miRTarBase - #MIRT000941


—
pre-miRNA Information
pre-miRNA hsa-mir-424   
Genomic Coordinates chrX: 134546614 - 134546711
Synonyms MIR322, MIRN424, hsa-mir-424, miRNA424, MIR424
Description Homo sapiens miR-424 stem-loop
Comment This hairpin precursor expresses a 5' arm product, named miR-424, in human promyelocytic leukemia (HL-60) cells . The level of expression of miR-424 was shown to be up-regulated 48 hours after TPA-induction. The sequence is orthologous to the experimentally verified rat miR-322 locus (MIR:MI0000589), which expresses its mature product from the 3' arm of the hairpin. The human miR-424 hairpin does not appear to contain the miR-322 sequence.
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-424-5p
Sequence 11| CAGCAGCAAUUCAUGUUUUGAA |32
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 5 X - 134546697 29233923 MiREDiBase
A-to-I 8 X - 134546694 17604727 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs888095819 1 dbSNP
rs1486362336 18 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CCND1   
Synonyms BCL1, D11S287E, PRAD1, U21B31
Description cyclin D1
Transcript NM_053056   
Expression
Putative miRNA Targets on CCND1
3'UTR of CCND1
(miRNA target sites are highlighted)		 
>CCND1|NM_053056|3'UTR
   1 GGGCGCCAGGCAGGCGGGCGCCACCGCCACCCGCAGCGAGGGCGGAGCCGGCCCCAGGTGCTCCCCTGACAGTCCCTCCT
  81 CTCCGGAGCATTTTGATACCAGAAGGGAAAGCTTCATTCTCCTTGTTGTTGGTTGTTTTTTCCTTTGCTCTTTCCCCCTT
 161 CCATCTCTGACTTAAGCAAAAGAAAAAGATTACCCAAAAACTGTCTTTAAAAGAGAGAGAGAGAAAAAAAAAATAGTATT
 241 TGCATAACCCTGAGCGGTGGGGGAGGAGGGTTGTGCTACAGATGATAGAGGATTTTATACCCCAATAATCAACTCGTTTT
 321 TATATTAATGTACTTGTTTCTCTGTTGTAAGAATAGGCATTAACACAAAGGAGGCGTCTCGGGAGAGGATTAGGTTCCAT
 401 CCTTTACGTGTTTAAAAAAAAGCATAAAAACATTTTAAAAACATAGAAAAATTCAGCAAACCATTTTTAAAGTAGAAGAG
 481 GGTTTTAGGTAGAAAAACATATTCTTGTGCTTTTCCTGATAAAGCACAGCTGTAGTGGGGTTCTAGGCATCTCTGTACTT
 561 TGCTTGCTCATATGCATGTAGTCACTTTATAAGTCATTGTATGTTATTATATTCCGTAGGTAGATGTGTAACCTCTTCAC
 641 CTTATTCATGGCTGAAGTCACCTCTTGGTTACAGTAGCGTAGCGTGCCCGTGTGCATGTCCTTTGCGCCTGTGACCACCA
 721 CCCCAACAAACCATCCAGTGACAAACCATCCAGTGGAGGTTTGTCGGGCACCAGCCAGCGTAGCAGGGTCGGGAAAGGCC
 801 ACCTGTCCCACTCCTACGATACGCTACTATAAAGAGAAGACGAAATAGTGACATAATATATTCTATTTTTATACTCTTCC
 881 TATTTTTGTAGTGACCTGTTTATGAGATGCTGGTTTTCTACCCAACGGCCCTGCAGCCAGCTCACGTCCAGGTTCAACCC
 961 ACAGCTACTTGGTTTGTGTTCTTCTTCATATTCTAAAACCATTCCATTTCCAAGCACTTTCAGTCCAATAGGTGTAGGAA
1041 ATAGCGCTGTTTTTGTTGTGTGTGCAGGGAGGGCAGTTTTCTAATGGAATGGTTTGGGAATATCCATGTACTTGTTTGCA
1121 AGCAGGACTTTGAGGCAAGTGTGGGCCACTGTGGTGGCAGTGGAGGTGGGGTGTTTGGGAGGCTGCGTGCCAGTCAAGAA
1201 GAAAAAGGTTTGCATTCTCACATTGCCAGGATGATAAGTTCCTTTCCTTTTCTTTAAAGAAGTTGAAGTTTAGGAATCCT
1281 TTGGTGCCAACTGGTGTTTGAAAGTAGGGACCTCAGAGGTTTACCTAGAGAACAGGTGGTTTTTAAGGGTTATCTTAGAT
1361 GTTTCACACCGGAAGGTTTTTAAACACTAAAATATATAATTTATAGTTAAGGCTAAAAAGTATATTTATTGCAGAGGATG
1441 TTCATAAGGCCAGTATGATTTATAAATGCAATCTCCCCTTGATTTAAACACACAGATACACACACACACACACACACACA
1521 CAAACCTTCTGCCTTTGATGTTACAGATTTAATACAGTTTATTTTTAAAGATAGATCCTTTTATAGGTGAGAAAAAAACA
1601 ATCTGGAAGAAAAAAACCACACAAAGACATTGATTCAGCCTGTTTGGCGTTTCCCAGAGTCATCTGATTGGACAGGCATG
1681 GGTGCAAGGAAAATTAGGGTACTCAACCTAAGTTCGGTTCCGATGAATTCTTATCCCCTGCCCCTTCCTTTAAAAAACTT
1761 AGTGACAAAATAGACAATTTGCACATCTTGGCTATGTAATTCTTGTAATTTTTATTTAGGAAGTGTTGAAGGGAGGTGGC
1841 AAGAGTGTGGAGGCTGACGTGTGAGGGAGGACAGGCGGGAGGAGGTGTGAGGAGGAGGCTCCCGAGGGGAAGGGGCGGTG
1921 CCCACACCGGGGACAGGCCGCAGCTCCATTTTCTTATTGCGCTGCTACCGTTGACTTCCAGGCACGGTTTGGAAATATTC
2001 ACATCGCTTCTGTGTATCTCTTTCACATTGTTTGCTGCTATTGGAGGATCAGTTTTTTGTTTTACAATGTCATATACTGC
2081 CATGTACTAGTTTTAGTTTTCTCTTAGAACATTGTATTACAGATGCCTTTTTTGTAGTTTTTTTTTTTTTTATGTGATCA
2161 ATTTTGACTTAATGTGATTACTGCTCTATTCCAAAAAGGTTGCTGTTTCACAATACCTCATGCTTCACTTAGCCATGGTG
2241 GACCCAGCGGGCAGGTTCTGCCTGCTTTGGCGGGCAGACACGCGGGCGCGATCCCACACAGGCTGGCGGGGGCCGGCCCC
2321 GAGGCCGCGTGCGTGAGAACCGCGCCGGTGTCCCCAGAGACCAGGCTGTGTCCCTCTTCTCTTCCCTGCGCCTGTGATGC
2401 TGGGCACTTCATCTGATCGGGGGCGTAGCATCATAGTAGTTTTTACAGCTGTGTTATTCTTTGCGTGTAGCTATGGAAGT
2481 TGCATAATTATTATTATTATTATTATAACAAGTGTGTCTTACGTGCCACCACGGCGTTGTACCTGTAGGACTCTCATTCG
2561 GGATGATTGGAATAGCTTCTGGAATTTGTTCAAGTTTTGGGTATGTTTAATCTGTTATGTACTAGTGTTCTGTTTGTTAT
2641 TGTTTTGTTAATTACACCATAATGCTAATTTAAAGAGACTCCAAATCTCAATGAAGCCAGCTCACAGTGCTGTGTGCCCC
2721 GGTCACCTAGCAAGCTGCCGAACCAAAAGAATTTGCACCCCGCTGCGGGCCCACGTGGTTGGGGCCCTGCCCTGGCAGGG
2801 TCATCCTGTGCTCGGAGGCCATCTCGGGCACAGGCCCACCCCGCCCCACCCCTCCAGAACACGGCTCACGCTTACCTCAA
2881 CCATCCTGGCTGCGGCGTCTGTCTGAACCACGCGGGGGCCTTGAGGGACGCTTTGTCTGTCGTGATGGGGCAAGGGCACA
2961 AGTCCTGGATGTTGTGTGTATCGAGAGGCCAAAGGCTGGTGGCAAGTGCACGGGGCACAGCGGAGTCTGTCCTGTGACGC
3041 GCAAGTCTGAGGGTCTGGGCGGCGGGCGGCTGGGTCTGTGCATTTCTGGTTGCACCGCGGCGCTTCCCAGCACCAACATG
3121 TAACCGGCATGTTTCCAGCAGAAGACAAAAAGACAAACATGAAAGTCTAGAAATAAAACTGGTAAAACCCCAAAAAAAAA
3201 AAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' aaguuuUGUACUUAACGACGAc 5'
                |||| : |||||||| 
Target 5' tctttcACATTGTTTGCTGCTa 3'
 2019 - 2040 160.00 -11.70
2 
miRNA  3' aaGUUUUGUACUUAACGACGAc 5'
            ||||| |  ::||||||:| 
Target 5' tcCAAAA-A--GGTTGCTGTTt 3'
 2190 - 2208 143.00 -10.40
3 
miRNA  3' aaguuuuGUACUUAACGACGAc 5'
                 :||||: ||||| | 
Target 5' acctgttTATGAGATGCTGGTt 3'
 894 - 915 127.00 -10.42
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30140134 2 COSMIC
COSN30452344 7 COSMIC
COSN30452288 8 COSMIC
COSN26440643 39 COSMIC
COSN24361326 66 COSMIC
COSN22751060 113 COSMIC
COSN17037802 226 COSMIC
COSN27221469 234 COSMIC
COSN9031603 239 COSMIC
COSN8689115 480 COSMIC
COSN25902211 575 COSMIC
COSN21634633 584 COSMIC
COSN16049000 706 COSMIC
COSN16904533 866 COSMIC
COSN22843579 903 COSMIC
COSN17078425 946 COSMIC
COSN22892708 971 COSMIC
COSN25236763 1154 COSMIC
COSN20982451 1164 COSMIC
COSN31611721 1187 COSMIC
COSN20108461 1523 COSMIC
COSN23819460 1524 COSMIC
COSN22850192 1771 COSMIC
COSN30171021 1803 COSMIC
COSN26481971 1832 COSMIC
COSN20077368 1883 COSMIC
COSN15333221 1887 COSMIC
COSN8584632 1909 COSMIC
COSN31481844 1928 COSMIC
COSN22883090 1991 COSMIC
COSN30580846 2013 COSMIC
COSN26435161 2081 COSMIC
COSN20494675 2128 COSMIC
COSN20071077 2152 COSMIC
COSN27226707 2152 COSMIC
COSN22850657 2345 COSMIC
COSN29114185 2839 COSMIC
COSN26808038 2933 COSMIC
COSN30761558 2939 COSMIC
COSN21980728 2951 COSMIC
COSN17077262 2981 COSMIC
COSN21626459 2998 COSMIC
COSN20066464 3098 COSMIC
COSN25983202 3109 COSMIC
COSN29397813 3174 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs889887455 1 dbSNP
rs1488354205 3 dbSNP
rs1187898588 5 dbSNP
rs775045588 6 dbSNP
rs1427570013 16 dbSNP
rs762429663 17 dbSNP
rs547958193 18 dbSNP
rs749904542 19 dbSNP
rs760169968 20 dbSNP
rs766001683 21 dbSNP
rs1039242204 24 dbSNP
rs753482335 26 dbSNP
rs566169135 27 dbSNP
rs1369045429 28 dbSNP
rs921788689 30 dbSNP
rs1307838783 32 dbSNP
rs765041741 33 dbSNP
rs752451676 34 dbSNP
rs1315426736 35 dbSNP
rs1484682583 38 dbSNP
rs539869079 39 dbSNP
rs1243654858 40 dbSNP
rs777708554 41 dbSNP
rs998406664 44 dbSNP
rs1047369285 45 dbSNP
rs1217235549 46 dbSNP
rs1480409396 50 dbSNP
rs745993963 51 dbSNP
rs1205616417 53 dbSNP
rs1439433362 56 dbSNP
rs967545535 60 dbSNP
rs7177 66 dbSNP
rs926066318 71 dbSNP
rs1345079984 75 dbSNP
rs957390352 77 dbSNP
rs991857797 81 dbSNP
rs915920225 82 dbSNP
rs963666606 85 dbSNP
rs747230443 86 dbSNP
rs1443367693 89 dbSNP
rs768816930 100 dbSNP
rs1173069451 101 dbSNP
rs1414454711 112 dbSNP
rs1355445394 117 dbSNP
rs982043723 120 dbSNP
rs1406864458 124 dbSNP
rs1306426360 127 dbSNP
rs1327099514 129 dbSNP
rs1032082450 133 dbSNP
rs927763170 136 dbSNP
rs1405629980 144 dbSNP
rs1803356 144 dbSNP
rs1235571055 152 dbSNP
rs376382983 159 dbSNP
rs913366940 178 dbSNP
rs1244371234 183 dbSNP
rs967532519 186 dbSNP
rs775791411 188 dbSNP
rs1366890864 193 dbSNP
rs1225160244 201 dbSNP
rs928893937 203 dbSNP
rs1282818621 212 dbSNP
rs1447899800 212 dbSNP
rs937341595 212 dbSNP
rs1338717348 216 dbSNP
rs1056234350 221 dbSNP
rs1388087284 222 dbSNP
rs113802535 223 dbSNP
rs1445100963 224 dbSNP
rs200641419 224 dbSNP
rs888155431 224 dbSNP
rs1217378954 225 dbSNP
rs76139292 226 dbSNP
rs1464026391 235 dbSNP
rs1242247152 238 dbSNP
rs1039316488 239 dbSNP
rs1204132747 243 dbSNP
rs931414116 250 dbSNP
rs556325124 256 dbSNP
rs1288085496 257 dbSNP
rs1228124166 271 dbSNP
rs761451423 277 dbSNP
rs1317775071 281 dbSNP
rs998377292 282 dbSNP
rs1221740074 287 dbSNP
rs1029900280 316 dbSNP
rs1364482937 317 dbSNP
rs903354801 323 dbSNP
rs1008064753 324 dbSNP
rs1433076036 331 dbSNP
rs1040977626 341 dbSNP
rs1477349002 343 dbSNP
rs999469780 344 dbSNP
rs1033182389 350 dbSNP
rs957648987 352 dbSNP
rs899783172 358 dbSNP
rs1166619312 362 dbSNP
rs991600123 371 dbSNP
rs1420786830 375 dbSNP
rs574336406 376 dbSNP
rs1022946937 377 dbSNP
rs764711212 379 dbSNP
rs772901129 381 dbSNP
rs1020669276 382 dbSNP
rs1167026121 390 dbSNP
rs982012596 402 dbSNP
rs1342079296 403 dbSNP
rs927900196 406 dbSNP
rs929822730 408 dbSNP
