pre-miRNA Information
pre-miRNA hsa-mir-150   
Genomic Coordinates chr19: 49500785 - 49500868
Description Homo sapiens miR-150 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-150-5p
Sequence 16| UCUCCCAACCCUUGUACCAGUG |37
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs955899705 11 dbSNP
rs1303487637 14 dbSNP
rs1407035158 15 dbSNP
rs1405626581 17 dbSNP
rs1339016814 21 dbSNP
rs1368638183 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B3QK6E miR-150 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Decrease Heart tissue MiRNA microarray
B3QK6E miR-150 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Peripheral blood mononuclear cell Quantitative reverse transcription PCR
BKR8B7 miR-150-5p Safety Biomarker (SAF) Clinical/Experimental Data Expression . Plasma Microarray
Gene Information
Gene Symbol MYB   
Synonyms Cmyb, c-myb, c-myb_CDS, efg
Description MYB proto-oncogene, transcription factor
Transcript NM_001130172   
Other Transcripts NM_001130173 , NM_001161656 , NM_001161657 , NM_001161658 , NM_001161659 , NM_001161660 , NM_005375   
Expression
Putative miRNA Targets on MYB
3'UTR of MYB
(miRNA target sites are highlighted)
>MYB|NM_001130172|3'UTR
   1 GACATTTCCAGAAAAGCATTATGGTTTTCAGAACACTTCAAGTTGACTTGGGATATATCATTCCTCAACATGAAACTTTT
  81 CATGAATGGGAGAAGAACCTATTTTTGTTGTGGTACAACAGTTGAGAGCAGCACCAAGTGCATTTAGTTGAATGAAGTCT
 161 TCTTGGATTTCACCCAACTAAAAGGATTTTTAAAAATAAATAACAGTCTTACCTAAATTATTAGGTAATGAATTGTAGCC
 241 AGTTGTTAATATCTTAATGCAGATTTTTTTAAAAAAAACATAAAATGATTTATCTGTATTTTAAAGGATCCAACAGATCA
 321 GTATTTTTTCCTGTGATGGGTTTTTTGAAATTTGACACATTAAAAGGTACTCCAGTATTTCACTTTTCTCGATCACTAAA
 401 CATATGCATATATTTTTAAAAATCAGTAAAAGCATTACTCTAAGTGTAGACTTAATACCATGTGACATTTAATCCAGATT
 481 GTAAATGCTCATTTATGGTTAATGACATTGAAGGTACATTTATTGTACCAAACCATTTTATGAGTTTTCTGTTAGCTTGC
 561 TTTAAAAATTATTACTGTAAGAAATAGTTTTATAAAAAATTATATTTTTATTCAGTAATTTAATTTTGTAAATGCCAAAT
 641 GAAAAACGTTTTTTGCTGCTATGGTCTTAGCCTGTAGACATGCTGCTAGTATCAGAGGGGCAGTAGAGCTTGGACAGAAA
 721 GAAAAGAAACTTGGTGTTAGGTAATTGACTATGCACTAGTATTTCAGACTTTTTAATTTTATATATATATACATTTTTTT
 801 TCCTTCTGCAATACATTTGAAAACTTGTTTGGGAGACTCTGCATTTTTTATTGTGGTTTTTTTGTTATTGTTGGTTTATA
 881 CAAGCATGCGTTGCACTTCTTTTTTGGGAGATGTGTGTTGTTGATGTTCTATGTTTTGTTTTGAGTGTAGCCTGACTGTT
 961 TTATAATTTGGGAGTTCTGCATTTGATCCGCATCCCCTGTGGTTTCTAAGTGTATGGTCTCAGAACTGTTGCATGGATCC
1041 TGTGTTTGCAACTGGGGAGACAGAAACTGTGGTTGATAGCCAGTCACTGCCTTAAGAACATTTGATGCAAGATGGCCAGC
1121 ACTGAACTTTTGAGATATGACGGTGTACTTACTGCCTTGTAGCAAAATAAAGATGTGCCCTTATTTTACCTACAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' guGAC--CAUGUUCCCAACCCUCu 5'
            |||   ||:||   ||||||| 
Target 5' gaCTGTTTTATAA--TTTGGGAGt 3'
954 - 975 150.00 -13.90
2
miRNA  3' gugACCAUGUUCCCAACCCUCu 5'
             ||||||||  |||| ||| 
Target 5' ttgTGGTACAACAGTTGAGAGc 3'
108 - 129 147.00 -17.10
3
miRNA  3' gugaccauguucCCAACCCUCu 5'
                      | ||||||| 
Target 5' atttgaaaacttGTTTGGGAGa 3'
815 - 836 142.00 -11.51
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN14197211 3 COSMIC
COSN30455529 51 COSMIC
COSN30116111 59 COSMIC
COSN30155858 67 COSMIC
COSN31525023 82 COSMIC
COSN30149252 96 COSMIC
COSN31530083 106 COSMIC
COSN31597759 167 COSMIC
COSN26818630 271 COSMIC
COSN21961385 272 COSMIC
COSN20103388 279 COSMIC
COSN16131885 370 COSMIC
COSN26669616 392 COSMIC
COSN31541822 665 COSMIC
COSN7690475 727 COSMIC
COSN26506750 868 COSMIC
COSN26601736 890 COSMIC
COSN26676977 916 COSMIC
COSN31662526 950 COSMIC
COSN31662077 986 COSMIC
COSN19190598 1070 COSMIC
COSN26647396 1080 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1457644081 2 dbSNP
rs761806864 4 dbSNP
rs1387237273 12 dbSNP
rs1399422192 16 dbSNP
rs747809460 19 dbSNP
rs765136014 20 dbSNP
rs761848825 22 dbSNP
rs1042371 37 dbSNP
rs202144270 42 dbSNP
rs371994822 45 dbSNP
rs1404287153 48 dbSNP
rs751266789 48 dbSNP
rs1480356922 51 dbSNP
rs1466705848 52 dbSNP
rs754377040 53 dbSNP
rs142843096 61 dbSNP
rs1049788717 62 dbSNP
rs909854589 67 dbSNP
rs1421014027 71 dbSNP
rs1382089296 85 dbSNP
rs941953392 96 dbSNP
rs1443944466 99 dbSNP
rs1412444215 107 dbSNP
rs980357860 125 dbSNP
rs1201996884 137 dbSNP
rs552220856 138 dbSNP
rs1483355172 139 dbSNP
rs927535213 140 dbSNP
rs1348121000 141 dbSNP
rs938908809 144 dbSNP
rs1355317005 149 dbSNP
rs1309360702 153 dbSNP
rs1245815528 158 dbSNP
rs1057212671 161 dbSNP
rs751717701 162 dbSNP
rs1397020970 164 dbSNP
rs1199574922 174 dbSNP
rs897721533 176 dbSNP
rs1421757017 177 dbSNP
rs1361181615 183 dbSNP
rs1163032110 186 dbSNP
rs759673901 197 dbSNP
rs370151079 198 dbSNP
rs1383351327 201 dbSNP
rs1439043737 203 dbSNP
rs1057334807 212 dbSNP
rs895601393 216 dbSNP
rs1424238866 219 dbSNP
rs1260607905 222 dbSNP
rs1184521611 226 dbSNP
rs1013079189 227 dbSNP
rs1489076141 231 dbSNP
rs1286051824 232 dbSNP
rs1221136961 233 dbSNP
rs945800550 238 dbSNP
rs1267812620 250 dbSNP
rs1245978922 251 dbSNP
rs112250530 263 dbSNP
rs1402026833 264 dbSNP
rs200493203 264 dbSNP
rs1341395891 269 dbSNP
rs1302596024 270 dbSNP
rs536173968 270 dbSNP
rs1458354581 271 dbSNP
rs3216774 271 dbSNP
rs74299305 271 dbSNP
rs869233628 271 dbSNP
rs55938804 272 dbSNP
rs201841211 275 dbSNP
rs1031884623 276 dbSNP
rs397807155 279 dbSNP
rs544771312 279 dbSNP
rs56040798 280 dbSNP
rs113427245 282 dbSNP
rs1400075188 285 dbSNP
rs1249935768 292 dbSNP
rs536544816 295 dbSNP
rs1220889492 310 dbSNP
rs1318844547 318 dbSNP
rs1282948470 321 dbSNP
rs1403179441 322 dbSNP
rs976979845 323 dbSNP
rs1329691068 324 dbSNP
rs922756590 325 dbSNP
rs1395728910 326 dbSNP
rs954177763 332 dbSNP
rs147011819 341 dbSNP
rs1305336373 343 dbSNP
rs909939541 355 dbSNP
rs1476844176 360 dbSNP
rs941359120 368 dbSNP
rs960584925 374 dbSNP
rs972689695 385 dbSNP
rs1249098362 391 dbSNP
rs186588575 392 dbSNP
rs112293547 403 dbSNP
rs1458547552 407 dbSNP
rs538759439 411 dbSNP
rs929201056 412 dbSNP
rs912915967 413 dbSNP
rs1057004804 429 dbSNP
rs945686194 432 dbSNP
rs895622879 442 dbSNP
rs1457691963 460 dbSNP
rs1335077869 481 dbSNP
rs1448908637 483 dbSNP
rs1400681039 485 dbSNP
rs1335865258 491 dbSNP
rs1412359780 500 dbSNP
rs948528579 506 dbSNP
rs779724172 507 dbSNP
rs558712123 508 dbSNP
rs1403955946 510 dbSNP
rs1255239390 514 dbSNP
rs575282702 515 dbSNP
rs1180983669 518 dbSNP
rs942392789 533 dbSNP
rs1242870012 541 dbSNP
rs1039956672 542 dbSNP
rs1376119110 566 dbSNP
rs1476552069 574 dbSNP
rs543911268 579 dbSNP
rs1348543480 580 dbSNP
rs554544217 581 dbSNP
rs1311568881 589 dbSNP
rs1168541733 594 dbSNP
rs1377592427 595 dbSNP
rs900982185 603 dbSNP
rs756417588 609 dbSNP
rs746661993 611 dbSNP
rs1423072822 614 dbSNP
rs1341880318 626 dbSNP
rs1046963813 629 dbSNP
rs1463959766 648 dbSNP
rs1358010410 649 dbSNP
rs1159957209 661 dbSNP
rs1327885452 674 dbSNP
rs886478060 680 dbSNP
rs575032658 681 dbSNP
rs1394868821 686 dbSNP
rs79468771 688 dbSNP
rs1004839271 689 dbSNP
rs963440512 690 dbSNP
rs1192667372 696 dbSNP
rs1321418627 699 dbSNP
rs1001601280 700 dbSNP
rs1327795569 705 dbSNP
rs1288203438 721 dbSNP
rs1217488038 755 dbSNP
rs778139617 762 dbSNP
rs374620401 765 dbSNP
rs1034951802 773 dbSNP
rs1276964126 778 dbSNP
rs960219997 780 dbSNP
rs1226396978 782 dbSNP
rs999823879 784 dbSNP
rs1315562816 788 dbSNP
rs1217267997 789 dbSNP
rs138229891 790 dbSNP
rs560328112 792 dbSNP
rs1489127218 793 dbSNP
rs1299466210 794 dbSNP
rs993518495 794 dbSNP
rs913482399 809 dbSNP
rs1365497917 816 dbSNP
rs532542952 819 dbSNP
rs1209613421 820 dbSNP
rs1163204604 832 dbSNP
rs397718007 837 dbSNP
rs56268608 837 dbSNP
rs978431208 838 dbSNP
rs892084018 840 dbSNP
rs998824935 841 dbSNP
rs1476945469 846 dbSNP
rs377628025 850 dbSNP
rs550590800 853 dbSNP
rs1194462207 857 dbSNP
rs954367288 857 dbSNP
rs985622997 858 dbSNP
rs1219213110 868 dbSNP
rs1262519912 868 dbSNP
rs1290282206 873 dbSNP
rs1017033185 875 dbSNP
rs562879021 876 dbSNP
rs922457189 882 dbSNP
rs933834145 887 dbSNP
rs972763290 890 dbSNP
rs1161217533 896 dbSNP
rs1386895030 902 dbSNP
rs1351014737 905 dbSNP
rs1328576554 918 dbSNP
rs887031151 921 dbSNP
rs1426044533 924 dbSNP
rs1005392961 930 dbSNP
rs1037682559 934 dbSNP
rs1480241019 936 dbSNP
rs918590226 939 dbSNP
rs1193026146 951 dbSNP
rs1489406493 952 dbSNP
rs531826017 956 dbSNP
rs1416076570 959 dbSNP
rs1293448895 964 dbSNP
rs1002053524 973 dbSNP
rs1259763490 976 dbSNP
rs1218805534 990 dbSNP
rs190986138 991 dbSNP
rs757843333 998 dbSNP
rs1275642853 999 dbSNP
rs1220501496 1000 dbSNP
rs1368899428 1007 dbSNP
rs1279556251 1010 dbSNP
rs1445220601 1013 dbSNP
rs917146702 1015 dbSNP
rs1332492231 1020 dbSNP
rs948580635 1027 dbSNP
rs1178303207 1033 dbSNP
rs1433907254 1034 dbSNP
rs367902794 1041 dbSNP
rs1014425740 1042 dbSNP
rs1217540178 1052 dbSNP
rs1482814869 1067 dbSNP
rs1199080191 1069 dbSNP
rs1262722466 1074 dbSNP
rs1253938080 1084 dbSNP
rs1211613118 1087 dbSNP
rs778285146 1090 dbSNP
rs1284703284 1095 dbSNP
rs967635543 1096 dbSNP
rs1379805401 1101 dbSNP
rs112386587 1105 dbSNP
rs111741587 1130 dbSNP
rs891448132 1133 dbSNP
rs997831376 1138 dbSNP
rs753169543 1139 dbSNP
rs975603296 1142 dbSNP
rs546882985 1143 dbSNP
rs1344630326 1176 dbSNP
rs1156960578 1177 dbSNP
rs1417749852 1185 dbSNP
rs1365258788 1191 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Xiao C; Calado DP; Galler G; Thai TH; et al.
- Cell, 2007
MiR-150 is a microRNA (miRNA) specifically expressed in mature lymphocytes, but not their progenitors. A top predicted target of miR-150 is c-Myb, a transcription factor controlling multiple steps of lymphocyte development. Combining loss- and gain-of-function gene targeting approaches for miR-150 with conditional and partial ablation of c-Myb, we show that miR-150 indeed controls c-Myb expression in vivo in a dose-dependent manner over a narrow range of miRNA and c-Myb concentrations and that this dramatically affects lymphocyte development and response. Our results identify a key transcription factor as a critical target of a stage-specifically expressed miRNA in lymphocytes and suggest that this and perhaps other miRNAs have evolved to control the expression of just a few critical target proteins in particular cellular contexts.
LinkOut: [PMID: 17923094]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions 293T , K562
Location of target site 3'UTR
Original Description (Extracted from the article) ... "To establish miR-150 as a functional negative regulator of MYB ...

- Lu J; Guo S; Ebert BL; Zhang H; Peng X; et al., 2008, Developmental cell.

Article - Lu J; Guo S; Ebert BL; Zhang H; Peng X; et al.
- Developmental cell, 2008
Lineage specification is a critical issue in developmental and regenerative biology. We hypothesized that microRNAs (miRNAs) are important participants in those processes and used the poorly understood regulation of megakaryocyte-erythrocyte progenitors (MEPs) in hematopoiesis as a model system. We report here that miR-150 modulates lineage fate in MEPs. Using a novel methodology capable of profiling miRNA expression in small numbers of primary cells, we identify miR-150 as preferentially expressed in the megakaryocytic lineage. Through gain- and loss-of-function experiments, we demonstrate that miR-150 drives MEP differentiation toward megakaryocytes at the expense of erythroid cells in vitro and in vivo. Moreover, we identify the transcription factor MYB as a critical target of miR-150 in this regulation. These experiments show that miR-150 regulates MEP fate, and thus establish a role for miRNAs in lineage specification of mammalian multipotent cells.
LinkOut: [PMID: 18539114]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions K562 , MCF-7 , Jurkat , CCRF-CEM , HEK293
Disease 4602.0;
Location of target site 3'UTR
Tools used in this research miRanda , PicTar , miRBase Target Database
Original Description (Extracted from the article) ... "In this study ...

- Lin YC; Kuo MW; Yu J; Kuo HH; Lin RJ; Lo WL; Yu AL, 2008, Molecular biology and evolution.

Article - Lin YC; Kuo MW; Yu J; Kuo HH; Lin RJ; Lo WL; Yu AL
- Molecular biology and evolution, 2008
Human c-Myb proto-oncogene is highly expressed in hematopoietic progenitors as well as leukemia and certain solid tumor. However, the regulatory mechanisms of its expression and biological functions remain largely unclear. Recently, c-Myb has been shown to be targeted by microRNA-150 (miR-150) which thereby controls B cell differentiation in mice. In this study, we demonstrated that c-Myb is an evolutionary conserved target of miR-150 in human and zebrafish, using reporter assays. Ectopic expression of miR-150 in breast cancer and leukemic cells repressed endogenous c-Myb at both messenger RNA (mRNA) and protein levels. Among several leukemia cell lines, primary leukemia cells, and normal lymphocytes, expression levels of miR-150 inversely correlated with c-Myb. The miR-150 overexpression or c-Myb silencing in zebrafish zygotes led to similar and serious phenotypic defects in zebrafish, and the phenotypic aberrations induced by miR-150 could be reversed by coinjection of c-Myb mRNA. Our findings suggest that c-Myb is an evolutionally conserved target of miR-150 and miR-150/c-Myb interaction is important for embryonic development and possibly oncogenesis.
LinkOut: [PMID: 18667440]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions UT7/TPO
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... "miR150 affects a c-Myb 3'-UTR reporter gene.//Using a reporter gene containing the c-Myb 3'UTR region ...

- Barroga CF; Pham H; Kaushansky K, 2008, Experimental hematology.

Article - Barroga CF; Pham H; Kaushansky K
- Experimental hematology, 2008
OBJECTIVE: Mice harboring c-Myb hypomorphic mutations display enhanced thrombopoiesis because of increased numbers of megakaryocytes and their progenitors. Thrombopoietin induces these same effects, which lead us to hypothesize that the hormone acts through modulation of c-Myb expression, as c-Myb levels falls during thrombopoietin-induced megakaryocyte (MK) maturation. Micro RNAs (miRs) downregulate gene expression by binding to the 3' untranslated region (UTR) of specific messenger RNAs (mRNAs); we noted that the 3'UTR of c-Myb contains four miR-150 binding sites. MATERIALS AND METHODS: We used quantitative reverse transcriptase polymerase chain reaction, Western blotting, and reporter gene analyses to assess the response of c-Myb to thrombopoietin stimulation and to gain of and loss of miR-150 expression. RESULTS: We found that thrombopoietin reduced c-Myb mRNA and protein levels within 7 hours in megakaryocytes and UT7/thrombopoietin (TPO) cells. Using a reporter gene containing the c-Myb 3'UTR region, including its four miR150 binding sites, we found that expression of miR150 reduced luciferase expression to 50% of baseline at 24 hours and to 25% at 48 hours in UT7/TPO cells. Quantitative polymerase chain reaction and Western blotting also revealed that miR-150 reduced endogenous c-Myb mRNA and protein to 50% in UT7/TPO cells, and to 65% in mature megakaryocytes. Converse experiments utilizing anti-miR150 increased luciferase activity twofold over control anti-miR. Finally, TPO increased miR150 expression 1.8-fold within 24 hours and 3.4-fold within 48 hours. CONCLUSIONS: These findings establish that miR150 downmodulates c-Myb levels, and because TPO affects miR150 expression, our results indicate that, in addition to affecting MK progenitor cell growth, TPO downmodulates c-Myb expression through induction of miR-150.
LinkOut: [PMID: 18814950]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HMEC-1 , THP-1
Location of target site 3'UTR
Original Description (Extracted from the article) ... Exogenous miR-150 Reduces c-Myb Protein Level in HMEC-1 Cells ...

- Zhang Y; Liu D; Chen X; Li J; Li L; Bian Z; et al., 2010, Molecular cell.

Article - Zhang Y; Liu D; Chen X; Li J; Li L; Bian Z; et al.
- Molecular cell, 2010
MicroRNAs (miRNAs) are a class of noncoding RNAs that regulate target gene expression at the posttranscriptional level. Here, we report that secreted miRNAs can serve as signaling molecules mediating intercellular communication. In human blood cells and cultured THP-1 cells, miR-150 was selectively packaged into microvesicles (MVs) and actively secreted. THP-1-derived MVs can enter and deliver miR-150 into human HMEC-1 cells, and elevated exogenous miR-150 effectively reduced c-Myb expression and enhanced cell migration in HMEC-1 cells. In vivo studies confirmed that intravenous injection of THP-1 MVs significantly increased the level of miR-150 in mouse blood vessels. MVs isolated from the plasma of patients with atherosclerosis contained higher levels of miR-150, and they more effectively promoted HMEC-1 cell migration than MVs from healthy donors. These results demonstrate that cells can secrete miRNAs and deliver them into recipient cells where the exogenous miRNAs can regulate target gene expression and recipient cell function.
LinkOut: [PMID: 20603081]
Experimental Support 6 for Non-Functional miRNA-Target Interaction
miRNA:Target xx
Validation Method
Conditions HT-29
Tools used in this research none
Original Description (Extracted from the article) ... "miR-150 was strongly elevated ...

