miRTarBase - #MIRT001083


—
pre-miRNA Information
pre-miRNA mmu-mir-17   
Genomic Coordinates chr14: 115043671 - 115043754
Synonyms Mirn17, mmu-mir-17, Mir17
Description Mus musculus miR-17 stem-loop
Comment Mouse mir-17 is predicted .
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-17-5p
Sequence 14| CAAAGUGCUUACAGUGCAGGUAG |36
Evidence Experimental
Experiments Cloned
Putative Targets

Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B0I1LA miR-17 Predictive Biomarker (PRD) Clinical/Experimental Data Expression Decrease Tumor tissue Quantitative real-time PCR
BL85QR miR-17-5p Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Urine Real-time polymerase chain reaction
Gene Information
Gene Symbol Stat3   
Synonyms 1110034C02Rik, AW109958, Aprf
Description signal transducer and activator of transcription 3
Transcript NM_011486   
Other Transcripts NM_213659 , NM_213660   
Expression
Putative miRNA Targets on Stat3
3'UTR of Stat3
(miRNA target sites are highlighted)		 
>Stat3|NM_011486|3'UTR
   1 CGGTGAAGGTGCTGAGCCCTCAGCAGGAGGGCAGTTTGAGTCGCTCACGTTTGACATGGATCTGACCTCGGAGTGTGCTA
  81 CCTCCCCCATGTGAGGAGCTGAAACCAGAAGCTGCAGAGACGTGACTTGAGACACCTGCCCCGTGCTCCACCCCTAAGCA
 161 GCCGAACCCCATATCGTCTGAAACTCCTAACTTTGTGGTTCCAGATTTTTTTTTTTAATTTCCTACTTCTGCTATCTTTG
 241 GGCAATCTGGGCACTTTTTAAAATAGAGAAATGAGTGAGTGTGGGTGATAAACTGTTATGTAAAGAGGAGAGCACCTCTG
 321 AGTCTGGGGATGGGGCTGAGAGCAGAAGGGAGCAAGGGGAACACCTCCTGTCCTGCCCGCCTGCCCTCCTTTTTCAGCAG
 401 CTCGGGGTTGGTTGTTAGACAAGTGCCTCCTGGTGCCCATGGCATCCTGTTGCCCCACTCTGTGAGCTGATACCCCAGGC
 481 TGGGAACTCCTGGCTCTGCACTTTCAACCTTGCTAATATCCACATAGAAGCTAGGACTAAGCCCAGAGGTTCCTCTTTAA
 561 ATTAAAAAAAAAAAAAATAAGAATTAAAGGGCAAAACACACTGACACAGCATAGCCTTTCCATATCAAGGAATACTCAGT
 641 TAACAGCCTCTCCAGCGCTGTCTTCAGGCTGATCATCTATATAAACCCTGGAATGGTTGCAGATCAAATCTGTAAAAGAG
 721 ATCCGAGAGCTGTGGCTTGGCCTCTGGTTCAAACACAAAGGCTAGAGAGAACCTAGATATCCCTGGGTTTTGTTTACCCA
 801 GTATGCTTGTCGGTTGGAGGTGTGAGGTAGGCCAAGGGCACTGGAAAGCCTTTGTCATCACCCTACTCCCTCCCCAACCC
 881 AGACTCCAGACCCTGTTTCAGGGTCAGCCTGCCCTGTGGGTGCCTTACTGGGCCTAGGGTCAACCTGCCTTCCTTTCCCA
 961 CTTGACCTTGCTGGTAGTATGTCCCCTTCCCATGTCCAAAGGCCCTCTGTCCTGCTTCTATTGGGAATCCCTGCCTCAGG
1041 ACCTTGTGTCGAGAGGGATTGCCTTACAGGTTTGAACCTGCCTCAGACTACAGGCCCTCAGCAAAGCTCAGGGAGTATGG
1121 TCCTTATTCTATGCGCTTGGTTCCCAGGGATATCTGTAACCACAGGGCAAAAGCTGACATATACTCCAGGTCTGCCCTCA
1201 TATGAGTGGTGTATTCTTGGCCTCCCCTGAGACTGGCAACTGTCTGCTCCCCATTGGGTCTCCCAGGTGAGGTGGAACAC
1281 AGTTCCTGCACCTACTGTGGCCTCCATGTCGCTTGCTTGCTTCGCTCACTCAGCTTACTGGAACACTGAGTGTTCAAGGC
1361 AAGCCTTTCCTGACAGAGGCATGGCTAGATTCAGTGACTCAAAGCCACCTCATTCAGCTGATCAGTGTCTGTGGAATTGT
1441 TTCCTTCCAGTTAACCAGTGTCTGAATTAAGGGCAGTGAGGACATTGTCTCCAAGACGAACTGCTTGCCTTGACCACCCC
1521 AGCCTTCTGCTTCGAGACAGTTACTGCTCTCCCACCCCATCAATGTTCTTTAGTTATACAATAAGCTGAACTTATAAACT
1601 GAAAGGGTATTTAGGAAGGCAAGGCTTGGGCATTTTTATGGCTTTCAATCCTGGGGACCCAGGAACAAGGTGAGGGCTTC
1681 TCTGGGGCTGGTGTTGTACCTCAGGGGCTCTGGGAAGTCTGTGTGCCTGGGTTAACCACCCATAGTGAGCCCCTGGAACT
1761 GCCCACTTTCCCTCTCCTTGGCCCCACTTGGCCCCAGCCTCACCCAGCCTGCAGACTGCTTAGCCTTTCAGTGCAGTGGC
1841 TTGTGTTCTGGCCACTGCACTCAGATTCCAATGTAAACTTTCTAGTGTAAAAATTTATATTATTGTGGGTTGTTTTTTGT
1921 TGTTGTTTGTTTTTGTATATTGCTGTAACTACTTTAACTTCCAGAAATAAAGATTATATAGGAACTGTCTGGC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gaUGGA----CGUGACAUUCGUGAAAc 5'
            |:||    ||| | |::||||||| 
Target 5' ctATCTTTGGGCAATCTGGGCACTTTt 3'
 232 - 258 163.00 -15.30
2 
miRNA  3' gauGGACGUGACAUUCGUGAAAc 5'
             |||| :|| |  ||||||| 
Target 5' actCCTG-GCTCT--GCACTTTc 3'
 486 - 505 155.00 -14.10
3 
miRNA  3' gauggaCGU---GACAUUCGUGAAAc 5'
                |||   || |::|||:||| 
Target 5' aggaagGCAAGGCT-TGGGCATTTTt 3'
 1613 - 1637 136.00 -9.90
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions CCE ES
Location of target site 3'UTR
Tools used in this research miRanda , TargetScan , PicTar , miRBase Target Database
Original Description (Extracted from the article) ... "We present evidence that miR-17 family members ...