rs967480225 409 dbSNP
rs982989701 411 dbSNP
rs1405836417 414 dbSNP
rs981615909 414 dbSNP
rs1367156675 415 dbSNP
rs1425518966 420 dbSNP
rs1323051530 423 dbSNP
rs541612852 433 dbSNP
rs909730931 441 dbSNP
rs781535069 443 dbSNP
rs1432919660 445 dbSNP
rs941084451 447 dbSNP
rs1039452423 455 dbSNP
rs899497814 458 dbSNP
rs933694635 460 dbSNP
rs1481230545 464 dbSNP
rs1051284716 482 dbSNP
rs1365759038 483 dbSNP
rs1271412750 489 dbSNP
rs959243736 505 dbSNP
rs1295114186 511 dbSNP
rs1361242546 517 dbSNP
rs903393378 519 dbSNP
rs991490308 538 dbSNP
rs559847341 545 dbSNP
rs1207287453 562 dbSNP
rs1310492992 568 dbSNP
rs1228503339 570 dbSNP
rs1224316580 580 dbSNP
rs1347630523 586 dbSNP
rs186742914 604 dbSNP
rs776194489 604 dbSNP
rs748518127 616 dbSNP
rs1033564593 617 dbSNP
rs149785366 620 dbSNP
rs545808319 628 dbSNP
rs1299784950 629 dbSNP
rs893320935 634 dbSNP
rs1464528045 639 dbSNP
rs762561244 641 dbSNP
rs1176521656 648 dbSNP
rs1470716579 662 dbSNP
rs1409288813 675 dbSNP
rs1158048486 679 dbSNP
rs1249191027 680 dbSNP
rs1251750595 683 dbSNP
rs563895387 684 dbSNP
rs1482581479 687 dbSNP
rs678653 688 dbSNP
rs1387464453 691 dbSNP
rs1445524386 693 dbSNP
rs866708873 696 dbSNP
rs908664926 697 dbSNP
rs1317273012 701 dbSNP
rs1308915003 702 dbSNP
rs3212893 707 dbSNP
rs773730838 708 dbSNP
rs1337371631 711 dbSNP
rs1454115336 719 dbSNP
rs951346316 722 dbSNP
rs2510607 723 dbSNP
rs1006889485 726 dbSNP
rs899731091 728 dbSNP
rs932536509 733 dbSNP
rs1434276774 734 dbSNP
rs1318342035 737 dbSNP
rs1384695013 743 dbSNP
rs1245183600 745 dbSNP
rs1161743192 752 dbSNP
rs1422523889 754 dbSNP
rs1385144919 756 dbSNP
rs1184825768 760 dbSNP
rs758933493 767 dbSNP
rs562366357 772 dbSNP
rs1486317592 780 dbSNP
rs1009238475 781 dbSNP
rs1242317339 786 dbSNP
rs1020659443 789 dbSNP
rs1315607468 791 dbSNP
rs371387647 792 dbSNP
rs1002984710 801 dbSNP
rs1317057521 804 dbSNP
rs147194931 806 dbSNP
rs958913683 813 dbSNP
rs1291489032 814 dbSNP
rs992125953 818 dbSNP
rs975127144 819 dbSNP
rs952817760 821 dbSNP
rs3212894 823 dbSNP
rs140469724 824 dbSNP
rs1429252063 827 dbSNP
rs1264112819 828 dbSNP
rs1208327904 831 dbSNP
rs3212895 835 dbSNP
rs774916002 840 dbSNP
rs144537936 842 dbSNP
rs535459249 843 dbSNP
rs1411291996 845 dbSNP
rs1379827926 847 dbSNP
rs976847787 848 dbSNP
rs1456684997 853 dbSNP
rs569902409 854 dbSNP
rs1269021446 861 dbSNP
rs1227503058 862 dbSNP
rs1327751313 866 dbSNP
rs1156883501 873 dbSNP
rs1298706058 881 dbSNP
rs1404009591 882 dbSNP
rs1408156897 885 dbSNP
rs924312590 889 dbSNP
rs1396397470 890 dbSNP
rs934882518 891 dbSNP
rs763841185 893 dbSNP
rs1054735331 895 dbSNP
rs1427039959 898 dbSNP
rs1454450316 899 dbSNP
rs3212896 913 dbSNP
rs1462530743 926 dbSNP
rs1374910955 927 dbSNP
rs756315808 928 dbSNP
rs1480249962 933 dbSNP
rs1044495316 935 dbSNP
rs1288470188 946 dbSNP
rs569348935 947 dbSNP
rs1226001045 954 dbSNP
rs1265552441 960 dbSNP
rs1481984872 972 dbSNP
rs147844202 975 dbSNP
rs1346262089 979 dbSNP
rs1002972414 985 dbSNP
rs1196354922 994 dbSNP
rs1200300205 996 dbSNP
rs1253765879 1000 dbSNP
rs1026710744 1023 dbSNP
rs1276942770 1028 dbSNP
rs1054077660 1030 dbSNP
rs893757435 1032 dbSNP
rs1407137145 1033 dbSNP
rs777972591 1035 dbSNP
rs950772737 1041 dbSNP
rs1004524092 1046 dbSNP
rs368481159 1047 dbSNP
rs538149856 1056 dbSNP
rs1201599930 1064 dbSNP
rs1469433109 1068 dbSNP
rs975179817 1069 dbSNP
rs921103137 1075 dbSNP
rs1178937280 1076 dbSNP
rs1466472310 1090 dbSNP
rs955094946 1091 dbSNP
rs1171850262 1098 dbSNP
rs574372109 1101 dbSNP
rs1399752490 1102 dbSNP
rs1232142407 1110 dbSNP
rs3212897 1117 dbSNP
rs1054818039 1119 dbSNP
rs1308295142 1123 dbSNP
rs924251044 1127 dbSNP
rs1253382783 1138 dbSNP
rs1369486890 1142 dbSNP
rs934372065 1154 dbSNP
rs1407474444 1155 dbSNP
rs1202465803 1156 dbSNP
rs1323704648 1158 dbSNP
rs1284634686 1159 dbSNP
rs1332246915 1160 dbSNP
rs183243879 1169 dbSNP
rs1348922942 1177 dbSNP
rs1233125326 1180 dbSNP
rs894594204 1183 dbSNP
rs757572186 1187 dbSNP
rs111859970 1188 dbSNP
rs948951785 1194 dbSNP
rs1406975710 1205 dbSNP
rs1338925619 1212 dbSNP
rs1399201572 1213 dbSNP
rs1406928566 1229 dbSNP
rs1027649724 1230 dbSNP
rs371251672 1233 dbSNP
rs1383297190 1247 dbSNP
rs1471071051 1247 dbSNP
rs1274194846 1252 dbSNP
rs761720025 1253 dbSNP
rs1211578322 1263 dbSNP
rs1482163737 1264 dbSNP
rs953017725 1265 dbSNP
rs1244467378 1278 dbSNP
rs1044555453 1279 dbSNP
rs3212898 1288 dbSNP
rs1283929898 1291 dbSNP
rs1224675033 1293 dbSNP
rs1015575047 1295 dbSNP
rs965390152 1297 dbSNP
rs1313519134 1302 dbSNP
rs113745276 1303 dbSNP
rs1383556328 1307 dbSNP
rs1047837263 1309 dbSNP
rs116435189 1310 dbSNP
rs886433547 1312 dbSNP
rs543396488 1329 dbSNP
rs1317294991 1330 dbSNP
rs1428814839 1331 dbSNP
rs1006263910 1334 dbSNP
rs1016682182 1337 dbSNP
rs1198051948 1363 dbSNP
rs1319301392 1366 dbSNP
rs962570595 1369 dbSNP
rs187904389 1371 dbSNP
rs529583023 1372 dbSNP
rs1369628949 1374 dbSNP
rs373375621 1377 dbSNP
rs1427418927 1378 dbSNP
rs1184268540 1391 dbSNP
rs746244692 1396 dbSNP
rs1242335589 1402 dbSNP
rs1390800209 1407 dbSNP
rs1489463103 1416 dbSNP
rs1290072457 1419 dbSNP
rs772318265 1427 dbSNP
rs548026313 1440 dbSNP
rs1360802516 1446 dbSNP
rs1322179844 1451 dbSNP
rs945323633 1452 dbSNP
rs747492017 1454 dbSNP
rs1328638508 1456 dbSNP
rs1270963217 1461 dbSNP
rs559944633 1468 dbSNP
rs1297304182 1472 dbSNP
rs1302312958 1474 dbSNP
rs1419954996 1475 dbSNP
rs11557584 1476 dbSNP
rs1425157811 1485 dbSNP
rs1248403804 1491 dbSNP
rs955895941 1494 dbSNP
rs10640302 1498 dbSNP
rs1306936640 1498 dbSNP
rs1452276366 1498 dbSNP
rs145829811 1498 dbSNP
rs1491009201 1498 dbSNP
rs200813571 1498 dbSNP
rs60324592 1498 dbSNP
rs796610638 1498 dbSNP
rs35535428 1499 dbSNP
rs1266159040 1505 dbSNP
rs927608268 1506 dbSNP
rs67101880 1508 dbSNP
rs1321686892 1510 dbSNP
rs1282946202 1517 dbSNP
rs1405323732 1520 dbSNP
rs1491562372 1522 dbSNP
rs57561503 1523 dbSNP
rs1265204473 1524 dbSNP
rs989791551 1524 dbSNP
rs1441419432 1526 dbSNP
rs1466192106 1531 dbSNP
rs1189054864 1533 dbSNP
rs1171916439 1547 dbSNP
rs1054766570 1556 dbSNP
rs868561360 1558 dbSNP
rs1176756544 1571 dbSNP
rs948927165 1572 dbSNP
rs533468346 1573 dbSNP
rs1269935354 1584 dbSNP
rs1048587604 1592 dbSNP
rs888626655 1592 dbSNP
rs1233470997 1599 dbSNP
rs2062445 1602 dbSNP
rs1389286648 1603 dbSNP
rs1004445319 1607 dbSNP
rs1166503789 1610 dbSNP
rs1368642303 1618 dbSNP
rs1313689106 1623 dbSNP
rs928775532 1635 dbSNP
rs1223081873 1637 dbSNP
rs772731825 1645 dbSNP
rs1160889502 1649 dbSNP
rs551627621 1650 dbSNP
rs1048276516 1664 dbSNP
rs886488437 1669 dbSNP
rs998220961 1679 dbSNP
rs1379663503 1680 dbSNP
rs1320348405 1682 dbSNP
rs570124582 1689 dbSNP
rs530841990 1694 dbSNP
rs1363437950 1697 dbSNP
rs556766891 1699 dbSNP
rs548942087 1700 dbSNP
rs568668101 1708 dbSNP
rs1242635386 1716 dbSNP
rs1313711693 1717 dbSNP
rs1037680665 1722 dbSNP
rs1321290060 1723 dbSNP
rs535334547 1728 dbSNP
rs900527940 1729 dbSNP
rs377373695 1736 dbSNP
rs1311335435 1739 dbSNP
rs1331191870 1740 dbSNP
rs996698011 1740 dbSNP
rs1459466939 1743 dbSNP
rs773872692 1745 dbSNP
rs1243707954 1752 dbSNP
rs1381349084 1759 dbSNP
rs1315143312 1760 dbSNP
rs759436493 1767 dbSNP
rs989705211 1770 dbSNP
rs1312811203 1785 dbSNP
rs1287992380 1788 dbSNP
rs915049324 1788 dbSNP
rs1346211387 1793 dbSNP
rs767197346 1796 dbSNP
rs553562452 1804 dbSNP
rs1209257177 1806 dbSNP
rs1028223563 1814 dbSNP
rs758315102 1824 dbSNP
rs1183311429 1825 dbSNP
rs1256433711 1826 dbSNP
rs1259916029 1831 dbSNP
rs1422861886 1833 dbSNP
rs78871738 1835 dbSNP
rs111229733 1846 dbSNP
rs1486041951 1850 dbSNP
rs539618802 1851 dbSNP
rs1413490858 1859 dbSNP
rs1220072056 1860 dbSNP
rs939020900 1861 dbSNP
rs1292481019 1862 dbSNP
rs3212899 1871 dbSNP
rs916304541 1875 dbSNP
rs557610582 1876 dbSNP
rs764070397 1877 dbSNP
rs369309004 1878 dbSNP
rs1021283352 1886 dbSNP
rs945693596 1887 dbSNP
rs1423228751 1890 dbSNP
rs1365496769 1894 dbSNP
rs1164855892 1895 dbSNP
rs1303778732 1897 dbSNP
rs969740984 1904 dbSNP
rs879160060 1905 dbSNP
rs753976474 1909 dbSNP
rs901464281 1913 dbSNP
rs998168513 1917 dbSNP
rs3212900 1918 dbSNP
rs1490143659 1923 dbSNP
rs757336988 1929 dbSNP
rs191306538 1930 dbSNP
rs1336824761 1936 dbSNP
rs1250300308 1937 dbSNP
rs373248238 1940 dbSNP
rs1267435614 1941 dbSNP
rs1281048612 1955 dbSNP
rs1403490211 1956 dbSNP
rs966480696 1956 dbSNP
rs908050805 1958 dbSNP
rs942101620 1961 dbSNP
rs977926375 1962 dbSNP
rs1034883880 1963 dbSNP
rs1038214162 1970 dbSNP
rs182627279 1971 dbSNP
rs1174595348 1972 dbSNP
rs1256360205 1973 dbSNP
rs1485315433 1974 dbSNP
rs1200863953 1979 dbSNP
rs759446411 1986 dbSNP
rs932016436 1986 dbSNP
rs756216186 1987 dbSNP
rs1244101535 2006 dbSNP
rs780180675 2007 dbSNP
rs1162221043 2015 dbSNP
rs1385226649 2016 dbSNP
rs1222581441 2021 dbSNP
rs1323218986 2022 dbSNP
rs1275811865 2025 dbSNP
rs1457780093 2028 dbSNP
rs1401813696 2032 dbSNP
rs1161296162 2033 dbSNP
rs1343542350 2034 dbSNP
rs930309612 2040 dbSNP