- Bian Z; Li L; Cui J; Zhang H; Liu Y; Zhang et al., 2011, The Journal of pathology.

Article - Bian Z; Li L; Cui J; Zhang H; Liu Y; Zhang et al.
- The Journal of pathology, 2011
Chronic inflammatory bowel diseases (IBDs) are associated with differential expression of genes involved in inflammation and tissue remodelling. We surveyed the expression profile of apoptosis-related microRNAs by real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) in a dextran sulphate sodium (DSS) murine model of colitis. We found that miR-150 was strongly elevated, whereas c-Myb, a transcription factor and a target gene of miR-150, was significantly reduced in colon tissue after DSS treatment. Interestingly, elevation of miR-150 and down-regulation of c-Myb were also observed in human colon with active ulcerative colitis compared to the normal colon. Supporting the observation of DSS treatment inducing colonic cell apoptosis, Bcl-2, an anti-apoptotic protein known to be regulated by c-Myb, was reduced in colon tissue of DSS-treated mice. Furthermore, forced expression of pre-miR-150 in colonic epithelial HT29 cells strongly elevated miR-150 levels and decreased c-Myb and Bcl-2 levels, thus enhancing cell apoptosis induced by serum deprivation. Together, the present study presents the first evidence that miR-150 and its targeting of c-Myb may serve as a new mechanism underlying the colonic epithelial disruption in DSS-induced murine experimental colitis and in active human IBD.
LinkOut: [PMID: 21590770]
Experimental Support 7 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions SMMC-7721 , Huh-7 , Hep3B
Disease CD133-positive liver cancer
Location of target site 3'UTR
Tools used in this research TargetScan , PicTar
Original Description (Extracted from the article) ... Overexpression of miR-150 leads to cell cycle arrest and promotes apoptosis in CD133 + cells. ...

- Zhang J; Luo N; Luo Y; Peng Z; Zhang T; Li S, 2012, International journal of oncology.

Article - Zhang J; Luo N; Luo Y; Peng Z; Zhang T; Li S
- International journal of oncology, 2012
MicroRNAs (miRNAs) have been implicated in the maintenance of the cancer stem cell (CSC) phenotype via their ability to affect expression of genes and proteins that regulate cell proliferation and/or cell death. Thus, identification of CSC-related miRNAs would provide information for a better understanding of CSCs. Here, we compared the miRNA profiles of CD133+ and CD133- primary hepatocellular carcinoma (HCC) subpopulations and found upregulation of 5 miRNAs in CD133- subpopulations, including hsa-miR-150, which may be involved in maintenance of the CD133+ liver CSC phenotype. We also show that miR-150 interacts with the 3'UTR of c-Myb mRNA and overexpression of miR-150 downregulates c-Myb protein levels. Furthermore, overexpression of miR-150 lead to a significant reduction of CD133+ cells, accompanied by significant inhibition of cell growth and tumorsphere formation. In addition, overexpression of miR-150 induces cell cycle arrest and apoptosis in CD133+ cells. Consistent with the outcome of cell cycle arrest and cell apoptosis, Western blotting results demonstrate that the cell cycle regulator cyclin D1 and cell survival regulator Bcl-2 are decreased in cells transfected with miR-150. Collectively, our findings demonstrate for the first time that miR-150 may be involved in liver CSC self-renewal, potentially via modulation of the downstream target c-Myb.
LinkOut: [PMID: 22025269]
Experimental Support 8 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BL
Location of target site 3'UTR
Tools used in this research previous_study
Original Description (Extracted from the article) ... C-Myb is a potential target of miR-150 in EBV-positive BL. ...

- Chen S; Wang Z; Dai X; Pan J; Ge J; Han X; et al., 2013, Cancer science.

Article - Chen S; Wang Z; Dai X; Pan J; Ge J; Han X; et al.
- Cancer science, 2013
Burkitt lymphoma (BL) is a highly aggressive B-cell lymphoma that includes two forms of BL differing in Epstein-Barr virus (EBV) infection status, EBV-positive and EBV-negative. Although many efforts, such as high-intensity, short-duration combination chemotherapy, have been devoted to improving therapy for this rapidly proliferating neoplasm, there are still significant treatment-associated toxicities. Therefore, there remains a need for novel effective therapeutic strategies. MicroRNAs play a role in "fine tuning" the physiological and pathological differentiation process, by which cells can rapidly regulate dynamic events such as cell-lineage decisions and morphogenesis. This unique miRNA feature shifts the traditional one drug target paradigm to a novel one drug multiple targets paradigm. Here, we found that BL cell lines showed an extremely low expression of microRNA-150 (miR-150), and then restored miR-150 expression at physiologic levels in BL cell lines Daudi, Raji, BJAB, and Ramos. The results showed that re-expression of miR-150 reduced proliferation of Daudi and Raji cells. Furthermore, Daudi and Raji, both of which are of EBV-positive germinal center B-cell origin, transduced with miR-150 can be rescued to differentiate toward B-cell terminal stage. However, no significant changes were observed in BJAB or Ramos cells, which are of EBV-negative germinal center B-cell origin. Of note, re-expression of miR-150 also resulted in decreasing c-Myb protein levels. Additionally, c-Myb knockdown in Daudi and Raji cell lines recapitulated the partial characteristics similar to that caused by re-expression of miR-150. Taken together, our findings show that miR-150 can induce EBV-positive BL differentiation by targeting c-Myb.
LinkOut: [PMID: 23521217]
Experimental Support 9 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions CD45
Disease mix-lineaged leukemia
Location of target site 3'UTR
Tools used in this research PicTar , TargetScan
Original Description (Extracted from the article) ... These results suggest a crucial suppressive role of miR-150 in MLL-AF9 leukemic cells and loss of its expression facilitates leukemic cell survival partially by altering cell identity and activating cancer pathways. ...

- Bousquet M; Zhuang G; Meng C; Ying W; et al., 2013, Molecular cancer research : MCR.

Article - Bousquet M; Zhuang G; Meng C; Ying W; et al.
- Molecular cancer research : MCR, 2013
UNLABELLED: The microRNA miR-150, a critical regulator of hematopoiesis, is downregulated in mixed-lineage leukemia (MLL). In this study, miR-150 acts as a potent leukemic tumor suppressor by blocking the oncogenic properties of leukemic cells. By using MLL-AF9-transformed cells, we demonstrate that ectopic expression of miR-150 inhibits blast colony formation, cell growth, and increases apoptosis in vitro. More importantly, ectopic expression of miR-150 in MLL-AF9-transformed cells completely blocked the development of myeloid leukemia in transplanted mice. Furthermore, gene expression profiling revealed that miR-150 altered the expression levels of more than 30 "stem cell signature" genes and many others that are involved in critical cancer pathways. In addition to the known miR-150 target Myb, we also identified Cbl and Egr2 as bona fide targets and shRNA-mediated suppression of these genes recapitulated the pro-apoptotic effects observed in leukemic cells with miR-150 ectopic expression. In conclusion, we demonstrate that miR-150 is a potent leukemic tumor suppressor that regulates multiple oncogenes. IMPLICATIONS: These data establish new, key players for the development of therapeutic strategies to treat MLL-AF9-related leukemia.
LinkOut: [PMID: 23604034]
Experimental Support 10 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HL60 , PL21 , THP-1
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... We confirmed that miR-150 targets MYB in leukemia cell lines by using a 3芒鈧鈩 UTR luciferase reporter assay (Figure S6). ...

- Morris VA; Zhang A; Yang T; Stirewalt DL; et al., 2013, PloS one.

Article - Morris VA; Zhang A; Yang T; Stirewalt DL; et al.
- PloS one, 2013
In acute myeloid leukemia (AML) and blast crisis (BC) chronic myeloid leukemia (CML) normal differentiation is impaired. Differentiation of immature stem/progenitor cells is critical for normal blood cell function. MicroRNAs (miRNAs or miRs) are small non-coding RNAs that interfere with gene expression by degrading messenger RNAs (mRNAs) or blocking protein translation. Aberrant miRNA expression is a feature of leukemia and miRNAs also play a significant role in normal hematopoiesis and differentiation. We have identified miRNAs differentially expressed in AML and BC CML and identified a new role for miR-150 in myeloid differentiation. Expression of miR-150 is low or absent in BC CML and AML patient samples and cell lines. We have found that expression of miR-150 in AML cell lines, CD34+ progenitor cells from healthy individuals, and primary BC CML and AML patient samples at levels similar to miR-150 expression in normal bone marrow promotes myeloid differentiation of these cells. MYB is a direct target of miR-150, and we have identified that the observed phenotype is partially mediated by MYB. In AML cell lines, differentiation of miR-150 expressing cells occurs independently of retinoic acid receptor alpha (RARA) signaling. High-throughput gene expression profiling (GEP) studies of the AML cell lines HL60, PL21, and THP-1 suggest that activation of CEPBA, CEBPE, and cytokines associated with myeloid differentiation in miR-150 expressing cells as compared to control cells contributes to myeloid differentiation. These data suggest that miR-150 promotes myeloid differentiation, a previously uncharacterized role for this miRNA, and that absent or low miR-150 expression contributes to blocked myeloid differentiation in acute leukemia cells.
LinkOut: [PMID: 24086639]
Experimental Support 11 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK 293 T
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... MiR-150 Targeting 3芒鈧鈩UTR of c-Myb Gene. Luciferase reporter assay and Western blot were performed to evaluate rat miR-150 regulates the expression of c-Myb. ...

- Wang W; Li C; Li W; Kong L; Qian A; Hu N; et al., 2014, Thrombosis research.

Article - Wang W; Li C; Li W; Kong L; Qian A; Hu N; et al.
- Thrombosis research, 2014
INTRODUCTION: Deep venous thrombosis (DVT) is one of the common peripheral vascular diseases. The recruitment and migration of bone marrow-derived endothelial progenitor cells (EPCs) to the sites of venous thrombus are necessary in the process of thrombus organization and recanalization. Our objective was to investigate the functional role of miR-150 in rat EPCs and its potential application in deep venous thrombosis. MATERIALS AND METHODS: Rat EPCs were cultured and transfected with miR-150 mimics and inhibitor. Wound healing assay, transwell migration assay and matrigel tube formation assay were performed to elucidate the effect of miR-150 of rat EPCs. Lentiviral construct expressing miR-150 was transfected into EPCs and the EPCs were injected to rat models of DVT. The rats were sacrificed on the day of 7 and 14 after the transplantation and the histological study was performed. Luciferase reporter assay and Western blot were performed to evaluate rat miR-150 regulates the expression of c-Myb. RESULTS: MiR-150 significantly promoted the migration and tube formation ability of EPCs in vitro and enhanced EPCs' homing, organization and resolution ability in vivo. Overexpression of miR-150 significantly reduced the protein level of c-Myb and repressed the activity of a luciferase reporter containing both of the two predicted miR-150 binding sites in c-Myb 3'-UTR, indicating that c-Myb may be a miR-150 target gene. CONCLUSION: MiR-150 enhanced the migration, tube formation, homing, thrombus recanalization and resolution ability of rat EPCs. Restoring miR-150 in EPCs revealed potential application in DVT therapy.
LinkOut: [PMID: 24438945]
Experimental Support 12 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions unspecified
Disease burkitt lymphoma
Tools used in this research unspecified
Original Description (Extracted from the article) ... miRNA expression profiling showed that miR-150 had extremely decreased expression levels in Burkitt lymphoma patients//miR-150 plays an important role in BL by targeting c-Myb and survivin ...

- Wang M; Yang W; Li M; Li Y, 2014, Experimental and molecular pathology.

