miRTarBase - #MIRT001065


—
pre-miRNA Information
pre-miRNA mmu-mir-16-1   
Genomic Coordinates chr14: 61631880 - 61631972
Description Mus musculus miR-16-1 stem-loop
Comment None
RNA Secondary Structure
pre-miRNA mmu-mir-16-2   
Genomic Coordinates chr3: 69009902 - 69009996
Synonyms Mirn16, Mirn16-1, miR-16, mir-16-1, Mir16-1, Mirn16-2, mir-16-2, Mir16-2
Description Mus musculus miR-16-2 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-16-5p
Sequence 17| UAGCAGCACGUAAAUAUUGGCG |38
Evidence Experimental
Experiments Cloned
Putative Targets

Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B3XID9 miR-16 Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Urine Quantitative real-time reverse transcription PCR
B08JQH miR-16-5p Predictive Biomarker (PRD) Clinical/Experimental Data Expression . Peripheral blood MicroRNA sequencing
Gene Information
Gene Symbol Ccnd1   
Synonyms AI327039, CycD1, Cyl-1, PRAD1, bcl-1, cD1
Description cyclin D1
Transcript NM_007631   
Expression
Putative miRNA Targets on Ccnd1
3'UTR of Ccnd1
(miRNA target sites are highlighted)		 
>Ccnd1|NM_007631|3'UTR
   1 GGGCCACCGGGCAGGCGGGAGCCACCAAGTAGTGGCACCCGCAAAGAGGAAGGAGCCAGCCCGGGTGCTCCTGACGACGT
  81 CCCCCTTGGGGACATGTTGTTACCAGAAGAGGAAGTTTTGTTCTCTTTGTTGGTTGTTTTTCCTTAATCTTTCTCCTTTC
 161 TATCTGATTTAAGCAAAAGAGAAAAAAATATCTGAAAGCTGTCTTAAAGAGAGAGAGAGAGAGATAGAATCTGCATCACC
 241 CTGAGAGTAGGGAGCCAGGGGGTGCTACAAAAATAGAATTCTGTACCCCAGTAATCAACTAGTTTTCTATTAATGTGCTT
 321 GTCTGTTCTAAGAGTAGGATTAACACAGGGGAAGTCTTGAGAAGGAGTTTTGATTCTTTTATATGTTTTTAAAAAAAAGC
 401 TTAAGAAACATTGCTTTAAAAAGGAAGGAAAAAAAATACAGCAAACCATTGTTAAAGTAGAAGAGTTTTTAGGTTGAGAA
 481 ATGTACTCTGCTTTGCTGAAAAGCCACAGCTTAGGCCCTCAGCCTCACTCCCTGGCTTGCTCAGTGCCTACAGCCCTGTT
 561 ACCTGATACCTGTGCTTTATCCCAGGGGTGGGCAGACCTCTTAACCTTATAGATGGTCAGTGCGACCTCTAGTGGTCTCA
 641 TGGCGTGTGGCACAACCCCCCTCCCCAGGGCTCAGCTTAATGTGCCCTCTCCCCCCAACAACCTGCAGGTTCACAGCACC
 721 AGCCACACAGCGGTAGGGATGAAATAGTGACATAATATATTCTATTTTTGTAACCTTCCTATTTTGTAGCTCTGTTTAGA
 801 GAGATGCTGGTTTTTGCCTGAAGGCCCTGCAGCCTGCCCACATCAGGTTAAACCCACAGCTTTTGTGTGTGGTTTGTTTT
 881 GTTGTGTTTTCTTTCTCTATGTTCCAAAACCATTCCATTTCAAAGCACTTTTGGTCAGCTAGCTGGAGGCAGTGTTGCTG
 961 GTGTGTGTTGGGGGGAGGGGTTCTAATGGAATGGATGGGGATGTCCACACACGCATTCAGATGGCTGTACAACAGGTTGT
1041 AGGGCTGGTAGTATGAGGTGCTTGGGAAGTTTTGTTGGGTCAAGAAGAGAGAACTCTGTTCTCGCACCACCGGGATCTGT
1121 CCTGCAAAGTTGAAGGGATCCTTTGGTGCCAGCTGGTGTTTGGAAGTAGGAACCATGATGGCATTACCTGGACAAGGAGA