rs1430219764 2042 dbSNP
rs1337700185 2043 dbSNP
rs1384718191 2044 dbSNP
rs1343720661 2047 dbSNP
rs778592697 2053 dbSNP
rs1314125525 2059 dbSNP
rs1328856414 2066 dbSNP
rs140779377 2067 dbSNP
rs187991526 2068 dbSNP
rs1008568415 2071 dbSNP
rs774887918 2072 dbSNP
rs1052927645 2074 dbSNP
rs1264693835 2076 dbSNP
rs1462927270 2077 dbSNP
rs560082693 2078 dbSNP
rs533399976 2079 dbSNP
rs1470775829 2084 dbSNP
rs1179486901 2088 dbSNP
rs1182490400 2112 dbSNP
rs1440979002 2113 dbSNP
rs386589338 2121 dbSNP
rs3918303 2121 dbSNP
rs535391224 2123 dbSNP
rs545565093 2126 dbSNP
rs563656986 2127 dbSNP
rs1349033603 2128 dbSNP
rs1279465076 2131 dbSNP
rs1379156762 2138 dbSNP
rs1452116540 2138 dbSNP
rs375055236 2138 dbSNP
rs555151080 2138 dbSNP
rs770510145 2138 dbSNP
rs1409298721 2139 dbSNP
rs1336475576 2140 dbSNP
rs1398710506 2142 dbSNP
rs1384039295 2148 dbSNP
rs1159132833 2152 dbSNP
rs1286513721 2153 dbSNP
rs1371175035 2154 dbSNP
rs200730331 2155 dbSNP
rs1301778195 2156 dbSNP
rs1311412192 2157 dbSNP
rs1208409238 2158 dbSNP
rs1182425922 2162 dbSNP
rs1021419331 2174 dbSNP
rs1276337937 2178 dbSNP
rs3212901 2181 dbSNP
rs969709977 2183 dbSNP
rs1190638587 2184 dbSNP
rs1203904411 2187 dbSNP
rs1217904775 2193 dbSNP
rs1356485584 2200 dbSNP
rs1290293713 2201 dbSNP
rs1001164563 2204 dbSNP
rs573466828 2206 dbSNP
rs1248948087 2213 dbSNP
rs1286158385 2220 dbSNP
rs1428918461 2221 dbSNP
rs889752561 2230 dbSNP
rs1298592558 2234 dbSNP
rs1401673109 2245 dbSNP
rs1363629659 2247 dbSNP
rs1035365934 2249 dbSNP
rs1479318454 2250 dbSNP
rs1192312607 2253 dbSNP
rs112206819 2272 dbSNP
rs1431810825 2273 dbSNP
rs1474879841 2282 dbSNP
rs1011330889 2283 dbSNP
rs960291962 2284 dbSNP
rs902631600 2285 dbSNP
rs1322356714 2287 dbSNP
rs534546330 2288 dbSNP
rs999303995 2289 dbSNP
rs908016001 2290 dbSNP
rs963907104 2291 dbSNP
rs1401582268 2300 dbSNP
rs372791652 2308 dbSNP
rs1437144057 2309 dbSNP
rs3212902 2309 dbSNP
rs3212903 2313 dbSNP
rs1294073881 2314 dbSNP
rs565957345 2315 dbSNP
rs1423893996 2316 dbSNP
rs1172426071 2317 dbSNP
rs932070532 2321 dbSNP
rs1427669336 2322 dbSNP
rs3212904 2327 dbSNP
rs911905538 2328 dbSNP
rs1227184171 2329 dbSNP
rs1270391923 2330 dbSNP
rs1220717747 2333 dbSNP
rs940450146 2333 dbSNP
rs140024500 2334 dbSNP
rs1452868578 2342 dbSNP
rs1053477162 2343 dbSNP
rs879685183 2344 dbSNP
rs1011864065 2345 dbSNP
rs1042915355 2346 dbSNP
rs1467513938 2347 dbSNP
rs1049973811 2349 dbSNP
rs112144268 2355 dbSNP
rs557913711 2365 dbSNP
rs1001300235 2368 dbSNP
rs1449142718 2370 dbSNP
rs1404287008 2377 dbSNP
rs946734279 2382 dbSNP
rs113288142 2385 dbSNP
rs1427826991 2389 dbSNP
rs374256592 2390 dbSNP
rs959997411 2391 dbSNP
rs758843980 2404 dbSNP
rs565876334 2406 dbSNP
rs1460161625 2408 dbSNP
rs1255687506 2419 dbSNP
rs963573790 2420 dbSNP
rs1313780145 2422 dbSNP
rs1304765558 2425 dbSNP
rs973503325 2426 dbSNP
rs780250886 2428 dbSNP
rs1164098940 2436 dbSNP
rs537102020 2438 dbSNP
rs1449945903 2448 dbSNP
rs922111453 2454 dbSNP
rs1381551629 2457 dbSNP
rs1051062 2459 dbSNP
rs1438586768 2465 dbSNP
rs769165547 2466 dbSNP
rs1419658225 2471 dbSNP
rs1012529446 2482 dbSNP
rs1023549919 2487 dbSNP
rs1182718399 2487 dbSNP
rs574345911 2487 dbSNP
rs911885483 2487 dbSNP
rs1365689629 2490 dbSNP
rs1215752889 2493 dbSNP
rs1354347501 2507 dbSNP
rs573725552 2509 dbSNP
rs1243137834 2513 dbSNP
rs961724240 2514 dbSNP
rs777055939 2522 dbSNP
rs541016434 2523 dbSNP
rs975789273 2524 dbSNP
rs923022915 2529 dbSNP
rs1161045043 2533 dbSNP
rs955557121 2533 dbSNP
rs1268054081 2534 dbSNP
rs1165662777 2536 dbSNP
rs986069216 2536 dbSNP
rs3212905 2537 dbSNP
rs913101981 2538 dbSNP
rs1228457034 2560 dbSNP
rs1043974781 2561 dbSNP
rs1220183742 2568 dbSNP
rs578178280 2574 dbSNP
rs545292410 2575 dbSNP
rs563873737 2576 dbSNP
rs192114382 2601 dbSNP
rs1042886088 2604 dbSNP
rs3212906 2619 dbSNP
rs1305379282 2629 dbSNP
rs1277224558 2643 dbSNP
rs1249137284 2644 dbSNP
rs113088923 2656 dbSNP
rs778155795 2657 dbSNP
rs1300523723 2658 dbSNP
rs1045330577 2659 dbSNP
rs1390054503 2665 dbSNP
rs1294215093 2682 dbSNP
rs1056928220 2692 dbSNP
rs1170313239 2702 dbSNP
rs1477994440 2703 dbSNP
rs1006117863 2707 dbSNP
rs895472191 2709 dbSNP
rs756359481 2711 dbSNP
rs1197143821 2712 dbSNP
rs528508692 2714 dbSNP
rs1004993622 2716 dbSNP
rs1473247516 2717 dbSNP
rs546576059 2718 dbSNP
rs1014593776 2721 dbSNP
rs55666306 2722 dbSNP
rs1257014693 2724 dbSNP
rs3212907 2727 dbSNP
rs1161328012 2734 dbSNP
rs1030080895 2736 dbSNP
rs1234459178 2740 dbSNP
rs1331006092 2741 dbSNP
rs1302630244 2749 dbSNP
rs551296182 2750 dbSNP
rs953576526 2761 dbSNP
rs3212908 2762 dbSNP
rs1019488041 2763 dbSNP
rs1341960716 2764 dbSNP
rs956816501 2766 dbSNP
rs1170573426 2767 dbSNP
rs968249749 2768 dbSNP
rs537238485 2769 dbSNP
rs760484924 2770 dbSNP
rs1416731727 2773 dbSNP
rs979621757 2775 dbSNP
rs988515364 2776 dbSNP
rs992143011 2779 dbSNP
rs917995807 2780 dbSNP
rs1269325777 2788 dbSNP
rs3212909 2789 dbSNP
rs1236080184 2790 dbSNP
rs947265437 2795 dbSNP
rs1203814114 2797 dbSNP
rs1045171871 2801 dbSNP
rs140650017 2803 dbSNP
rs1036271782 2804 dbSNP
rs1332520654 2808 dbSNP
rs1209710625 2811 dbSNP
rs534628073 2814 dbSNP
rs937189911 2815 dbSNP
rs1030383965 2826 dbSNP
rs748455804 2827 dbSNP
rs764129482 2828 dbSNP
rs940459407 2832 dbSNP
rs1177398427 2834 dbSNP
rs1228535482 2835 dbSNP
rs773752502 2835 dbSNP
rs1021383912 2836 dbSNP
rs760166916 2838 dbSNP
rs979610379 2839 dbSNP
rs898853917 2841 dbSNP
rs765879174 2843 dbSNP
rs956981787 2844 dbSNP
rs776074405 2849 dbSNP
rs995031239 2850 dbSNP
rs1284667513 2853 dbSNP
rs759220714 2854 dbSNP
rs1029234600 2863 dbSNP
rs992382225 2864 dbSNP
rs1447578556 2865 dbSNP
rs1438806825 2866 dbSNP
rs764807554 2867 dbSNP
rs1231731590 2868 dbSNP
rs3802782 2870 dbSNP
rs1008981840 2871 dbSNP
rs1431580946 2872 dbSNP
rs1479548648 2881 dbSNP
rs1359787072 2884 dbSNP
rs1172259240 2887 dbSNP
rs1396899681 2890 dbSNP
rs948081304 2891 dbSNP
rs1411516603 2893 dbSNP
rs1326755443 2894 dbSNP
rs1019120785 2895 dbSNP
rs956978418 2896 dbSNP
rs758200830 2897 dbSNP
rs909330324 2898 dbSNP
rs1343120821 2900 dbSNP
rs941838775 2905 dbSNP
rs988263745 2912 dbSNP
rs764005327 2913 dbSNP
rs1270452510 2914 dbSNP
rs189388457 2915 dbSNP
rs1216631712 2916 dbSNP
rs756198452 2919 dbSNP
rs1287850235 2923 dbSNP
rs1482991667 2924 dbSNP
rs34781697 2925 dbSNP
rs1442806962 2929 dbSNP
rs552902181 2930 dbSNP
rs1271111248 2931 dbSNP
rs1489890920 2934 dbSNP
rs1198414998 2935 dbSNP
rs1229680202 2937 dbSNP
rs1373915658 2940 dbSNP
rs780204390 2942 dbSNP
rs978665135 2943 dbSNP
rs553821905 2948 dbSNP
rs1425169635 2950 dbSNP
rs1165449107 2951 dbSNP
rs1363132668 2954 dbSNP
rs888747494 2955 dbSNP
rs1405488511 2957 dbSNP
rs539281793 2959 dbSNP
rs937242416 2967 dbSNP
rs755255558 2969 dbSNP
rs1204383584 2970 dbSNP
rs779218398 2972 dbSNP
rs1268737656 2974 dbSNP
rs1423359243 2978 dbSNP
rs1021791904 2979 dbSNP
rs904305753 2980 dbSNP
rs7178 2981 dbSNP
rs1294668998 2983 dbSNP
rs917101810 2984 dbSNP
rs1357350806 2989 dbSNP
rs1209258531 2991 dbSNP
rs940411341 2998 dbSNP
rs1384911321 2999 dbSNP
rs1196996121 3000 dbSNP
rs575482362 3012 dbSNP
rs1448921540 3013 dbSNP
rs1191338214 3016 dbSNP
rs200170583 3020 dbSNP
rs1445061410 3021 dbSNP
rs1165392467 3022 dbSNP
rs182540344 3023 dbSNP
rs1457348485 3026 dbSNP
rs930351808 3029 dbSNP
rs1436559105 3035 dbSNP
rs1158599364 3038 dbSNP
rs1328785666 3038 dbSNP
rs145912824 3039 dbSNP
rs889333390 3040 dbSNP
rs1009168079 3041 dbSNP
rs1364913527 3042 dbSNP
rs1453908820 3046 dbSNP
rs574666788 3051 dbSNP
rs980834196 3053 dbSNP
rs1040921012 3056 dbSNP
rs1381141866 3057 dbSNP
rs372155093 3061 dbSNP
rs776125781 3062 dbSNP
rs1352996367 3063 dbSNP
rs565242482 3064 dbSNP
rs919056104 3065 dbSNP
rs1461594851 3066 dbSNP
rs1185129222 3068 dbSNP
rs758993756 3069 dbSNP
rs1022409854 3070 dbSNP
rs757993935 3070 dbSNP
rs11604847 3071 dbSNP
rs533078965 3077 dbSNP
rs933149551 3077 dbSNP
rs1423120774 3090 dbSNP
rs1051357 3096 dbSNP
rs750697023 3097 dbSNP
rs551698744 3098 dbSNP
rs776449946 3099 dbSNP
rs762698268 3100 dbSNP
rs1470755860 3101 dbSNP
rs1339061438 3102 dbSNP
rs992776664 3103 dbSNP
rs1395935024 3104 dbSNP
rs1463837724 3107 dbSNP
rs1357795577 3112 dbSNP
rs917050973 3113 dbSNP
rs1308392384 3116 dbSNP
rs904210762 3117 dbSNP
rs1226716096 3119 dbSNP
rs1287826053 3126 dbSNP
rs763928703 3127 dbSNP
rs1210996435 3131 dbSNP
rs972222092 3135 dbSNP
rs1156900165 3147 dbSNP
rs1439240460 3149 dbSNP
rs1242579788 3151 dbSNP
rs1274707203 3160 dbSNP
rs1803191 3161 dbSNP
rs758578621 3162 dbSNP
rs1482825753 3163 dbSNP
rs1803190 3169 dbSNP
rs1196301536 3174 dbSNP
rs761597546 3175 dbSNP
rs1252652188 3176 dbSNP
rs1417251326 3179 dbSNP
rs1180746537 3182 dbSNP
rs1429420358 3183 dbSNP
rs1481186183 3189 dbSNP
rs920305726 3190 dbSNP
rs1376255517 3191 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HepG2 , A549
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... "Taken together ...