Article - Wang M; Yang W; Li M; Li Y
- Experimental and molecular pathology, 2014
BACKGROUND: Burkitt lymphoma (BL) is a highly aggressive B-cell lymphoma with rapid proliferation. It has become evident that miRNAs are involved in hematopoietic malignancies. This study was undertaken to investigate the miRNA expression patterns of pediatric intestinal BL tissues. METHODS: We collected 28 BL and 8 reactive lymphoid hyperplasia (RLH) samples. miRNA expression profiling was performed in BL and RLH tissues to identify BL-related miRNAs, which were further analyzed by qRT-PCR and miRNA-ISH. In addition, immunohistochemistry (IHC) and western blot were used to define the protein targets of the BL-related miRNAs. Furthermore, we evaluated cell growth status by using methylthiazolyldiphenyl-tetrazolium bromide (MTT) assay in Raji cell line, which was transected with the BL-related miRNA mimics or inhibitors. RESULTS: miRNA expression profiling showed that miR-150 had extremely decreased expression levels in BL patients. In both ISH and qRT-PCR analyses, BL had reduced levels of miR-150 expression compared with RLH. However, there is no significant correlation of miR-150 expression and EBV status in BL. Moreover, IHC and western blotting defined that c-Myb and Survivin are the protein targets of miR-150. Re-expression of miR-150 reduced the proliferation of Raji cells. CONCLUSIONS: Deregulation of miR-150 may be useful as a diagnostic tool in BL, based on miRNA profile screening, qRT-PCR and miRNA-ISH. miR-150 plays an important role in BL by targeting c-Myb and Survivin. Re-expression of miR-150 reduced the proliferation of Raji cells, which suggests it to be a promising novel candidate for tumor treatment.
LinkOut: [PMID: 24613688]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.587 3.3e-3 0.592 3.0e-3 20 Click to see details
GSE38226 Liver fibrosis 0.473 1.5e-2 0.353 5.8e-2 21 Click to see details
GSE19783 ER- ER- breast cancer -0.236 1.8e-2 -0.205 3.5e-2 79 Click to see details
GSE19536 Breast cancer -0.169 4.6e-2 -0.143 7.8e-2 100 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.31 6.6e-2 -0.257 1.1e-1 25 Click to see details
GSE17306 Multiple myeloma 0.215 6.9e-2 0.100 2.5e-1 49 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.278 8.9e-2 -0.301 7.2e-2 25 Click to see details
GSE19783 ER+ ER+ breast cancer -0.297 1.0e-1 -0.221 1.7e-1 20 Click to see details
GSE21032 Prostate cancer 0.14 1.0e-1 0.135 1.1e-1 83 Click to see details
GSE17498 Multiple myeloma 0.169 1.5e-1 0.257 5.5e-2 40 Click to see details
GSE42095 Differentiated embryonic stem cells -0.218 1.6e-1 -0.108 3.1e-1 23 Click to see details
GSE28544 Breast cancer 0.192 1.8e-1 0.261 1.1e-1 24 Click to see details
GSE19350 CNS germ cell tumors 0.281 1.9e-1 0.378 1.1e-1 12 Click to see details
GSE14794 Lymphoblastoid cells 0.081 2.2e-1 0.029 3.9e-1 90 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.245 2.6e-1 -0.333 1.9e-1 9 Click to see details
GSE28260 Renal cortex and medulla -0.126 3.4e-1 -0.177 2.8e-1 13 Click to see details
GSE32688 Pancreatic cancer 0.059 3.7e-1 0.016 4.7e-1 32 Click to see details
GSE26953 Aortic valvular endothelial cells 0.062 3.9e-1 0.024 4.6e-1 24 Click to see details
GSE21687 Ependynoma primary tumors -0.033 4.0e-1 0.012 4.6e-1 64 Click to see details
GSE27834 Pluripotent stem cells -0.014 4.8e-1 0.047 4.3e-1 16 Click to see details
GSE27834 Pluripotent stem cells -0.014 4.8e-1 0.047 4.3e-1 16 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRC 0.557 0 0.606 0 68 Click to see details
STAD 0.622 0 0.587 0 32 Click to see details
PRAD 0.492 0 0.427 0 50 Click to see details
LIHC 0.389 0 0.395 0 49 Click to see details
THCA 0.329 0.01 0.262 0.02 59 Click to see details
BRCA -0.243 0.01 -0.268 0.01 84 Click to see details
HNSC 0.265 0.04 0.274 0.04 42 Click to see details
KICH 0.341 0.05 0.435 0.01 25 Click to see details
ESCA -0.51 0.05 -0.436 0.09 11 Click to see details
UCEC 0.364 0.06 0.256 0.15 19 Click to see details
BLCA 0.341 0.08 0.362 0.07 18 Click to see details
KIRP 0.208 0.13 0.162 0.19 32 Click to see details
LUSC 0.169 0.16 0.193 0.12 38 Click to see details
CESC -0.882 0.16 -1.000 0.5 3 Click to see details
PAAD 0.621 0.19 0.800 0.1 4 Click to see details
COAD 0.276 0.25 0.238 0.29 8 Click to see details
CHOL -0.243 0.26 -0.150 0.35 9 Click to see details
LUAD -0.091 0.39 0.126 0.35 12 Click to see details
PCPG -0.193 0.44 0.500 0.33 3 Click to see details
PCPG -0.193 0.44 0.500 0.33 3 Click to see details
PCPG -0.193 0.44 0.500 0.33 3 Click to see details
503 hsa-miR-150-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000935 MYB MYB proto-oncogene, transcription factor 5 13
MIRT003222 EGR2 early growth response 2 5 2
MIRT004272 VEGFA vascular endothelial growth factor A 2 1
MIRT004357 P2RX7 purinergic receptor P2X 7 6 4
MIRT005739 IGF2 insulin like growth factor 2 1 1
MIRT006115 MUC4 mucin 4, cell surface associated 3 1
MIRT006604 Myb myeloblastosis oncogene 3 1
MIRT006668 CXCR4 C-X-C motif chemokine receptor 4 1 1
MIRT006984 ZEB1 zinc finger E-box binding homeobox 1 6 3
MIRT007016 NOTCH3 notch 3 1 1
MIRT007053 FLT3 fms related tyrosine kinase 3 1 1
MIRT007087 EP300 E1A binding protein p300 3 2
MIRT021208 cmyb v-myb avian myeloblastosis viral oncogene homolog 1 1
MIRT021209 PTPRR protein tyrosine phosphatase, receptor type R 1 1
MIRT021210 MS4A3 membrane spanning 4-domains A3 1 1
MIRT021211 CCNE1 cyclin E1 1 1
MIRT021212 AGA aspartylglucosaminidase 1 1
MIRT045387 ATP13A3 ATPase 13A3 1 1
MIRT052652 TP53 tumor protein p53 4 2
MIRT054633 BIRC5 baculoviral IAP repeat containing 5 3 1
MIRT054852 SRCIN1 SRC kinase signaling inhibitor 1 5 3
MIRT054868 CBL Cbl proto-oncogene 3 1
MIRT133589 ADIPOR2 adiponectin receptor 2 2 1
MIRT136366 ATP2B1 ATPase plasma membrane Ca2+ transporting 1 2 2
MIRT222062 PURB purine rich element binding protein B 2 6
MIRT222128 FOXK1 forkhead box K1 2 2
MIRT232510 MBD6 methyl-CpG binding domain protein 6 2 2
MIRT293382 ZBTB7A zinc finger and BTB domain containing 7A 2 2
MIRT388973 CNPPD1 cyclin Pas1/PHO80 domain containing 1 2 2
MIRT392627 HILPDA hypoxia inducible lipid droplet associated 2 2
MIRT437627 SYNPO2 synaptopodin 2 2 1
MIRT437628 PDIA6 protein disulfide isomerase family A member 6 2 1
MIRT437629 EREG epiregulin 4 3
MIRT437630 TOM1 target of myb1 membrane trafficking protein 2 1
MIRT437631 CNST consortin, connexin sorting protein 2 1
MIRT437632 TRPS1 transcriptional repressor GATA binding 1 2 1
MIRT437633 CAST calpastatin 2 1
MIRT437634 AIFM2 apoptosis inducing factor, mitochondria associated 2 4 3
MIRT437635 C16orf63 FGFR1OP N-terminal like 2 1
MIRT437823 COL4A4 collagen type IV alpha 4 chain 1 1
MIRT437824 SP1 Sp1 transcription factor 3 2
MIRT437917 CISH cytokine inducible SH2 containing protein 3 1
MIRT438120 CCR6 C-C motif chemokine receptor 6 3 1
MIRT447959 WDR77 WD repeat domain 77 2 2
MIRT461324 MRPS27 mitochondrial ribosomal protein S27 2 2
MIRT493802 GAN gigaxonin 2 6
MIRT495023 C2CD4B C2 calcium dependent domain containing 4B 2 2
MIRT495046 AGTPBP1 ATP/GTP binding protein 1 2 2
MIRT496570 DGCR6L DiGeorge syndrome critical region gene 6 like 2 2
MIRT497483 XPR1 xenotropic and polytropic retrovirus receptor 1 2 2
MIRT497936 ABCB7 ATP binding cassette subfamily B member 7 2 2
MIRT503982 C4orf29 abhydrolase domain containing 18 2 4
MIRT504020 ACSL6 acyl-CoA synthetase long chain family member 6 2 2
MIRT504765 TEP1 telomerase associated protein 1 2 4
MIRT504841 RRP36 ribosomal RNA processing 36 2 6
MIRT505556 SMUG1 single-strand-selective monofunctional uracil-DNA glycosylase 1 2 2
MIRT506090 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 2 2
MIRT509109 BMP8B bone morphogenetic protein 8b 2 6
MIRT513390 TUBB4A tubulin beta 4A class IVa 2 2
MIRT514115 SERF2 small EDRK-rich factor 2 2 2
MIRT514299 FXYD5 FXYD domain containing ion transport regulator 5 2 4
MIRT514959 SIGLEC11 sialic acid binding Ig like lectin 11 2 2
MIRT515171 AHI1 Abelson helper integration site 1 2 2
MIRT515373 IPP intracisternal A particle-promoted polypeptide 2 2
MIRT515723 SEPT14 septin 14 2 4
MIRT516023 A1CF APOBEC1 complementation factor 2 2
MIRT516252 BCAS4 breast carcinoma amplified sequence 4 2 2
MIRT516535 MIXL1 Mix paired-like homeobox 2 2
MIRT516803 ZNF708 zinc finger protein 708 2 4
MIRT516989 COX19 COX19, cytochrome c oxidase assembly factor 2 4
MIRT517038 FGD6 FYVE, RhoGEF and PH domain containing 6 2 2
MIRT517097 CCDC30 coiled-coil domain containing 30 2 4
MIRT517794 EFCAB11 EF-hand calcium binding domain 11 2 4
MIRT518871 NKD1 naked cuticle homolog 1 2 2
MIRT519497 MAPK13 mitogen-activated protein kinase 13 2 2
MIRT520436 TTLL12 tubulin tyrosine ligase like 12 2 2
MIRT520989 SOCS5 suppressor of cytokine signaling 5 2 2
MIRT521526 QSOX1 quiescin sulfhydryl oxidase 1 2 4
MIRT521645 PROSC pyridoxal phosphate binding protein 2 2
MIRT522851 KIAA1551 KIAA1551 2 2
MIRT522973 INTU inturned planar cell polarity protein 2 2
MIRT523061 HYPK huntingtin interacting protein K 2 2
MIRT523581 GGA2 golgi associated, gamma adaptin ear containing, ARF binding protein 2 2 2
MIRT524273 CYCS cytochrome c, somatic 2 4
MIRT524435 CNKSR3 CNKSR family member 3 2 2
MIRT524603 CACYBP calcyclin binding protein 2 2
MIRT524962 AGO3 argonaute 3, RISC catalytic component 2 4
MIRT525288 C18orf32 chromosome 18 open reading frame 32 2 2
MIRT526171 ANKRD65 ankyrin repeat domain 65 2 2
MIRT526618 NME6 NME/NM23 nucleoside diphosphate kinase 6 2 2
MIRT527226 C3orf36 chromosome 3 open reading frame 36 2 4
MIRT528701 TRAF3IP2 TRAF3 interacting protein 2 2 4
MIRT529981 TNFAIP8L1 TNF alpha induced protein 8 like 1 2 2
MIRT530022 KIAA1875 WD repeat domain 97 2 2
MIRT530238 PLXDC1 plexin domain containing 1 2 2
MIRT530573 ABHD15 abhydrolase domain containing 15 2 2
MIRT530807 GPR182 G protein-coupled receptor 182 2 2
MIRT531755 TXK TXK tyrosine kinase 2 2
MIRT532028 FHDC1 FH2 domain containing 1 2 2
MIRT534310 SKIDA1 SKI/DACH domain containing 1 2 2
MIRT535305 PHF12 PHD finger protein 12 2 2
MIRT537947 DSN1 DSN1 homolog, MIS12 kinetochore complex component 2 2
MIRT540257 FAM89A family with sequence similarity 89 member A 2 2
MIRT540369 MASTL microtubule associated serine/threonine kinase like 2 2
MIRT540648 ZNF514 zinc finger protein 514 2 2
MIRT540669 MIS18A MIS18 kinetochore protein A 2 4
MIRT542033 PTRF caveolae associated protein 1 2 2
MIRT542124 DIS3L DIS3 like exosome 3'-5' exoribonuclease 2 2
MIRT542350 MED16 mediator complex subunit 16 2 2
MIRT544456 KRBOX4 KRAB box domain containing 4 2 2
MIRT547164 PDZD8 PDZ domain containing 8 2 2
MIRT548162 FRAT2 FRAT2, WNT signaling pathway regulator 2 2
MIRT551677 BBS5 Bardet-Biedl syndrome 5 2 2
MIRT551694 ASB16 ankyrin repeat and SOCS box containing 16 2 2
MIRT555324 PPP2CB protein phosphatase 2 catalytic subunit beta 2 2
MIRT555448 POLR3A RNA polymerase III subunit A 2 2
MIRT557269 HMGB1 high mobility group box 1 2 4
MIRT557564 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT563033 CEP72 centrosomal protein 72 2 2
MIRT572904 RUNDC3B RUN domain containing 3B 2 2
MIRT575896 Dis3 DIS3 homolog, exosome endoribonuclease and 3'-5' exoribonuclease 2 3
MIRT607666 BTN3A2 butyrophilin subfamily 3 member A2 2 2
MIRT608731 MYH9 myosin heavy chain 9 2 2
MIRT608837 PTCHD1 patched domain containing 1 2 2
MIRT609296 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 2 2
MIRT610291 DIS3 DIS3 homolog, exosome endoribonuclease and 3'-5' exoribonuclease 2 3
MIRT610301 KLHL21 kelch like family member 21 2 2
MIRT610640 PIGM phosphatidylinositol glycan anchor biosynthesis class M 2 2
MIRT611035 RRP1B ribosomal RNA processing 1B 2 2
MIRT612595 RANGAP1 Ran GTPase activating protein 1 2 2
MIRT613614 FAM185A family with sequence similarity 185 member A 2 2
MIRT614242 WDR53 WD repeat domain 53 2 4
MIRT615157 SPIB Spi-B transcription factor 2 2
MIRT615549 TNFSF15 TNF superfamily member 15 2 2
MIRT617736 ATCAY ATCAY, caytaxin 2 4
MIRT618237 PGBD4 piggyBac transposable element derived 4 2 2
MIRT618289 ZNF682 zinc finger protein 682 2 2
MIRT618692 CAMK1D calcium/calmodulin dependent protein kinase ID 2 2
MIRT619031 SLC35G1 solute carrier family 35 member G1 2 2
MIRT619053 TTC4 tetratricopeptide repeat domain 4 2 2
MIRT619079 DNAAF3 dynein axonemal assembly factor 3 2 2
MIRT619258 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT619659 CORO2A coronin 2A 2 4
MIRT619759 MYO1F myosin IF 2 4
MIRT620183 TRIM72 tripartite motif containing 72 2 2
MIRT620889 ANO7 anoctamin 7 2 2
MIRT620905 MUT methylmalonyl-CoA mutase 2 2
MIRT621044 PPP2R3A protein phosphatase 2 regulatory subunit B''alpha 2 2
MIRT621088 WDR12 WD repeat domain 12 2 2
MIRT621237 SIGLEC9 sialic acid binding Ig like lectin 9 2 4
MIRT621448 TCN2 transcobalamin 2 2 2
MIRT621707 TRIP11 thyroid hormone receptor interactor 11 2 2
MIRT621721 TRAPPC10 trafficking protein particle complex 10 2 2
MIRT622504 RBM3 RNA binding motif (RNP1, RRM) protein 3 2 4
MIRT623203 MTSS1L MTSS1L, I-BAR domain containing 2 2
MIRT623514 KCNK3 potassium two pore domain channel subfamily K member 3 2 2
MIRT623799 GK5 glycerol kinase 5 (putative) 2 4
MIRT624223 CXorf21 chromosome X open reading frame 21 2 2
MIRT625681 SYAP1 synapse associated protein 1 2 2
MIRT625818 POFUT1 protein O-fucosyltransferase 1 2 2
MIRT626154 NFYA nuclear transcription factor Y subunit alpha 2 2
MIRT626174 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 2 4
MIRT626202 PNRC1 proline rich nuclear receptor coactivator 1 2 4
MIRT626803 TTPAL alpha tocopherol transfer protein like 2 2
MIRT626912 HIST1H2BG histone cluster 1 H2B family member g 2 2
MIRT627968 NIPAL1 NIPA like domain containing 1 2 2
MIRT629503 AS3MT arsenite methyltransferase 2 2
MIRT629823 REL REL proto-oncogene, NF-kB subunit 2 2
MIRT630112 PNPLA3 patatin like phospholipase domain containing 3 2 2
MIRT630643 ELK1 ELK1, ETS transcription factor 2 2
MIRT631462 FBXO47 F-box protein 47 2 2
MIRT631508 FFAR4 free fatty acid receptor 4 2 2
MIRT631740 NKX2-1 NK2 homeobox 1 2 2
MIRT632154 CWC25 CWC25 spliceosome associated protein homolog 2 2
MIRT632501 RAB13 RAB13, member RAS oncogene family 2 2
MIRT632582 POLQ DNA polymerase theta 2 2
MIRT633103 CBX5 chromobox 5 2 2
MIRT633206 WFDC6 WAP four-disulfide core domain 6 2 2
MIRT633814 WDR92 WD repeat domain 92 2 2
MIRT634081 APOH apolipoprotein H 2 2
MIRT634291 SUGT1 SGT1 homolog, MIS12 kinetochore complex assembly cochaperone 2 2
MIRT634636 HIP1 huntingtin interacting protein 1 2 4
MIRT634883 SENP8 SUMO/sentrin peptidase family member, NEDD8 specific 2 2
MIRT634936 GTF2H2C GTF2H2 family member C 2 2
MIRT635444 SLC25A44 solute carrier family 25 member 44 2 2
MIRT635751 PIK3C2A phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha 2 2
MIRT636475 KLHL7 kelch like family member 7 2 2
MIRT636869 ARSE arylsulfatase E (chondrodysplasia punctata 1) 2 2
MIRT637182 TMEM50A transmembrane protein 50A 2 2
MIRT638017 TTC31 tetratricopeptide repeat domain 31 2 2
MIRT638109 YPEL1 yippee like 1 2 2
MIRT638739 FAXC failed axon connections homolog 2 2
MIRT638924 CALCOCO2 calcium binding and coiled-coil domain 2 2 2
MIRT639858 TBC1D16 TBC1 domain family member 16 2 2
MIRT640453 IP6K2 inositol hexakisphosphate kinase 2 2 4
MIRT640896 AMD1 adenosylmethionine decarboxylase 1 2 2
MIRT641015 ANKFY1 ankyrin repeat and FYVE domain containing 1 2 2
MIRT641259 C8orf46 chromosome 8 open reading frame 46 2 2
MIRT641762 ZNF207 zinc finger protein 207 2 2
MIRT641819 ULK2 unc-51 like autophagy activating kinase 2 2 2
MIRT641969 PWWP2A PWWP domain containing 2A 2 2
MIRT642223 RABAC1 Rab acceptor 1 2 2
MIRT642330 ZNF573 zinc finger protein 573 2 2