- Foshay KM; Gallicano GI, 2009, Developmental biology.

Article - Foshay KM; Gallicano GI
- Developmental biology, 2009
MicroRNAs are small non-coding RNAs that regulate protein expression by binding 3'UTRs of target mRNAs, thereby inhibiting translation. Similar to siRNAs, miRNAs are cleaved by Dicer. Mouse and ES cell Dicer mutants demonstrate that microRNAs are necessary for embryonic development and cellular differentiation. However, technical obstacles and the relative infancy of this field have resulted in few data on the functional significance of individual microRNAs. We present evidence that miR-17 family members, miR-17-5p, miR-20a, miR-93, and miR-106a, are differentially expressed in developing mouse embryos and function to control differentiation of stem cells. Specifically, miR-93 localizes to differentiating primitive endoderm and trophectoderm of the blastocyst. We also observe high miR-93 and miR-17-5p expression within the mesoderm of gastrulating embryos. Using an ES cell model system, we demonstrate that modulation of these miRNAs delays or enhances differentiation into the germ layers. Additionally, we demonstrate that these miRNAs regulate STAT3 mRNA in vitro. We suggest that STAT3, a known ES cell regulator, is one target mRNA responsible for the effects of these miRNAs on cellular differentiation.
LinkOut: [PMID: 19073166]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions MLE12 , NMuMG
Disease miR-20a;
Location of target site 3'UTR
Tools used in this research mFold , miRanda , TargetScan
Original Description (Extracted from the article) ... "We identified Stat3 and Mapk14 as key direct targets of miR-17 ...

- Carraro G; El-Hashash A; Guidolin D; Tiozzo et al., 2009, Developmental biology.

Article - Carraro G; El-Hashash A; Guidolin D; Tiozzo et al.
- Developmental biology, 2009
The miR-17 family of microRNAs has recently been recognized for its importance during lung development. The transgenic overexpression of the entire miR-17-92 cluster in the lung epithelium led to elevated cellular proliferation and inhibition of differentiation, while targeted deletion of miR-17-92 and miR-106b-25 clusters showed embryonic or early post-natal lethality. Herein we demonstrate that miR-17 and its paralogs, miR-20a, and miR-106b, are highly expressed during the pseudoglandular stage and identify their critical functional role during embryonic lung development. Simultaneous downregulation of these three miRNAs in explants of isolated lung epithelium altered FGF10 induced budding morphogenesis, an effect that was rescued by synthetic miR-17. E-Cadherin levels were reduced, and its distribution was altered by miR-17, miR-20a and miR-106b downregulation, while conversely, beta-catenin activity was augmented, and expression of its downstream targets, including Bmp4 as well as Fgfr2b, increased. Finally, we identified Stat3 and Mapk14 as key direct targets of miR-17, miR-20a, and miR-106b and showed that simultaneous overexpression of Stat3 and Mapk14 mimics the alteration of E-Cadherin distribution observed after miR-17, miR-20a, and miR-106b downregulation. We conclude that the mir-17 family of miRNA modulates FGF10-FGFR2b downstream signaling by specifically targeting Stat3 and Mapk14, hence regulating E-Cadherin expression, which in turn modulates epithelial bud morphogenesis in response to FGF10 signaling.