- Liu Q; Fu H; Sun F; Zhang H; Tie Y; Zhu J; et al., 2008, Nucleic acids research.

Article - Liu Q; Fu H; Sun F; Zhang H; Tie Y; Zhu J; et al.
- Nucleic acids research, 2008
MicroRNAs (miRNAs) are a class of small regulatory RNAs that are thought to be involved in diverse biological processes by regulating gene expression. Numerous miRNAs have been identified in various species, and many more miRNAs remain to be detected. Generally, hundreds of mRNAs have been predicted to be potential targets of one miRNA, so it is a great challenge to identify the genuine miRNA targets. Here, we generated the cell lines depleted of Drosha protein and screened dozens of transcripts (including Cyclin D1) regulated potentially by miRNA-mediated RNA silencing pathway. On the basis of miRNA expressing library, we established a miRNA targets reverse screening method by using luciferase reporter assay. By this method, we found that the expression of Cyclin D1 (CCND1) was regulated by miR-16 family directly, and miR-16 induced G1 arrest in A549 cells partially by CCND1. Furthermore, several other cell cycle genes were revealed to be regulated by miR-16 family, including Cyclin D3 (CCND3), Cyclin E1 (CCNE1) and CDK6. Taken together, our data suggests that miR-16 family triggers an accumulation of cells in G0/G1 by silencing multiple cell cycle genes simultaneously, rather than the individual target.
LinkOut: [PMID: 18701644]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HeLa
Disease WEE1
Location of target site 3'UTR
Tools used in this research EIMMO , TargetScan
Original Description (Extracted from the article) ... "we 茂卢聛nd the following: mir-424 targets ANLN ...

- Forrest AR; Kanamori-Katayama M; Tomaru Y; et al., 2010, Leukemia.

Article - Forrest AR; Kanamori-Katayama M; Tomaru Y; et al.
- Leukemia, 2010
Acute myeloid leukemia (AML) involves a block in terminal differentiation of the myeloid lineage and uncontrolled proliferation of a progenitor state. Using phorbol myristate acetate (PMA), it is possible to overcome this block in THP-1 cells (an M5-AML containing the MLL-MLLT3 fusion), resulting in differentiation to an adherent monocytic phenotype. As part of FANTOM4, we used microarrays to identify 23 microRNAs that are regulated by PMA. We identify four PMA-induced microRNAs (mir-155, mir-222, mir-424 and mir-503) that when overexpressed cause cell-cycle arrest and partial differentiation and when used in combination induce additional changes not seen by any individual microRNA. We further characterize these pro-differentiative microRNAs and show that mir-155 and mir-222 induce G2 arrest and apoptosis, respectively. We find mir-424 and mir-503 are derived from a polycistronic precursor mir-424-503 that is under repression by the MLL-MLLT3 leukemogenic fusion. Both of these microRNAs directly target cell-cycle regulators and induce G1 cell-cycle arrest when overexpressed in THP-1. We also find that the pro-differentiative mir-424 and mir-503 downregulate the anti-differentiative mir-9 by targeting a site in its primary transcript. Our study highlights the combinatorial effects of multiple microRNAs within cellular systems.
LinkOut: [PMID: 19956200]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
CLIP-seq Support 1 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000227507.2 | 3UTR | AUCGCUUCUGUGUAUCUCUUUCACAUUGUUUGCUGCUAUUGGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE14794 Lymphoblastoid cells -0.275 4.4e-3 -0.200 2.9e-2 90 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.487 6.8e-3 0.530 3.2e-3 25 Click to see details
GSE28544 Breast cancer 0.481 8.7e-3 0.481 8.7e-3 24 Click to see details
GSE17498 Multiple myeloma -0.347 1.4e-2 -0.355 1.2e-2 40 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.329 5.4e-2 -0.344 4.6e-2 25 Click to see details
GSE42095 Differentiated embryonic stem cells 0.253 1.2e-1 0.171 2.2e-1 23 Click to see details
GSE21032 Prostate cancer -0.128 1.2e-1 -0.122 1.4e-1 83 Click to see details
GSE38226 Liver fibrosis -0.259 1.3e-1 0.036 4.4e-1 21 Click to see details
GSE19350 CNS germ cell tumors 0.265 2.0e-1 0.201 2.7e-1 12 Click to see details
GSE17306 Multiple myeloma -0.105 2.4e-1 -0.075 3.0e-1 49 Click to see details
GSE21687 Ependynoma primary tumors 0.087 2.5e-1 -0.127 1.6e-1 64 Click to see details
GSE19536 Breast cancer -0.067 2.5e-1 -0.062 2.7e-1 100 Click to see details
GSE19783 ER+ ER+ breast cancer -0.138 2.8e-1 0.084 3.6e-1 20 Click to see details
GSE19783 ER- ER- breast cancer -0.059 3.0e-1 -0.055 3.2e-1 79 Click to see details
GSE32688 Pancreatic cancer 0.083 3.3e-1 0.096 3.0e-1 32 Click to see details
GSE27834 Pluripotent stem cells -0.106 3.5e-1 -0.162 2.7e-1 16 Click to see details
GSE28260 Renal cortex and medulla 0.056 4.3e-1 0.148 3.1e-1 13 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.062 4.4e-1 0.000 5.0e-1 9 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.034 4.4e-1 0.159 2.5e-1 20 Click to see details
GSE26953 Aortic valvular endothelial cells -0.017 4.7e-1 0.062 3.9e-1 24 Click to see details
GSE26953 Aortic valvular endothelial cells -0.017 4.7e-1 0.062 3.9e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA -0.277 0.01 -0.213 0.03 84 Click to see details
COAD -0.906 0.02 -1.000 0.5 5 Click to see details
CHOL -0.691 0.02 -0.683 0.02 9 Click to see details
PAAD -0.875 0.06 -0.800 0.1 4 Click to see details
ESCA 0.49 0.06 0.627 0.02 11 Click to see details
STAD 0.226 0.11 0.229 0.1 32 Click to see details
KIRC -0.143 0.12 -0.236 0.03 68 Click to see details
HNSC -0.182 0.12 -0.283 0.03 42 Click to see details
LIHC 0.106 0.23 0.091 0.27 49 Click to see details
CESC 0.714 0.25 1.000 0.5 3 Click to see details
KICH -0.127 0.27 -0.266 0.1 25 Click to see details
BLCA 0.146 0.28 0.251 0.16 18 Click to see details
LUSC -0.084 0.31 -0.157 0.17 38 Click to see details
PRAD -0.068 0.32 0.131 0.18 50 Click to see details
LUAD 0.086 0.4 -0.014 0.48 12 Click to see details
KIRP 0.045 0.4 0.037 0.42 32 Click to see details
UCEC -0.051 0.42 -0.084 0.37 19 Click to see details
PCPG -0.12 0.46 0.500 0.33 3 Click to see details
THCA -0.007 0.48 -0.063 0.32 59 Click to see details
THCA -0.007 0.48 -0.063 0.32 59 Click to see details
THCA -0.007 0.48 -0.063 0.32 59 Click to see details
451 hsa-miR-424-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000653 CCNF cyclin F 2 1
MIRT000654 CDC14A cell division cycle 14A 2 1
MIRT000655 CDC25A cell division cycle 25A 4 3
MIRT000656 CHEK1 checkpoint kinase 1 5 4
MIRT000657 KIF23 kinesin family member 23 4 7
MIRT000658 ATF6 activating transcription factor 6 2 1
MIRT000659 WEE1 WEE1 G2 checkpoint kinase 6 7
MIRT000660 ANLN anillin actin binding protein 2 1
MIRT000696 PLAG1 PLAG1 zinc finger 6 10
MIRT000936 CCNE1 cyclin E1 6 7
MIRT000937 CCND3 cyclin D3 4 1
MIRT000938 CDK6 cyclin dependent kinase 6 6 3
MIRT000941 CCND1 cyclin D1 6 4
MIRT003225 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 2 1
MIRT003226 MAP2K1 mitogen-activated protein kinase kinase 1 4 2
MIRT003227 PIAS1 protein inhibitor of activated STAT 1 2 1
MIRT003228 FGFR1 fibroblast growth factor receptor 1 5 3
MIRT003928 NFIA nuclear factor I A 3 2
MIRT005886 MYB MYB proto-oncogene, transcription factor 3 2
MIRT005887 SIAH1 siah E3 ubiquitin protein ligase 1 3 1
MIRT005926 HIF1A hypoxia inducible factor 1 alpha subunit 5 1
MIRT005927 CUL2 cullin 2 5 1
MIRT005928 SPI1 Spi-1 proto-oncogene 5 1
MIRT042434 CCIN calicin 1 1
MIRT042435 TTC39A tetratricopeptide repeat domain 39A 1 1
MIRT042436 TMF1 TATA element modulatory factor 1 1 1
MIRT042437 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT042438 PNISR PNN interacting serine and arginine rich protein 2 3
MIRT042439 IARS isoleucyl-tRNA synthetase 1 1
MIRT042440 HIST2H2AA3 histone cluster 2 H2A family member a3 1 1
MIRT042441 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 2 3
MIRT042442 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT042443 MAGED1 MAGE family member D1 1 1
MIRT042444 CNIH4 cornichon family AMPA receptor auxiliary protein 4 1 1
MIRT042445 ANKHD1 ankyrin repeat and KH domain containing 1 1 1
MIRT042446 EIF4G2 eukaryotic translation initiation factor 4 gamma 2 1 1
MIRT042447 BAZ2B bromodomain adjacent to zinc finger domain 2B 1 1
MIRT042448 APBB2 amyloid beta precursor protein binding family B member 2 1 1
MIRT042449 ANKRD17 ankyrin repeat domain 17 1 1
MIRT042450 RBM4B RNA binding motif protein 4B 1 1
MIRT042451 LAMTOR4 late endosomal/lysosomal adaptor, MAPK and MTOR activator 4 1 1
MIRT042452 TRAP1 TNF receptor associated protein 1 1 1
MIRT042453 SCOC short coiled-coil protein 1 1
MIRT042454 SACS sacsin molecular chaperone 1 1
MIRT042455 IFIH1 interferon induced with helicase C domain 1 1 1
MIRT042456 TBPL1 TATA-box binding protein like 1 2 3
MIRT042457 SMARCA5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 1 1
MIRT042458 GTF2A1 general transcription factor IIA subunit 1 1 1
MIRT053106 FASN fatty acid synthase 4 5
MIRT053149 SOCS6 suppressor of cytokine signaling 6 2 1
MIRT053379 CDX2 caudal type homeobox 2 3 1
MIRT055427 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 10
MIRT055818 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT057518 CEP55 centrosomal protein 55 2 8
MIRT057737 ZDHHC16 zinc finger DHHC-type containing 16 2 2
MIRT061008 C1ORF21 chromosome 1 open reading frame 21 2 6
MIRT061250 AMOTL1 angiomotin like 1 2 12
MIRT064689 CCND2 cyclin D2 2 4
MIRT065719 TARBP2 TARBP2, RISC loading complex RNA binding subunit 2 4
MIRT066297 MTFR1L mitochondrial fission regulator 1 like 2 2
MIRT066316 USP15 ubiquitin specific peptidase 15 2 2
MIRT071212 FCF1 FCF1, rRNA-processing protein 2 2
MIRT072826 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 4
MIRT074534 PAGR1 PAXIP1 associated glutamate rich protein 1 2 4
MIRT075256 SNTB2 syntrophin beta 2 2 4