MIRT642473 C16orf58 chromosome 16 open reading frame 58 2 2
MIRT642610 APOPT1 apoptogenic 1, mitochondrial 2 2
MIRT643113 SMIM7 small integral membrane protein 7 2 2
MIRT643598 SPAG16 sperm associated antigen 16 2 2
MIRT643643 EZH2 enhancer of zeste 2 polycomb repressive complex 2 subunit 2 2
MIRT643902 TCEB2 elongin B 2 2
MIRT644048 WWC2 WW and C2 domain containing 2 2 2
MIRT644189 LAT2 linker for activation of T-cells family member 2 2 2
MIRT644530 TMEM134 transmembrane protein 134 2 2
MIRT644842 SEC14L4 SEC14 like lipid binding 4 2 2
MIRT645545 RBL1 RB transcriptional corepressor like 1 2 2
MIRT646835 TLDC1 TBC/LysM-associated domain containing 1 2 2
MIRT647519 PPIE peptidylprolyl isomerase E 2 2
MIRT647786 ASB8 ankyrin repeat and SOCS box containing 8 2 2
MIRT648208 TRIM35 tripartite motif containing 35 2 2
MIRT648267 ZNF582 zinc finger protein 582 2 2
MIRT648368 CYB5A cytochrome b5 type A 2 2
MIRT648452 LEAP2 liver enriched antimicrobial peptide 2 2 2
MIRT648672 ZNF626 zinc finger protein 626 2 2
MIRT648832 C8orf37 chromosome 8 open reading frame 37 2 2
MIRT648921 ZNF551 zinc finger protein 551 2 2
MIRT649211 KIAA1715 lunapark, ER junction formation factor 2 2
MIRT649728 LTBP2 latent transforming growth factor beta binding protein 2 2 2
MIRT649821 PSMC1 proteasome 26S subunit, ATPase 1 2 2
MIRT650419 FKBP9 FK506 binding protein 9 2 2
MIRT650938 CTNS cystinosin, lysosomal cystine transporter 2 2
MIRT651025 ZNF699 zinc finger protein 699 2 2
MIRT651604 WDFY2 WD repeat and FYVE domain containing 2 2 2
MIRT652017 TTYH3 tweety family member 3 2 2
MIRT652285 TNS4 tensin 4 2 2
MIRT652335 TMOD3 tropomodulin 3 2 4
MIRT652352 TMOD2 tropomodulin 2 2 4
MIRT652359 TMEM92 transmembrane protein 92 2 2
MIRT652404 TMEM33 transmembrane protein 33 2 2
MIRT652917 SYNJ2BP synaptojanin 2 binding protein 2 2
MIRT653393 SLFN13 schlafen family member 13 2 2
MIRT653609 SLC33A1 solute carrier family 33 member 1 2 2
MIRT653858 SHE Src homology 2 domain containing E 2 2
MIRT654009 SCO1 SCO1, cytochrome c oxidase assembly protein 2 2
MIRT654056 S1PR1 sphingosine-1-phosphate receptor 1 2 2
MIRT654233 RNF165 ring finger protein 165 2 2
MIRT654504 RABIF RAB interacting factor 2 2
MIRT654973 PLEKHA2 pleckstrin homology domain containing A2 2 2
MIRT655024 PLA2G16 phospholipase A2 group XVI 2 2
MIRT655509 PAIP2B poly(A) binding protein interacting protein 2B 2 2
MIRT655745 NR2F2 nuclear receptor subfamily 2 group F member 2 2 2
MIRT656186 MON1B MON1 homolog B, secretory trafficking associated 2 2
MIRT657019 KCNK5 potassium two pore domain channel subfamily K member 5 2 2
MIRT657104 JDP2 Jun dimerization protein 2 2 2
MIRT657466 C21orf33 chromosome 21 open reading frame 33 2 2
MIRT658458 FAM13B family with sequence similarity 13 member B 2 2
MIRT658577 EPHB2 EPH receptor B2 2 2
MIRT658696 EMC3 ER membrane protein complex subunit 3 2 2
MIRT658869 DSTYK dual serine/threonine and tyrosine protein kinase 2 2
MIRT659038 DHTKD1 dehydrogenase E1 and transketolase domain containing 1 2 2
MIRT659449 CNNM2 cyclin and CBS domain divalent metal cation transport mediator 2 2 2
MIRT659591 CEP135 centrosomal protein 135 2 2
MIRT659645 CDK2 cyclin dependent kinase 2 2 2
MIRT660332 BCL11B B-cell CLL/lymphoma 11B 2 2
MIRT660548 ARHGAP29 Rho GTPase activating protein 29 2 2
MIRT661925 MLN motilin 2 2
MIRT662388 ICA1L islet cell autoantigen 1 like 2 4
MIRT662936 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT662982 PAK3 p21 (RAC1) activated kinase 3 2 2
MIRT663592 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT664898 EMC7 ER membrane protein complex subunit 7 2 2
MIRT665117 DNASE2 deoxyribonuclease 2, lysosomal 2 2
MIRT666531 RNF157 ring finger protein 157 2 2
MIRT667341 MSANTD3 Myb/SANT DNA binding domain containing 3 2 2
MIRT668932 COL9A2 collagen type IX alpha 2 chain 2 2
MIRT669579 AKIRIN1 akirin 1 2 2
MIRT669700 ABHD2 abhydrolase domain containing 2 2 2
MIRT670609 NPHP1 nephrocystin 1 2 2
MIRT670886 CYTIP cytohesin 1 interacting protein 2 2
MIRT670937 LIPG lipase G, endothelial type 2 2
MIRT671957 SPPL3 signal peptide peptidase like 3 2 2
MIRT673112 MFSD2A major facilitator superfamily domain containing 2A 2 2
MIRT673403 WNT7B Wnt family member 7B 2 2
MIRT673545 DEGS1 delta 4-desaturase, sphingolipid 1 2 2
MIRT674411 GNE glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase 2 2
MIRT676075 TIMM50 translocase of inner mitochondrial membrane 50 2 2
MIRT676146 ALDOA aldolase, fructose-bisphosphate A 2 2
MIRT676294 SLC25A37 solute carrier family 25 member 37 2 2
MIRT676444 PLEKHM3 pleckstrin homology domain containing M3 2 2
MIRT676502 GJD3 gap junction protein delta 3 2 2
MIRT676625 CSNK1E casein kinase 1 epsilon 2 2
MIRT676658 LRRC27 leucine rich repeat containing 27 2 2
MIRT676693 LAIR1 leukocyte associated immunoglobulin like receptor 1 2 2
MIRT676779 NPHS1 NPHS1, nephrin 2 2
MIRT676788 CXorf38 chromosome X open reading frame 38 2 6
MIRT676939 EMP2 epithelial membrane protein 2 2 2
MIRT676949 S1PR3 sphingosine-1-phosphate receptor 3 2 2
MIRT677098 MFSD11 major facilitator superfamily domain containing 11 2 4
MIRT677239 C15orf40 chromosome 15 open reading frame 40 2 2
MIRT677370 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT677490 GTF2H2 general transcription factor IIH subunit 2 2 2
MIRT677539 TM4SF5 transmembrane 4 L six family member 5 2 2
MIRT677677 PRPF38A pre-mRNA processing factor 38A 2 2
MIRT677765 GRM6 glutamate metabotropic receptor 6 2 2
MIRT678016 SPIC Spi-C transcription factor 2 2
MIRT678038 CCS copper chaperone for superoxide dismutase 2 2
MIRT678358 PPAP2B phospholipid phosphatase 3 2 2
MIRT678445 PARD6G par-6 family cell polarity regulator gamma 2 2
MIRT678508 LCTL lactase like 2 2
MIRT678523 ZNF347 zinc finger protein 347 2 4
MIRT678643 PDCD4 programmed cell death 4 5 3
MIRT678725 SRCAP Snf2 related CREBBP activator protein 2 2
MIRT678925 XPOT exportin for tRNA 2 2
MIRT678988 SLC1A5 solute carrier family 1 member 5 2 2
MIRT679073 MANEAL mannosidase endo-alpha like 2 2
MIRT679116 NMNAT1 nicotinamide nucleotide adenylyltransferase 1 2 2
MIRT679280 MIPOL1 mirror-image polydactyly 1 2 2
MIRT679378 HIF1AN hypoxia inducible factor 1 alpha subunit inhibitor 2 2
MIRT679700 MTRNR2L5 MT-RNR2-like 5 2 2
MIRT679714 RPL24 ribosomal protein L24 2 2
MIRT679889 SNX2 sorting nexin 2 2 2
MIRT679936 MCTS1 MCTS1, re-initiation and release factor 2 2
MIRT679993 RUNDC1 RUN domain containing 1 2 2
MIRT680064 CD96 CD96 molecule 2 2
MIRT680080 THAP1 THAP domain containing 1 2 2
MIRT680093 SLC35F6 solute carrier family 35 member F6 2 4
MIRT680452 PDE6A phosphodiesterase 6A 2 2
MIRT680489 XIAP X-linked inhibitor of apoptosis 2 2
MIRT681820 N4BP2L2 NEDD4 binding protein 2 like 2 2 2
MIRT683311 C19orf40 Fanconi anemia core complex associated protein 24 1 1
MIRT683378 ESR2 estrogen receptor 2 2 2
MIRT683419 ZNF878 zinc finger protein 878 2 2
MIRT683486 ZNF7 zinc finger protein 7 2 2
MIRT683619 PCP4L1 Purkinje cell protein 4 like 1 2 2
MIRT683682 MICA MHC class I polypeptide-related sequence A 2 2
MIRT683864 OCIAD1 OCIA domain containing 1 2 2
MIRT683938 MYLK3 myosin light chain kinase 3 2 4
MIRT683969 QRFPR pyroglutamylated RFamide peptide receptor 2 2
MIRT684072 TLR7 toll like receptor 7 2 2
MIRT684125 CEP104 centrosomal protein 104 2 2
MIRT684473 INTS7 integrator complex subunit 7 2 2
MIRT684484 GPR137B G protein-coupled receptor 137B 2 2
MIRT684704 LRRD1 leucine rich repeats and death domain containing 1 2 2
MIRT685188 DCTN5 dynactin subunit 5 2 2
MIRT685238 F2RL1 F2R like trypsin receptor 1 2 2
MIRT685513 MSH3 mutS homolog 3 2 2
MIRT685619 C12orf49 chromosome 12 open reading frame 49 2 2
MIRT685655 C11orf1 chromosome 11 open reading frame 1 2 2
MIRT685701 BHMT2 betaine--homocysteine S-methyltransferase 2 2 2
MIRT685734 C12orf65 chromosome 12 open reading frame 65 2 2
MIRT685775 ZNF426 zinc finger protein 426 2 2
MIRT685876 RTN2 reticulon 2 2 2
MIRT685941 PTGIS prostaglandin I2 synthase 2 2
MIRT686099 TNIP3 TNFAIP3 interacting protein 3 2 2
MIRT686149 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 2 2
MIRT686278 WWC1 WW and C2 domain containing 1 2 2
MIRT686310 VPS53 VPS53, GARP complex subunit 2 2
MIRT686355 USP15 ubiquitin specific peptidase 15 2 2
MIRT686381 UBE2V2 ubiquitin conjugating enzyme E2 V2 2 2
MIRT686472 LINC00598 long intergenic non-protein coding RNA 598 2 2
MIRT686484 TRIOBP TRIO and F-actin binding protein 2 2
MIRT686685 TIMM10 translocase of inner mitochondrial membrane 10 2 2
MIRT686821 SLC7A11 solute carrier family 7 member 11 2 2
MIRT686908 SGTB small glutamine rich tetratricopeptide repeat containing beta 2 2
MIRT686977 SERINC1 serine incorporator 1 2 2
MIRT687036 RNF115 ring finger protein 115 2 2
MIRT687071 RABGAP1L RAB GTPase activating protein 1 like 2 2
MIRT687245 PDHB pyruvate dehydrogenase E1 beta subunit 2 2
MIRT687395 NSUN4 NOP2/Sun RNA methyltransferase family member 4 2 2
MIRT687640 LRIF1 ligand dependent nuclear receptor interacting factor 1 2 2
MIRT687830 ISG20L2 interferon stimulated exonuclease gene 20 like 2 2 2
MIRT687853 ISCA2 iron-sulfur cluster assembly 2 2 2
MIRT687922 HOOK3 hook microtubule tethering protein 3 2 2
MIRT688023 GPN2 GPN-loop GTPase 2 2 2
MIRT688266 FAM213A family with sequence similarity 213 member A 2 2
MIRT688500 DDI2 DNA damage inducible 1 homolog 2 2 2
MIRT688628 CRISPLD2 cysteine rich secretory protein LCCL domain containing 2 2 2
MIRT688672 CPT1A carnitine palmitoyltransferase 1A 2 2
MIRT688822 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 2 2
MIRT689061 AGMAT agmatinase 2 2
MIRT689116 ZBTB25 zinc finger and BTB domain containing 25 2 2
MIRT689165 ZNF665 zinc finger protein 665 2 2
MIRT689792 GTF2H3 general transcription factor IIH subunit 3 2 2
MIRT689837 HIST1H2BJ histone cluster 1 H2B family member j 2 2
MIRT690069 MBD1 methyl-CpG binding domain protein 1 2 2
MIRT690688 PTCHD3 patched domain containing 3 2 2
MIRT690731 IRAK4 interleukin 1 receptor associated kinase 4 2 2
MIRT690978 ZNF578 zinc finger protein 578 2 2
MIRT691070 NUGGC nuclear GTPase, germinal center associated 2 2
MIRT691323 KIAA1841 KIAA1841 2 2
MIRT691489 FOXRED2 FAD dependent oxidoreductase domain containing 2 2 2
MIRT692063 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT692204 NOL9 nucleolar protein 9 2 2
MIRT692315 RFK riboflavin kinase 2 2
MIRT692375 LY6G5B lymphocyte antigen 6 family member G5B 2 2
MIRT692435 METTL8 methyltransferase like 8 2 2
MIRT692472 APEX2 apurinic/apyrimidinic endodeoxyribonuclease 2 2 2
MIRT692538 PARD3 par-3 family cell polarity regulator 2 2
MIRT692600 GDF5OS growth differentiation factor 5 opposite strand 2 2
MIRT692781 SYNPO2L synaptopodin 2 like 2 2
MIRT692872 RBM41 RNA binding motif protein 41 2 2
MIRT692976 LGSN lengsin, lens protein with glutamine synthetase domain 2 2
MIRT693347 RNF34 ring finger protein 34 2 2
MIRT694048 PRIM1 DNA primase subunit 1 2 2
MIRT694091 KIAA0930 KIAA0930 2 2
MIRT694658 C14orf119 chromosome 14 open reading frame 119 2 2
MIRT694811 STX4 syntaxin 4 2 2
MIRT694930 ANKS4B ankyrin repeat and sterile alpha motif domain containing 4B 2 2
MIRT695658 MAN2B2 mannosidase alpha class 2B member 2 2 2
MIRT695828 ABCG8 ATP binding cassette subfamily G member 8 2 2
MIRT695970 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 2 2
MIRT696179 GNB5 G protein subunit beta 5 2 2
MIRT696328 FAM153B family with sequence similarity 153 member B 2 2
MIRT696858 UBOX5 U-box domain containing 5 2 2
MIRT696900 C14orf105 coiled-coil domain containing 198 2 2
MIRT697242 ZYG11A zyg-11 family member A, cell cycle regulator 2 2
MIRT697386 ZMAT3 zinc finger matrin-type 3 2 2
MIRT698328 TMEM127 transmembrane protein 127 2 2
MIRT698923 SPEM1 spermatid maturation 1 2 2
MIRT699262 SLC6A4 solute carrier family 6 member 4 2 2
MIRT699313 SLC35F5 solute carrier family 35 member F5 2 4
MIRT699628 SH3BP5 SH3 domain binding protein 5 2 2
MIRT699818 SCN2B sodium voltage-gated channel beta subunit 2 2 2
MIRT700044 RPL14 ribosomal protein L14 2 2
MIRT700100 RNF19B ring finger protein 19B 2 2
MIRT700506 PTPN4 protein tyrosine phosphatase, non-receptor type 4 2 2
MIRT700751 PLAA phospholipase A2 activating protein 2 2
MIRT700834 PGM2L1 phosphoglucomutase 2 like 1 2 2
MIRT701202 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT701292 NUDT3 nudix hydrolase 3 2 2
MIRT701823 MRPL37 mitochondrial ribosomal protein L37 2 2
MIRT702046 METTL21A methyltransferase like 21A 2 2
MIRT702438 KIAA1549 KIAA1549 2 2
MIRT703033 HAS2 hyaluronan synthase 2 2 4
MIRT703087 GPRIN3 GPRIN family member 3 2 2
MIRT703842 ETV3 ETS variant 3 2 2
MIRT704108 DRAXIN dorsal inhibitory axon guidance protein 2 2
MIRT704142 DNAL1 dynein axonemal light chain 1 2 2
MIRT704179 DNAJB4 DnaJ heat shock protein family (Hsp40) member B4 2 2
MIRT704192 LDHD lactate dehydrogenase D 2 2
MIRT704758 CDKN2AIPNL CDKN2A interacting protein N-terminal like 2 2
MIRT705345 ATP1B3 ATPase Na+/K+ transporting subunit beta 3 2 2
MIRT706024 ZSCAN2 zinc finger and SCAN domain containing 2 2 2
MIRT706040 F2R coagulation factor II thrombin receptor 2 2
MIRT706103 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 2 2
MIRT706346 STAC2 SH3 and cysteine rich domain 2 2 2
MIRT706512 MTMR9 myotubularin related protein 9 2 2
MIRT706798 RAI1 retinoic acid induced 1 2 2
MIRT708366 CDIPT CDP-diacylglycerol--inositol 3-phosphatidyltransferase 2 2
MIRT708653 LYRM7 LYR motif containing 7 2 2
MIRT708813 CDS2 CDP-diacylglycerol synthase 2 2 2
MIRT709069 FAHD1 fumarylacetoacetate hydrolase domain containing 1 2 2
MIRT709501 RHOH ras homolog family member H 2 2
MIRT709533 ZBED1 zinc finger BED-type containing 1 2 2
MIRT709958 TRUB2 TruB pseudouridine synthase family member 2 2 2
MIRT710521 NDUFV3 NADH:ubiquinone oxidoreductase subunit V3 2 2
MIRT711654 RAB21 RAB21, member RAS oncogene family 2 2
MIRT711849 AMOTL2 angiomotin like 2 2 2
MIRT712974 KANSL3 KAT8 regulatory NSL complex subunit 3 2 2
MIRT713935 PIGR polymeric immunoglobulin receptor 2 2
MIRT714303 ZNF454 zinc finger protein 454 2 2
MIRT714609 EXO5 exonuclease 5 2 2
MIRT714993 TSPAN11 tetraspanin 11 2 2
MIRT715730 PIAS2 protein inhibitor of activated STAT 2 2 2
MIRT715791 TBL3 transducin beta like 3 2 2
MIRT716541 GOLGA2 golgin A2 2 2
MIRT716624 CRCP CGRP receptor component 2 2
MIRT717144 DLEU1 deleted in lymphocytic leukemia 1 (non-protein coding) 2 2
MIRT717414 ZCCHC24 zinc finger CCHC-type containing 24 2 2
MIRT717527 GATAD2B GATA zinc finger domain containing 2B 2 2
MIRT717916 LRRC15 leucine rich repeat containing 15 2 2
MIRT717971 PXMP4 peroxisomal membrane protein 4 2 2
MIRT718744 ATP9A ATPase phospholipid transporting 9A (putative) 2 2
MIRT719068 ACOX1 acyl-CoA oxidase 1 2 2
MIRT719098 PCYT1A phosphate cytidylyltransferase 1, choline, alpha 2 2
MIRT719144 DPYSL5 dihydropyrimidinase like 5 2 2
MIRT719223 CAMK4 calcium/calmodulin dependent protein kinase IV 2 2
MIRT719923 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 2
MIRT720721 RAPGEF6 Rap guanine nucleotide exchange factor 6 2 2
MIRT721507 CARHSP1 calcium regulated heat stable protein 1 2 2
MIRT721911 BDP1 B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB 2 2
MIRT722613 TEAD1 TEA domain transcription factor 1 2 2
MIRT722704 ZNF460 zinc finger protein 460 2 2
MIRT722874 XPNPEP3 X-prolyl aminopeptidase 3 2 2
MIRT723730 ZHX3 zinc fingers and homeoboxes 3 2 2
MIRT723998 LMTK2 lemur tyrosine kinase 2 2 2
MIRT724002 TMEM174 transmembrane protein 174 2 2
MIRT724383 NEK8 NIMA related kinase 8 2 2
MIRT724547 HAUS2 HAUS augmin like complex subunit 2 2 2
MIRT724839 ATAD2B ATPase family, AAA domain containing 2B 2 2
MIRT731116 SSSCA1 Sjogren syndrome/scleroderma autoantigen 1 3 1