LinkOut: [PMID: 19559694]
411 mmu-miR-17-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001083 Stat3 signal transducer and activator of transcription 3 4 2
MIRT003387 Mapk14 mitogen-activated protein kinase 14 5 2
MIRT004122 Rbl2 RB transcriptional corepressor like 2 5 2
MIRT006702 Bcl2l11 BCL2-like 11 (apoptosis facilitator) 2 1
MIRT006736 Sqstm1 sequestosome 1 3 1
MIRT009812 Ankrd29 ankyrin repeat domain 29 1 1
MIRT009813 Eef2k eukaryotic elongation factor-2 kinase 1 1
MIRT009814 Neurod1 neurogenic differentiation 1 1 1
MIRT009815 Ankhd1 ankyrin repeat and KH domain containing 1 1 1
MIRT009816 Mrc1 mannose receptor, C type 1 1 1
MIRT009817 Nsg2 neuron specific gene family member 2 1 1
MIRT009818 Zic2 zinc finger protein of the cerebellum 2 1 1
MIRT009819 Dhx36 DEAH (Asp-Glu-Ala-His) box polypeptide 36 1 1
MIRT009820 Adam19 a disintegrin and metallopeptidase domain 19 (meltrin beta) 1 1
MIRT009821 Gabra1 gamma-aminobutyric acid (GABA) A receptor, subunit alpha 1 1 1
MIRT009822 Yipf6 Yip1 domain family, member 6 1 1
MIRT009823 Sdccag3 serologically defined colon cancer antigen 3 1 1
MIRT009824 Dgkd diacylglycerol kinase, delta 1 1
MIRT009825 Itm2c integral membrane protein 2C 1 1
MIRT009826 Ptprg protein tyrosine phosphatase, receptor type, G 1 1
MIRT009827 Pik3r4 phosphoinositide-3-kinase regulatory subunit 4 1 1
MIRT009828 Rsrc2 arginine/serine-rich coiled-coil 2 1 1
MIRT009829 Napb N-ethylmaleimide sensitive fusion protein attachment protein beta 1 1
MIRT009830 Serpinb9 serine (or cysteine) peptidase inhibitor, clade B, member 9 1 1
MIRT009831 Islr2 immunoglobulin superfamily containing leucine-rich repeat 2 1 1
MIRT009832 Aspscr1 alveolar soft part sarcoma chromosome region, candidate 1 (human) 1 1
MIRT009833 Tmem230 transmembrane protein 230 1 1
MIRT009834 Tor1aip2 torsin A interacting protein 2 1 1
MIRT009835 Slc44a5 solute carrier family 44, member 5 1 1
MIRT009836 Cops2 COP9 signalosome subunit 2 1 1
MIRT009837 Tomm34 translocase of outer mitochondrial membrane 34 1 1
MIRT009838 Lcorl ligand dependent nuclear receptor corepressor-like 1 1
MIRT009839 Gabrb3 gamma-aminobutyric acid (GABA) A receptor, subunit beta 3 1 1
MIRT009840 Ubtf upstream binding transcription factor, RNA polymerase I 1 1
MIRT009841 Ppig peptidyl-prolyl isomerase G (cyclophilin G) 1 1
MIRT009842 Fam120c family with sequence similarity 120, member C 1 1
MIRT009843 Rapgefl1 Rap guanine nucleotide exchange factor (GEF)-like 1 1 1
MIRT009844 Ranbp2 RAN binding protein 2 1 1
MIRT009845 Spast spastin 1 1
MIRT009846 C2cd4c C2 calcium-dependent domain containing 4C 1 1
MIRT009847 Zdhhc16 zinc finger, DHHC domain containing 16 1 1
MIRT009848 Nfe2l2 nuclear factor, erythroid derived 2, like 2 1 1
MIRT009849 Shh sonic hedgehog 1 1
MIRT009850 Lsamp limbic system-associated membrane protein 1 1
MIRT009851 Eml1 echinoderm microtubule associated protein like 1 1 1
MIRT009852 Lrp11 low density lipoprotein receptor-related protein 11 1 1
MIRT009853 Tgfa transforming growth factor alpha 1 1
MIRT009854 Dcbld2 discoidin, CUB and LCCL domain containing 2 1 1
MIRT009855 Mcm7 minichromosome maintenance complex component 7 1 1
MIRT009856 Fam49b family with sequence similarity 49, member B 1 1
MIRT009857 Zfp62 zinc finger protein 62 1 1
MIRT009858 Epb4.1l5 erythrocyte membrane protein band 4.1 like 5 1 1
MIRT009859 Cpeb4 cytoplasmic polyadenylation element binding protein 4 1 1
MIRT009860 Cyld CYLD lysine 63 deubiquitinase 1 1
MIRT009861 March6 membrane-associated ring finger (C3HC4) 6 1 1
MIRT009862 Lrrc55 leucine rich repeat containing 55 1 1
MIRT009863 Nrip1 nuclear receptor interacting protein 1 1 1
MIRT009864 Cxcl12 chemokine (C-X-C motif) ligand 12 1 1
MIRT009865 Luc7l3 LUC7-like 3 (S. cerevisiae) 1 1
MIRT009866 Ankrd9 ankyrin repeat domain 9 1 1
MIRT009867 Cpe carboxypeptidase E 1 1
MIRT009868 Akt3 thymoma viral proto-oncogene 3 1 1
MIRT009869 Kbtbd8 kelch repeat and BTB (POZ) domain containing 8 1 1
MIRT009870 Etnk1 ethanolamine kinase 1 1 1
MIRT009871 Dnmt3a DNA methyltransferase 3A 1 1
MIRT009872 Tspan9 tetraspanin 9 1 1
MIRT009873 Col4a2 collagen, type IV, alpha 2 1 1
MIRT009874 Polq polymerase (DNA directed), theta 1 1
MIRT009875 2810055G20Rik Mir99a and Mirlet7c-1 host gene (non-protein coding) 1 1
MIRT009876 Scn8a sodium channel, voltage-gated, type VIII, alpha 1 1
MIRT009877 Atf2 activating transcription factor 2 1 1
MIRT009878 Gtf2h2 general transcription factor II H, polypeptide 2 1 1