MIRT075278 VPS4A vacuolar protein sorting 4 homolog A 2 8
MIRT075897 C16ORF72 chromosome 16 open reading frame 72 2 6
MIRT076796 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT078287 RPS6KB1 ribosomal protein S6 kinase B1 2 2
MIRT079659 NAPG NSF attachment protein gamma 2 12
MIRT080016 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 2 4
MIRT082989 PNPLA6 patatin like phospholipase domain containing 6 2 2
MIRT083270 ZCCHC3 zinc finger CCHC-type containing 3 2 6
MIRT084466 SOWAHC sosondowah ankyrin repeat domain family member C 2 4
MIRT086013 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 2 2
MIRT087428 ZNRF3 zinc and ring finger 3 2 2
MIRT087559 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 2 2
MIRT089112 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 2 4
MIRT089212 ACTR2 ARP2 actin related protein 2 homolog 2 2
MIRT091674 RARB retinoic acid receptor beta 2 6
MIRT093688 PI4K2B phosphatidylinositol 4-kinase type 2 beta 2 6
MIRT096239 CANX calnexin 2 2
MIRT100211 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 2 2
MIRT100369 HSPA1B heat shock protein family A (Hsp70) member 1B 2 6
MIRT100572 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 2 2
MIRT100741 VEGFA vascular endothelial growth factor A 2 12
MIRT100900 CD2AP CD2 associated protein 2 2
MIRT102441 CALU calumenin 2 2
MIRT102636 UBN2 ubinuclein 2 2 10
MIRT102974 EN2 engrailed homeobox 2 2 6
MIRT103097 MAFK MAF bZIP transcription factor K 2 4
MIRT103859 FOXK1 forkhead box K1 2 2
MIRT104020 USP42 ubiquitin specific peptidase 42 2 6
MIRT104236 DMTF1 cyclin D binding myb like transcription factor 1 2 2
MIRT106300 ZFHX4 zinc finger homeobox 4 2 6
MIRT106737 RAD23B RAD23 homolog B, nucleotide excision repair protein 2 2
MIRT107222 ZBTB34 zinc finger and BTB domain containing 34 2 2
MIRT107689 RECK reversion inducing cysteine rich protein with kazal motifs 2 2
MIRT109245 ZNF275 zinc finger protein 275 2 2
MIRT110057 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 5 7
MIRT112976 LUZP1 leucine zipper protein 1 2 6
MIRT114929 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT117660 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT120684 PAK2 p21 (RAC1) activated kinase 2 2 2
MIRT127740 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 2
MIRT133776 SKI SKI proto-oncogene 2 2
MIRT140152 SPRED1 sprouty related EVH1 domain containing 1 2 2
MIRT142247 DCTN5 dynactin subunit 5 2 8
MIRT152287 TNFSF9 TNF superfamily member 9 2 2
MIRT154054 RASSF2 Ras association domain family member 2 2 2
MIRT156468 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 2 2
MIRT158533 TNRC6B trinucleotide repeat containing 6B 2 4
MIRT165183 GRAMD3 GRAM domain containing 2B 2 2
MIRT165904 CREBRF CREB3 regulatory factor 2 2
MIRT175237 PSAT1 phosphoserine aminotransferase 1 2 6
MIRT179014 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 2
MIRT180914 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 8
MIRT186375 PNRC2 proline rich nuclear receptor coactivator 2 2 2
MIRT189764 CDADC1 cytidine and dCMP deaminase domain containing 1 2 2
MIRT189965 AGO4 argonaute 4, RISC catalytic component 2 2
MIRT190188 GPR180 G protein-coupled receptor 180 2 6
MIRT191460 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 2 2
MIRT191629 SLC39A9 solute carrier family 39 member 9 2 6
MIRT194242 FAM103A1 family with sequence similarity 103 member A1 2 6
MIRT194909 RBBP6 RB binding protein 6, ubiquitin ligase 2 8
MIRT196457 TAOK1 TAO kinase 1 2 2
MIRT201460 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 2 8
MIRT204597 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 8
MIRT204628 MOB4 MOB family member 4, phocein 2 8
MIRT204744 BZW1 basic leucine zipper and W2 domains 1 2 12
MIRT206023 NUP50 nucleoporin 50 2 6
MIRT211201 FGF2 fibroblast growth factor 2 5 5
MIRT211317 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 4
MIRT212611 RBPJ recombination signal binding protein for immunoglobulin kappa J region 2 8
MIRT223695 FZD6 frizzled class receptor 6 2 6
MIRT224969 BAG4 BCL2 associated athanogene 4 2 2
MIRT229350 ZNF449 zinc finger protein 449 2 2
MIRT229864 YIPF6 Yip1 domain family member 6 2 2
MIRT234346 MSL1 male specific lethal 1 homolog 2 8
MIRT247241 ELK4 ELK4, ETS transcription factor 2 4
MIRT247371 GABARAPL1 GABA type A receptor associated protein like 1 2 6
MIRT248769 ATXN7L3B ataxin 7 like 3B 2 4
MIRT249453 ZNF691 zinc finger protein 691 2 4
MIRT251497 DYNLL2 dynein light chain LC8-type 2 2 4
MIRT255339 SRPRB SRP receptor beta subunit 2 4
MIRT256311 CDC42SE2 CDC42 small effector 2 2 2
MIRT258414 WIPI2 WD repeat domain, phosphoinositide interacting 2 2 2
MIRT265059 TBRG1 transforming growth factor beta regulator 1 2 2
MIRT267532 C1ORF226 chromosome 1 open reading frame 226 2 2
MIRT270556 SETD1B SET domain containing 1B 2 2
MIRT273669 HOXC8 homeobox C8 2 2
MIRT274745 RAB3IP RAB3A interacting protein 2 2
MIRT277509 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 2 4
MIRT282538 SLCO3A1 solute carrier organic anion transporter family member 3A1 2 2
MIRT289635 CBX2 chromobox 2 2 2
MIRT294287 ZFP28 ZFP28 zinc finger protein 2 2
MIRT295815 CHMP4B charged multivesicular body protein 4B 2 2
MIRT297782 GABPA GA binding protein transcription factor alpha subunit 2 4
MIRT300110 STRADB STE20-related kinase adaptor beta 2 2
MIRT300998 MTMR3 myotubularin related protein 3 2 2
MIRT302619 CRIM1 cysteine rich transmembrane BMP regulator 1 2 6
MIRT302829 SOCS5 suppressor of cytokine signaling 5 2 2
MIRT307145 CTDSPL CTD small phosphatase like 2 4
MIRT313679 ITGA2 integrin subunit alpha 2 2 2
MIRT314055 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 2 8
MIRT317725 PPIL1 peptidylprolyl isomerase like 1 2 6
MIRT319335 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 2 2
MIRT320631 ZNRF2 zinc and ring finger 2 2 2
MIRT326306 OCRL OCRL, inositol polyphosphate-5-phosphatase 2 2
MIRT327967 CHIC1 cysteine rich hydrophobic domain 1 2 6
MIRT367269 CRKL CRK like proto-oncogene, adaptor protein 2 2
MIRT438750 PTCH1 patched 1 1 1
MIRT443811 SIDT2 SID1 transmembrane family member 2 2 2
MIRT446504 ASCC1 activating signal cointegrator 1 complex subunit 1 2 2
MIRT447774 DMRT2 doublesex and mab-3 related transcription factor 2 2 2
MIRT448443 TLL1 tolloid like 1 2 2
MIRT449186 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 2 2
MIRT451835 ALDH3B1 aldehyde dehydrogenase 3 family member B1 2 2
MIRT453284 EFTUD2 elongation factor Tu GTP binding domain containing 2 2 2
MIRT453750 CSNK1E casein kinase 1 epsilon 2 2
MIRT454966 TPM2 tropomyosin 2 2 2
MIRT456863 ZNF460 zinc finger protein 460 2 10
MIRT460220 FGFR4 fibroblast growth factor receptor 4 2 2
MIRT460434 DOCK11 dedicator of cytokinesis 11 2 2
MIRT461560 ACTR3B ARP3 actin related protein 3 homolog B 2 2
MIRT463168 ZNF367 zinc finger protein 367 2 10
MIRT464666 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 8
MIRT464752 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 2 2
MIRT465167 TSC22D2 TSC22 domain family member 2 2 2
MIRT465566 TOB2 transducer of ERBB2, 2 2 2
MIRT465930 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 8
MIRT466009 TMEM189 transmembrane protein 189 2 8
MIRT466294 TM4SF1 transmembrane 4 L six family member 1 2 2
MIRT466433 TFAP2A transcription factor AP-2 alpha 2 8
MIRT466920 STK38 serine/threonine kinase 38 2 10
MIRT466998 SSRP1 structure specific recognition protein 1 2 4
MIRT468055 SIK1 salt inducible kinase 1 2 2
MIRT468147 SH3BP4 SH3 domain binding protein 4 2 2
MIRT468673 SEC24A SEC24 homolog A, COPII coat complex component 2 4
MIRT469086 RNF168 ring finger protein 168 2 2
MIRT469411 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT471035 PISD phosphatidylserine decarboxylase 2 10
MIRT471492 PDE4D phosphodiesterase 4D 2 4
MIRT471952 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT472269 NFIC nuclear factor I C 2 2
MIRT472661 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 2 4
MIRT474314 LAMC1 laminin subunit gamma 1 2 2
MIRT474829 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 2 2
MIRT475065 IVNS1ABP influenza virus NS1A binding protein 2 6
MIRT475119 IPPK inositol-pentakisphosphate 2-kinase 2 2
MIRT475535 HOXA3 homeobox A3 4 8
MIRT475716 HEYL hes related family bHLH transcription factor with YRPW motif-like 2 2
MIRT475841 HDGF heparin binding growth factor 2 4
MIRT476256 GNB1 G protein subunit beta 1 2 6
MIRT476273 GNAL G protein subunit alpha L 2 6
MIRT476696 FURIN furin, paired basic amino acid cleaving enzyme 2 2
MIRT477561 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 8
MIRT477845 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 2 2
MIRT478908 CPSF7 cleavage and polyadenylation specific factor 7 2 6
MIRT479989 CARD10 caspase recruitment domain family member 10 2 2
MIRT481185 AVL9 AVL9 cell migration associated 2 6
MIRT482117 AKT3 AKT serine/threonine kinase 3 5 4
MIRT482373 AGO2 argonaute 2, RISC catalytic component 2 2
MIRT482553 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 10
MIRT482578 ABHD2 abhydrolase domain containing 2 2 2
MIRT484774 ABCC6 ATP binding cassette subfamily C member 6 2 4
MIRT485216 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 2 8
MIRT487390 C10orf54 V-set immunoregulatory receptor 2 2
MIRT492711 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 2 2
MIRT494353 CASKIN1 CASK interacting protein 1 2 2
MIRT495143 ZNRF1 zinc and ring finger 1 2 2
MIRT496015 CD180 CD180 molecule 2 2
MIRT497772 KIAA0895 KIAA0895 2 2
MIRT498980 ORC4 origin recognition complex subunit 4 2 8
MIRT499452 ODF2L outer dense fiber of sperm tails 2 like 2 8
MIRT499616 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 2 8
MIRT500093 L2HGDH L-2-hydroxyglutarate dehydrogenase 2 8
MIRT500324 ZNF622 zinc finger protein 622 2 8
MIRT500422 ZMAT3 zinc finger matrin-type 3 2 4
MIRT500576 USP53 ubiquitin specific peptidase 53 2 2
MIRT500864 SYPL1 synaptophysin like 1 2 8