MIRT732237 CREB1 cAMP responsive element binding protein 1 3 1
MIRT732355 STAT5B signal transducer and activator of transcription 5B 3 1
MIRT733221 FOXP3 forkhead box P3 3 0
MIRT733222 IGF1R insulin like growth factor 1 receptor 3 0
MIRT733289 PLP2 proteolipid protein 2 3 0
MIRT734121 SNAI2 snail family transcriptional repressor 2 3 0
MIRT734221 BACH2 BTB domain and CNC homolog 2 3 0
MIRT734464 SUFU SUFU negative regulator of hedgehog signaling 3 0
MIRT735346 AGO2 argonaute 2, RISC catalytic component 3 0
MIRT735864 KRAS KRAS proto-oncogene, GTPase 1 0
MIRT736321 CDKN1B cyclin dependent kinase inhibitor 1B 3 0
MIRT755475 PDAP1 PDGFA associated protein 1 6 1
MIRT756267 TREM1 triggering receptor expressed on myeloid cells 1 3 1
MIRT756410 BAP1 BRCA1 associated protein 1 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-150 Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-150 N-ethyl-N-nitrosourea NULL 12967 Quantitative real-time PCR mouse liver 21029445 2010 down-regulated
miR-150 Benzo(a)pyrene NULL 2336 Microarray Adult male B6C3F1 mice 21569818 2011 down-regulated
miR-150 cisplatin approved 84093 Quantitative real-time PCR K562 cell 20428827 2010 down-regualted
miR-150 Glucose NULL 5793 Microarray endothelial cells 24394957 2014 up-regulated
miR-150 Methamphetamine approved 10836 Quantitative real-time PCR CD4+ T cells 24434277 2014 up-regulated
miR-150 Imatinib mesylate approved 123596 Quantitative real-time PCR chronic myeloid leukemia 20460641 2010 up-regulated
miR-150 Imatinib mesylate approved 123596 TaqMan low-density array chronic myeloid leukemia 20460641 2010 up-regulated
miR-150 Morphine approved 5288826 Quantitative real-time PCR HIV 21224041 2011 down-regulated
miR-150 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-150 Marine fungal metabolite 1386A NULL NULL Microarray MCF-7 breast cancer cells. 22159329 2012 down-regulated
miR-150 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-150 Glucocorticoid NULL NULL TaqMan low-density array Eosinophilic esophagitis 22815788 2012 up-regulated
miR-150 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 down-regulated
miR-150 Comfrey NULL 6440495 Microarray rat liver 21370286 2011 down-regulated
miR-150 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-150 Morphine approved 5288826 Microarray human monocyte-derived macrophages (h-mdms) infection with HIV-1 20564181 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-150 Tripterygium wilfordii Hook F sensitive tissue
hsa-mir-150 Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-mir-150 Decitabine 451668 approved sensitive tissue (esopheageal cancer)
hsa-miR-150-5p (1'S,2'S,11'R)-11'-phenylsulfanylspiro[1,3-dioxolane-2,10'-8-oxa-7-azatricyclo[7.4.0.02,7]tridecane]-13'-one 392646 NSC693225 sensitive
hsa-miR-150-5p (1'S,8'R)-9',10'-dibromospiro[1,3-dithiolane-2,11'-tricyclo[6.3.1.02,7]dodeca-2,4,6,9-tetraene] 389921 NSC686573 sensitive
hsa-miR-150-5p (1-(((2-amino-6-chloro-4-pyrimidinyl)amino)methyl)-3-phenylcyclobutyl)methanol 385235 NSC676348 sensitive
hsa-miR-150-5p (11E)-11-(3-aminopropylidene)-15,16-dimethoxy-20-methyl-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaen-19-one 9978660 NSC724562 sensitive
hsa-miR-150-5p (11E)-11-(4-iodobutylidene)-15,16-dimethoxy-20-methyl-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaen-19-one 5472476 NSC719211 sensitive
hsa-miR-150-5p (11E)-11-(6-aminohexylidene)-15,16-dimethoxy-20-methyl-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaen-19-one 45027835 NSC727049 sensitive
hsa-miR-150-5p (19E,21E,23Z,25Z,27E,29E,31E)-33-[3,5-dihydroxy-6-methyl-4-[[2-(4-methylpiperazin-1-yl)acetyl]amino]oxan-2-yl]oxy-N-[2-(dimethylamino)ethyl]-1,3,5,7,9,13,37-heptahydroxy-17-[5-hydroxy-7-[4-(methylamino)phenyl]-7-oxoheptan-2-yl]-18-methyl-11,15-dioxo-16,39 5472916 NSC722659 sensitive
hsa-miR-150-5p (1R,12S)-20-[2-(dimethylamino)ethyl]-15,16-dimethoxy-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-2,4(8),9,13,15,17-hexaene-11,19-dione 45027831 NSC726770 sensitive
hsa-miR-150-5p (1s,4s,6s,9r,11r,14r,15r)-14-hydroxy-4,9,14-trimethyl-18-methylidene-5,10,16-trioxatetracyclo[13.3.1.04,6.09,11]nonadecan-17-one 24205276 NSC734913 sensitive
hsa-miR-150-5p (1Z)-N-[(5-carbamoyl-1H-imidazol-4-yl)amino]-2-(2-methylanilino)-2-oxoethanimidoyl cyanide 5466280 NSC683608 sensitive
hsa-miR-150-5p (2,3-dihydroxyphenyl)-[1-[(4-fluorophenyl)methyl]-4-hydroxyindol-3-yl]methanone 42624812 NSC746053 sensitive
hsa-miR-150-5p (2E)-2-[(3,4-dimethoxyphenyl)methylidene]-5-[(dimethylamino)methyl]cyclopentan-1-one;hydrochloride 21141940 NSC639516 sensitive
hsa-miR-150-5p (2E)-2-[(4-chlorophenyl)methylidene]-5-(morpholin-4-ylmethyl)cyclopentan-1-one;hydrochloride 50988453 NSC639517 sensitive
hsa-miR-150-5p (2e,4e,6z,8e)-n-(1,3-benzodioxol-5-yl)-3,7-dimethyl-9-(2,6,6-trimethylcyclohexen-1-yl)nona-2,4,6,8-tetraenamide 24202490 NSC672131 sensitive
hsa-miR-150-5p (2E,6E)-2,6-bis[(4-bromophenyl)methylidene]cyclohexan-1-one 5716584 NSC632831 sensitive
hsa-miR-150-5p (2r,6r)-9,11-dibromo-10-thia-3,5-diazatricyclo[6.3.0.02,6]undeca-1(11),8-diene-4,7-dione 400215 NSC711733 sensitive
hsa-miR-150-5p (2R,6R)-9,11-dibromo-5-oxa-10-thia-3-azatricyclo[6.3.0.02,6]undeca-1(11),8-diene-4,7-dione 383027 NSC671009 sensitive
hsa-miR-150-5p (2S)-2-[(E,2S)-2-hydroxy-4-oxo-6-phenylhex-5-enyl]-2,3-dihydropyran-6-one 5468230 NSC666388 sensitive
hsa-miR-150-5p (2S,4S,5S,8R,11Z,15S)-8,28-dihydroxy-5-methyl-3-oxa-16-azaheptacyclo[15.12.0.02,4.02,8.04,15.018,27.020,25]nonacosa-1(29),11,17,20,22,24,27-heptaen-9,13-diyne-7,19,26-trione 54608726 NSC670656 sensitive
hsa-miR-150-5p (2z)-2-[(4-hydroxyphenyl)methylidene]-5-methoxy-1-benzofuran-3-one 54613041 NSC747169 sensitive
hsa-miR-150-5p (2z)-5-methoxy-2-[(3-phenacyloxyphenyl)methylidene]-1-benzofuran-3-one 45028682 NSC743694 sensitive
hsa-miR-150-5p (2Z,6Z)-2,6-bis[[3-[(dimethylamino)methyl]-4-hydroxyphenyl]methylidene]cyclohexan-1-one 6067712 NSC683834 sensitive
hsa-miR-150-5p (3,4,4-trichloro-2-nitro-1-phenylsulfanylbuta-1,3-dienyl)sulfanylbenzene 379911 NSC665103 sensitive
hsa-miR-150-5p (3e)-3-[(2-chloro-5-methoxy-6-methyl-1h-indol-3-yl)methylidene]-5-methoxy-6-methyl-1h-indol-2-one 5471478 NSC711618 sensitive
hsa-miR-150-5p (3E)-3-[(3-hydroxyphenyl)methylidene]chromen-4-one 5386998 NSC619390 sensitive
hsa-miR-150-5p (3e)-3-[(3,4-dihydroxyphenyl)methylidene]-6-phenylchromen-4-one 45029091 NSC745449 sensitive
hsa-miR-150-5p (3E)-3-[[3-[1-(4-fluorophenyl)sulfonylpiperidin-4-yl]imidazo[1,5-a]pyridin-1-yl]methylidene]-1H-indol-2-one 54613720 NSC750970 resistant
hsa-miR-150-5p (3E)-3-[1-(4-chloroanilino)ethylidene]oxolan-2-one 820318 NSC680781 sensitive
hsa-miR-150-5p (3e)-7-chloro-4-hydroxy-1-oxido-3-(p-tolylimino)quinoxalin-1-ium-2-carbonitrile 135457335 NSC693867 sensitive
hsa-miR-150-5p (3E,5E)-1-acetyl-3,5-dibenzylidenepiperidin-4-one 5387998 NSC630599 sensitive
hsa-miR-150-5p (3E,5E)-1-methyl-3,5-bis[(2-nitrophenyl)methylidene]piperidin-4-one;hydrochloride 5468196 NSC666038 sensitive
hsa-miR-150-5p (3E,5E)-3,5-bis[(3,4-dichlorophenyl)methylidene]-1-[3-(dimethylamino)propanoyl]piperidin-4-one;hydrochloride 5388808 NSC638645 sensitive
hsa-miR-150-5p (3E,5Z)-3,5-bis[(3,4-dimethoxyphenyl)methylidene]thian-4-one 6477009 NSC144310 sensitive
hsa-miR-150-5p (3s,6s)-3,6-bis(5-bromo-1h-indol-3-yl)piperazine-2,5-dione 6712394 NSC679833 sensitive
hsa-miR-150-5p (3s,8r,9s,10r,13s,14s,16e)-3-hydroxy-10,13-dimethyl-16-[(4-nitrophenyl)methylidene]-2,3,4,7,8,9,11,12,14,15-decahydro-1h-cyclopenta[a]phenanthren-17-one 5472098 NSC716261 resistant
hsa-miR-150-5p (3s,8r,9s,10r,13s,14s,16e,17e)-17-hydroxyimino-16-[(4-methoxyphenyl)methylidene]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15-decahydro-1h-cyclopenta[a]phenanthren-3-ol 9572507 NSC718185 sensitive
hsa-miR-150-5p (3z)-3-[[3-[2-(4-methoxyphenyl)-2-oxoethoxy]phenyl]methylidene]-6-methylthiochromen-4-one 45028770 NSC744075 sensitive
hsa-miR-150-5p (3z)-5-hydroxy-3-[(3,4,5-trimethoxyphenyl)methylidene]-1h-indol-2-one 24205822 NSC736802 sensitive
hsa-miR-150-5p (3Z,5E)-3,5-dibenzylidene-1-[(E)-3-phenylprop-2-enoyl]piperidin-4-one 5351375 NSC638634 sensitive
hsa-miR-150-5p (3Z,5Z)-3,5-dibenzylidene-1-[3-(dimethylamino)propanoyl]piperidin-4-one 6477768 NSC634784 sensitive
hsa-miR-150-5p (4-methylphenyl) (3E,5E)-3,5-dibenzylidene-4-oxopiperidine-1-carboxylate 5388005 NSC630606 sensitive
hsa-miR-150-5p (4-nitrophenyl) (3E,5E)-3,5-dibenzylidene-4-oxopiperidine-1-carboxylate 5388007 NSC630608 sensitive
hsa-miR-150-5p (4S,9aR)-4-(4-fluoroanilino)-9-(4-hydroxy-3,5-dimethoxyphenyl)-6,7-dimethoxy-3a,4,9,9a-tetrahydro-3H-benzo[f][2]benzofuran-1-one 369962 NSC642329 sensitive
hsa-miR-150-5p (4Z)-4-[[1-(3-chlorophenyl)-3-(4-methoxyphenyl)pyrazol-4-yl]methylidene]-5-imino-1-phenylpyrazol-3-amine 135276800 NSC763587 sensitive
hsa-miR-150-5p (5ar,6r,8ar)-6-(1,5-dimethylhexyl)-5a-methyl-2,3,4,5,6,7,8,8a-octahydro-1h-cyclopenta[b]azepine 403828 NSC719362 sensitive
hsa-miR-150-5p (5E)-2-(morpholin-4-ylmethyl)-5-nonylidenecyclopentan-1-one;hydrochloride 54612513 NSC639505 sensitive
hsa-miR-150-5p (5E)-2-[(4-chloroanilino)methyl]-5-[(4-hydroxyphenyl)methylidene]cyclopentan-1-one 5930524 NSC639541 sensitive
hsa-miR-150-5p (5E)-2-[(dimethylamino)methyl]-5-[(4-methoxyphenyl)methylidene]cyclopentan-1-one;hydrochloride 21141935 NSC639511 sensitive
hsa-miR-150-5p (5e)-3-benzyl-5-benzylidene-2-(3,4,5-trimethoxyphenyl)-1,3-thiazolidin-4-one 5470510 NSC702359 sensitive
hsa-miR-150-5p (5s,8ar)-5-[(1-benzylpiperidin-4-yl)amino]-9-(4-hydroxy-3,5-dimethoxyphenyl)-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[6,5-f][1,3]benzodioxol-8-one;hydrochloride 374331 NSC651855 sensitive
hsa-miR-150-5p (5z)-3-[4-benzoyl-2-[(4z)-5-oxo-2-phenyl-4-[(3,4,5-trimethoxyphenyl)methylidene]imidazol-1-yl]phenyl]-2-phenyl-5-[(3,4,5-trimethoxyphenyl)methylidene]imidazol-4-one NSC711885 sensitive
hsa-miR-150-5p (6aS)-3-[3-[4-[3-[[(6aS)-8,8-difluoro-2-methoxy-11-oxo-7,9-dihydro-6aH-pyrrolo[2,1-c][1,4]benzodiazepin-3-yl]oxy]propyl]piperazin-1-yl]propoxy]-8,8-difluoro-2-methoxy-7,9-dihydro-6aH-pyrrolo[2,1-c][1,4]benzodiazepin-11-one 44204058 NSC744331 sensitive
hsa-miR-150-5p (6aS)-3-[4-[6-(4-fluorophenyl)-2-methylpyrimidin-4-yl]oxybutoxy]-2-methoxy-6a,7,8,9-tetrahydropyrrolo[2,1-c][1,4]benzodiazepin-11-one 405944 NSC723732 sensitive
hsa-miR-150-5p (6E)-2-[(dimethylamino)methyl]-6-[(4-methoxyphenyl)methylidene]cyclohexan-1-one;hydrochloride 5468453 NSC670687 sensitive
hsa-miR-150-5p (7z)-6-(4-methoxyphenyl)-3-methyl-7-[[5-(4-nitrophenyl)furan-2-yl]methylidene]-[1,2,4]triazolo[3,4-b][1,3,4]thiadiazine 5471358 NSC710779 sensitive
hsa-miR-150-5p (9,10-dioxoanthracen-2-yl)methyl 3-benzamido-2-hydroxy-3-phenylpropanoate 361915 NSC625350 resistant
hsa-miR-150-5p (e)-1-(2,5-dihydroxyphenyl)ethene-2-isonitrile NSC632129 sensitive
hsa-miR-150-5p (E)-1-(3,4-dimethoxyphenyl)-3-[2-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl]prop-2-en-1-one 54599698 NSC750746 sensitive
hsa-miR-150-5p (e)-1-(3,5-ditert-butyl-4-hydroxyphenyl)-3-(3,4-dimethoxyphenyl)prop-2-en-1-one 5471156 NSC709100 sensitive
hsa-miR-150-5p (e)-1-[3-[(4,6-dianilino-1,3,5-triazin-2-yl)amino]phenyl]-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 45028636 NSC743530 sensitive
hsa-miR-150-5p (e)-1,3-diphenyl-2-(piperidin-1-ylmethyl)prop-2-en-1-one 6147837 NSC109154 sensitive
hsa-miR-150-5p (e)-3-(1,3-benzodioxol-5-yl)-1-(3,5-ditert-butyl-4-hydroxyphenyl)prop-2-en-1-one 5471158 NSC709102 sensitive
hsa-miR-150-5p (E)-3-(3,4-dihydroxyphenyl)-N-[(8R,9S,13S,14S,17S)-3-methoxy-13-methyl-6,7,8,9,11,12,14,15,16,17-decahydrocyclopenta[a]phenanthren-17-yl]prop-2-enamide 11546817 NSC734307 sensitive
hsa-miR-150-5p (e)-3-(4-chlorophenyl)-1-[4-[(7-chloroquinolin-4-yl)amino]phenyl]prop-2-en-1-one 25113941 NSC743862 sensitive
hsa-miR-150-5p (E)-3-(6-thiophen-2-ylimidazo[2,1-b][1,3]thiazol-5-yl)-1-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 50908742 NSC750743 sensitive
hsa-miR-150-5p (e)-3-chloro-2-(3,4-dimethoxyphenyl)-3-(3,4-dipropoxyphenyl)prop-2-enal 3004402 NSC650594 sensitive
hsa-miR-150-5p (e)-3-chloro-2-(4-fluorophenyl)-3-(4-methoxyphenyl)prop-2-enal 5387394 NSC623173 sensitive
hsa-miR-150-5p (e)-3-chloro-3-(3,4-dimethoxyphenyl)-2-(4-nitrophenyl)prop-2-enal 5387397 NSC623176 sensitive
hsa-miR-150-5p (E)-but-2-enedioic acid;1-[[3-(diethylamino)-2-hydroxypropyl]amino]-4-(oxiran-2-ylmethylamino)anthracene-9,10-dione 5388837 NSC639366 sensitive
hsa-miR-150-5p (E)-but-2-enedioic acid;2-[4-tert-butyl-1-[(4-fluorophenyl)methyl]cyclohexyl]oxy-N,N-dimethylethanamine 5351427 NSC670226 sensitive
hsa-miR-150-5p (E)-N-[[(17S)-3,17-dihydroxy-13-methyl-7,8,9,11,12,14,15,16-octahydro-6H-cyclopenta[a]phenanthren-17-yl]methyl]-3-(4-hydroxy-3-methoxyphenyl)prop-2-enamide 24205473 NSC735946 sensitive
hsa-miR-150-5p (ne)-n-[(3e,8r,9s,10r,13s,14s,16e)-16-[(3,4-dimethoxyphenyl)methylidene]-3-hydroxyimino-10,13-dimethyl-1,2,6,7,8,9,11,12,14,15-decahydrocyclopenta[a]phenanthren-17-ylidene]hydroxylamine 9572443 NSC716260 sensitive
hsa-miR-150-5p (z)-2-(9h-carbazol-2-yloxy)-n-methoxy-1-(4-methoxyphenyl)ethanimine 11405724 NSC726373 resistant
hsa-miR-150-5p (z)-4-bromo-4-iodo-3-phenyl-3-buten-2-one 3004479 NSC657561 sensitive
hsa-miR-150-5p [(1R)-1-[[(2S)-2-amino-3-naphthalen-1-ylpropanoyl]amino]-3-methylbutyl]boronic acid;hydrochloride 387440 NSC681229 sensitive
hsa-miR-150-5p [(1R,2S,6R,9Z)-9-(acetyloxymethyl)-4-(hydroxymethyl)-14-methylidene-13-oxo-5,12-dioxatricyclo[9.3.0.04,6]tetradec-9-en-2-yl] 2-methylprop-2-enoate 5468206 NSC666113 sensitive
hsa-miR-150-5p [(1s,2r)-1-benzamido-3-[[(1s,2s,3r,4s,7r,9s,10s,12r,15s)-4,12-diacetyloxy-2-benzoyloxy-1,9-dihydroxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10.04,7]heptadec-13-en-15-yl]oxy]-3-oxo-1- 16129931 NSC705435 sensitive
hsa-miR-150-5p [(1s,2s,3r,4r,7r,8r,11s,14r,15r,17s)-15-hydroxy-14-methoxy-4,8,11,15-tetramethyl-9-oxo-10,18-dioxatetracyclo[9.7.0.02,7.03,17]octadecan-4-yl] butanoate 11015858 NSC737077 sensitive
hsa-miR-150-5p [(1s,4s,7r,9s,10s,12r)-4,12-diacetyloxy-15-[3-[(3-chlorobenzoyl)amino]-2-hydroxy-3-phenylpropanoyl]oxy-1,9-dihydroxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10.04,7]heptadec-13-en-2-y 6712240 NSC662158 sensitive
hsa-miR-150-5p [(1S,5Z,9S,10R)-12-oxo-11-azabicyclo[8.2.0]dodec-5-en-3,7-diyn-9-yl] acetate 5470109 NSC697685 sensitive
hsa-miR-150-5p [(2S,3S)-3-[(E)-3-(3,4-diacetyloxyphenyl)prop-2-enoyl]oxybutan-2-yl] (E)-3-(3,4-diacetyloxyphenyl)prop-2-enoate 5470293 NSC699168 sensitive
hsa-miR-150-5p [(3bR,9aS,11aS)-2-(2-hydroxy-5-oxo-2H-furan-3-yl)-3b,6,6,9a-tetramethyl-2,3,3a,4,5,5a,7,8,9,9b,10,11-dodecahydronaphtho[2,1-e][1]benzofuran-11a-yl]methyl acetate 378635 NSC661428 sensitive
hsa-miR-150-5p [(3S)-3-[tert-butyl(diphenyl)silyl]oxy-4-(2-methoxyethoxymethoxy)-4-methylpentyl] acetate 357861 NSC617394 sensitive
hsa-miR-150-5p [(3S,10R,13S,16E)-16-[[3-methoxy-4-(2-piperidin-1-ylethoxy)phenyl]methylidene]-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 24203176 NSC727082 sensitive
hsa-miR-150-5p [(3S,10R,13S,16E,17S)-16-[[4-(3-imidazol-1-ylpropoxy)-3-methoxyphenyl]methylidene]-10,13-dimethyl-3-pyrrolidin-1-yl-1,2,3,4,7,8,9,11,12,14,15,17-dodecahydrocyclopenta[a]phenanthren-17-yl] acetate 24204019 NSC730460 sensitive
hsa-miR-150-5p [(3s,8r,9s,10r,13s,14s,16e)-16-(1-acetyloxy-2,2,2-trifluoroethylidene)-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1h-cyclopenta[a]phenanthren-3-yl] acetate 5351782 NSC45238 sensitive
hsa-miR-150-5p [(5S,8R,9S,10S,13S,14S,17S)-10,13-dimethyl-3-oxo-1,2,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydrocyclopenta[a]phenanthren-17-yl] N-(2-chloroethyl)-N-nitrosocarbamate 320803 NSC269721 sensitive