MIRT009879 Heg1 heart development protein with EGF-like domains 1 1 1
MIRT009880 Ppp1r21 protein phosphatase 1, regulatory subunit 21 1 1
MIRT009881 C1qa complement component 1, q subcomponent, alpha polypeptide 1 1
MIRT009882 Tnrc6b trinucleotide repeat containing 6b 1 1
MIRT009883 Klf10 Kruppel-like factor 10 1 1
MIRT009884 Rsf1 remodeling and spacing factor 1 1 1
MIRT009885 Cald1 caldesmon 1 1 1
MIRT009886 Fam63b MINDY lysine 48 deubiquitinase 2 1 1
MIRT009887 Rab12 RAB12, member RAS oncogene family 1 1
MIRT009888 Epha7 Eph receptor A7 1 1
MIRT009889 Xrn1 5'-3' exoribonuclease 1 1 1
MIRT009890 Rnf103 ring finger protein 103 1 1
MIRT009891 Srcin1 SRC kinase signaling inhibitor 1 1 1
MIRT009892 March8 membrane-associated ring finger (C3HC4) 8 1 1
MIRT009893 Mcl1 myeloid cell leukemia sequence 1 1 1
MIRT009894 Zfp704 zinc finger protein 704 1 1
MIRT009895 Fcho2 FCH domain only 2 1 1
MIRT009896 Derl2 Der1-like domain family, member 2 1 1
MIRT009897 Socs6 suppressor of cytokine signaling 6 1 1
MIRT009898 Itgb8 integrin beta 8 1 1
MIRT009899 Bmp4 bone morphogenetic protein 4 1 1
MIRT009900 Pten phosphatase and tensin homolog 2 1
MIRT009901 Insm1 insulinoma-associated 1 1 1
MIRT009902 Zfp84 zinc finger protein 84 1 1
MIRT009903 Map4k2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT009904 B4galnt1 beta-1,4-N-acetyl-galactosaminyl transferase 1 1 1
MIRT009905 Map1a microtubule-associated protein 1 A 1 1
MIRT009906 Pappa pregnancy-associated plasma protein A 1 1
MIRT009907 Gng4 guanine nucleotide binding protein (G protein), gamma 4 1 1
MIRT009908 Slc10a7 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 1 1
MIRT009909 Robo2 roundabout guidance receptor 2 1 1
MIRT009910 Ttc14 tetratricopeptide repeat domain 14 1 1
MIRT009911 Taok2 TAO kinase 2 1 1
MIRT009912 Pgrmc2 progesterone receptor membrane component 2 1 1
MIRT009913 Rasal1 RAS protein activator like 1 (GAP1 like) 1 1
MIRT009914 Eps15 epidermal growth factor receptor pathway substrate 15 1 1
MIRT009915 Slc7a14 solute carrier family 7 (cationic amino acid transporter, y+ system), member 14 1 1
MIRT009916 Aplp2 amyloid beta (A4) precursor-like protein 2 1 1
MIRT009917 Cd164 CD164 antigen 1 1
MIRT009918 St6galnac5 ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5 1 1
MIRT009919 Nipa2 non imprinted in Prader-Willi/Angelman syndrome 2 homolog (human) 1 1
MIRT009920 En2 engrailed 2 1 1
MIRT009921 Pum1 pumilio RNA-binding family member 1 1 1
MIRT009922 Ppp2r2c protein phosphatase 2, regulatory subunit B, gamma 1 1
MIRT009923 Zfp317 zinc finger protein 317 1 1
MIRT009924 Whsc1l1 nuclear receptor binding SET domain protein 3 1 1
MIRT009925 Reep1 receptor accessory protein 1 1 1
MIRT009926 Cpeb3 cytoplasmic polyadenylation element binding protein 3 1 1
MIRT009927 Ncam1 neural cell adhesion molecule 1 1 1
MIRT009928 Qser1 glutamine and serine rich 1 1 1
MIRT009929 A330021E22Rik cilia and flagella associated protein 69 1 1
MIRT009930 Ubxn2a UBX domain protein 2A 1 2
MIRT009931 1700052N19Rik acidic residue methyltransferase 1 1 1
MIRT009932 Nefh neurofilament, heavy polypeptide 1 1
MIRT009933 Necab1 N-terminal EF-hand calcium binding protein 1 1 1
MIRT009934 Map7d2 MAP7 domain containing 2 1 1
MIRT009935 Igsf3 immunoglobulin superfamily, member 3 1 1
MIRT009936 Ift88 intraflagellar transport 88 1 1
MIRT009937 Ap3d1 adaptor-related protein complex 3, delta 1 subunit 1 1
MIRT009938 Zeb2 zinc finger E-box binding homeobox 2 1 1
MIRT009939 Aifm1 apoptosis-inducing factor, mitochondrion-associated 1 1 1
MIRT009940 Cdh2 cadherin 2 1 1
MIRT009941 B3galt2 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2 1 1
MIRT009942 Cbx2 chromobox 2 1 1
MIRT009943 Lnp lunapark, ER junction formation factor 1 1
MIRT009944 Adam17 a disintegrin and metallopeptidase domain 17 1 1
MIRT009945 Gas7 growth arrest specific 7 1 1
MIRT009946 Dync1li2 dynein, cytoplasmic 1 light intermediate chain 2 1 1
MIRT009947 Rab30 RAB30, member RAS oncogene family 1 1
MIRT009948 Rap1gds1 RAP1, GTP-GDP dissociation stimulator 1 1 1
MIRT009949 Atxn3 ataxin 3 1 1
MIRT009950 Dpysl2 dihydropyrimidinase-like 2 1 1
MIRT009951 Pbrm1 polybromo 1 1 1
MIRT009952 Papolg poly(A) polymerase gamma 1 1
MIRT009953 Cav1 caveolin 1, caveolae protein 1 1
MIRT009954 Lmbrd1 LMBR1 domain containing 1 1 1
MIRT009955 Klf9 Kruppel-like factor 9 1 1
MIRT009956 Lpp LIM domain containing preferred translocation partner in lipoma 1 1