1201 TTGGGGACAACTCTTAAGTCTCACACAGGAGGCTTTTAAACACTAAAATGTCTAATTTATACTTAAGGCTACAGAAGAGT
1281 ATTTATGGGAAAGGCTGCCCATGACCAGTGTGACTCAAAGCAATGTGATCTCCCTTGATTCAAACGCACACCTCTGCCCT
1361 GCTGGAGAAGGTTTAGGGCCATGTCTGAGAGATTGGTCTTTCATTGGGCAACGGGGGGGGGGGGGGGGTCCTTAAAAAAA
1441 AAAAACCACAAAGACAGAGATTTGGTCTGCTTGACTTTCCCAACCCAATTGGCCCCATTGGAGAGCCATCCAAACTGAGG
1521 AAAATTAGGGGACTCCAAAAGAGTTTGATTCTGGCACATTCTTGCCGCTGCCCCCAAGTTAACAACAGTAGGTAATTTGC
1601 ACACCTCTGGCTCTGTGCCTTTCTATTAGGACTTTTTGGCAGAAGGTGGAGAGCGGGAGGCTTAAGAGGGGATGTGAGGG
1681 AAGAGGTGAAGGTGGGACCACATGGGACAGGCCACGGCTCCTCTCATGGCGCTGCTACCGATGACTCCCAGGATCCCAGA
1761 CGTTCAGAACCAGATTCTCATTGCTTTGTATCTTTCACGTTGTTTTCGCTGCTATTGGAGGGTCAGTTTTGTTTTGTTTT
1841 GTTTTACAATGTCAGACTGCCATGTTCAAGTTTTAATTTCCTCATAGAGTGTATTTACAGATGCCCTTTTTTGTACTTTT
1921 TTTTTTAATTGTGATCTATTTTGGCTTAATGTGATTACCGCTGTATTCCAAAAAAAAAAAAAAAACAGGTTCCTGTTCAC
2001 AATACCTCATGTATCATCTAGCCATGCACGAGCCTGGCAGGCAGGTGGGCGGTCTGCCTCCAGGGATCCTGGGACCCTGA
2081 TGGCGATCGTCCTGTCATGCTGGGCCCTTCATTTGATCTGGGACATAGCATCACAGCAGTCAGGGCACCTGGATTGTTCT
2161 GTTATCGATATTGTTTCTTGTAGCGGCCTGTTGTGCATGCCACCATGCTGCTGGCCCGGGGGGATTTGCTCTGAGTCTCC
2241 GGTGCATCATTTAATCTGTTAGGTTCTAGTGTTCCGTCTTGTTTTGTGTTAATTACAGCATTGTGCTAATGTAAAGACTC
2321 TGCCTTTGCGAAGCCAGCTGCAGTGCTGTAGGCCCCCAAGTTCCCTAGCAAGCTGCCAAACCAAAACGGGCACCACCAGC
2401 TCAGCTGAGGCATCCCAGCCAGGCAGGACCCTTGAGGGCCGCTGTATCCATGGTGATGGGGTGAGGTTTTGGCCAAAAGG
2481 CCAAAGACTGGTGGTGGGTCCACGGAATCTGCCCTGTGACATGAAAGGCTTTGAGGGGCTCTGGCTGGTGGCCAGGTTGG
2561 CTTTTTGTATTTCTGGTTGACACACCATGGCGCTTCCCAGCACAGACATGTGACCAGCATGGTCCAGGAAAAAAAAAAAG
2641 ACAAAAAATCTAGAAAATAAAATTGGTAAAATCTCA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gcgguuauaaauGCACGACGAu 5'
                      | ||||||| 
Target 5' tgtgcatgccacCATGCTGCTg 3'
 2192 - 2213 142.00 -13.30
2 
miRNA  3' gcgGUUAUAAAUGCACGACGAu 5'
             |: |:||| |  |||||| 
Target 5' tcaCGTTGTTTTC--GCTGCTa 3'
 1795 - 1814 130.00 -11.50
3 
miRNA  3' gcgguuauaaaugCACGACGAu 5'
                       |||:|||| 
Target 5' ctagctggaggcaGTGTTGCTg 3'
 939 - 960 129.00 -12.70
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions LNCaP , RWPE-1 , K562
Location of target site 3'UTR
Tools used in this research miRanda , TargetScan , PicTar
Original Description (Extracted from the article) ... "Both miRNAs are able to target BCL2 ...

- Bonci D; Coppola V; Musumeci M; Addario A; et al., 2008, Nature medicine.