MIRT500935 SRPR SRP receptor alpha subunit 2 6
MIRT500949 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 2 8
MIRT501088 SMAD7 SMAD family member 7 5 9
MIRT501502 PRICKLE2 prickle planar cell polarity protein 2 2 2
MIRT502036 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 2
MIRT502148 KIF5B kinesin family member 5B 2 8
MIRT502498 FAM122B family with sequence similarity 122B 2 8
MIRT502571 E2F7 E2F transcription factor 7 2 10
MIRT502646 DDX3X DEAD-box helicase 3, X-linked 2 8
MIRT502919 CDCA4 cell division cycle associated 4 2 8
MIRT502948 CDC37L1 cell division cycle 37 like 1 2 8
MIRT503143 ATG9A autophagy related 9A 2 6
MIRT504334 ASGR2 asialoglycoprotein receptor 2 2 6
MIRT504536 ZNF620 zinc finger protein 620 2 6
MIRT504852 HAUS3 HAUS augmin like complex subunit 3 2 6
MIRT505114 YTHDC1 YTH domain containing 1 2 6
MIRT505346 TMEM245 transmembrane protein 245 2 6
MIRT505396 TMEM100 transmembrane protein 100 2 2
MIRT505502 SRSF1 serine and arginine rich splicing factor 1 2 6
MIRT505546 SNX16 sorting nexin 16 2 6
MIRT505690 SESTD1 SEC14 and spectrin domain containing 1 2 6
MIRT505908 RIMS3 regulating synaptic membrane exocytosis 3 2 6
MIRT505926 RCAN3 RCAN family member 3 2 4
MIRT506108 PPIG peptidylprolyl isomerase G 2 6
MIRT506139 PLRG1 pleiotropic regulator 1 2 4
MIRT506192 PHKA1 phosphorylase kinase regulatory subunit alpha 1 2 6
MIRT506486 MYO5A myosin VA 2 6
MIRT506999 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 2 6
MIRT507819 CDK1 cyclin dependent kinase 1 2 6
MIRT507850 CCNE2 cyclin E2 2 6
MIRT507882 CBX6 chromobox 6 2 2
MIRT508036 AXIN2 axin 2 2 6
MIRT508641 CASK calcium/calmodulin dependent serine protein kinase 2 5
MIRT509364 DMPK DM1 protein kinase 2 11
MIRT509690 ATAD5 ATPase family, AAA domain containing 5 2 4
MIRT510043 AKR1B10 aldo-keto reductase family 1 member B10 2 4
MIRT511845 GPATCH8 G-patch domain containing 8 2 4
MIRT512285 ARHGDIA Rho GDP dissociation inhibitor alpha 2 6
MIRT512642 CPEB3 cytoplasmic polyadenylation element binding protein 3 2 4
MIRT513856 JARID2 jumonji and AT-rich interaction domain containing 2 2 8
MIRT514022 CAMSAP1 calmodulin regulated spectrin associated protein 1 2 4
MIRT514043 ATG14 autophagy related 14 2 2
MIRT518091 TRIM35 tripartite motif containing 35 2 2
MIRT518530 FLCN folliculin 2 6
MIRT518994 NNT nicotinamide nucleotide transhydrogenase 2 4
MIRT521056 SLC2A3 solute carrier family 2 member 3 2 4
MIRT521203 SBNO1 strawberry notch homolog 1 2 6
MIRT521814 POM121C POM121 transmembrane nucleoporin C 2 2
MIRT522100 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 4
MIRT522775 LAMP2 lysosomal associated membrane protein 2 2 6
MIRT537817 EFNB2 ephrin B2 2 4
MIRT539899 RPL14 ribosomal protein L14 2 4
MIRT540843 GNAT1 G protein subunit alpha transducin 1 2 4
MIRT541216 HOXA10 homeobox A10 2 2
MIRT541434 CBX4 chromobox 4 2 2
MIRT542808 PHC3 polyhomeotic homolog 3 2 2
MIRT542836 PDCD1 programmed cell death 1 2 7
MIRT543059 BAZ2A bromodomain adjacent to zinc finger domain 2A 2 2
MIRT543079 APP amyloid beta precursor protein 2 2
MIRT543306 ZNF585B zinc finger protein 585B 2 2
MIRT543408 ANAPC13 anaphase promoting complex subunit 13 2 2
MIRT543525 PRSS21 protease, serine 21 2 2
MIRT543797 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 2 4
MIRT543835 GSG1 germ cell associated 1 2 2
MIRT544571 POLDIP3 DNA polymerase delta interacting protein 3 2 2
MIRT544589 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 2 4
MIRT544912 CLSPN claspin 2 2
MIRT544965 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 2
MIRT545186 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 4
MIRT545347 CCDC83 coiled-coil domain containing 83 2 2
MIRT545682 DECR1 2,4-dienoyl-CoA reductase 1 2 2
MIRT545959 ZBTB10 zinc finger and BTB domain containing 10 2 2
MIRT546114 USP48 ubiquitin specific peptidase 48 2 4
MIRT546610 SALL1 spalt like transcription factor 1 2 4
MIRT546623 RUNX1T1 RUNX1 translocation partner 1 2 2
MIRT546639 RTN4 reticulon 4 2 2
MIRT547132 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 2 2
MIRT547234 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 2 4
MIRT547306 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 2 2
MIRT547411 MKX mohawk homeobox 2 2
MIRT547462 MBD4 methyl-CpG binding domain 4, DNA glycosylase 2 2
MIRT547549 LRRFIP2 LRR binding FLII interacting protein 2 2 4
MIRT547663 KPNA3 karyopherin subunit alpha 3 2 2
MIRT547700 KPNA1 karyopherin subunit alpha 1 2 4
MIRT547970 HIGD1A HIG1 hypoxia inducible domain family member 1A 2 4
MIRT547996 HCFC2 host cell factor C2 2 4
MIRT548015 GRB2 growth factor receptor bound protein 2 2 4
MIRT548223 FKBP1A FK506 binding protein 1A 2 2
MIRT548273 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT548729 CRK CRK proto-oncogene, adaptor protein 2 2
MIRT548806 CLIP4 CAP-Gly domain containing linker protein family member 4 2 4
MIRT548949 CDK17 cyclin dependent kinase 17 2 2
MIRT549074 CACUL1 CDK2 associated cullin domain 1 2 2
MIRT549121 C11orf24 chromosome 11 open reading frame 24 2 4
MIRT549276 ASH1L ASH1 like histone lysine methyltransferase 2 2
MIRT549390 AMOT angiomotin 2 2
MIRT550402 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 2 4
MIRT550466 OSCAR osteoclast associated, immunoglobulin-like receptor 2 4
MIRT550615 MTHFR methylenetetrahydrofolate reductase 2 2
MIRT550823 FAM229B family with sequence similarity 229 member B 2 2
MIRT551379 EPM2AIP1 EPM2A interacting protein 1 2 2
MIRT551617 ZNF267 zinc finger protein 267 2 2
MIRT551737 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 2 2
MIRT552035 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT552344 ZNF704 zinc finger protein 704 2 2
MIRT552749 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 2 2
MIRT553439 TPM3 tropomyosin 3 2 2
MIRT553561 TMEM161B transmembrane protein 161B 2 2
MIRT553618 TM7SF3 transmembrane 7 superfamily member 3 2 2
MIRT553772 TAF13 TATA-box binding protein associated factor 13 2 4
MIRT553809 SZRD1 SUZ RNA binding domain containing 1 2 4
MIRT554700 RNF149 ring finger protein 149 2 2
MIRT554962 RACGAP1 Rac GTPase activating protein 1 2 2
MIRT555032 RAB23 RAB23, member RAS oncogene family 2 2
MIRT555142 PTPRD protein tyrosine phosphatase, receptor type D 2 2
MIRT555225 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 2 4
MIRT555275 PRDM4 PR/SET domain 4 2 2
MIRT555432 PPAP2B phospholipid phosphatase 3 2 2
MIRT556387 LURAP1L leucine rich adaptor protein 1 like 2 2
MIRT556855 KANK1 KN motif and ankyrin repeat domains 1 2 4
MIRT557281 HIST2H2BE histone cluster 2 H2B family member e 2 2
MIRT557480 GPR27 G protein-coupled receptor 27 2 4
MIRT558037 EXT1 exostosin glycosyltransferase 1 2 2
MIRT558507 CYP26B1 cytochrome P450 family 26 subfamily B member 1 2 4
MIRT558589 CREBL2 cAMP responsive element binding protein like 2 2 4
MIRT558662 CNKSR3 CNKSR family member 3 2 2
MIRT559011 CA8 carbonic anhydrase 8 2 2
MIRT559158 BTN3A3 butyrophilin subfamily 3 member A3 2 2
MIRT559531 ARHGAP12 Rho GTPase activating protein 12 2 4
MIRT560852 OSBPL3 oxysterol binding protein like 3 2 2
MIRT561149 KRT33B keratin 33B 2 2
MIRT561400 TUBB2A tubulin beta 2A class IIa 2 2
MIRT561874 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT562027 LANCL1 LanC like 1 2 2
MIRT562201 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 2 2
MIRT562877 KIAA1456 KIAA1456 2 2
MIRT563086 SLC25A12 solute carrier family 25 member 12 2 2
MIRT563503 DLGAP3 DLG associated protein 3 2 2
MIRT563701 THRAP3 thyroid hormone receptor associated protein 3 2 2
MIRT563845 SMDT1 single-pass membrane protein with aspartate rich tail 1 2 2
MIRT563896 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 2 2
MIRT564332 CCNT1 cyclin T1 2 2
MIRT564478 ZNF391 zinc finger protein 391 2 2
MIRT564552 CCDC80 coiled-coil domain containing 80 2 2
MIRT564836 ZBTB16 zinc finger and BTB domain containing 16 2 2
MIRT564950 XKR7 XK related 7 2 2
MIRT564989 WNK3 WNK lysine deficient protein kinase 3 2 2
MIRT565044 VAV2 vav guanine nucleotide exchange factor 2 2 2
MIRT565401 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT566120 RASEF RAS and EF-hand domain containing 2 2
MIRT566650 NCKAP1 NCK associated protein 1 2 2
MIRT566831 MAP3K7 mitogen-activated protein kinase kinase kinase 7 2 2
MIRT567021 KLHL15 kelch like family member 15 2 2
MIRT567446 GNG12 G protein subunit gamma 12 2 2
MIRT567477 FZD9 frizzled class receptor 9 2 2
MIRT568021 CMTM4 CKLF like MARVEL transmembrane domain containing 4 2 2
MIRT568142 CCDC88C coiled-coil domain containing 88C 2 2
MIRT568474 ARMC12 armadillo repeat containing 12 2 2
MIRT568574 AHNAK2 AHNAK nucleoprotein 2 2 2
MIRT568625 ACVR2A activin A receptor type 2A 5 3
MIRT570466 TLK1 tousled like kinase 1 2 2
MIRT571119 UBE2H ubiquitin conjugating enzyme E2 H 2 2
MIRT571283 TTLL5 tubulin tyrosine ligase like 5 2 2
MIRT571428 RIF1 replication timing regulatory factor 1 2 2
MIRT571660 SERBP1 SERPINE1 mRNA binding protein 1 2 2
MIRT571828 PHF19 PHD finger protein 19 2 2
MIRT571928 LSM11 LSM11, U7 small nuclear RNA associated 2 2
MIRT574057 PROSC pyridoxal phosphate binding protein 2 2
MIRT574202 CLEC2D C-type lectin domain family 2 member D 2 2
MIRT574539 PDIA6 protein disulfide isomerase family A member 6 2 4
MIRT574594 N4BP1 NEDD4 binding protein 1 2 2
MIRT575882 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 2 4
MIRT575924 Dmpk dystrophia myotonica-protein kinase 2 7
MIRT576099 Pdcd1 programmed cell death 1 2 5
MIRT576591 Npepps aminopeptidase puromycin sensitive 2 2
MIRT614698 TRAK1 trafficking kinesin protein 1 2 2
MIRT616467 ADRA2B adrenoceptor alpha 2B 2 2
MIRT618896 ANKMY1 ankyrin repeat and MYND domain containing 1 2 2
MIRT621498 GPRC5A G protein-coupled receptor class C group 5 member A 2 4
MIRT640538 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT645510 BSPRY B-box and SPRY domain containing 2 2