MIRT009957 Tmx4 thioredoxin-related transmembrane protein 4 1 1
MIRT009958 Rasa1 RAS p21 protein activator 1 1 1
MIRT009959 Fam117b family with sequence similarity 117, member B 1 1
MIRT009960 Rb1 RB transcriptional corepressor 1 1 1
MIRT009961 Syt1 synaptotagmin I 1 1
MIRT009962 Crebrf CREB3 regulatory factor 1 1
MIRT009963 Acvr1b activin A receptor, type 1B 1 1
MIRT009964 Spag9 sperm associated antigen 9 1 1
MIRT009965 Usp3 ubiquitin specific peptidase 3 1 1
MIRT009966 Bmp2k BMP2 inducible kinase 1 1
MIRT009967 Cnot6l CCR4-NOT transcription complex, subunit 6-like 1 1
MIRT009968 Kif5c kinesin family member 5C 1 1
MIRT009969 Camta1 calmodulin binding transcription activator 1 1 1
MIRT009970 Klhl2 kelch-like 2, Mayven 1 1
MIRT009971 Casc4 cancer susceptibility candidate 4 1 1
MIRT009972 F3 coagulation factor III 1 1
MIRT009973 1600012H06Rik RIKEN cDNA 1600012H06 gene 1 1
MIRT009974 6030458C11Rik RIKEN cDNA 6030458C11 gene 1 1
MIRT009975 Kif5a kinesin family member 5A 1 1
MIRT009976 Camk2n1 calcium/calmodulin-dependent protein kinase II inhibitor 1 1 1
MIRT009977 Zfp367 zinc finger protein 367 1 1
MIRT009978 Slc24a2 solute carrier family 24 (sodium/potassium/calcium exchanger), member 2 1 1
MIRT009979 Ccser2 coiled-coil serine rich 2 1 1
MIRT009980 Zfand4 zinc finger, AN1-type domain 4 1 1
MIRT009981 Fam134c reticulophagy regulator family member 3 1 1
MIRT009982 Tnfrsf21 tumor necrosis factor receptor superfamily, member 21 1 1
MIRT009983 Rev3l REV3 like, DNA directed polymerase zeta catalytic subunit 1 1
MIRT009984 Wfs1 wolframin ER transmembrane glycoprotein 1 1
MIRT009985 Smim20 small integral membrane protein 20 1 1
MIRT009986 Nbea neurobeachin 1 1
MIRT009987 Map3k5 mitogen-activated protein kinase kinase kinase 5 1 1
MIRT009988 Plagl2 pleiomorphic adenoma gene-like 2 1 1
MIRT009989 Brms1l breast cancer metastasis-suppressor 1-like 1 1
MIRT009990 Zfp597 zinc finger protein 597 1 1
MIRT009991 Smoc2 SPARC related modular calcium binding 2 1 1
MIRT009992 Ezh1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT009993 Ppp3r1 protein phosphatase 3, regulatory subunit B, alpha isoform (calcineurin B, type I) 1 1
MIRT009994 Znfx1 zinc finger, NFX1-type containing 1 1 1
MIRT009995 Pim3 proviral integration site 3 1 1
MIRT009996 Mlxip MLX interacting protein 1 1
MIRT009997 Adcyap1r1 adenylate cyclase activating polypeptide 1 receptor 1 1 1
MIRT009998 Ryr2 ryanodine receptor 2, cardiac 1 1
MIRT009999 Scp2 sterol carrier protein 2, liver 1 1
MIRT010000 Nf1 neurofibromin 1 1 1
MIRT010001 Rundc3b RUN domain containing 3B 1 1
MIRT010002 Dhcr24 24-dehydrocholesterol reductase 1 1
MIRT010003 Wdr37 WD repeat domain 37 1 1
MIRT010004 Slc1a4 solute carrier family 1 (glutamate/neutral amino acid transporter), member 4 1 1
MIRT010005 Ugcg UDP-glucose ceramide glucosyltransferase 1 1
MIRT010006 Ralgds ral guanine nucleotide dissociation stimulator 1 1
MIRT010007 Cdc42se2 CDC42 small effector 2 1 1
MIRT010008 Hdac8 histone deacetylase 8 1 1
MIRT010009 Extl3 exostoses (multiple)-like 3 1 1
MIRT010010 Ftsjd2 cap methyltransferase 1 1 1
MIRT010011 Kras Kirsten rat sarcoma viral oncogene homolog 1 1
MIRT010012 Draxin dorsal inhibitory axon guidance protein 1 1
MIRT010013 Cyth1 cytohesin 1 1 1
MIRT010014 Polr3k polymerase (RNA) III (DNA directed) polypeptide K 1 1
MIRT010015 Map4 microtubule-associated protein 4 1 1
MIRT010016 Rabgap1l RAB GTPase activating protein 1-like 1 1
MIRT010017 Pabpc5 poly(A) binding protein, cytoplasmic 5 1 1
MIRT010018 Slc7a2 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 1 1
MIRT010019 Sepp1 selenoprotein P 1 1
MIRT010020 Capn2 calpain 2 1 1
MIRT010021 Zmat3 zinc finger matrin type 3 1 1
MIRT010022 Extl2 exostoses (multiple)-like 2 1 1
MIRT010023 Zhx3 zinc fingers and homeoboxes 3 1 1
MIRT010024 Rassf4 Ras association (RalGDS/AF-6) domain family member 4 1 1
MIRT010025 Kpnb1 karyopherin (importin) beta 1 1 1
MIRT010026 Tex2 testis expressed gene 2 1 1
MIRT010027 Xpc xeroderma pigmentosum, complementation group C 1 1
MIRT010028 Oprl1 opioid receptor-like 1 1 1
MIRT010029 Sh3bgrl SH3-binding domain glutamic acid-rich protein like 1 1
MIRT010030 Nptx1 neuronal pentraxin 1 1 1
MIRT010031 Hsd17b10 hydroxysteroid (17-beta) dehydrogenase 10 1 1
MIRT010032 Nt5dc3 5'-nucleotidase domain containing 3 1 1
MIRT010033 Rdx radixin 1 1
MIRT010034 Alkbh5 alkB homolog 5, RNA demethylase 1 1
MIRT010035 Fchsd2 FCH and double SH3 domains 2 1 1
MIRT010036 Rnf213 ring finger protein 213 1 1