Article - Bonci D; Coppola V; Musumeci M; Addario A; et al.
- Nature medicine, 2008
MicroRNAs (miRNAs) are noncoding small RNAs that repress protein translation by targeting specific messenger RNAs. miR-15a and miR-16-1 act as putative tumor suppressors by targeting the oncogene BCL2. These miRNAs form a cluster at the chromosomal region 13q14, which is frequently deleted in cancer. Here, we report that the miR-15a and miR-16-1 cluster targets CCND1 (encoding cyclin D1) and WNT3A, which promotes several tumorigenic features such as survival, proliferation and invasion. In cancer cells of advanced prostate tumors, the miR-15a and miR-16 level is significantly decreased, whereas the expression of BCL2, CCND1 and WNT3A is inversely upregulated. Delivery of antagomirs specific for miR-15a and miR-16 to normal mouse prostate results in marked hyperplasia, and knockdown of miR-15a and miR-16 promotes survival, proliferation and invasiveness of untransformed prostate cells, which become tumorigenic in immunodeficient NOD-SCID mice. Conversely, reconstitution of miR-15a and miR-16-1 expression results in growth arrest, apoptosis and marked regression of prostate tumor xenografts. Altogether, we propose that miR-15a and miR-16 act as tumor suppressor genes in prostate cancer through the control of cell survival, proliferation and invasion. These findings have therapeutic implications and may be exploited for future treatment of prostate cancer.
LinkOut: [PMID: 18931683]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions NZB
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... Cyclin D1 Is a Direct Target of miR-15a and miR-16 ...

- Salerno E; Scaglione BJ; Coffman FD; Brown et al., 2009, Molecular cancer therapeutics.

Article - Salerno E; Scaglione BJ; Coffman FD; Brown et al.
- Molecular cancer therapeutics, 2009
Alterations in the human 13q14 genomic region containing microRNAs mir-15a and mir-16-1 are present in most human chronic lymphocytic leukemia (CLL). We have previously found the development of CLL in the New Zealand Black murine model to be associated with a point mutation in the primary mir-15a/16-1 region, which correlated with a decrease in mature miR-16 and miR-15a levels. In this study, addition of exogenous miR-15a and miR-16 led to an accumulation of cells in G(1) in non-New Zealand Black B cell and New Zealand Black-derived malignant B-1 cell lines. However, the New Zealand Black line had significantly greater G(1) accumulation, suggesting a restoration of cell cycle control upon exogenous miR-15a/16 addition. Our experiments showed a reduction in protein levels of cyclin D1, a miR-15a/16 target and cell cycle regulator of G(1)/S transition, in the New Zealand Black cell line following miR-15a/16 addition. These microRNAs were shown to directly target the cyclin D1 3' untranslated region using a green fluorescent protein lentiviral expression system. miR-16 was also shown to augment apoptosis induction by nutlin, a mouse double minute 2 (MDM2) antagonist, and genistein, a tyrosine kinase inhibitor, when added to a B-1 cell line derived from multiple in vivo passages of malignant B-1 cells from New Zealand Black mice with CLL. miR-16 synergized with nutlin and genistein to induce apoptosis. Our data support a role for the mir-15a/16-1 cluster in cell cycle regulation and suggest that these mature microRNAs in both the New Zealand Black model and human CLL may be targets for therapeutic efficacy in this disease.
LinkOut: [PMID: 19723889]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions unspecified
Disease 12443.0
Original Description (Extracted from the article) ... "Results show miR-16 suppression during the colitis-to-cancer sequence in colon epithelial cells ...

- Witalison EE; Cui X; Causey CP; Thompson et al., 2015, Oncotarget.