hsa-miR-150-5p [(z)-[2-[[6-[[2-[(z)-(carbamothioylhydrazinylidene)methyl]phenoxy]methyl]pyridin-2-yl]methoxy]phenyl]methylideneamino]thiourea 54611756 NSC715648 resistant
hsa-miR-150-5p [1,1'-binaphthalene]-2,2',3,3'-tetrol 316673 NSC245006 sensitive
hsa-miR-150-5p [1,1,1,3,3,3-hexafluoro-2-(quinolin-2-ylmethyl)propan-2-yl] acetate 379602 NSC664303 sensitive
hsa-miR-150-5p [2-(4-methoxyphenyl)quinolin-4-yl]-piperidin-2-ylmethanol;dihydrochloride 91885392 NSC23925 sensitive
hsa-miR-150-5p [2-(5-fluoro-2,4-dioxopyrimidin-1-yl)-6-methyl-5-oxo-2h-pyran-4-yl] acetate 358202 NSC618093 sensitive
hsa-miR-150-5p [2-[(2E)-2-[1-(2-hydroxyphenyl)-2-(3-oxo-1H-2-benzofuran-1-yl)ethylidene]hydrazinyl]-2-oxoethyl]-trimethylazanium;chloride 135483962 NSC647614 sensitive
hsa-miR-150-5p [2-amino-9-[3,4-dihydroxy-5-(hydroxymethyl)oxolan-2-yl]-1H-purin-6-ylidene]sulfanium;(2-hydroxy-5-nitrophenyl)mercury 135403618 NSC321239 sensitive
hsa-miR-150-5p [3-(chloromethyl)indolin-1-yl]-(5,6,7-trimethoxy-1h-indol-2-yl)methanone 393954 NSC696990 sensitive
hsa-miR-150-5p [3-(furan-2-carbonyl)-2-thioxo-imidazolidin-1-yl]-(2-furyl)methanone 396757 NSC703467 sensitive
hsa-miR-150-5p [3-[(2e,4e,6e,8e)-3,7-dimethyl-9-(2,6,6-trimethylcyclohexen-1-yl)nona-2,4,6,8-tetraenoyl]oxy-5-(5-fluoro-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methyl (2e,4e,6e,8e)-3,7-dimethyl-9-(2,6,6-trimethylcyclohe 5468409 NSC669728 sensitive
hsa-miR-150-5p [3-[(3E,5E)-3,5-dibenzylidene-4-oxopiperidin-1-yl]-3-oxopropyl]-trimethylazanium;bromide 5388801 NSC638635 sensitive
hsa-miR-150-5p [3-[[5-(4-amino-2-oxopyrimidin-1-yl)-3,4-dihydroxyoxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-2-octadecoxypropyl] [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-3-hydroxyoxolan-2-yl]methyl hydrogen phosphate 394836 NSC698688 sensitive
hsa-miR-150-5p [3-butanoyloxy-5-(5-fluoro-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methyl butanoate 379286 NSC663792 sensitive
hsa-miR-150-5p [3-keto-bmt(sup 1)]-[val(sup 2)]-cyclosporin 5467197 NSC648265 sensitive
hsa-miR-150-5p [3,4,5-triacetyloxy-6-(1-cyano-2-sulfanylidene-4-thiophen-2-yl-5,6-dihydrobenzo[f]isoquinolin-3-yl)oxan-2-yl]methyl acetate 386291 NSC678049 sensitive
hsa-miR-150-5p [3,4,5-triacetyloxy-6-[(4Z)-4-[(4-chlorophenyl)methylidene]-5-oxo-1-prop-2-enylimidazol-2-yl]sulfanyloxan-2-yl]methyl acetate 5470570 NSC703037 resistant
hsa-miR-150-5p [3,4,5-triacetyloxy-6-[4-(4-chlorophenyl)-3-cyano-7,7-dimethyl-5-oxo-2-sulfanylidene-6,8-dihydroquinolin-1-yl]oxan-2-yl]methyl acetate 385412 NSC676591 sensitive
hsa-miR-150-5p [4-(5,8-diacetyloxy-1-tetracyclo[6.6.0.02,7.09,14]tetradeca-2(7),3,5,9,11,13-hexaenyl)phenyl] acetate 231714 NSC28365 sensitive
hsa-miR-150-5p [4-[(E)-[3-[(dimethylamino)methyl]-2-oxocyclopentylidene]methyl]phenoxy]methyl propanoate;hydrochloride 50988761 NSC639514 sensitive
hsa-miR-150-5p [4-amino-2-[(4-methoxyphenyl)amino]thiazol-5-yl]-(2-thienyl)methanone 399016 NSC709437 sensitive
hsa-miR-150-5p [4-fluoro-5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-2-(hydroxymethyl)oxolan-3-yl] butanoate 380992 NSC666869 sensitive
hsa-miR-150-5p [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-2-(hydroxymethyl)oxolan-3-yl] [5-[5-fluoro-4-(hexadecylamino)-2-oxopyrimidin-1-yl]-3-hydroxyoxolan-2-yl]methyl hydrogen phosphate 387052 NSC680420 sensitive
hsa-miR-150-5p [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-2-(hydroxymethyl)oxolan-3-yl] butanoate 379284 NSC663790 sensitive
hsa-miR-150-5p [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-2-[[[5-[4-(hexadecanoylamino)-2-oxopyrimidin-1-yl]-2-(hydroxymethyl)oxolan-3-yl]oxy-hydroxyphosphoryl]oxymethyl]oxolan-3-yl] acetate 390212 NSC687369 sensitive
hsa-miR-150-5p [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-3-hydroxyoxolan-2-yl]methoxy-N-(1-methoxy-1-oxo-3-phenylpropan-2-yl)phosphonamidic acid 384407 NSC674182 sensitive
hsa-miR-150-5p [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-3-hydroxyoxolan-2-yl]methyl (2-hydroxy-3-octadecoxypropyl) hydrogen phosphate 387050 NSC680418 sensitive
hsa-miR-150-5p [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-3-hydroxyoxolan-2-yl]methyl [5-[5-fluoro-4-(octadecylamino)-2-oxopyrimidin-1-yl]-2-(hydroxymethyl)oxolan-3-yl] hydrogen phosphate 390213 NSC687370 sensitive
hsa-miR-150-5p [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-3-hydroxyoxolan-2-yl]methyl bis(2,2,2-trichloroethyl) phosphate 382829 NSC670653 sensitive
hsa-miR-150-5p [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-3-hydroxyoxolan-2-yl]methyl butanoate 379285 NSC663791 sensitive
hsa-miR-150-5p [6-[(E)-(carbamothioylhydrazinylidene)methyl]pyridin-3-yl] 2-phenoxyacetate 9555563 NSC185057 sensitive
hsa-miR-150-5p [6-methoxy-3,4-bis-(4-methylphenyl)sulfonyloxyoxan-2-yl]methyl 4-methylbenzenesulfonate 359615 NSC620674 resistant
hsa-miR-150-5p [6,7-difluoro-4-oxido-1-oxo-3-(trifluoromethyl)quinoxalin-1-ium-2-yl]-phenylmethanone 406024 NSC723906 sensitive
hsa-miR-150-5p [7-chloro-4-oxido-1-oxo-3-(trifluoromethyl)quinoxalin-1-ium-2-yl]-(furan-2-yl)methanone 23635647 NSC728078 sensitive
hsa-miR-150-5p [7-fluoro-4-oxido-1-oxo-3-(trifluoromethyl)quinoxalin-1-ium-2-yl]-(furan-2-yl)methanone 23635646 NSC736443 sensitive
hsa-miR-150-5p [bis(aminomethyl)diethylsilane]dichloroplatinum (ii) NSC645351 sensitive
hsa-miR-150-5p [dibutyl-(2,6-difluorobenzoyl)oxy-stannyl] 2,6-difluorobenzoate 16683188 NSC643841 sensitive
hsa-miR-150-5p 1-(3-methoxyphenyl)-4-phenyl-[1,2,4]triazolo[4,3-a]quinoxaline 399100 NSC709516 sensitive
hsa-miR-150-5p 1-(4'-phthalimidopropyl-carbonyl)-5-fluorouracil 388985 NSC684405 sensitive
hsa-miR-150-5p 1-(4-chloronaphthalen-1-yl)-2-(dimethylamino)ethanol 4-methylbenzenesulfonate(1:1) 230791 NSC26074 sensitive
hsa-miR-150-5p 1-(4-chlorophenyl)-3-[(E)-1-(1H-imidazo[4,5-b]pyridin-2-yl)ethylideneamino]thiourea 135424828 NSC674103 sensitive
hsa-miR-150-5p 1-(6-bromo-2-chloroquinolin-3-yl)-n-(4-chlorophenyl)methanimine 402198 NSC716089 sensitive
hsa-miR-150-5p 1-(naphthalen-1-ylmethyl)-4-[1-(naphthalen-1-ylmethyl)piperidin-4-yl]piperidine 364095 NSC669995 sensitive
hsa-miR-150-5p 1-[(3-chloro-2-hydroxypropyl)amino]-4-[[3-(diethylamino)-2-hydroxypropyl]amino]anthracene-9,10-dione;hydrochloride 368387 NSC639365 sensitive
hsa-miR-150-5p 1-[[2-(4-chlorophenyl)-4-methylidene-5-oxooxolan-2-yl]methyl]-5-methylpyrimidine-2,4-dione 381501 NSC668257 sensitive
hsa-miR-150-5p 1-[[4-[(4-methoxy-6-nitroacridin-9-yl)amino]phenyl]sulfonyl]guanidine 391138 NSC689864 sensitive
hsa-miR-150-5p 1-[4-[4-[(5-fluoro-2,4-dioxopyrimidin-1-yl)methyl]triazol-1-yl]-5-[[(4-methoxyphenyl)-diphenylmethoxy]methyl]oxolan-2-yl]-5-methylpyrimidine-2,4-dione 392020 NSC691819 sensitive
hsa-miR-150-5p 1-[4-[tert-butyl(dimethyl)silyl]oxy-5-[[tert-butyl(dimethyl)silyl]oxymethyl]oxolan-2-yl]-5-fluoropyrimidine-2,4-dione 388209 NSC682803 sensitive
hsa-miR-150-5p 1-[5-[[[4-chlorobutyl(2,3-dihydroxypropyl)amino]-[(5-nitrofuran-2-yl)methoxy]phosphoryl]oxymethyl]-4-hydroxyoxolan-2-yl]-5-fluoropyrimidine-2,4-dione 24205136 NSC734430 sensitive
hsa-miR-150-5p 1-[6-[[tert-butyl(dimethyl)silyl]oxymethyl]-2,2-dimethyl-3a,4,6,6a-tetrahydrofuro[3,4-d][1,3]dioxol-4-yl]-5-ethynyl-6-iodopyrimidine-2,4-dione 45028651 NSC743558 sensitive
hsa-miR-150-5p 1-[6,7-dichloro-4-oxido-1-oxo-3-(trifluoromethyl)quinoxalin-1-ium-2-yl]ethanone 403949 NSC719715 sensitive
hsa-miR-150-5p 1-allyl-3-[(z)-(5-nitro-2-oxo-indolin-3-ylidene)amino]thiourea 135426761 NSC716765 sensitive
hsa-miR-150-5p 1-allyl-3-[(z)-[1-(morpholinomethyl)-5-nitro-2-oxo-indolin-3-ylidene]amino]thiourea NSC716768 sensitive
hsa-miR-150-5p 1-azido-2-phenyl-3-phenalenone 381891 NSC669152 sensitive
hsa-miR-150-5p 1-benzyl-3-chloro-4-(3-chloro-2-methylanilino)pyrrole-2,5-dione 1570150 NSC727885 sensitive
hsa-miR-150-5p 1-benzyl-3-chloro-4-(3-chloroanilino)pyrrole-2,5-dione 1554887 NSC727759 sensitive
hsa-miR-150-5p 1-di(propan-2-yloxy)phosphoryl-n'-[4-[[di(propan-2-yloxy)phosphoryl-[2-(4-nitrophenyl)hydrazinyl]methylidene]amino]phenyl]-n-(4-nitroanilino)methanimidamide 3838849 NSC652151 sensitive
hsa-miR-150-5p 1-ethoxy-4-[(E)-2-nitroethenyl]benzene 762460 NSC57187 sensitive
hsa-miR-150-5p 11-ethyl-4,5,12-trimethyl-6-thia-1,8,11-triazatricyclo[7.4.0.03,7]trideca-3(7),4,8,12-tetraen-2-one 45028557 NSC743244 sensitive
hsa-miR-150-5p 11-hydroxyusambarine chlorhydrate 401426 NSC715082 sensitive
hsa-miR-150-5p 11-pyridin-2-yl-2,12,15-triazapentacyclo[11.7.1.03,8.09,21.014,19]henicosa-1,3,5,7,9,11,13(21),14(19),15,17-decaen-20-one 4595742 NSC686554 sensitive
hsa-miR-150-5p 12-ethyl-3-methyl-8-phenyl-2,4,5,9,10,12-hexazatetracyclo[11.4.0.02,6.07,11]heptadeca-1(17),3,5,7,10,13,15-heptaene 383802 NSC672305 sensitive
hsa-miR-150-5p 13-benzoyl-18,19-dimethoxy-5,7-dioxa-13-azapentacyclo[10.7.1.02,10.04,8.016,20]icosa-1(20),2,4(8),9,16,18-hexaene-12-carbonitrile 363096 NSC627666 resistant
hsa-miR-150-5p 14,16-bis[3-(dimethylamino)propyl]-4-methoxy-10-nitro-8,14,16-triazatetracyclo[7.7.1.02,7.013,17]heptadeca-1,3,5,7,9,11,13(17)-heptaene-15-thione;hydrochloride 392049 NSC691845 sensitive
hsa-miR-150-5p 15,18-dihydroxy-5,7-dimethyl-11-thia-2,5,7,9-tetrazapentacyclo[10.8.0.02,10.03,8.014,19]icosa-1(12),3(8),9,14,16,18-hexaene-4,6,13,20-tetrone 380627 NSC666302 sensitive
hsa-miR-150-5p 170d343 259210 NSC88915 sensitive
hsa-miR-150-5p 1h-imidazole-4-carboxamide, 5-(3-methyl-1-tetrazenyl)- 135493930 NSC684047 sensitive
hsa-miR-150-5p 1h-indole, 5-bromo-3-[2-(2-pyridinyl)-4-thiazolyl]- 397551 NSC705871 sensitive
hsa-miR-150-5p 2-(2-furyl)-4-(2-nitrophenyl)-1-(4-pyridyl)-4a,7a-dihydro-4h-furo[3,4-b]pyridine-5,7-dione NSC692577 sensitive
hsa-miR-150-5p 2-(2,4-dichlorobenzyl)-3,5,6-trimethyl-2h-indazole-7-carbonitrile 367590 NSC637422 resistant
hsa-miR-150-5p 2-(4-amino-3-bromopyrrolo[2,3-d]pyridazin-1-yl)-5-(hydroxymethyl)oxolane-3,4-diol 365915 NSC634037 sensitive
hsa-miR-150-5p 2-(4-chloro-2-methylanilino)-n-[(e)-(2-chlorophenyl)methylideneamino]-6-(trifluoromethyl)pyridine-3-carboxamide 46227884 NSC747198 sensitive
hsa-miR-150-5p 2-(4-chlorophenoxy)-1-[5-hydroxy-3-(5-nitrofuran-2-yl)-5-phenyl-4,5-dihydro-1h-pyrazol-1-yl]ethanone 367872 NSC638038 sensitive
hsa-miR-150-5p 2-(4-chlorophenyl)-1-methylene-3-phenyl-pyrazino[1,2-a]benzimidazole 390230 NSC687522 resistant
hsa-miR-150-5p 2-(4-chlorophenyl)-2-(4-hydroxyiminocyclohexa-2,5-dien-1-ylidene)acetonitrile 346832 NSC405158 sensitive
hsa-miR-150-5p 2-(4-fluoroanilino)-N-[[1-[(3-phenoxyphenyl)methyl]triazol-4-yl]methyl]pyridine-3-carboxamide 90680998 NSC758359 resistant
hsa-miR-150-5p 2-(4-isothiocyanatophenyl)sulfanylacetic acid 345648 NSC403376 sensitive
hsa-miR-150-5p 2-(4-methylphenoxy)aniline 88730 NSC624229 sensitive
hsa-miR-150-5p 2-(8-(4-methoxyphenyl)-7-methyl-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-6-yl)hydrazinecarboxamide NSC667911 sensitive
hsa-miR-150-5p 2-(diethylaminomethyl)-4-[(10-methylindolo[3,2-b]quinolin-11-yl)amino]phenol;hydrochloride 373149 NSC649091 sensitive
hsa-miR-150-5p 2-[(2-aminophenyl)sulfanylmethyl]-3-methoxy-xanthen-9-one 330512 NSC319447 sensitive
hsa-miR-150-5p 2-[(3,4-dicloro)anilino]-3-phenyl-5,7-diamino quinoxaline 24203444 NSC728037 sensitive
hsa-miR-150-5p 2-[(dimethylamino)methyl]-1-(2-nitrophenyl)prop-2-en-1-one 411522 NSC34821 sensitive
hsa-miR-150-5p 2-[(dimethylamino)methyl]-1-(2,5-dimethylphenyl)prop-2-en-1-one 436059 NSC382001 sensitive
hsa-miR-150-5p 2-[(dimethylamino)methyl]-3-[(Z)-heptadec-10-enyl]-5-methoxycyclohexa-2,5-diene-1,4-dione;hydrochloride 5387996 NSC630511 sensitive
hsa-miR-150-5p 2-[(e)-(2-methyl-6-thiophen-2-ylimidazo[2,1-b][1,3]thiazol-5-yl)methylideneamino]guanidine;hydrochloride 24204549 NSC732178 sensitive
hsa-miR-150-5p 2-[(e)-(2-methyl-6-thiophen-3-ylimidazo[2,1-b][1,3]thiazol-5-yl)methylideneamino]guanidine;hydrochloride 24204551 NSC732179 sensitive
hsa-miR-150-5p 2-[(e)-[6-(2,4-dichloro-5-nitrophenyl)-2,3-dimethylimidazo[2,1-b][1,3]thiazol-5-yl]methylideneamino]guanidine;hydrochloride 9572631 NSC722877 sensitive
hsa-miR-150-5p 2-[(e)-[6-(3,6-dimethoxy-2-nitrophenyl)-2-propylimidazo[2,1-b][1,3]thiazol-5-yl]methylideneamino]guanidine;hydrochloride 9572654 NSC723548 sensitive
hsa-miR-150-5p 2-[(E)-2-(1,3-benzodioxol-5-yl)ethenyl]-5-(5-methyl-1H-pyrazol-3-yl)-1,3,4-oxadiazole 155808300 NSC763646 sensitive
hsa-miR-150-5p 2-[(E)-3-bromo-2,3-dichloro-1-nitroprop-2-enylidene]imidazolidine 3005154 NSC678033 sensitive
hsa-miR-150-5p 2-[[(e)-(4-methoxyphenyl)iminocarbamoyl]amino]-4-methyl-pentanamide 390563 NSC688071 sensitive
hsa-miR-150-5p 2-[[[4-chlorobutyl(methyl)amino]-[[5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-3-hydroxyoxolan-2-yl]methoxy]phosphoryl]oxymethyl]-5-methoxy-1-methylindole-4,7-dione 404843 NSC721387 sensitive
hsa-miR-150-5p 2-[[1H-benzimidazol-2-ylmethyl(benzyl)amino]methyl]-6-[[bis(1H-benzimidazol-2-ylmethyl)amino]methyl]-4-methylphenol;hydrochloride 386989 NSC680300 sensitive
hsa-miR-150-5p 2-[1-[(z)-3-(4-chlorophenyl)-1-(3,4-dimethoxyphenyl)-3-oxoprop-1-en-2-yl]pyridin-2-ylidene]propanedinitrile 5470857 NSC705928 sensitive
hsa-miR-150-5p 2-[16-(3,4-dimethoxyphenyl)-12,14-diphenyl-10-oxa-3,5,6,8,12,13-hexazatetracyclo[7.7.0.02,6.011,15]hexadeca-1(9),2,4,7,11(15),13-hexaen-4-yl]acetonitrile 391834 NSC691421 resistant
hsa-miR-150-5p 2-[3-methyl-N-(2-methylsulfonyloxyethyl)-4-[[4-(2-methyl-1,3-thiazol-4-yl)phenyl]iminomethyl]anilino]ethyl methanesulfonate;hydrochloride 24194270 NSC166237 sensitive
hsa-miR-150-5p 2-[4-[(2e)-2-[[(1e)-2-[4-(carboxymethoxy)-2,3-dichlorophenyl]-1-[5-(4-fluorophenyl)dithiol-3-ylidene]-2-oxoethyl]disulfanyl]-2-[5-(4-fluorophenyl)dithiol-3-ylidene]acetyl]-2,3-dichlorophenoxy]acetic a 3000383 NSC641283 sensitive
hsa-miR-150-5p 2-[4-[(e)-(4-oxochromen-3-ylidene)methyl]phenoxy]-n-(1,3-thiazol-2-yl)acetamide 45028758 NSC744063 sensitive
hsa-miR-150-5p 2-[4-[(z)-(4-oxothiochromen-3-ylidene)methyl]phenoxy]-n-(1,3-thiazol-2-yl)acetamide 45028765 NSC744070 sensitive
hsa-miR-150-5p 2-[4-[[2-(2,4-dinitrophenyl)hydrazinyl]diazenyl]phenyl]-1h-benzimidazole 6712853 NSC716951 sensitive
hsa-miR-150-5p 2-[4-[5-[2,6-dimethoxy-4-[5-(3,4,5-trimethoxyphenyl)-4,5-dihydro-1,2-oxazol-3-yl]phenoxy]pentoxy]-3-methoxyphenyl]-2,3-dihydro-1H-quinazolin-4-one 45029290 NSC746035 sensitive
hsa-miR-150-5p 2-[9-[(7-oxocyclohepta-1,3,5-trien-1-yl)amino]nonylamino]cyclohepta-2,4,6-trien-1-one 358331 NSC618296 sensitive
hsa-miR-150-5p 2-acetamido-N-(4-chloro-3-oxo-1-phenylbutan-2-yl)-4-methylpentanamide 299926 NSC173905 sensitive
hsa-miR-150-5p 2-acetyl-1,2-dihydroellipticine 376328 NSC657149 resistant
hsa-miR-150-5p 2-amino-1-N,9-N-bis[10-[(4-hydroxyphenyl)methyl]-7,11,14-trimethyl-2,5,9,12,15-pentaoxo-3-propan-2-yl-8-oxa-1,4,11,14-tetrazabicyclo[14.3.0]nonadecan-6-yl]-4,6-dimethyl-3-oxophenoxazine-1,9-dicarboxamide 16129921 NSC684901 sensitive
hsa-miR-150-5p 2-amino-4-(2-hydroxy-4-methylphenyl)-5-phenylpyrimidine 392744 NSC693547 sensitive
hsa-miR-150-5p 2-amino-4-(3,4-dimethoxyphenyl)-10-methyl-5,6-dihydro-[1]benzothiepino[4,5-c]pyridine-1-carbonitrile 391881 NSC691562 sensitive
hsa-miR-150-5p 2-amino-4-[(2e)-2-[(2,6-dichlorophenyl)methylidene]hydrazinyl]-6-morpholin-4-ylpyrimidine-5-carbonitrile 24204821 NSC733008 sensitive
hsa-miR-150-5p 2-amino-6-[4-[[4,6-bis(4-chloroanilino)-1,3,5-triazin-2-yl]amino]phenyl]-4-(4-methoxyphenyl)pyridine-3-carbonitrile 45028694 NSC743853 sensitive
hsa-miR-150-5p 2-amino-6-ethylsulfanyl-4-(furan-2-yl)pyridine-3,5-dicarbonitrile 745534 NSC731356 sensitive
hsa-miR-150-5p 2-amino-6-methyl-5-pyridin-4-ylsulfanyl-3H-quinazolin-4-one 135400184 NSC648316 sensitive