MIRT010037 Gpm6b glycoprotein m6b 1 1
MIRT010038 Dio2 deiodinase, iodothyronine, type II 1 1
MIRT010039 Ptpn11 protein tyrosine phosphatase, non-receptor type 11 1 1
MIRT010040 Scn3b sodium channel, voltage-gated, type III, beta 1 1
MIRT010041 Anp32a acidic (leucine-rich) nuclear phosphoprotein 32 family, member A 1 1
MIRT010042 Dnm1l dynamin 1-like 1 1
MIRT010043 Kdelr2 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2 1 1
MIRT010044 Fn1 fibronectin 1 1 1
MIRT010045 Nudt18 nudix (nucleoside diphosphate linked moiety X)-type motif 18 1 1
MIRT010046 Gpatch8 G patch domain containing 8 1 1
MIRT010047 Msantd4 Myb/SANT-like DNA-binding domain containing 4 with coiled-coils 1 1
MIRT010048 Acap2 ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 1 1
MIRT010049 Slc36a1 solute carrier family 36 (proton/amino acid symporter), member 1 1 1
MIRT010050 Klhl42 kelch-like 42 1 1
MIRT010051 Ogfod1 2-oxoglutarate and iron-dependent oxygenase domain containing 1 1 1
MIRT010052 Zfhx3 zinc finger homeobox 3 1 1
MIRT010053 Rab33b RAB33B, member RAS oncogene family 1 1
MIRT010054 Rasgef1a RasGEF domain family, member 1A 1 1
MIRT010055 M6pr mannose-6-phosphate receptor, cation dependent 1 1
MIRT010056 Aff4 AF4/FMR2 family, member 4 1 1
MIRT010057 Med17 mediator complex subunit 17 1 1
MIRT010058 Sema3c sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C 1 1
MIRT010059 Scara5 scavenger receptor class A, member 5 1 1
MIRT010060 Cadm2 cell adhesion molecule 2 1 1
MIRT010061 Dmd dystrophin, muscular dystrophy 1 1
MIRT010062 Tbc1d12 TBC1D12: TBC1 domain family, member 12 1 1
MIRT010063 Mylip myosin regulatory light chain interacting protein 1 1
MIRT010064 Frmpd4 FERM and PDZ domain containing 4 1 1
MIRT010065 Celf2 CUGBP, Elav-like family member 2 1 1
MIRT010066 Mga MAX gene associated 1 1
MIRT010067 Entpd7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT010068 Macf1 microtubule-actin crosslinking factor 1 1 1
MIRT010069 Msl1 male-specific lethal 1 homolog (Drosophila) 1 1
MIRT010070 N4bp2l2 NEDD4 binding protein 2-like 2 1 1
MIRT010071 Cds1 CDP-diacylglycerol synthase 1 1 1
MIRT010072 Prune2 prune homolog 2 1 1
MIRT010073 Ski ski sarcoma viral oncogene homolog (avian) 1 1
MIRT010074 D15Ertd621e family with sequence similarity 91, member A1 1 1
MIRT010075 Wnk1 WNK lysine deficient protein kinase 1 1 1
MIRT010076 Ptprj protein tyrosine phosphatase, receptor type, J 1 1
MIRT010077 Gramd1a GRAM domain containing 1A 1 1
MIRT010078 Tceb3 elongin A 1 1
MIRT010079 Npat nuclear protein in the AT region 1 1
MIRT010080 Cacna2d1 calcium channel, voltage-dependent, alpha2/delta subunit 1 1 1
MIRT010081 Dip2a disco interacting protein 2 homolog A 1 1
MIRT010082 Ajuba ajuba LIM protein 1 1
MIRT010083 Tmem64 transmembrane protein 64 1 1
MIRT010084 Zfp652 zinc finger protein 652 1 1
MIRT010085 Pfn2 profilin 2 1 1
MIRT010086 Tbc1d8b TBC1 domain family, member 8B 1 1
MIRT010087 Scn1a sodium channel, voltage-gated, type I, alpha 1 1
MIRT010088 Ppp6c protein phosphatase 6, catalytic subunit 1 1
MIRT010089 Hid1 HID1 domain containing 1 1
MIRT010090 Trip12 thyroid hormone receptor interactor 12 1 1
MIRT010091 Nr1d2 nuclear receptor subfamily 1, group D, member 2 1 1
MIRT010092 Nudcd3 NudC domain containing 3 1 1
MIRT010093 Cend1 cell cycle exit and neuronal differentiation 1 1 1
MIRT010094 Aldh6a1 aldehyde dehydrogenase family 6, subfamily A1 1 1
MIRT010095 Scn2a1 sodium channel, voltage-gated, type II, alpha 1 1
MIRT010096 Lrrn3 leucine rich repeat protein 3, neuronal 1 1
MIRT010097 Rnf220 ring finger protein 220 1 1
MIRT010098 Fbxo9 f-box protein 9 1 1
MIRT010099 Pcf11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT010100 Flnb filamin, beta 1 1
MIRT010101 Rogdi rogdi homolog 1 1
MIRT010102 March9 membrane-associated ring finger (C3HC4) 9 1 1
MIRT010103 Ildr2 immunoglobulin-like domain containing receptor 2 1 1
MIRT010104 Limch1 LIM and calponin homology domains 1 1 1
MIRT010105 Cdc7 cell division cycle 7 (S. cerevisiae) 1 1
MIRT010106 Yy1 YY1 transcription factor 1 1
MIRT010107 Arhgef9 CDC42 guanine nucleotide exchange factor (GEF) 9 1 1
MIRT010108 Phlpp1 PH domain and leucine rich repeat protein phosphatase 1 1 1
MIRT010109 Tnks tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 1 1
MIRT010110 4931406C07Rik RIKEN cDNA 4931406C07 gene 1 1
MIRT010111 Kif21a kinesin family member 21A 1 1
MIRT010112 Plxna2 plexin A2 1 1
MIRT010113 Syt11 synaptotagmin XI 1 1
