 expression, our results indicate that, in addition to affecting MK progenitor cell growth, TPO downmodulates c-Myb expression through induction of miR-150.

- Molecular cell, 2010

MicroRNAs (miRNAs) are a class of noncoding RNAs that regulate target gene expression at the posttranscriptional level. Here, we report that secreted miRNAs can serve as signaling molecules mediating intercellular communication. In human blood cells and cultured THP-1 cells, miR-150 was selectively packaged into microvesicles (MVs) and actively secreted. THP-1-derived MVs can enter and deliver miR-150 into human HMEC-1 cells, and elevated exogenous miR-150 effectively reduced c-Myb expression and enhanced cell migration in HMEC-1 cells. In vivo studies confirmed that intravenous injection of THP-1 MVs significantly increased the level of miR-150 in mouse blood vessels. MVs isolated from the plasma of patients with atherosclerosis contained higher levels of miR-150, and they more effectively promoted HMEC-1 cell migration than MVs from healthy donors. These results demonstrate that cells can secrete miRNAs and deliver them into recipient cells where the exogenous miRNAs can regulate target gene expression and recipient cell function.

- The Journal of pathology, 2011

Chronic inflammatory bowel diseases (IBDs) are associated with differential expression of genes involved in inflammation and tissue remodelling. We surveyed the expression profile of apoptosis-related microRNAs by real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) in a dextran sulphate sodium (DSS) murine model of colitis. We found that miR-150 was strongly elevated, whereas c-Myb, a transcription factor and a target gene of miR-150, was significantly reduced in colon tissue after DSS treatment. Interestingly, elevation of miR-150 and down-regulation of c-Myb were also observed in human colon with active ulcerative colitis compared to the normal colon. Supporting the observation of DSS treatment inducing colonic cell apoptosis, Bcl-2, an anti-apoptotic protein known to be regulated by c-Myb, was reduced in colon tissue of DSS-treated mice. Furthermore, forced expression of pre-miR-150 in colonic epithelial HT29 cells strongly elevated miR-150 levels and decreased c-Myb and Bcl-2 levels, thus enhancing cell apoptosis induced by serum deprivation. Together, the present study presents the first evidence that miR-150 and its targeting of c-Myb may serve as a new mechanism underlying the colonic epithelial disruption in DSS-induced murine experimental colitis and in active human IBD.

- International journal of oncology, 2012

MicroRNAs (miRNAs) have been implicated in the maintenance of the cancer stem cell (CSC) phenotype via their ability to affect expression of genes and proteins that regulate cell proliferation and/or cell death. Thus, identification of CSC-related miRNAs would provide information for a better understanding of CSCs. Here, we compared the miRNA profiles of CD133+ and CD133- primary hepatocellular carcinoma (HCC) subpopulations and found upregulation of 5 miRNAs in CD133- subpopulations, including hsa-miR-150, which may be involved in maintenance of the CD133+ liver CSC phenotype. We also show that miR-150 interacts with the 3'UTR of c-Myb mRNA and overexpression of miR-150 downregulates c-Myb protein levels. Furthermore, overexpression of miR-150 lead to a significant reduction of CD133+ cells, accompanied by significant inhibition of cell growth and tumorsphere formation. In addition, overexpression of miR-150 induces cell cycle arrest and apoptosis in CD133+ cells. Consistent with the outcome of cell cycle arrest and cell apoptosis, Western blotting results demonstrate that the cell cycle regulator cyclin D1 and cell survival regulator Bcl-2 are decreased in cells transfected with miR-150. Collectively, our findings demonstrate for the first time that miR-150 may be involved in liver CSC self-renewal, potentially via modulation of the downstream target c-Myb.

- Cancer science, 2013

Burkitt lymphoma (BL) is a highly aggressive B-cell lymphoma that includes two forms of BL differing in Epstein-Barr virus (EBV) infection status, EBV-positive and EBV-negative. Although many efforts, such as high-intensity, short-duration combination chemotherapy, have been devoted to improving therapy for this rapidly proliferating neoplasm, there are still significant treatment-associated toxicities. Therefore, there remains a need for novel effective therapeutic strategies. MicroRNAs play a role in "fine tuning" the physiological and pathological differentiation process, by which cells can rapidly regulate dynamic events such as cell-lineage decisions and morphogenesis. This unique miRNA feature shifts the traditional one drug target paradigm to a novel one drug multiple targets paradigm. Here, we found that BL cell lines showed an extremely low expression of microRNA-150 (miR-150), and then restored miR-150 expression at physiologic levels in BL cell lines Daudi, Raji, BJAB, and Ramos. The results showed that re-expression of miR-150 reduced proliferation of Daudi and Raji cells. Furthermore, Daudi and Raji, both of which are of EBV-positive germinal center B-cell origin, transduced with miR-150 can be rescued to differentiate toward B-cell terminal stage. However, no significant changes were observed in BJAB or Ramos cells, which are of EBV-negative germinal center B-cell origin. Of note, re-expression of miR-150 also resulted in decreasing c-Myb protein levels. Additionally, c-Myb knockdown in Daudi and Raji cell lines recapitulated the partial characteristics similar to that caused by re-expression of miR-150. Taken together, our findings show that miR-150 can induce EBV-positive BL differentiation by targeting c-Myb.