MIRT646595 ANKRD36 ankyrin repeat domain 36 2 2
MIRT648784 KLHL40 kelch like family member 40 2 2
MIRT655812 NOTCH2 notch 2 2 2
MIRT658793 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 2 2
MIRT659256 CUL3 cullin 3 2 2
MIRT680982 DCAF17 DDB1 and CUL4 associated factor 17 2 2
MIRT682285 RS1 retinoschisin 1 2 2
MIRT682514 GLP2R glucagon like peptide 2 receptor 2 2
MIRT691709 FLOT2 flotillin 2 2 2
MIRT693930 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 2 2
MIRT701506 NEGR1 neuronal growth regulator 1 2 2
MIRT702092 MCFD2 multiple coagulation factor deficiency 2 2 2
MIRT702877 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT713419 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT714438 ARHGAP32 Rho GTPase activating protein 32 2 2
MIRT716432 RAB15 RAB15, member RAS oncogene family 2 2
MIRT717461 ADORA3 adenosine A3 receptor 2 2
MIRT720149 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 2 2
MIRT725132 SYNRG synergin gamma 2 2
MIRT731524 SOCS2 suppressor of cytokine signaling 2 1 1
MIRT731954 KDM5B lysine demethylase 5B 1 1
MIRT732455 LINC00922 long intergenic non-protein coding RNA 922 2 0
MIRT734001 BFAR bifunctional apoptosis regulator 3 0
MIRT734203 APLNR apelin receptor 3 0
MIRT734275 APLN apelin 3 0
MIRT735229 KCNQ1OT1 KCNQ1 opposite strand/antisense transcript 1 (non-protein coding) 0 0
MIRT737161 LINC00324 long intergenic non-protein coding RNA 324 1 0
MIRT737429 CADM1 cell adhesion molecule 1 2 0
MIRT756449 NUAK1 NUAK family kinase 1 1 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-424 Tamoxifen approved 2733526 Microarray rat liver 17343880 2007 up-regulated
miR-424 Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 down-regulated
miR-424 Medpor NULL NULL Microarray osteoblast-like cells line (MG-63) 18408260 2008 up-regulated
miR-424 17beta-estradiol (E2) approved 5757 Microarray MCF-7 breast cancer cells 19528081 2009 up-regulated
miR-424 Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-424 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer SKBR3 22076154 2011 up-regulated
miR-424 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-424 Vitamin D3 approved 5280795 Quantitative real-time PCR Plasma 22594500 2012 down-regulated
miR-424 Bicalutamide approved 2375 Microarray prostate 22674191 2012 up-regulated
miR-424 Ginsenoside Rh2 NULL 119307 Microarray NSCLC cell line A549 23152132 2013 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-424 Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (BGC823)
hsa-mir-424 Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (SGC-7901)
hsa-mir-424 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-424 Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer tissue
hsa-mir-424 Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer tissue
hsa-mir-424 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-424 Methotrexate 126941 NSC740 approved resistant cell line (W1)
hsa-mir-424 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-mir-424 Androstenedione 6128 NSC9563 sensitive cell line (MCF-7)
hsa-mir-424 Androstenedione+Anastrozole sensitive cell line (MCF-7)
hsa-mir-424 Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-424 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-mir-424 Cisplatin 5460033 NSC119875 approved sensitive cell line (SGC-7901)
hsa-mir-424 Cisplatin 5460033 NSC119875 approved sensitive cell line (BGC-823)
hsa-miR-424-5p (-)-huprine y 54608866 NSC720262 resistant
hsa-miR-424-5p (-)7,8-dihydrocalanolide a 383107 NSC682400 sensitive
hsa-miR-424-5p (3e)-3-[(2,6-dimethylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1-methylindol-2-one 24205817 NSC736793 resistant
hsa-miR-424-5p (3e)-3-[(2,6-dimethylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1h-indol-2-one 5471419 NSC711074 resistant
hsa-miR-424-5p (3z,5z)-3,5-bis[(4-fluorophenyl)methylidene]-1,1-dimethylpiperidin-1-ium-4-one;iodide 54608810 NSC634794 sensitive
hsa-miR-424-5p (4E)-2-(2-hydroxybenzoyl)-5-methyl-4-[(4-nitrophenyl)methylidene]pyrazol-3-one 5467414 NSC652175 sensitive
hsa-miR-424-5p (5R,5aS)-5-[2-(dimethylamino)ethoxy]-9-(4-hydroxy-3,5-dimethoxyphenyl)-5a,6,8a,9-tetrahydro-5H-[2]benzofuro[5,6-f][1,3]benzodioxol-8-one;hydrochloride 371049 NSC644945 sensitive
hsa-miR-424-5p (5s,5as)-5-[3-(dimethylamino)propylamino]-9-(4-hydroxy-3,5-dimethoxyphenyl)-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[6,5-f][1,3]benzodioxol-8-one 375034 NSC653860 sensitive
hsa-miR-424-5p (E)-3-[2-(4-methoxyphenyl)imidazo[1,2-a]pyridin-3-yl]-1-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 54613570 NSC750335 resistant
hsa-miR-424-5p (E)-but-2-enedioic acid;2-[4-tert-butyl-1-[(4-fluorophenyl)methyl]cyclohexyl]oxy-N,N-dimethylethanamine 5351427 NSC670226 resistant
hsa-miR-424-5p (z)-3-iodo-1,2-diphenyl-2-propen-1-one 5468683 NSC674454 resistant
hsa-miR-424-5p [1-[(2-bromo-5-hydroxy-4-methoxyphenyl)methyl]spiro[1,3,4,5,7,8-hexahydroisoquinoline-6,2'-1,3-dioxolane]-2-yl]-cyclobutylmethanone 401792 NSC715522 resistant
hsa-miR-424-5p [2-[[3-(3-aminopropoxy)naphthalene-2-carbonyl]amino]-5-chlorophenyl] 3-(3-aminopropoxy)naphthalene-2-carboxylate;hydrochloride 54613723 NSC751300 resistant
hsa-miR-424-5p [4-fluoro-5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-2-(hydroxymethyl)oxolan-3-yl] butanoate 380992 NSC666869 sensitive
hsa-miR-424-5p 1-(2-hydroxybenzoyl)-3-methyl-4-(4-methoxybenzylidene)-1h-pyrazole-5(4h)-one 5351408 NSC652174 sensitive
hsa-miR-424-5p 1-(5,8-dimethyl-6-nitro-9h-carbazol-3-yl)ethanone hydrazone 6078917 NSC652561 sensitive
hsa-miR-424-5p 1-[(2S)-3-[[2,7-di(piperidin-1-yl)-2,3,4a,5,7,7a-hexahydrofuro[3,4-b][1,4]dioxin-3-yl]oxy]oxolan-2-yl]piperidine 253322 NSC76150 sensitive
hsa-miR-424-5p 1-[(z)-(5-chloro-2-hydroxyphenyl)methylideneamino]-3-[(e)-(5-chloro-2-hydroxyphenyl)methylideneamino]urea 135408530 NSC48238 resistant
hsa-miR-424-5p 1-[5-[(e)-2-[4-(dimethylamino)phenyl]ethenyl]-6-methyl-1,2,4-triazin-3-yl]-6-hydroxy-3-phenyl-2-sulfanylidenepyrimidin-4-one 6412312 NSC698031 resistant
hsa-miR-424-5p 1-[8-(3-methoxyphenyl)-6,7-dimethyl-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-6-yl]pyrrolidine 382365 NSC669884 resistant
hsa-miR-424-5p 10,11-methylenedioxycamptothecin 72403 NSC634724 sensitive
hsa-miR-424-5p 15-[2-(dimethylamino)ethyl]-10-[2-(2-hydroxyethylamino)ethylamino]-1,15-diazatetracyclo[7.7.1.02,7.013,17]heptadeca-2,4,6,9,11,13(17)-hexaene-8,14,16-trione;hydrochloride 392057 NSC691849 sensitive
hsa-miR-424-5p 15-[2-(dimethylamino)ethyl]-10-[2-(dimethylamino)ethyl-methylamino]-1,15-diazatetracyclo[7.7.1.02,7.013,17]heptadeca-2,4,6,9,11,13(17)-hexaene-8,14,16-trione 392571 NSC693118 sensitive
hsa-miR-424-5p 2-(2-ethyl-6-propan-2-ylanilino)-3-(4-methylpyridin-1-ium-1-yl)naphthalene-1,4-dione;perchlorate 24202023 NSC618659 sensitive
hsa-miR-424-5p 2-(dipentylamino)-1-(1,2,3,4-tetrahydrophenanthren-9-yl)ethanol;hydrochloride 24181846 NSC62485 resistant
hsa-miR-424-5p 2-[[1-(chloromethoxy)-2-(dimethylamino)ethyl]amino]-n-[2-[[4-[2-[[2-[[1-(chloromethoxy)-2-(dimethylamino)ethyl]amino]-2-(sulfanylmethylamino)acetyl]amino]ethylamino]-5,8-dihydroxy-9,10-dioxoanthracen- 438971 NSC692228 sensitive
hsa-miR-424-5p 2-[[4-[(2-amino-4-oxo-3H-quinazolin-6-yl)methyl-prop-2-ynylamino]benzoyl]amino]pentanedioic acid 135402053 NSC327182 sensitive
hsa-miR-424-5p 2-[16-(3,4-dimethoxyphenyl)-12,14-diphenyl-10-oxa-3,5,6,8,12,13-hexazatetracyclo[7.7.0.02,6.011,15]hexadeca-1(9),2,4,7,11(15),13-hexaen-4-yl]acetonitrile 391834 NSC691421 sensitive
hsa-miR-424-5p 2-[2-[5-(ethoxycarbonylcarbamoyl)-3-methyl-2,4-dioxopyrimidin-1-yl]ethylsulfanyl]ethyl n-[6-[2-[2-[5-(ethoxycarbonylcarbamoyl)-3-methyl-2,4-dioxopyrimidin-1-yl]ethylsulfanyl]ethoxycarbonylamino]hexyl] 367630 NSC637505 sensitive
hsa-miR-424-5p 2-[3-[1-(4-chlorophenyl)-1-methyl-3-oxo-isoindolin-2-yl]propyl]isoindoline-1,3-dione 395648 NSC700430 resistant
hsa-miR-424-5p 2-amino-6-(benzylamino)-4-(2-chlorophenyl)pyridine-3,5-dicarbonitrile 24205132 NSC734396 sensitive
hsa-miR-424-5p 2-bromo-4-(5-fluoro-1,3-benzothiazol-2-yl)aniline 399248 NSC709925 resistant
hsa-miR-424-5p 2-chloro-3-phenoxy-1,4-naphthoquinone NSC1507 resistant
hsa-miR-424-5p 2-hydroxy-3-[(8-hydroxyquinolin-7-yl)-(4-methoxyphenyl)methyl]-6-propan-2-ylcyclohepta-2,4,6-trien-1-one 361375 NSC624401 sensitive
hsa-miR-424-5p 2-methoxy-5,7,8,13,13a,14-hexahydroisoquino[3,2-b][3]benzazepine 392606 NSC693146 resistant
hsa-miR-424-5p 2-phenyl-3a,3b,4,5,6,7,8,8a,13,13b-decahydro-1h-cyclohepta[c]pyrrolo[3,4-a]carbazole-1,3(2h)-dione 362439 NSC626388 sensitive
hsa-miR-424-5p 2-thienyl-[3-(thiophene-2-carbonyl)-2-thioxo-imidazolidin-1-yl]methanone 396758 NSC703468 sensitive
hsa-miR-424-5p 2,2,2-trifluoro-N-[3-[naphthalen-2-ylmethyl-[4-[naphthalen-2-ylmethyl-[3-[(2,2,2-trifluoroacetyl)amino]propyl]amino]butyl]amino]propyl]acetamide 389638 NSC685981 resistant
hsa-miR-424-5p 2,4-quinazolinediamine, 6,6'-thiobis- 393413 NSC695267 sensitive
hsa-miR-424-5p 2,5,11-trimethyl-9-phenoxy-6h-pyrido[4,3-b]carbazol-2-ium;acetate 10431819 NSC650269 sensitive
hsa-miR-424-5p 20-[3-(1,4-diazepan-1-yl)propyl]-15,16-dimethoxy-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaene-11,19-dione;hydrochloride 45027855 NSC728319 sensitive
hsa-miR-424-5p 3-[(4-chlorophenyl)methyl]-4-[(e)-(3-methoxyphenyl)methylideneamino]-1h-1,2,4-triazol-5-one 9556356 NSC698065 sensitive
hsa-miR-424-5p 3-[(e)-carbazol-9-yliminomethyl]-4-hydroxy-5-methoxybenzaldehyde 135436314 NSC718153 sensitive
hsa-miR-424-5p 3-amino-N-(4-benzylphenyl)-5-chloroindazole-1-carboxamide 51033073 NSC749550 resistant
hsa-miR-424-5p 4'-(9-acridinylamino)sulfanilanilide, monohydrochloride 148802 NSC140701 sensitive
hsa-miR-424-5p 4-(2-azidophenothiazin-10-yl)-N,N-dimethylbutan-1-amine;oxalic acid 385933 NSC677395 resistant
hsa-miR-424-5p 4-[(1-benzyl-4-chloro-2,5-dioxopyrrol-3-yl)amino]-N-(4-fluorophenyl)benzamide 1194957 NSC732830 sensitive