Article - Witalison EE; Cui X; Causey CP; Thompson et al.
- Oncotarget, 2015
Ulcerative colitis (UC) is a chronic disease, in which the lining of the colon becomes inflamed and develops ulcers leading to abdominal pain, diarrhea, and rectal bleeding. The extent of these symptoms depends on disease severity. The protein arginine deiminase (PAD) family of enzymes converts peptidyl-Arginine to peptidyl-Citrulline through citrullination. PADs are dysregulated, with abnormal citrullination in many diseases, including UC and colorectal cancer (CRC). We have developed the small molecule, pan-PAD inhibitor, Chlor-amidine (Cl-amidine), with multiple goals, including treating UC and preventing CRC. Building off our recent results showing that: 1) Cl-amidine suppresses colitis in vivo in a dextran sulfate sodium (DSS) mouse model; and 2) Cl-amidine induces microRNA (miR)-16 in vitro causing cell cycle arrest, we tested the hypothesis that Cl-amidine can prevent tumorigenesis and that miR-16 induction, by Cl-amidine, may be involved in vivo. Consistent with our hypothesis, we present evidence that Cl-amidine, delivered in the drinking water, prevents colon tumorigenesis in our mouse model of colitis-associated CRC where mice are given carcinogenic azoxymethane (AOM), followed by multiple cycles of 2% DSS to induce colitis. To begin identifying mechanisms, we examined the effects of Cl-amidine on miR-16. Results show miR-16 suppression during the colitis-to-cancer sequence in colon epithelial cells, which was rescued by drinking Cl-amidine. Likewise, Ki67 and cellular proliferation targets of miR-16 (Cyclins D1 and E1) were suppressed by Cl-amidine. The decrease in cell proliferation markers and increase in tumor suppressor miRNA expression potentially define a mechanism of how Cl-amidine is suppressing tumorigenesis in vivo.
LinkOut: [PMID: 26440311]
51 mmu-miR-16-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001064 Wnt3a wingless-type MMTV integration site family, member 3A 4 1
MIRT001065 Ccnd1 cyclin D1 4 2
MIRT001066 Bcl2 B cell leukemia/lymphoma 2 4 2
MIRT001689 Ccnt2 cyclin T2 1 1
MIRT003375 Arl2 ADP-ribosylation factor-like 2 4 1
MIRT004105 Cadm1 cell adhesion molecule 1 2 1
MIRT005352 App amyloid beta (A4) precursor protein 4 1
MIRT005922 Mdm4 transformed mouse 3T3 cell double minute 4 3 1
MIRT005923 Vegfa vascular endothelial growth factor A 4 3
MIRT005924 Jun jun proto-oncogene 3 1
MIRT005925 Jag1 jagged 1 3 1
MIRT006566 Slc6a4 solute carrier family 6 (neurotransmitter transporter, serotonin), member 4 1 1
MIRT006940 Ccne1 cyclin E1 3 2
MIRT427938 Ppap2b phospholipid phosphatase 3 3 1
MIRT438298 Bcl2l2 BCL2-like 2 1 1
MIRT438763 Cd40 CD40 antigen 3 1
MIRT438766 Fgf2 fibroblast growth factor 2 3 1
MIRT577813 Rnf168 ring finger protein 168 1 1
MIRT578440 Irgq immunity-related GTPase family, Q 1 5
MIRT578972 Dhdh dihydrodiol dehydrogenase (dimeric) 1 2
MIRT583721 Erlin2 ER lipid raft associated 2 1 1
MIRT584146 Creb5 cAMP responsive element binding protein 5 1 1
MIRT591285 Klc1 kinesin light chain 1 1 2
MIRT591939 Ddx19b DEAD (Asp-Glu-Ala-Asp) box polypeptide 19b 1 1
MIRT592081 Sorcs2 sortilin-related VPS10 domain containing receptor 2 1 1
MIRT592201 Mapkap1 mitogen-activated protein kinase associated protein 1 1 2
MIRT592347 Armcx6 armadillo repeat containing, X-linked 6 1 2
MIRT592355 Angel1 angel homolog 1 1 1
MIRT592370 4930444A02Rik protein-O-mannose kinase 1 1
MIRT592407 Tacc1 transforming, acidic coiled-coil containing protein 1 1 2
MIRT592431 Spsb4 splA/ryanodine receptor domain and SOCS box containing 4 1 1
MIRT592665 Itgav integrin alpha V 1 1
MIRT592716 Fbxo21 F-box protein 21 1 2
MIRT592808 Bicd1 bicaudal D homolog 1 (Drosophila) 1 3
MIRT597924 Pacsin2 protein kinase C and casein kinase substrate in neurons 2 1 1
MIRT598104 Ncl nucleolin 1 1
MIRT598638 Idua iduronidase, alpha-L- 1 1
MIRT599012 Fgd4 FYVE, RhoGEF and PH domain containing 4 1 1
MIRT600261 Trim2 tripartite motif-containing 2 1 1
MIRT600294 Tifab TRAF-interacting protein with forkhead-associated domain, family member B 1 1
MIRT601126 Bri3bp Bri3 binding protein 1 1
MIRT601137 Bcl11b B cell leukemia/lymphoma 11B 1 1
MIRT603793 Lpcat2b lysophosphatidylcholine acyltransferase 2B 1 1
MIRT733369 Synrg synergin, gamma 1 0
MIRT733370 Tnrc6b trinucleotide repeat containing 6b 1 0
MIRT733372 Lamtor3 late endosomal/lysosomal adaptor, MAPK and MTOR activator 3 1 0