- Molecular cancer research : MCR, 2013

UNLABELLED: The microRNA miR-150, a critical regulator of hematopoiesis, is downregulated in mixed-lineage leukemia (MLL). In this study, miR-150 acts as a potent leukemic tumor suppressor by blocking the oncogenic properties of leukemic cells. By using MLL-AF9-transformed cells, we demonstrate that ectopic expression of miR-150 inhibits blast colony formation, cell growth, and increases apoptosis in vitro. More importantly, ectopic expression of miR-150 in MLL-AF9-transformed cells completely blocked the development of myeloid leukemia in transplanted mice. Furthermore, gene expression profiling revealed that miR-150 altered the expression levels of more than 30 "stem cell signature" genes and many others that are involved in critical cancer pathways. In addition to the known miR-150 target Myb, we also identified Cbl and Egr2 as bona fide targets and shRNA-mediated suppression of these genes recapitulated the pro-apoptotic effects observed in leukemic cells with miR-150 ectopic expression. In conclusion, we demonstrate that miR-150 is a potent leukemic tumor suppressor that regulates multiple oncogenes. IMPLICATIONS: These data establish new, key players for the development of therapeutic strategies to treat MLL-AF9-related leukemia.

- PloS one, 2013

In acute myeloid leukemia (AML) and blast crisis (BC) chronic myeloid leukemia (CML) normal differentiation is impaired. Differentiation of immature stem/progenitor cells is critical for normal blood cell function. MicroRNAs (miRNAs or miRs) are small non-coding RNAs that interfere with gene expression by degrading messenger RNAs (mRNAs) or blocking protein translation. Aberrant miRNA expression is a feature of leukemia and miRNAs also play a significant role in normal hematopoiesis and differentiation. We have identified miRNAs differentially expressed in AML and BC CML and identified a new role for miR-150 in myeloid differentiation. Expression of miR-150 is low or absent in BC CML and AML patient samples and cell lines. We have found that expression of miR-150 in AML cell lines, CD34+ progenitor cells from healthy individuals, and primary BC CML and AML patient samples at levels similar to miR-150 expression in normal bone marrow promotes myeloid differentiation of these cells. MYB is a direct target of miR-150, and we have identified that the observed phenotype is partially mediated by MYB. In AML cell lines, differentiation of miR-150 expressing cells occurs independently of retinoic acid receptor alpha (RARA) signaling. High-throughput gene expression profiling (GEP) studies of the AML cell lines HL60, PL21, and THP-1 suggest that activation of CEPBA, CEBPE, and cytokines associated with myeloid differentiation in miR-150 expressing cells as compared to control cells contributes to myeloid differentiation. These data suggest that miR-150 promotes myeloid differentiation, a previously uncharacterized role for this miRNA, and that absent or low miR-150 expression contributes to blocked myeloid differentiation in acute leukemia cells.

- Thrombosis research, 2014

INTRODUCTION: Deep venous thrombosis (DVT) is one of the common peripheral vascular diseases. The recruitment and migration of bone marrow-derived endothelial progenitor cells (EPCs) to the sites of venous thrombus are necessary in the process of thrombus organization and recanalization. Our objective was to investigate the functional role of miR-150 in rat EPCs and its potential application in deep venous thrombosis. MATERIALS AND METHODS: Rat EPCs were cultured and transfected with miR-150 mimics and inhibitor. Wound healing assay, transwell migration assay and matrigel tube formation assay were performed to elucidate the effect of miR-150 of rat EPCs. Lentiviral construct expressing miR-150 was transfected into EPCs and the EPCs were injected to rat models of DVT. The rats were sacrificed on the day of 7 and 14 after the transplantation and the histological study was performed. Luciferase reporter assay and Western blot were performed to evaluate rat miR-150 regulates the expression of c-Myb. RESULTS: MiR-150 significantly promoted the migration and tube formation ability of EPCs in vitro and enhanced EPCs' homing, organization and resolution ability in vivo. Overexpression of miR-150 significantly reduced the protein level of c-Myb and repressed the activity of a luciferase reporter containing both of the two predicted miR-150 binding sites in c-Myb 3'-UTR, indicating that c-Myb may be a miR-150 target gene. CONCLUSION: MiR-150 enhanced the migration, tube formation, homing, thrombus recanalization and resolution ability of rat EPCs. Restoring miR-150 in EPCs revealed potential application in DVT therapy.

- Experimental and molecular pathology, 2014

BACKGROUND: Burkitt lymphoma (BL) is a highly aggressive B-cell lymphoma with rapid proliferation. It has become evident that miRNAs are involved in hematopoietic malignancies. This study was undertaken to investigate the miRNA expression patterns of pediatric intestinal BL tissues. METHODS: We collected 28 BL and 8 reactive lymphoid hyperplasia (RLH) samples. miRNA expression profiling was performed in BL and RLH tissues to identify BL-related miRNAs, which were further analyzed by qRT-PCR and miRNA-ISH. In addition, immunohistochemistry (IHC) and western blot were used to define the protein targets of the BL-related miRNAs. Furthermore, we evaluated cell growth status by using methylthiazolyldiphenyl-tetrazolium bromide (MTT) assay in Raji cell line, which was transected with the BL-related miRNA mimics or inhibitors. RESULTS: miRNA expression profiling showed that miR-150 had extremely decreased expression levels in BL patients. In both ISH and qRT-PCR analyses, BL had reduced levels of miR-150 expression compared with RLH. However, there is no significant correlation of miR-150 expression and EBV status in BL. Moreover, IHC and western blotting defined that c-Myb and Survivin are the protein targets of miR-150. Re-expression of miR-150 reduced the proliferation of Raji cells. CONCLUSIONS: Deregulation of miR-150 may be useful as a diagnostic tool in BL, based on miRNA profile screening, qRT-PCR and miRNA-ISH. miR-150 plays an important role in BL by targeting c-Myb and Survivin. Re-expression of miR-150 reduced the proliferation of Raji cells, which suggests it to be a promising novel candidate for tumor treatment.