hsa-miR-424-5p 4-[[3-[(4-carbamimidoylphenoxy)methyl]phenyl]methoxy]benzenecarboximidamide;hydrochloride 24203365 NSC727667 sensitive
hsa-miR-424-5p 4-[6-[4-(4,6-diamino-2,2-dimethyl-1,3,5-triazin-1-yl)phenyl]hexyl]benzenesulfonyl fluoride;ethanesulfonic acid 280526 NSC132279 sensitive
hsa-miR-424-5p 4-amino-8-chloro-2-(4-methoxyphenyl)iminopyrimido[2,1-b][1,3]benzothiazole-3-carbonitrile 45029232 NSC745677 resistant
hsa-miR-424-5p 4-n-(7-chloro-3-phenylquinolin-4-yl)-1-n,1-n-diethylpentane-1,4-diamine;hydroiodide 24182056 NSC13477 resistant
hsa-miR-424-5p 4-n-(7-chloroquinolin-4-yl)-1-n-cyclohexylcyclohexane-1,4-diamine NSC3618 resistant
hsa-miR-424-5p 5-(3-phenyl-3-oxo-1-propynyl)pyrimidine-2,4(1h,3h)-dione 359098 NSC619674 sensitive
hsa-miR-424-5p 5-(4-methoxyphenyl)-3-(3,4,5-trimethoxyphenyl)-4,5-dihydro-1h-pyrazole 49865894 NSC748404 resistant
hsa-miR-424-5p 5-[(E)-2-(5-ethyl-1-methylpyridin-1-ium-2-yl)ethenyl]quinolin-8-ol;iodide 135534376 NSC79543 sensitive
hsa-miR-424-5p 5-amino-2-(4-chloroanilino)-1,3-thiazole-4-carbonitrile 367981 NSC638199 sensitive
hsa-miR-424-5p 5-phenyl-2,3-bis(2-thienyl)thiophene 395510 NSC700200 resistant
hsa-miR-424-5p 6-[2-[2-[2-[2-(5,11-dioxoindeno[1,2-c]isoquinolin-6-yl)ethylamino]ethylamino]ethylamino]ethyl]indeno[1,2-c]isoquinoline-5,11-dione;2,2,2-trifluoroacetic acid 45027880 NSC730870 sensitive
hsa-miR-424-5p 6-[2-[3-[2-(5,11-dioxoindeno[1,2-c]isoquinolin-6-yl)ethylamino]propylamino]ethyl]indeno[1,2-c]isoquinoline-5,11-dione;2,2,2-trifluoroacetic acid 45027847 NSC728087 sensitive
hsa-miR-424-5p 6-[3-[(4-fluorophenyl)methoxy]phenyl]-5-(2-methylsulfonylpyrimidin-4-yl)imidazo[2,1-b][1,3]thiazole 155811287 NSC763232 resistant
hsa-miR-424-5p 6-chloro-1-[2-[ethyl-(2-hydroxy-2-methylpropyl)amino]ethylamino]-4-methylthioxanthen-9-one;hydrochloride 24182355 NSC15795 resistant
hsa-miR-424-5p 6-chloro-9-[4-(4-methylphenoxy)-5-[(4-methylphenoxy)methyl]oxolan-2-yl]purine 389530 NSC685827 resistant
hsa-miR-424-5p 7-phenyl-5h-pyrazolo[3,4-e][1,2,4]triazin-3-ylamine 6399307 NSC629487 sensitive
hsa-miR-424-5p 7h-5,6-dithioleno[4,3-d]uracil 388876 NSC684074 sensitive
hsa-miR-424-5p 9,10-anthracenedione, 1-[(oxiranylmethyl)amino]- 384119 NSC673348 sensitive
hsa-miR-424-5p 9.beta.-d-arabinofuranosyl-2-chloroadenine 235481 NSC76356 sensitive
hsa-miR-424-5p Acetylmarinobufogenin 282302 NSC135687 sensitive
hsa-miR-424-5p Aclarubicin 308141 NSC208734 sensitive
hsa-miR-424-5p Acovenoside b 272418 NSC116789 sensitive
hsa-miR-424-5p Anthraquinone, 1-hydroxy-4-[p-(2-hydroxyethyl)anilino]- 291365 NSC156565 resistant
hsa-miR-424-5p Arq monoacetate 385441 NSC676676 sensitive
hsa-miR-424-5p Azane;dichloroplatinum;2-(3,4-dimethoxyphenyl)ethanamine 498557 NSC631304 sensitive
hsa-miR-424-5p Azq 42616 NSC182986 sensitive
hsa-miR-424-5p Bafilomycin deriv 5385089 NSC381866 resistant
hsa-miR-424-5p Benzene, 1,1'-(1,2-ethanediyl)bis[2,5-dimethoxy- 297389 NSC168516 resistant
hsa-miR-424-5p Betuletol 5459196 NSC641548 sensitive
hsa-miR-424-5p Bialamicol 10304 NSC6386 resistant
hsa-miR-424-5p Biantrazole 54607781 NSC357885 sensitive
hsa-miR-424-5p Bn-2629 393111 NSC694501 sensitive
hsa-miR-424-5p Calactin 30100 NSC650471 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin 24360 NSC94600 sensitive
hsa-miR-424-5p Camptothecin 24360 NSC94600 sensitive
hsa-miR-424-5p Cardenolide 2 388098 NSC682561 sensitive
hsa-miR-424-5p Ci-921: amsacrine derivative 157348 NSC343499 sensitive
hsa-miR-424-5p Cladribine 1546 NSC105014 sensitive
hsa-miR-424-5p Digitoxigenin glycoside NSC267713 sensitive
hsa-miR-424-5p Digoxin 2724385 NSC95100 approved sensitive
hsa-miR-424-5p Dimethyl (Z)-2-(2,3,4,6,8-pentamethylazulen-1-yl)but-2-enedioate 5468314 NSC668419 resistant
hsa-miR-424-5p Echujetin 274159 NSC407806 sensitive
hsa-miR-424-5p Fagaronine chloride 40304 NSC157995 sensitive
hsa-miR-424-5p Faradiol 397486 NSC705534 sensitive
hsa-miR-424-5p Ferric-taxol 54612932 NSC749908 resistant
hsa-miR-424-5p Fludarabine 657237 NSC118218 approved sensitive
hsa-miR-424-5p Gnmlngdfmleynr-uhfffaoysa-n 402862 NSC717147 resistant
hsa-miR-424-5p Gw876790x 25023715 NSC756413 resistant
hsa-miR-424-5p Homohalichondrin b 6711269 NSC609394 resistant
hsa-miR-424-5p Hopeaphenol 495605 NSC661748 resistant
hsa-miR-424-5p Irinotecan 60838 NSC728073 approved sensitive
hsa-miR-424-5p Irinotecan 60838 NSC728073 approved sensitive
hsa-miR-424-5p Isopinnatal 390665 NSC688277 sensitive
hsa-miR-424-5p Lmp-400 11533060 NSC724998 sensitive
hsa-miR-424-5p Lunatin 5351204 NSC89671 resistant
hsa-miR-424-5p M-amsa 148674 NSC154948 sensitive
hsa-miR-424-5p Melphalan 460612 NSC8806 approved sensitive
hsa-miR-424-5p Merophan 9571 NSC57199 sensitive
hsa-miR-424-5p Methyl (2s)-2-[[4-[[[(e)-2-methyl-3-phenylprop-2-enoyl]amino]methyl]benzoyl]amino]-4-methylsulfanylbutanoate 5470461 NSC702106 resistant
hsa-miR-424-5p Mitoxantrone 4212 NSC279836 approved sensitive
hsa-miR-424-5p Mitoxantrone 4212 NSC279836 approved sensitive
hsa-miR-424-5p N-((3-benzoyl-2-thioxo-1-imidazolidinyl)carbothioyl)-n-phenylbenzamide 396960 NSC704180 sensitive
hsa-miR-424-5p N-(3,5-dimethoxybenzyl)-4-methoxyaniline 364713 NSC631371 resistant
hsa-miR-424-5p N-[(5s,8ar,9r)-9-(4-hydroxy-3,5-dimethoxyphenyl)-8-oxo-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[5,6-f][1,3]benzodioxol-5-yl]-3-cyanobenzamide 369926 NSC642293 sensitive
hsa-miR-424-5p N-[4-[[[2-(4-chloroanilino)pyridine-3-carbonyl]amino]sulfamoyl]phenyl]acetamide 16126694 NSC737147 resistant
hsa-miR-424-5p N-[bis(aziridin-1-yl)phosphoryl]adamantan-1-amine 64376 NSC166199 sensitive
hsa-miR-424-5p N,n-bis{[(4-chlorophenyl)sulfanyl]methyl}-4-methylaniline 248767 NSC66211 sensitive
hsa-miR-424-5p Navan 941650 NSC108165 resistant
hsa-miR-424-5p Ncs-665564 380161 NSC665564 sensitive
hsa-miR-424-5p Neriifolin 276293 NSC123976 sensitive
hsa-miR-424-5p NSC623283 NSC623283 sensitive
hsa-miR-424-5p NSC763857 NSC763857 resistant
hsa-miR-424-5p Oxanthrazole 59916 NSC349174 sensitive
hsa-miR-424-5p Pcnu 26328 NSC95466 sensitive
hsa-miR-424-5p Phenylbenzophenone 407452 NSC5639 resistant
hsa-miR-424-5p S-(6-oxo-1,3,5-triphenyl-2-thioxo-1,2,3,6-tetrahydro-4-pyrimidinyl) 4-methoxybenzenecarbothioate 383063 NSC671107 sensitive
hsa-miR-424-5p S-(dimethylarsino)-3-mercapto-1,2-propanediol 406475 NSC724596 sensitive
hsa-miR-424-5p Stk716556 342450 NSC379399 resistant
hsa-miR-424-5p Tamoxifen 2733525 NSC180973 approved resistant
hsa-miR-424-5p Tetramethyl (1R,5R,6S,9S)-3-(4-chlorobenzoyl)oxy-5-hydroxy-7-[2-(trifluoromethyl)phenyl]bicyclo[3.3.1]non-2-ene-2,4,6,9-tetracarboxylate 24204894 NSC733348 sensitive
hsa-miR-424-5p Thevetin 5458241 NSC123979 sensitive
hsa-miR-424-5p Toddalin 5351594 NSC76023 resistant
hsa-miR-424-5p Topotecan 60699 NSC609699 approved sensitive
hsa-miR-424-5p Topotecan 60699 NSC609699 approved sensitive
hsa-miR-424-5p Venenatine 272417 NSC116787 sensitive
hsa-miR-424-5p Yoshi 864 18949 NSC102627 sensitive
hsa-miR-424-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-424-5p Docetaxel 148124 NSC628503 approved resistant High Non-Small Cell Lung Cancer cell line (SPC-A1)
hsa-miR-424-5p Doxorubicin 31703 NSC123127 approved resistant High Leukemia cell line (K562)
hsa-miR-424-5p 10-Hydroxycamptothecin 97226 NSC107124 sensitive High Gastric Cancer cell line (BGC823, SGC-7901, MGC-803, HGC-27, NCI-N87, AGS)
hsa-miR-424-5p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (SUIT-2, CAPAN-1)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved sensitive High Germ Cell Tumor cell line (NTERA-2)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved sensitive Low Epidermoid Carcinoma cell line (KB-3-1, KB-CP.5, KB-CP20)
hsa-miR-424-5p Chemotherapy sensitive High Epithelial Ovarian Cancer tissue
hsa-miR-424-5p Etoposide 36462 NSC141540 approved resistant Low melanoma tissue and cell line (A375)
hsa-miR-424-5p Doxorubicin 31703 NSC123127 approved resistant Low Colorectal Cancer tissue and cell line (HCT-116)
hsa-miR-424-5p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-424-5p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-424-5p Fluorouracil 3385 NSC19893 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-424-5p Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-424-5p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (HCT-116)
hsa-miR-424-5p Vincristine 5978 approved sensitive High Colorectal Cancer cell line (HCT-8)
hsa-miR-424-5p Gefitinib 123631 NSC715055 approved sensitive High Lung Adenocarcinoma cell line (A549)
hsa-miR-424-5p Doxorubicin 31703 NSC123127 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-424-5p Docetaxel 148124 NSC628503 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-424-5p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-424-5p Imatinib 5291 NSC743414 approved sensitive Low Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-424-5p Taxane 9548828 resistant High Prostate Cancer cell line (PC-3, PR20
hsa-miR-424-5p Plx-4720 24180719 NSC757438 sensitive High Thyroid Cancer cell line (8505c, BCPAP)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-424-5p Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-424-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-424-5p Trail sensitive Low Acute Myeloid Leukemia tissue and cell line (HL-60, K562, NB4)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer cell line (ID8)
hsa-miR-424-5p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (TAMR4, TAMR8)
hsa-miR-424-5p Paclitaxel 36314 NSC125973 approved sensitive Low Breast Cancer tissue and cell line
hsa-miR-424-5p Curcumin 969516 NSC32982 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-424-5p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-424-5p Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-424-5p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-424-5p Ceritinib 57379345