MIRT010114 Btg2 B cell translocation gene 2, anti-proliferative 1 1
MIRT010115 Skil SKI-like 1 1
MIRT010116 Megf9 multiple EGF-like-domains 9 1 1
MIRT010117 Wdr82 WD repeat domain containing 82 1 1
MIRT010118 D630045J12Rik RIKEN cDNA D630045J12 gene 1 1
MIRT010119 Igfbp7 insulin-like growth factor binding protein 7 1 1
MIRT010120 Tfe3 transcription factor E3 1 1
MIRT010121 Elovl6 ELOVL family member 6, elongation of long chain fatty acids (yeast) 1 1
MIRT010122 Ppap2b phospholipid phosphatase 3 1 1
MIRT010123 Sox8 SRY (sex determining region Y)-box 8 1 1
MIRT010124 Gxylt1 glucoside xylosyltransferase 1 1 1
MIRT010125 Mgll monoglyceride lipase 1 1
MIRT010126 Amot angiomotin 1 1
MIRT010127 Appl2 adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2 1 1
MIRT010128 Tenm4 teneurin transmembrane protein 4 1 1
MIRT010129 Myo10 myosin X 1 1
MIRT010130 Nfia nuclear factor I/A 1 1
MIRT010131 Mycbp MYC binding protein 1 1
MIRT010132 2510009E07Rik RIKEN cDNA 2510009E07 gene 1 1
MIRT010133 Ccdc88a coiled coil domain containing 88A 1 1
MIRT010134 Chl1 cell adhesion molecule L1-like 1 1
MIRT010135 Grb10 growth factor receptor bound protein 10 1 1
MIRT010136 Fat2 FAT atypical cadherin 2 1 1
MIRT010137 Map2 microtubule-associated protein 2 1 1
MIRT010138 Sh3d19 SH3 domain protein D19 1 1
MIRT010139 Sall3 sal-like 3 (Drosophila) 1 1
MIRT010140 Taok1 TAO kinase 1 1 1
MIRT010141 Trim2 tripartite motif-containing 2 1 1
MIRT010142 Arap2 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 1 1
MIRT010143 Slc35f3 solute carrier family 35, member F3 1 1
MIRT010144 Erbb4 erb-b2 receptor tyrosine kinase 4 1 1
MIRT010145 Ubr3 ubiquitin protein ligase E3 component n-recognin 3 1 1
MIRT010146 Brwd1 bromodomain and WD repeat domain containing 1 1 1
MIRT010147 Serinc1 serine incorporator 1 1 1
MIRT010148 Ep300 E1A binding protein p300 1 1
MIRT010149 Pank1 pantothenate kinase 1 1 1
MIRT010150 Rcan3 regulator of calcineurin 3 1 1
MIRT010151 Sez6l seizure related 6 homolog like 1 1
MIRT010152 Adam10 a disintegrin and metallopeptidase domain 10 1 1
MIRT010153 Pvr poliovirus receptor 1 1
MIRT010154 Tmed8 transmembrane p24 trafficking protein 8 1 1
MIRT010155 4930506M07Rik shootin 1 1 1
MIRT010156 Mapre3 microtubule-associated protein, RP/EB family, member 3 1 1
MIRT010157 Ankrd17 ankyrin repeat domain 17 1 1
MIRT010158 Celsr2 cadherin, EGF LAG seven-pass G-type receptor 2 1 1
MIRT010159 Gabbr2 gamma-aminobutyric acid (GABA) B receptor, 2 1 1
MIRT010160 Zfp217 zinc finger protein 217 1 1
MIRT010161 Sobp sine oculis-binding protein homolog (Drosophila) 1 1
MIRT010162 Ythdf3 YTH domain family 3 1 1
MIRT010163 Lrrc3 leucine rich repeat containing 3 1 1
MIRT010164 Klhl20 kelch-like 20 1 1
MIRT010165 Gpr63 G protein-coupled receptor 63 1 1
MIRT010166 Otud4 OTU domain containing 4 1 1
MIRT010167 Stxbp5 syntaxin binding protein 5 (tomosyn) 1 1
MIRT010168 Slc17a7 solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7 1 1
MIRT010169 Rab11fip4 RAB11 family interacting protein 4 (class II) 1 1
MIRT010170 Ttc9 tetratricopeptide repeat domain 9 1 1
MIRT010171 Tmod2 tropomodulin 2 1 1
MIRT010172 Fbxo21 F-box protein 21 1 1
MIRT010173 App amyloid beta (A4) precursor protein 1 1
MIRT010174 Rora RAR-related orphan receptor alpha 1 1
MIRT010175 Tmcc1 transmembrane and coiled coil domains 1 1 1
MIRT010176 D4Wsu53e arginine/serine rich protein 1 1 1
MIRT010177 Lrch1 leucine-rich repeats and calponin homology (CH) domain containing 1 1 1
MIRT010178 Dpysl5 dihydropyrimidinase-like 5 1 1
MIRT010179 Ficd FIC domain containing 1 1
MIRT010180 Fam134a reticulophagy regulator family member 2 1 1
MIRT010181 Pcdhac1 protocadherin alpha subfamily C, 1 1 1
MIRT010182 Rgma repulsive guidance molecule family member A 1 1
MIRT010183 Abca1 ATP-binding cassette, sub-family A (ABC1), member 1 1 1
MIRT010184 Foxp1 forkhead box P1 1 1
MIRT053654 Zfpm2 zinc finger protein, multitype 2 3 1
MIRT054318 Hbp1 high mobility group box transcription factor 1 3 1
MIRT054658 Trp53inp1 transformation related protein 53 inducible nuclear protein 1 3 1
MIRT054697 Tbx3 T-box 3 3 2
MIRT054700 Fgf10 fibroblast growth factor 10 3 1
MIRT054703 Shox2 short stature homeobox 2 3 2
MIRT054704 Osr1 odd-skipped related 1 (Drosophila) 3 1
MIRT437543 Timp2 tissue inhibitor of metalloproteinase 2 4 2
MIRT437544 Timp1 tissue inhibitor of metalloproteinase 1 3 1
MIRT438451 Tceal1 transcription elongation factor A (SII)-like 1 3 1
MIRT438660 Vegfa vascular endothelial growth factor A 2 1