hsa-miR-150-5p 2-amino-8-fluoro-4,6-dimethyl-3-oxo-1-n,9-n-bis[7,11,14-trimethyl-2,5,9,12,15-pentaoxo-3,10-di(propan-2-yl)-8-oxa-1,4,11,14-tetrazabicyclo[14.3.0]nonadecan-6-yl]phenoxazine-1,9-dicarboxamide 383041 NSC671031 sensitive
hsa-miR-150-5p 2-amino-9-chloro-3,5-bis(4-chlorophenyl)pyrimido[4,5-c]quinolin-1-one 16126264 NSC741296 sensitive
hsa-miR-150-5p 2-amino-N-[4-chloro-2-(1H-pyrrole-2-carbonyl)phenyl]acetamide 284708 NSC140873 sensitive
hsa-miR-150-5p 2-bromo-5-methoxybenzal-2',3'-dimethoxy-5-naphthylamine 387181 NSC680717 sensitive
hsa-miR-150-5p 2-bromochalcone 5918180 NSC700203 sensitive
hsa-miR-150-5p 2-butenoic acid, 3-[(1,3-dihydroxy-2-naphthalenyl)thio]-, ethyl ester, (z)- 5358773 NSC278632 sensitive
hsa-miR-150-5p 2-hydroxy-5-({(e)-[(10-hydroxyacridin-9(10h)-ylidene)methyl]diazenyl}sulfonyl)benzoic acid 363212 NSC627890 sensitive
hsa-miR-150-5p 2-hydroxy-6,6-dimethyl-4-[(e)-(p-tolylhydrazono)methyl]cyclohexa-2,4-diene-1,1,3-tricarbonitrile 9571495 NSC672219 sensitive
hsa-miR-150-5p 2-isopropyl-11-oxo-n-[2-(4-phenylpiperazin-1-yl)ethyl]-11h-pyrido[2,1-b]quinazoline-8-carboxamide 353192 NSC600684 sensitive
hsa-miR-150-5p 2-isoquinolin-2-ium-2-yl-1-phenanthren-3-ylethanone;iodide 5351160 NSC35489 sensitive
hsa-miR-150-5p 2-mercapto-6-(2-phenylhydrazino)-4-pyrimidinol 3005146 NSC677260 sensitive
hsa-miR-150-5p 2-methyl-1-(2,3,4,5,6-pentafluorobenzoyl)-1h-benzimidazole 383504 NSC671889 sensitive
hsa-miR-150-5p 2-methyl-n-[3-[methyl-[3-[(2-methylbenzo[g]indazole-3-carbonyl)amino]propyl]amino]propyl]benzo[g]indazole-3-carboxamide 403555 NSC718579 sensitive
hsa-miR-150-5p 2-n,4-n-bis(4-chlorophenyl)-6-n-[4-[5-(3,4,5-trimethoxyphenyl)-1,2-oxazol-3-yl]phenyl]-1,3,5-triazine-2,4,6-triamine 45028707 NSC743876 sensitive
hsa-miR-150-5p 2-n,4-n-bis(4-chlorophenyl)-6-n-[4-[5-(4-methoxyphenyl)-1,2-oxazol-3-yl]phenyl]-1,3,5-triazine-2,4,6-triamine 45028705 NSC743874 sensitive
hsa-miR-150-5p 2-phenyl-N-[3-[4-[3-[(2-phenylquinoline-4-carbonyl)amino]propyl]piperazin-1-yl]propyl]quinoline-4-carboxamide;hydrochloride 384385 NSC674092 sensitive
hsa-miR-150-5p 2-propenyl estradiol 5468270 NSC667047 sensitive
hsa-miR-150-5p 2,1,3-benzoselanadiazole, nitro-6-(trifluoromethyl)- 362897 NSC627371 sensitive
hsa-miR-150-5p 2,2'-spirobi[3,6,7,8-tetrahydro-1H-cyclopenta[g]naphthalene]-5,5'-dione 382634 NSC670283 sensitive
hsa-miR-150-5p 2,2'(1h,1'h)-spirobi[s-indacen]-1-one, 4'-acetyl-3,3',5,5',6,6',7,7'-octahydro- 382664 NSC670312 sensitive
hsa-miR-150-5p 2,3-dibromo-4-(5-chloro-2-methoxyanilino)-4-oxobutanoic acid 307450 NSC205555 sensitive
hsa-miR-150-5p 2,3,6,7-tetrabenzoylthiopyrano[3,2-b]thiopyran-4,8-dione 399527 NSC710391 sensitive
hsa-miR-150-5p 2,5-cyclohexadiene-1,4-dione, 2,3-dimethoxy-5-(2-naphthalenylthio)- 314728 NSC234214 sensitive
hsa-miR-150-5p 2,5-dibenzyl-2-[(dimethylamino)methyl]cyclopentan-1-one;hydrochloride 368538 NSC639617 sensitive
hsa-miR-150-5p 2,6-dibenzylidenecyclohexanone 1550330 NSC40618 sensitive
hsa-miR-150-5p 2,6-dichloro-7-[4-(4-methylphenoxy)-5-[(4-methylphenoxy)methyl]oxolan-2-yl]purine 389535 NSC685833 sensitive
hsa-miR-150-5p 2,6-dimethoxy-4-[7-methyl-6-(2-phenylhydrazinyl)-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-8-yl]phenol NSC671173 sensitive
hsa-miR-150-5p 2,6-dimethyl-4-(3-nitrophenyl)-3-n,5-n-bis(4-nitrophenyl)-1,4-dihydropyridine-3,5-dicarboxamide 367764 NSC637703 sensitive
hsa-miR-150-5p 2,9-bis(bromomethyl)-1,10-phenanthroline 353741 NSC602850 sensitive
hsa-miR-150-5p 2[4'aminobiphenyl]5,6dichlorobenzimidazole 24205088 NSC734231 sensitive
hsa-miR-150-5p 2h-1-benzopyran-2-one, 4-(2-benzofuranyl)-7-methoxy- 364364 NSC630375 resistant
hsa-miR-150-5p 3-(2-(5-bromo-2-hydroxyphenyl)-3-chloro-4-oxo-1-azetidinyl)-4(3h)-quinazolinone 373572 NSC650025 sensitive
hsa-miR-150-5p 3-(2-aminoethylsulfanyl)propanoic acid 420295 NSC122621 sensitive
hsa-miR-150-5p 3-(2-fluoro-2,2-dinitro-ethoxy)propane-1,2-diol 388365 NSC683260 sensitive
hsa-miR-150-5p 3-(4-bromophenyl)-2-methylbenzo[f]benzimidazole-4,9-dione 229013 NSC22348 sensitive
hsa-miR-150-5p 3-(4-chlorophenyl)-2-(3,4,5-trimethoxyphenyl)-1,3-thiazolidin-4-one 396385 NSC702338 sensitive
hsa-miR-150-5p 3-(4-fluorophenyl)-3-(4-hydroxy-2-methylphenyl)phthalide 387973 NSC682335 resistant
hsa-miR-150-5p 3-(4-fluorophenyl)-4-methyl-8-pyrrolidin-1-yl-8H-thieno[2,3-b]pyrrolizin-4-ium;iodide 388534 NSC683516 sensitive
hsa-miR-150-5p 3-[(1-benzyl-4-chloro-2,5-dioxopyrrol-3-yl)amino]-N-(2,3-dichlorophenyl)benzamide 1574647 NSC728128 sensitive
hsa-miR-150-5p 3-[(1-benzyl-4-chloro-2,5-dioxopyrrol-3-yl)amino]-N-[2-chloro-5-(trifluoromethyl)phenyl]benzamide 1574661 NSC732851 sensitive
hsa-miR-150-5p 3-[(3,5-dibenzyloxyphenyl)-(4-hydroxy-2-oxo-chromen-3-yl)methyl]-4-hydroxy-chromen-2-one 54682817 NSC686385 sensitive
hsa-miR-150-5p 3-[(3,5-dichlorobenzyl)(methyl)amino]-1,2-diphenylpropan-1-one 360991 NSC623723 sensitive
hsa-miR-150-5p 3-[(E)-3-(4-chlorophenyl)prop-2-enoyl]-2-hydroxycyclohepta-2,4,6-trien-1-one 5918418 NSC356777 sensitive
hsa-miR-150-5p 3-[2-(1h-indol-3-yl)-2-oxoethyl]quinoxalin-2(1h)-one 400273 NSC711806 sensitive
hsa-miR-150-5p 3-[4-[(1z)-1-[1-(4-bromophenyl)-2-(2-chloro-5-nitrophenyl)-5-oxoimidazol-4-ylidene]ethyl]-n-(2-cyanoethyl)-3-methylanilino]propanenitrile 3004303 NSC643740 sensitive
hsa-miR-150-5p 3-[5-amino-3-(4-chlorophenyl)pyrazol-1-yl]-6-[(e)-2-(furan-2-yl)ethenyl]-4h-1,2,4-triazin-5-one 135968229 NSC748494 sensitive
hsa-miR-150-5p 3-[6-(2,5-dioxo-4,4-diphenylimidazolidin-1-yl)hexyl]-5,5-diphenylimidazolidine-2,4-dione 343242 NSC382386 resistant
hsa-miR-150-5p 3-{2-[4,6-bis(trifluoromethyl)pyrimidin-2(5h)-ylidene]hydrazinyl}-5,6-diphenyl-1,2,4-triazine 360651 NSC622958 sensitive
hsa-miR-150-5p 3-chloro-4-[[2-[2-chloro-4-(4,6-diamino-2,2-dimethyl-1,3,5-triazin-1-yl)phenoxy]acetyl]amino]benzenesulfonyl fluoride;ethanesulfonic acid 277243 NSC125845 sensitive
hsa-miR-150-5p 3-deazauridine 277822 NSC126849 sensitive
hsa-miR-150-5p 3-ethyl-9,10-dimethoxy-2-(1,2,3,4-tetrahydroisoquinolin-1-ylmethyl)-4,6,7,11b-tetrahydro-1H-benzo[a]quinolizine 421494 NSC134754 sensitive
hsa-miR-150-5p 3-oxospiro[1H-indene-2,6'-2,3,5,7-tetrahydro-1H-s-indacene]-4'-carboxylic acid 384728 NSC674964 sensitive
hsa-miR-150-5p 3-phenyl-6-(trifluoromethyl)-n-(3,4,5-trimethoxyphenyl)-2-quinoxalinamine 364818 NSC631578 sensitive
hsa-miR-150-5p 3,12,15,24-tetramethoxy-7,8,19,20-tetrathiapentacyclo[19.3.1.12,6.19,13.114,18]octacosa-1(24),2,4,6(28),9(27),10,12,14,16,18(26),21(25),22-dodecaene-25,26,27,28-tetrol 402151 NSC716011 sensitive
hsa-miR-150-5p 3,19-(4-acetamido)benzylidineandrographolide 54612901 NSC747452 sensitive
hsa-miR-150-5p 3,19-benzylidine-14-deoxy-11,12-didehydroandrographolide 54612900 NSC747451 sensitive
hsa-miR-150-5p 3,4,5-trimethoxy-n-(4h-pyrrolo[2,1-c][1,4]benzoxazin-1-ylmethyl)aniline 403776 NSC719249 sensitive
hsa-miR-150-5p 3,4,8-trimethyl-7-((2-methyl-4-methylene-5-oxotetrahydro-2-furanyl)methoxy)-2h-chromen-2-one 381508 NSC668264 sensitive
hsa-miR-150-5p 4-((3-(hydroxy(oxido)amino)-5-methoxy-9-acridinyl)amino)-n-(2-pyrimidinyl)benzenesulfonamide 391139 NSC689865 sensitive
hsa-miR-150-5p 4-(1,3-benzothiazol-2-yl)-1-[2-chloro-5-(trifluoromethyl)phenyl]-5-imino-2H-pyrrol-3-ol 135438224 NSC732962 sensitive
hsa-miR-150-5p 4-(1,4-dioxobenzo[a]carbazol-11-yl)benzonitrile 397017 NSC704280 sensitive
hsa-miR-150-5p 4-(2-(2-chloroanilino)-4-methyl-1,3-thiazol-5-yl)-n-(2-isopropyl-6-methylphenyl)-2,4-dioxobutanamide 377043 NSC658259 sensitive
hsa-miR-150-5p 4-(2-pyridinyl)-5h-1,2,3-dithiazole-5-thione 25181424 NSC741898 sensitive
hsa-miR-150-5p 4-(3-thioxodithiol-4-yl)-5,6-dihydrodithiolo[5,4-b][1,4]thiazine-3-thione 398473 NSC708376 resistant
hsa-miR-150-5p 4-(4-chlorophenyl)-1,1-dimethyl-4,5-dihydro-1h,3h-[1,3,5]oxadiazepino[5,6-a]benzimidazole 374204 NSC651694 sensitive
hsa-miR-150-5p 4-(5-(4-(hydroxy(oxido)amino)phenyl)-2-furyl)-2-(4-toluidino)-1,3-thiazole 367868 NSC638034 sensitive
hsa-miR-150-5p 4-(6-thioguanine)-7-nitro-2,1,3-benzoxadiazole 3246652 NSC348401 sensitive
hsa-miR-150-5p 4-(dimethylaminodiazenyl)-5-methyl-n-[(e)-thiophen-2-ylmethylideneamino]-1h-pyrazole-3-carboxamide 135545660 NSC131258 sensitive
hsa-miR-150-5p 4-[(1-benzyl-4-chloro-2,5-dioxopyrrol-3-yl)amino]-N-(2-methoxyphenyl)benzamide 1194947 NSC732826 sensitive
hsa-miR-150-5p 4-[(1-benzyl-4-chloro-2,5-dioxopyrrol-3-yl)amino]-N-(5-chloro-2-methoxyphenyl)benzamide 1194969 NSC728134 sensitive
hsa-miR-150-5p 4-[(1-benzyl-4-chloro-2,5-dioxopyrrol-3-yl)amino]-N-[2-(3,4-dimethoxyphenyl)ethyl]benzamide 1194992 NSC732832 sensitive
hsa-miR-150-5p 4-[(1-benzyl-4-chloro-2,5-dioxopyrrol-3-yl)amino]-N-[3-(trifluoromethyl)phenyl]benzamide 1194958 NSC732841 sensitive
hsa-miR-150-5p 4-[(2Z)-2-[1-amino-3-(methylamino)-1,3-bis(sulfanylidene)propan-2-ylidene]hydrazinyl]-1H-imidazole-5-carboxamide 5466293 NSC684046 sensitive
hsa-miR-150-5p 4-[(4-carbamimidoylphenyl)diazenyl]-3-hydroxy-n-phenylnaphthalene-2-carboxamide;hydrochloride 135502362 NSC359466 sensitive
hsa-miR-150-5p 4-[(4z)-5-oxo-4-[(4-phenoxyphenyl)methylidene]-2-phenylimidazol-1-yl]-n-(1,3-thiazol-2-yl)benzenesulfonamide 5472414 NSC718649 sensitive
hsa-miR-150-5p 4-[(6-chloro-4h-1,3-benzodioxin-8-yl)methylsulfanyl]pyrrolo[1,2-a]quinoxaline 331156 NSC321491 resistant
hsa-miR-150-5p 4-[(6-sulfanylidene-3,7-dihydropurin-8-yl)diazenyl]benzenesulfonamide 3246283 NSC75140 sensitive
hsa-miR-150-5p 4-[(e)-2-[3-(4-chlorophenyl)-6a,10b-dimethyl-8-methylidene-1,4a,5,6,7,9,10,10a-octahydronaphtho[2,1-d][1,3]dioxin-7-yl]ethenyl]-2h-furan-5-one 54613025 NSC750038 sensitive
hsa-miR-150-5p 4-[(z)-(5-methoxy-1-methyl-2-phenylpyrazolo[1,5-a]indol-1-ium-4-ylidene)methyl]-n,n-dimethylaniline;trifluoromethanesulfonate 5471991 NSC715777 sensitive
hsa-miR-150-5p 4-[(z)-indolo[1,2-b]indazol-11-ylidenemethyl]-n,n-dimethylaniline 5472473 NSC719163 sensitive
hsa-miR-150-5p 4-[[(4S,9aR)-9-(4-hydroxy-3,5-dimethoxyphenyl)-6,7-dimethoxy-1-oxo-3a,4,9,9a-tetrahydro-3H-benzo[f][2]benzofuran-4-yl]amino]benzonitrile 369961 NSC642328 sensitive
hsa-miR-150-5p 4-[[(5s,8ar)-9-(4-hydroxy-3,5-dimethoxyphenyl)-8-oxo-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[5,6-f][1,3]benzodioxol-5-yl]amino]benzonitrile 363636 NSC628665 sensitive
hsa-miR-150-5p 4-[[4-chloro-1-[(2,4-dichlorophenyl)methyl]-2,5-dioxopyrrol-3-yl]amino]-N-[3-(trifluoromethyl)phenyl]benzamide 1640172 NSC732698 sensitive
hsa-miR-150-5p 4-[2-(5,6-dihydrobenzo[a]carbazol-11-yl)ethyl]morpholine 390894 NSC689069 sensitive
hsa-miR-150-5p 4-[2,3,4,5-tetrakis(phenylmethoxy)pentyl]piperidine-2,6-dione 386082 NSC677672 sensitive
hsa-miR-150-5p 4-[3-(3,4-dihydro-1h-isoquinolin-2-yl)prop-1-en-2-yl]-n-pyrazin-2-ylbenzamide 24205286 NSC734949 sensitive
hsa-miR-150-5p 4-acetylspiro[1,3,5,6,7,8-hexahydrocyclopenta[b]naphthalene-2,2'-3,6,7,8-tetrahydro-1h-cyclopenta[g]naphthalene]-5'-one 382750 NSC670428 sensitive
hsa-miR-150-5p 4-appt 5995211 NSC195327 sensitive
hsa-miR-150-5p 4-chloro-5-(pyridin-2-ylthio)-3h-1,2-dithiole-3-thione 16766538 NSC729183 sensitive
hsa-miR-150-5p 4-chloro-5-phenoxy-3h-1,2-dithiole-3-thione 16766044 NSC729184 sensitive
hsa-miR-150-5p 4-chloro-6,7,8-triethoxyquinazoline 330473 NSC319079 sensitive
hsa-miR-150-5p 4-methoxy-2-nitronaphtho[2,1-b]furan 100603 NSC329226 sensitive
hsa-miR-150-5p 4-methyl-3-[4-[2-[4-(4-methyl-5-sulfanylidene-1h-1,2,4-triazol-3-yl)phenyl]iminohydrazinyl]phenyl]-1h-1,2,4-triazole-5-thione 5472009 NSC715974 sensitive
hsa-miR-150-5p 4-methyl-n'-[7-methyl-8-(3,4,5-trimethoxyphenyl)-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-6-yl]benzenesulfonohydrazide 381384 NSC667924 sensitive
hsa-miR-150-5p 4-morpholin-4-yl-6-[(Z)-2-(5-nitrothiophen-2-yl)ethenyl]-1,3,5-triazin-2-amine 24205526 NSC736081 sensitive
hsa-miR-150-5p 4-morpholinecarbodithioic acid, antimony complex NSC625498 sensitive
hsa-miR-150-5p 4-n,n-bis-2'-cyanoethylaminobenzylidene-4-fluoro aniline 359414 NSC620277 sensitive
hsa-miR-150-5p 4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1H-2-benzofuran-1-yl)-N-[3-(trifluoromethyl)phenyl]butanamide 369471 NSC641241 sensitive
hsa-miR-150-5p 4-nitro-n-[4-(pyridin-4-ylamino)phenyl]benzamide 4261343 NSC146769 sensitive
hsa-miR-150-5p 4-oxatetracyclo[8.2.2.12,5.09,15]pentadeca-2,5,7,9(15),13-pentaene-11,11,12,12-tetracarbonitrile 363912 NSC629301 sensitive
hsa-miR-150-5p 4-piperidinone, 3,5-bis[(4-fluorophenyl)methylene]-, (e,e)- 5469267 NSC685126 sensitive
hsa-miR-150-5p 4,6,6-trimethyl-4-[(e)-4-phenylsulfanylbut-1-enyl]norpinan-2-one 5469503 NSC689222 sensitive
hsa-miR-150-5p 5-(3-methoxyphenyl)-3-(3,4,5-trimethoxyphenyl)-4,5-dihydro-1h-pyrazole 45028260 NSC741942 sensitive
hsa-miR-150-5p 5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-3-hydroxyoxolane-2-carboxylic acid 266285 NSC103704 sensitive
hsa-miR-150-5p 5-[(E)-3-(4-methoxyphenyl)prop-2-enylidene]-2-sulfanylidene-1,3-diazinane-4,6-dione 5874667 NSC684569 sensitive
hsa-miR-150-5p 5-[1-(benzylsulfanyl)-2-nitroethyl]-1,3-benzodioxole 379577 NSC664266 sensitive
hsa-miR-150-5p 5-[2-(2,5-dimethoxyphenyl)ethynyl]-N-hexyl-2-methoxybenzamide 403659 NSC718727 sensitive
hsa-miR-150-5p 5-[4-[(7-chloroquinolin-4-yl)amino]phenyl]-3-(4-methoxyphenyl)-3,4-dihydropyrazole-2-carbaldehyde 72374707 NSC759016 sensitive
hsa-miR-150-5p 5-[4-[(7-chloroquinolin-4-yl)amino]phenyl]-3-(4-methylphenyl)-3,4-dihydropyrazole-2-carbaldehyde 72374709 NSC759018 sensitive
hsa-miR-150-5p 5-[5-(5-formyl-4-propyl-1h-pyrrol-2-yl)-2-thienyl]-3-propyl-1h-pyrrole-2-carbaldehyde 374810 NSC653147 sensitive
hsa-miR-150-5p 5-amino-2-(4-chloroanilino)-1,3-thiazole-4-carbonitrile 367981 NSC638199 sensitive
hsa-miR-150-5p 5-amino-2-[(10-methylacridin-10-ium-9-yl)methylamino]-5-oxopentanoic acid;methyl hydrogen sulfate 498398 NSC627745 sensitive
hsa-miR-150-5p 5-benzyl-5h-benzo[b]phosphindole 5-oxide 380786 NSC666496 sensitive
hsa-miR-150-5p 5-bromo-1-[[2-(4-bromophenyl)-4-methylene-5-oxo-tetrahydrofuran-2-yl]methyl]pyrimidine-2,4-dione 381503 NSC668259 sensitive
hsa-miR-150-5p 5-bromo-1-[[4-methylidene-5-oxo-2-(4-phenylphenyl)oxolan-2-yl]methyl]pyrimidine-2,4-dione 381504 NSC668260 sensitive
hsa-miR-150-5p 5-fluoro-N-(2-methyl-3-oxo-8-phenyl-1-thia-4-azaspiro[4.5]decan-4-yl)-3-phenyl-1H-indole-2-carboxamide 24205446 NSC735540 sensitive
hsa-miR-150-5p 5-fur 1821 NSC146604 sensitive
hsa-miR-150-5p 5-methyl-1-[[4-methylene-5-oxo-2-(4-phenylphenyl)tetrahydrofuran-2-yl]methyl]pyrimidine-2,4-dione 381502 NSC668258 sensitive
hsa-miR-150-5p 5-methyl-2-(4-phenoxyphenyl)isothiazolo[5,4-b]pyridin-3(2h)-one 393165 NSC694619 sensitive
hsa-miR-150-5p 5-methyl-7-[(z)-2-(1-methylquinolin-1-ium-2-yl)ethenyl]quinolin-8-ol;iodide 135534469 NSC86368 sensitive
hsa-miR-150-5p 5-tert-butyl-2-(2-(4-tert-butyl-2-(formylamino)phenoxy)ethoxy)phenylformamide 394579 NSC698148 sensitive
hsa-miR-150-5p 5-tert-butyl-2-[2-[2-[4-tert-butyl-2-[(4-nitrophenyl)sulfamoyl]phenoxy]ethoxy]ethoxy]-n-(4-nitrophenyl)benzenesulfonamide 360745 NSC623084 sensitive
hsa-miR-150-5p 5,11-dimethyl-10h-pyrido[2,3-b]carbazol-7-ol 379123 NSC663337 sensitive
hsa-miR-150-5p 5,7-dibromo-2-[(e)-2-(4-hydroxy-3-methoxyphenyl)ethenyl]quinolin-8-ol 135460261 NSC67090 sensitive
hsa-miR-150-5p 5,7-dimethoxy-2-[(2-methyl-1,3-dioxan-2-yl)methyl]naphthalene-1,4-dione 372272 NSC647328 sensitive
hsa-miR-150-5p 5660ah 22658 NSC30863 sensitive
hsa-miR-150-5p 6-(2-furyl)-4-(2-nitrophenyl)-1-(4-pyridyl)-4h-pyridine-2,3-dicarboxylic acid 392302 NSC692578 sensitive
hsa-miR-150-5p 6-(2-furyl)-4-(2-nitrophenyl)-1-(4-pyridyl)-4h-pyridine-3-carboxylic acid 392306 NSC692582 sensitive
hsa-miR-150-5p 6-(2-piperazin-1-ylethyl)indeno[1,2-c]isoquinoline-5,11-dione 11291330 NSC725670 sensitive