MIRT733373 Hip1 huntingtin interacting protein 1 1 0
MIRT733374 Il6ra interleukin 6 receptor, alpha 1 0
MIRT735570 CXCL10 C-X-C motif chemokine ligand 10 3 0
MIRT736046 Il7r interleukin 7 receptor 2 0
MIRT756040 Rbfox2 RNA binding protein, fox-1 homolog (C. elegans) 2 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-16 cisplatin approved 84093 Quantitative real-time PCR K562 cell 20428827 2010 up-regulated
miR-16 Cisplatin approved 84093 Quantitative real-time PCR SH-SY5Y cells 24026226 2013 up-regualted
miR-16 Benzo(a)pyrene NULL 2336 Microarray MM plasma cells 24798859 2014 up-regulated
miR-16 Calcium sulfate (CaS) NULL 24497 Microarray MG63E osteoblast-like cells 17618507 2008 down-regulated
miR-16 Glucocorticoid NULL NULL Microarray acute lymphoblastic leukemia 19148136 2009 up-regulated
miR-16 Glucocorticoid NULL NULL Northern blot acute lymphoblastic leukemia 19148136 2009 up-regulated
miR-16 Glucocorticoid NULL NULL Quantitative real-time PCR acute lymphoblastic leukemia 19148136 2009 up-regulated
miR-16 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray Pancreatic Cancer PANC-1 cells 19407485 2009 up-regulated
miR-16 5-aza-2'-deoxycytidine (5-Aza-CdR) + trichostatin A(TSA) NULL NULL Microarray Pancreatic Cancer PANC-1 cells 19407485 2009 up-regulated
miR-16 Trichostatin A (TSA) NULL 444732 Microarray Pancreatic Cancer PANC-1 cells 19407485 2009 up-regulated
miR-16 All-trans-retinoic acid (ATRA) approved 444795 Quantitative real-time PCR acute promyelocytic leukemia (APL) 19749800 2009 up-regulated
miR-16 Curcumin NULL 969516 Quantitative real-time PCR MCF-7 cells 19908170 2010 up-regulated
miR-16 Glucose NULL 5793 Microarray proximal tubule cell line HK-2 20067797 2010 down-regulated
miR-16 Bisphenol A NULL 6623 Microarray immortalized cytotrophoblast cell lines HTR-8 20417706 2010 up-regulated
miR-16 Polylysine NULL 162282 Quantitative real-time PCR 293T(FLAG AGO2) cells 20529860 2010 down-regulated
miR-16 Trypaflavine NULL NULL Quantitative real-time PCR 293T(FLAG AGO2) cells 20529860 2010 down-regulated
miR-16 Nicotine approved 89594 Quantitative real-time PCR gastric cancer cells 21081469 2011 up-regulated
miR-16 Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-16 Enoxacin approved 3229 Quantitative real-time PCR HCT-116 and RKO colon cancer cell lines 21368194 2011 up-regulated
miR-16 Ginsenoside Rh2 NULL 119307 Microarray human glioma cells U251 21372826 2011 down-regulated
miR-16 5-Fluorouracil approved 3385 Microarray MCF-7 breast cancer cells 21506117 2011 up-regulated
miR-16 5-Fluorouracil approved 3385 Quantitative real-time PCR MCF-7 breast cancer cells 21506117 2011 up-regulated
miR-16 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-16 Estrogen NULL NULL Quantitative real-time PCR breast cancer cells. 22260523 2012 down-regulated
miR-16 Cisplatin approved 84093 Quantitative real-time PCR HeLa cells 22475935 2012 up-regulated
miR-16 Bortezomib approved 387447 Quantitative real-time PCR bone marrow stromal cells (BMSCs) 22781767 2012 up-regulated
miR-16 Melphalan approved 460612 Quantitative real-time PCR bone marrow stromal cells (BMSCs) 22781767 2012 up-regulated
miR-16 Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-16 Tamoxifen approved 2733526 Microarray rat liver 17343880 2007 up-regulated
miR-16 Tamoxifen approved 2733526 Quantitative real-time PCR rat liver 17343880 2007 up-regulated
miR-16 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-16 Tert-butyl hydroperoxide (t-BHP) NULL 6410 Microarray mouse auditory cells 20510889 2010 up-regulated
miR-16 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 down-regulated
miR-16 Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 down-regulated
miR-16 Morphine approved 5288826 Microarray human monocyte-derived macrophages (h-mdms) infection with HIV-1 20564181 2010 up-regulated
miR-16 Marine fungal metabolite 1386A NULL NULL Microarray MCF-7 breast cancer cells. 22159329 2012 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
mmu-miR-16-5p Tamoxifen 2733525 NSC180973 approved sensitive Low Breast Cancer tissue and cell line
mmu-miR-16-5p Vincristine 5978 approved sensitive Low Gastric Cancer tissue and cell line (NF-3xmir16)
mmu-miR-16-5p Doxorubicin 31703 NSC123127 approved sensitive Low Gastric Cancer tissue and cell line (SGC7901)

Error report submission