MIRT579568 Fam227a family with sequence similarity 227, member A 1 2
MIRT579898 Zbtb41 zinc finger and BTB domain containing 41 1 1
MIRT581955 Pdp2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT582232 Neurl1b neuralized E3 ubiquitin protein ligase 1B 1 1
MIRT582243 Nedd4l neural precursor cell expressed, developmentally down-regulated gene 4-like 1 1
MIRT582785 Kdm2a lysine (K)-specific demethylase 2A 1 1
MIRT584410 Cd28 CD28 antigen 1 2
MIRT585755 St8sia3 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3 1 1
MIRT589803 Id1 inhibitor of DNA binding 1 1 1
MIRT593371 Pcdh10 protocadherin 10 1 1
MIRT593560 Ppp1r3b protein phosphatase 1, regulatory (inhibitor) subunit 3B 1 1
MIRT594600 Ptp4a2 protein tyrosine phosphatase 4a2 1 1
MIRT594634 Morf4l1 mortality factor 4 like 1 1 1
MIRT595285 Mef2c myocyte enhancer factor 2C 1 1
MIRT595293 Mctp2 multiple C2 domains, transmembrane 2 1 1
MIRT595356 Fgfr1op2 FGFR1 oncogene partner 2 1 1
MIRT595987 Larp1 La ribonucleoprotein domain family, member 1 1 1
MIRT596213 Ago4 argonaute RISC catalytic subunit 4 1 1
MIRT603877 Il10rb interleukin 10 receptor, beta 1 1
MIRT731344 Ulk1 unc-51 like kinase 1 1 1
MIRT731807 Smad5 SMAD family member 5 3 1
MIRT756363 Tgfbr2 transforming growth factor, beta receptor II 4 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-17 5-Fluorouracil approved 3385 Microarray HCT-8 colon cancer cell line 19956872 2010 down-regulated
miR-17 Polylysine NULL 162282 Quantitative real-time PCR 293T(FLAG AGO2) cells 20529860 2010 down-regulated
miR-17 Trypaflavine NULL NULL Quantitative real-time PCR 293T(FLAG AGO2) cells 20529860 2010 down-regulated
miR-17 5-azacytidine (5-AzaC) approved 9444 Quantitative real-time PCR chronic myeloid leukemia (CML)K562 cell line 21176349 2011 down-regulated
miR-17 Testosterone + 1,25-Dihydroxyvitamin D3 approved NULL Microarray prostate cancer 21592394 2011 down-regulated
miR-17 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-17 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer SKBR3 22076154 2011 down-regulated
miR-17 Sulindac sulfide approved 5352624 Quantitative real-time PCR HCT116 colon tumor cells 22286762 2012 down-regulated
miR-17 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-17 Bicalutamide approved 2375 Microarray prostate 22674191 2012 down-regulated
miR-17 Bicalutamide approved 2375 Quantitative real-time PCR LNCaP cells 22674191 2012 down-regulated
miR-17 Proanthocyanin NULL 108065 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-17 Tert-butyl hydroperoxide (t-BHP) NULL 6410 Microarray mouse auditory cells 20510889 2010 up-regulated
miR-17 Dexamethasone approved 5743 Quantitative real-time PCR WEHI7.2 murine T-cell lymphoma cell line 21239610 2011 down-regulated
miR-17 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 up-regulated
miR-17-5p cisplatin approved 84093 Quantitative real-time PCR K562 cell 20428827 2010 up-regulated
miR-17-5p Camptothecin NULL 24360 Microarray human cancer cells 24252850 2014 down-regulated
miR-17-5p 17beta-estradiol (E2) approved 5757 Quantitative real-time PCR endometrial stromal 19088369 2008 up-regulated
miR-17-5p 17beta-estradiol (E2) approved 5757 Quantitative real-time PCR glandular epithelial cells 19088369 2008 up-regulated
miR-17-5p Medroxyprogesterone acetate approved 6279 Quantitative real-time PCR endometrial stromal 19088369 2008 up-regulated
miR-17-5p Medroxyprogesterone acetate approved 6279 Quantitative real-time PCR glandular epithelial cells 19088369 2008 up-regulated
miR-17-5p 17beta-estradiol (E2) approved 5757 Microarray MCF-7 breast cancer cells 19528081 2009 up-regulated
miR-17-5p Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 down-regulated
miR-17-5p Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-17-5p Tamoxifen approved 2733526 Microarray rat liver 17343880 2007 up-regulated
miR-17-5p Tamoxifen approved 2733526 Quantitative real-time PCR rat liver 17343880 2007 up-regulated
miR-17-5p 17beta-estradiol (E2) approved 5757 Microarray rat breast 17700064 2007 up-regulated
miR-17-5p 17beta-estradiol (E2) approved 5757 Quantitative real-time PCR rat breast 17700064 2007 up-regulated
miR-17-5p Acarbose Approved 444254 Microarray diabetic rats cells 24260283 2014 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
mmu-miR-17-5p Etoposide 36462 NSC141540 approved resistant Low Leukemia tissue and cell line (K562, HL60)

Error report submission