hsa-miR-150-5p 6-(3-aminopropyl)-9-bromo-3-nitroindeno[1,2-c]isoquinoline-5,11-dione;hydrochloride 17755124 NSC734562 sensitive
hsa-miR-150-5p 6-(3-aminopropyl)-9-fluoro-2,3-dimethoxyindeno[1,2-c]isoquinoline-5,11-dione;hydrochloride 17755624 NSC740564 sensitive
hsa-miR-150-5p 6-(3-azidopropyl)-2,3,9-trimethoxyindeno[1,2-c]isoquinoline-5,11-dione 17755406 NSC737342 sensitive
hsa-miR-150-5p 6-(3-azidopropyl)-9-fluoro-2,3-dimethoxyindeno[1,2-c]isoquinoline-5,11-dione 17755409 NSC740524 sensitive
hsa-miR-150-5p 6-(3-bromopropyl)-9-methyl-3-nitroindeno[1,2-c]isoquinoline-5,11-dione 17756502 NSC736005 sensitive
hsa-miR-150-5p 6-(3-chloropropyl)-3-nitro-5,11-dioxoindeno[1,2-c]isoquinoline-9-carbonitrile 17756602 NSC740975 sensitive
hsa-miR-150-5p 6-(3-chloropropyl)-7-methoxy-3-nitroindeno[1,2-c]isoquinoline-5,11-dione 16098805 NSC733883 sensitive
hsa-miR-150-5p 6-(3-imidazol-1-ylpropyl)-9-methoxyindeno[1,2-c]isoquinoline-5,11-dione 17755851 NSC740648 sensitive
hsa-miR-150-5p 6-(5-aminopentyl)indeno[1,2-c]isoquinoline-5,11-dione;hydrochloride 16221201 NSC736829 sensitive
hsa-miR-150-5p 6-[2-[2-[2-(trifluoromethyl)phenyl]ethynyl]phenyl]hex-5-yn-1-ol 16750522 NSC735001 sensitive
hsa-miR-150-5p 6-[3-(3-aminopropylamino)propyl]-13-[3-[(2-methoxyphenyl)methylamino]propyl]-6,13-diazatetracyclo[6.6.2.04,16.011,15]hexadeca-1(15),2,4(16),8,10-pentaene-5,7,12,14-tetrone 137645384 NSC760979 sensitive
hsa-miR-150-5p 6-[3-(dimethylamino)propyl]-3-nitroindeno[1,2-c]isoquinoline-5,11-dione 44409874 NSC734872 sensitive
hsa-miR-150-5p 6-[4-(1-cyclohexenyl)-1,3-butadiyn-1-yl]-2(2h)-pyranone 10263039 NSC726863 sensitive
hsa-miR-150-5p 6-[4-[(2R,3R)-3-(hydroxymethyl)oxiran-2-yl]buta-1,3-diynyl]pyran-2-one 11816756 NSC730868 sensitive
hsa-miR-150-5p 6-benzyloxyhexanal 389877 NSC686505 sensitive
hsa-miR-150-5p 6-bromo-2,10-dithiatetracyclo[10.8.0.04,9.014,19]icosa-1(20),4(9),5,7,12,14,16,18-octaene-3,11-dione 397767 NSC706190 sensitive
hsa-miR-150-5p 6-chloro-1-(2-nitrophenyl)sulfonyl-3,4-dihydro-2h-quinoline 380120 NSC665522 sensitive
hsa-miR-150-5p 6-chloro-1,2,3-benzodithiazol-1-ium;chloride 359816 NSC621376 sensitive
hsa-miR-150-5p 6-chloro-3-[(Z)-[2-(4-methoxyphenyl)benzimidazol-5-ylidene]methyl]-1H-indol-2-ol 155806854 NSC763703 sensitive
hsa-miR-150-5p 6-chloro-8-[(3,5-dimethoxyphenyl)methyl]-7-phenyl-4,5-dihydropyrrolo[3,2-g][1,2]benzoxazole 60148312 NSC754118 sensitive
hsa-miR-150-5p 6-chloro-9-[[4-(chloromethyl)phenyl]methyl]purine 24204347 NSC731409 sensitive
hsa-miR-150-5p 6-chloro-n-[2-[2-[(6-chloro-2-methoxyacridin-9-yl)amino]phenyl]phenyl]-2-methoxyacridin-9-amine 371158 NSC645159 sensitive
hsa-miR-150-5p 6-ethoxy-2-(hydroxymethyl)-2h-pyran-3(6h)-one 398342 NSC708062 sensitive
hsa-miR-150-5p 6-methoxyquinoline-4-carbaldehyde;2,4,6-trinitrophenol 258759 NSC88054 sensitive
hsa-miR-150-5p 6-phenyl-6h-indeno[1,2-c]isoquinoline-5,11-dione 334247 NSC338643 resistant
hsa-miR-150-5p 6,7-dihydro-5h-benzo[3,4]cyclohepta[1,2-b]quinolin-13-amine 402658 NSC716845 sensitive
hsa-miR-150-5p 64c9bv8lpj 683248 NSC328130 sensitive
hsa-miR-150-5p 7-[(E)-2-(1,6-dimethylquinolin-1-ium-2-yl)ethenyl]-5-methylquinolin-8-ol 135483953 NSC86371 sensitive
hsa-miR-150-5p 7-[(naphthalen-1-ylamino)(phenyl)methyl]quinolin-8-ol 256754 NSC84092 sensitive
hsa-miR-150-5p 7-chloro-10,11-dimethoxy-2,8-diazatricyclo[7.3.1.05,13]trideca-1(12),5,7,9(13),10-pentaene-3,4-dione 397794 NSC706232 sensitive
hsa-miR-150-5p 7-chloro-3-[3-(dimethylamino)propylamino]-1,4-dioxido-quinoxaline-1,4-diium-2-carbonitrile 135418452 NSC689727 sensitive
hsa-miR-150-5p 7-chloro-6-(2-morpholin-4-ylethylamino)quinoline-5,8-dione 379078 NSC663285 sensitive
hsa-miR-150-5p 7-chlorobenzo[c]quinolizin-11-ium-6-amine;chloride 386892 NSC679795 sensitive
hsa-miR-150-5p 7-epi-3,4-bis-nor-dolastatin 11 396354 NSC702158 sensitive
hsa-miR-150-5p 7-fluoro-2-benzoyl-3-trifluoromethylquioxaline 1,4-dioxide 23635154 NSC740385 sensitive
hsa-miR-150-5p 7-hydroxy-2-nonyl-4h-chromen-4-one 5375154 NSC631965 sensitive
hsa-miR-150-5p 7h-5,6-dithioleno[4,3-d]uracil 388876 NSC684074 sensitive
hsa-miR-150-5p 7z-plakortide h 5472712 NSC721049 sensitive
hsa-miR-150-5p 8-[[3-[(10,10-dimethyl-5-pyridin-2-yl-4-azatricyclo[7.1.1.02,7]undeca-2,4,6-trien-8-yl)methyl]phenyl]methyl]-10,10-dimethyl-5-pyridin-2-yl-4-azatricyclo[7.1.1.02,7]undeca-2,4,6-triene 496183 NSC681462 sensitive
hsa-miR-150-5p 8-chloro-adenosine 337175 NSC354258 sensitive
hsa-miR-150-5p 8-chloro-n-[2-(dimethylamino)ethyl]-11h-pyrido[2,3-a]carbazole-5-carboxamide 44139299 NSC741237 sensitive
hsa-miR-150-5p 8-hydroxy-5-iodoquinoline 96111 NSC53183 sensitive
hsa-miR-150-5p 8-hydroxy-7-[[4-[(E)-2-[4-[(8-hydroxy-5-sulfoquinoline-7-carbonyl)amino]-2-sulfophenyl]ethenyl]-3-sulfophenyl]carbamoyl]quinoline-5-sulfonic acid 5468154 NSC665534 sensitive
hsa-miR-150-5p 8-hydroxymanzamine a 5468481 NSC670852 sensitive
hsa-miR-150-5p 8-methoxybenzimidazo[2,1-b][1,3,5]benzothiadiazepin-12(13h)-imine 383196 NSC671315 sensitive
hsa-miR-150-5p 8-methylbenzimidazolo[2,1-b][1,3,5]benzothiadiazepin-12-amine;hydrochloride 383197 NSC671316 sensitive
hsa-miR-150-5p 8(5h)-quinolinone, 7-chloro-5-[[4-(diethylamino)-2-methylphenyl]imino]- 363174 NSC627778 sensitive
hsa-miR-150-5p 9-(2-(4-(((amino(imino)methyl)amino)sulfonyl)phenyl)hydrazino)acridine 385775 NSC677169 sensitive
hsa-miR-150-5p 9-(3,4-dichlorophenyl)-2,7-bis[(dimethylamino)methyl]-3,4,5,6,7,9-hexahydro-2H-xanthene-1,8-dione 435524 NSC371488 sensitive
hsa-miR-150-5p 9-(oxan-2-yl)-1,3-diphenyl-2-sulfanylidenepurin-6-one 387937 NSC682242 resistant
hsa-miR-150-5p 9-.alpha.-acetoxyparthenolide 5906991 NSC672116 sensitive
hsa-miR-150-5p 9-[4-[(4,6-dimethylpyrimidin-2-yl)sulfamoyl]anilino]-n-(2-hydroxyethyl)acridine-4-carboxamide 384527 NSC674498 sensitive
hsa-miR-150-5p 9-[9-amino-2,2,4,4-tetra(propan-2-yl)-6a,8,9,9a-tetrahydro-6H-furo[3,2-f][1,3,5,2,4]trioxadisilocin-8-yl]purin-6-amine 390181 NSC687330 sensitive
hsa-miR-150-5p 9-amino-6-(3-azidopropyl)-2,3-dimethoxyindeno[1,2-c]isoquinoline-5,11-dione 17755320 NSC740033 sensitive
hsa-miR-150-5p 9-chlorobenzo[c]quinolizin-11-ium-6-amine;chloride 386894 NSC679796 sensitive
hsa-miR-150-5p 9-tert-butyl-4-(4-methoxyphenyl)-16-nitro-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 376308 NSC657023 sensitive
hsa-miR-150-5p 9,14-dihydroxy-16-methyl-2,11-dioxo-15-azatetracyclo[8.7.0.01,14.03,8]heptadeca-3,5,7,9,12,16-hexaene-17-carbonitrile 405342 NSC722565 sensitive
hsa-miR-150-5p 9h-purine, 2-amino-6-(2,4-dichlorobenzylthio)-9-isobutyl- 240896 NSC47786 sensitive
hsa-miR-150-5p Acetamide, n-(2-mercaptoethyl)-, benzoate (6ci, 7ci) 281604 NSC134459 sensitive
hsa-miR-150-5p Act01953 384164 NSC673455 sensitive
hsa-miR-150-5p Actinomycin x4357g methoxime 9573583 NSC237671 sensitive
hsa-miR-150-5p Aj-131/36477019 384476 NSC674278 resistant
hsa-miR-150-5p Ak136303 388306 NSC682996 sensitive
hsa-miR-150-5p Antineoplastic-301477 152904 NSC301477 sensitive
hsa-miR-150-5p Antineoplastic-641319 24202347 NSC641319 sensitive
hsa-miR-150-5p Antineoplastic-656904 376224 NSC656904 sensitive
hsa-miR-150-5p Aplidazole c . tfa 362402 NSC626167 sensitive
hsa-miR-150-5p Ar-685/43362993 11842566 NSC733154 sensitive
hsa-miR-150-5p Arnebin 32465 NSC140377 sensitive
hsa-miR-150-5p Aromoline 122728 NSC93674 sensitive
hsa-miR-150-5p Arq monoacetate 385441 NSC676676 sensitive
hsa-miR-150-5p Artelasticin 5471311 NSC710342 sensitive
hsa-miR-150-5p Artelastin 399488 NSC710340 sensitive
hsa-miR-150-5p Arylmethylene-f 5473168 NSC724319 sensitive
hsa-miR-150-5p B676297k277 3',4'-deoxypsorospermin 3',4'-chlorohydrin 354175 NSC605099 sensitive
hsa-miR-150-5p Baccharin 5358645 NSC269757 sensitive
hsa-miR-150-5p Baccharinoid a-1 (busam) 5458898 NSC375726 sensitive
hsa-miR-150-5p Bc 76 246230 NSC58905 sensitive
hsa-miR-150-5p Benzimidazolo[2,1-b][1,3,5]benzothiadiazepin-12-amine;hydrochloride 383190 NSC671311 sensitive
hsa-miR-150-5p Benzofurazan, 4-nitro-7-(2-pyridinylthio)-, n-oxide 313619 NSC228155 sensitive
hsa-miR-150-5p Benzoxazole, 2-[(1-methyl-4-nitro-1h-imidazol-5-yl)thio]- 364608 NSC631136 sensitive
hsa-miR-150-5p Benzyl (2s)-2-[methyl-[(2s)-1-[(2s)-3-methyl-2-[methyl-[3-methyl-2-[methyl-[(2s)-3-methyl-2-[(2-methylpropan-2-yl)oxycarbonylamino]butanoyl]amino]butanoyl]amino]butanoyl]pyrrolidine-2-carbonyl]amino]- 6712043 NSC653624 sensitive
hsa-miR-150-5p Benzyl 2-(dibenzylamino)-3-phenylpropanoate 375616 NSC655438 sensitive
hsa-miR-150-5p Benzyl N,N-dimethyl-N'-(C-methylsulfanyl-N-phenylcarbonimidoyl)carbamimidothioate;hydroiodide 9569856 NSC622579 sensitive
hsa-miR-150-5p Betuletol 5459196 NSC641548 sensitive
hsa-miR-150-5p Bis[(5-methyl-2,2-dioxo-1,3,2-dioxathian-5-yl)methyl] sulfate 398487 NSC708390 sensitive
hsa-miR-150-5p Bisarylpurine 45028308 NSC742146 sensitive
hsa-miR-150-5p Bn-2629 393111 NSC694501 sensitive
hsa-miR-150-5p Bohlmann k2631 327378 NSC302289 sensitive
hsa-miR-150-5p Bp-1-102 53388144 NSC764037 sensitive
hsa-miR-150-5p Butanedioic acid;10-[3-(4-methylpiperazin-1-yl)propyl]-2-(trifluoromethyl)phenothiazine 5351168 NSC46061 sensitive
hsa-miR-150-5p C8, carbonyl prodigiosine 135540857 NSC742417 sensitive
hsa-miR-150-5p Caracemide 54747 NSC253272 sensitive
hsa-miR-150-5p Carbon monoxide;iridium;1-phenyldiazenylnaphthalen-2-olate 6711627 NSC632877 sensitive
hsa-miR-150-5p Carmofur 2577 NSC758963 sensitive
hsa-miR-150-5p Chalcone analog NSC331935 sensitive
hsa-miR-150-5p Chapliatrin 5458480 NSC249956 sensitive
hsa-miR-150-5p Chemdiv1_011311 403099 NSC717571 sensitive
hsa-miR-150-5p Chinon 95715 NSC30706 sensitive
hsa-miR-150-5p Chlorobis(4-ethyltropolonato)bismuth(iii) NSC634368 sensitive
hsa-miR-150-5p Chloroform;(1S,12R)-20-methyl-16-nitro-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-2,4(8),9,13(18),14,16-hexaene-11,19-dione 45027874 NSC730009 sensitive
hsa-miR-150-5p Chloroplatinum(1+); 2-diphenylphosphanyl-n,n-dimethyl-ethanamine 499568 NSC685470 sensitive
hsa-miR-150-5p Cinerubin a hcl 5458466 NSC243022 sensitive
hsa-miR-150-5p Cinnoline, 4-nitro-, 1-oxide 100397 NSC294846 sensitive
hsa-miR-150-5p Cis-amminedichloro(4-methoxyphenethylamine)platinum(ii) 498559 NSC631306 sensitive
hsa-miR-150-5p Claritin 3957 NSC721075 sensitive
hsa-miR-150-5p Cps49 9905583 NSC726796 sensitive
hsa-miR-150-5p Crassin acetate 5355441 NSC46728 sensitive
hsa-miR-150-5p Crassin, acetate 5355441 NSC36437 sensitive
hsa-miR-150-5p Cuspidatin c 5459164 NSC636859 sensitive
hsa-miR-150-5p Cyclopentane; dichloro(dichloroferriooxy)iron; dichloroiron 498236 NSC608972 sensitive
hsa-miR-150-5p Cysteine, s-[(4-aminocarbonyl-1h-imidazol-5-yl)azo]- 135493928 NSC684043 sensitive
hsa-miR-150-5p Cyto9h5 340720 NSC371777 sensitive
hsa-miR-150-5p Dacarbazine 5351166 NSC45388 approved sensitive
hsa-miR-150-5p Deoxyartemisitene 6712468 NSC690035 sensitive
hsa-miR-150-5p Destruxin a 122810 NSC361126 sensitive
hsa-miR-150-5p Destruxin b NSC236580 sensitive
hsa-miR-150-5p Dianhydrogalactitol 31789 NSC132313 sensitive
hsa-miR-150-5p Dibutyl(bis((3-(2-fluorophenyl)acryloyl)oxy))stannane 16683204 NSC643860 sensitive
hsa-miR-150-5p Dichlorodipropyltin 93562 NSC92618 sensitive
hsa-miR-150-5p Diethyl 2-[[2-[4-[(3-phenylquinoxalin-2-yl)amino]phenyl]acetyl]amino]pentanedioate 401477 NSC715135 resistant
hsa-miR-150-5p Diethyl 2-[[4-[(3-ethoxycarbonylquinoxalin-2-yl)amino]benzoyl]amino]pentanedioate 382848 NSC670678 resistant
hsa-miR-150-5p Diethyl 2-[[4-[3-phenyl-6-(trifluoromethyl)quinoxalin-2-yl]oxybenzoyl]amino]pentanedioate 390814 NSC688816 resistant
hsa-miR-150-5p Dihydro-5-azacytidine 5351280 NSC264880 sensitive
hsa-miR-150-5p Diketocoriolin b 294475 NSC163027 sensitive
hsa-miR-150-5p Dimethyl 1,6,7,10-tetramethylfluoranthene-8,9-dicarboxylate 393210 NSC694698 sensitive
hsa-miR-150-5p Dimethyl 12-cyclohexyl-8-oxo-1-phenyl-12-azatricyclo[7.2.1.02,7]dodeca-2,4,6,10-tetraene-10,11-dicarboxylate 394469 NSC697942 sensitive
hsa-miR-150-5p Dimethyl 4-(2,4-dimethoxyphenyl)-1-(4-methoxy-2-nitrophenyl)-6-(4-methylphenyl)-4h-pyridine-2,3-dicarboxylate 392298 NSC692574 sensitive
hsa-miR-150-5p Dimethyl 4-(3-methoxyphenyl)-1-[(4-methyl-3,6-dioxocyclohexa-1,4-dien-1-yl)methyl]-4h-pyridine-3,5-dicarboxylate 24203415 NSC727927 sensitive
hsa-miR-150-5p Dimethyl 6-(2-furyl)-4-(2-nitrophenyl)-1-(4-pyridyl)-4h-pyridine-2,3-dicarboxylate 392303 NSC692579 sensitive
hsa-miR-150-5p Doxoform 24202589 NSC699490 sensitive
hsa-miR-150-5p Dromostanolone propionate 224004 NSC12198 sensitive
hsa-miR-150-5p Eh00008 354026 NSC603974 sensitive
hsa-miR-150-5p Elsinochrome c 495866 NSC671197 sensitive
hsa-miR-150-5p Eremantholide b 5478094 NSC380721 sensitive
hsa-miR-150-5p Eremantholide c 5468332 NSC669146 sensitive
hsa-miR-150-5p Erioflorin acetate 5358418 NSC251667 sensitive
hsa-miR-150-5p Ethyl (3E,5E)-3,5-dibenzylidene-4-oxopiperidine-1-carboxylate 5388001 NSC630602 sensitive
hsa-miR-150-5p Ethyl 2-[(e)-[2-(2-hydroxy-1h-indol-3-yl)indol-3-ylidene]amino]oxyacetate 135436298 NSC717838 resistant
hsa-miR-150-5p Ethyl 3-(4-fluoroanilino)-7-(trifluoromethyl)quinoxaline-2-carboxylate 388326 NSC683061 sensitive
hsa-miR-150-5p Ethyl 3-(4-fluoroanilino)quinoxaline-2-carboxylate 387137 NSC680553 resistant
hsa-miR-150-5p Ethyl 3-[[5-[(e)-3-methoxy-3-oxoprop-1-enyl]-1h-imidazol-4-yl]diazenyl]benzoate 135436270 NSC716679 sensitive
hsa-miR-150-5p Ethyl 4-(2-diethylaminoethylsulfanyl)-6-oxo-1,3-diphenyl-2-thioxo-pyrimidine-5-carboxylate 396732 NSC703442 sensitive
hsa-miR-150-5p Ethyl 4-oxo-3-phenyl-[1,2,3,5]tetrazino[5,4-a]indole-10-carboxylate 396113 NSC701661 sensitive
hsa-miR-150-5p Ethyl 5-benzoyl-4-phenyl-4,5-dihydro-1H-pyrazole-3-carboxylate 386876 NSC679716 sensitive
hsa-miR-150-5p Ethyl 6-chloro-4-phenyl-2-(piperazin-1-ylmethyl)quinoline-3-carboxylate 369623 NSC641536 sensitive
hsa-miR-150-5p Ethyl 7-benzyl-6a-hydroxy-6-methoxy-8-methyl-1,3,4-trioxo-2-phenyl-5,6-dihydro-3ah-pyrrolo[3,4-d]indole-9-carboxylate 405615 NSC722985 sensitive
hsa-miR-150-5p Ethyl n-[(7-chloro-2-methylsulfanyl-4,5-dioxo-3h-pyrano[3,4-e][1,3]oxazin-2-yl)amino]carbamate 396374 NSC702323 sensitive
hsa-miR-150-5p Ethyl phenylpropiolate 91516 NSC41566 sensitive
hsa-miR-150-5p Eu-0000702 399169 NSC709588 resistant
hsa-miR-150-5p Ex-a776 5356520 NSC59984 sensitive
hsa-miR-150-5p From marine animal dolabella auricularia 354399 NSC606195 sensitive
hsa-miR-150-5p Helenalin 23205 NSC85236 sensitive
hsa-miR-150-5p Heliangolide 5384466 NSC335753 sensitive
hsa-miR-150-5p Heliquinomycin 5470493 NSC702208 sensitive
hsa-miR-150-5p Howzfofuoigprl-uhfffaoysa-n 359314 NSC620077 sensitive
hsa-miR-150-5p Hsci1_000155 5467485 NSC653260 sensitive
hsa-miR-150-5p Iflab1_001965 1497314 NSC740963 sensitive
hsa-miR-150-5p Indenoisoquinoline derivative 329826 NSC314622 sensitive
hsa-miR-150-5p Indenoisoquinoline derivative 329826 NSC314622 sensitive
hsa-miR-150-5p Inosine dialdehyde 135400916 NSC118994 sensitive
hsa-miR-150-5p Inostamycin 368135 NSC638478 sensitive
hsa-miR-150-5p Insariotoxin 6711181 NSC138780 sensitive
hsa-miR-150-5p Insulin-methotrexate conjugate NSC648365 sensitive
hsa-miR-150-5p Iodine green 54605107 NSC8673 sensitive
hsa-miR-150-5p Isobaccharin 5358646 NSC269760 sensitive
hsa-miR-150-5p Isobrucein a 322357 NSC279503 sensitive
hsa-miR-150-5p Isopinnatal 390665 NSC688277 sensitive
hsa-miR-150-5p J-400634 385621 NSC676944 sensitive
hsa-miR-150-5p Jacaranone 73307 NSC251682 sensitive
hsa-miR-150-5p Kh-carb10 56946086 NSC745321 sensitive
hsa-miR-150-5p Kijanimicin sodium salt 54707591 NSC329515 sensitive
hsa-miR-150-5p Krisolamine 31420 NSC7833 sensitive
hsa-miR-150-5p Kusaginin 5459010 NSC603831 sensitive
hsa-miR-150-5p Lapachone