| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-96 |
| Genomic Coordinates | chr7: 129774692 - 129774769 |
| Synonyms | DFNA50, MIRN96, hsa-mir-96, miR-96, miRNA96, MIR96 |
| Description | Homo sapiens miR-96 stem-loop |
| Comment | This sequence is localised to chromosome 7 and was named mir-96-7 in reference . |
| RNA Secondary Structure |  |
| Associated Diseases |  |
| Mature miRNA Information | |||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-96-5p | ||||||||||||||||||||||||
| Sequence | 9| UUUGGCACUAGCACAUUUUUGCU |31 | ||||||||||||||||||||||||
| Evidence | Experimental | ||||||||||||||||||||||||
| Experiments | Cloned | DRVs in miRNA |
|
||||||||||||||||||||||
| SNPs in miRNA |
|
||||||||||||||||||||||||
| Putative Targets | |||||||||||||||||||||||||
| miRNA Expression profile | |
|---|---|
| Human miRNA Tissue Atlas | |
| miRNAs in Extracellular Vesicles |
|
| Circulating MicroRNA Expression Profiling | |
| Biomarker Information |
| ||||||
|---|---|---|---|---|---|---|---|
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | FOXO1 | ||||||||||||||||||||
| Synonyms | FKH1, FKHR, FOXO1A | ||||||||||||||||||||
| Description | forkhead box O1 | ||||||||||||||||||||
| Transcript | NM_002015 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on FOXO1 | |||||||||||||||||||||
| 3'UTR of FOXO1 (miRNA target sites are highlighted) |
>FOXO1|NM_002015|3'UTR 1 GGGTTAGTGAGCAGGTTACACTTAAAAGTACTTCAGATTGTCTGACAGCAGGAACTGAGAGAAGCAGTCCAAAGATGTCT 81 TTCACCAACTCCCTTTTAGTTTTCTTGGTTAAAAAAAAAAACAAAAAAAAAAACCCTCCTTTTTTCCTTTCGTCAGACTT 161 GGCAGCAAAGACATTTTTCCTGTACAGGATGTTTGCCCAATGTGTGCAGGTTATGTGCTGCTGTAGATAAGGACTGTGCC 241 ATTGGAAATTTCATTACAATGAAGTGCCAAACTCACTACACCATATAATTGCAGAAAAGATTTTCAGATCCTGGTGTGCT 321 TTCAAGTTTTGTATATAAGCAGTAGATACAGATTGTATTTGTGTGTGTTTTTGGTTTTTCTAAATATCCAATTGGTCCAA 401 GGAAAGTTTATACTCTTTTTGTAATACTGTGATGGGCCTCATGTCTTGATAAGTTAAACTTTTGTTTGTACTACCTGTTT 481 TCTGCGGAACTGACGGATCACAAAGAACTGAATCTCCATTCTGCATCTCCATTGAACAGCCTTGGACCTGTTCACGTTGC 561 CACAGAATTCACATGAGAACCAAGTAGCCTGTTATCAATCTGCTAAATTAATGGACTTGTTAAACTTTTGGAAAAAAAAA 641 GATTAAATGCCAGCTTTGTACAGGTCTTTTCTATTTTTTTTTGTTTATTTTGTTATTTGCAAATTTGTACAAACATTTAA 721 ATGGTTCTAATTTCCAGATAAATGATTTTTGATGTTATTGTTGGGACTTAAGAACATTTTTGGAATAGATATTGAACTGT 801 AATAATGTTTTCTTAAAACTAGAGTCTACTTTGTTACATAGTCAGCTTGTAAATTTTGTGGAACCACAGGTATTTGGGGC 881 AGCATTCATAATTTTCATTTTGTATTCTAACTGGATTAGTACTAATTTTATACATGCTTAACTGGTTTGTACACTTTGGG 961 ATGCTACTTAGTGATGTTTCTGACTAATCTTAAATCATTGTAATTAGTACTTGCATATTCAACGTTTCAGGCCCTGGTTG 1041 GGCAGGAAAGTGATGTATAGTTATGGACACTTTGCGTTTCTTATTTAGGATAACTTAATATGTTTTTATGTATGTATTTT 1121 AAAGAAATTTCATCTGCTTCTACTGAACTATGCGTACTGCATAGCATCAAGTCTTCTCTAGAGACCTCTGTAGTCCTGGG 1201 AGGCCTCATAATGTTTGTAGATCAGAAAAGGGAGATCTGCATCTAAAGCAATGGTCCTTTGTCAAACGAGGGATTTTGAT 1281 CCACTTCACCATTTTGAGTTGAGCTTTAGCAAAAGTTTCCCCTCATAATTCTTTGCTCTTGTTTCAGTCCAGGTGGAGGT 1361 TGGTTTTGTAGTTCTGCCTTGAGGAATTATGTCAACACTCATACTTCATCTCATTCTCCCTTCTGCCCTGCAGATTAGAT 1441 TACTTAGCACACTGTGGAAGTTTAAGTGGAAGGAGGGAATTTAAAAATGGGACTTGAGTGGTTTGTAGAATTTGTGTTCA 1521 TAAGTTCAGATGGGTAGCAAATGGAATAGAACTTACTTAAAAATTGGGGAGATTTATTTGAAAACCAGCTGTAAGTTGTG 1601 CATTGAGATTATGTTAAAAGCCTTGGCTTAAGAATTTGAAAATTTCTTTAGCCTGTAGCAACCTAAACTGTAATTCCTAT 1681 CATTATGTTTTATTACTTTCCAATTACCTGTAACTGACAGACCAAATTAATTGGCTTTGTGTCCTATTTAGTCCATCAGT 1761 ATTTTCAAGTCATGTGGAAAGCCCAAAGTCATCACAATGAAGAGAACAGGTGCACAGCACTGTTCCTCTTGTGTTCTTGA 1841 GAAGGATCTAATTTTTCTGTATATAGCCCACATCACACTTGCTTTGTCTTGTATGTTAATTGCATCTTCATTGGCTTGGT 1921 ATTTCCTAAATGTTTAACAAGAACACAAGTGTTCCTGATAAGATTTCCTACAGTAAGCCAGCTCTATTGTAAGCTTCCCA 2001 CTGTGATGATCATTTTTTTGAAGATTCATTGAACAGCCACCACTCTATCATCCTCATTTTGGGGCAGTCCAAGACATAGC 2081 TGGTTTTAGAAACCCAAGTTCCTCTAAGCACAGCCTCCCGGGTATGTAACTGAACTTGGTGCCAAAGTACTTGTGTACTA 2161 ATTTCTATTACTACGTACTGTCACTTTCCTCCCGTGCCATTACTGCATCATAATACAAGGAACCTCAGAGCCCCCATTTG 2241 TTCATTAAAGAGGCAACTACAGCCAAAATCACTGTTAAAATCTTACTACTTCATGGAGTAGCTCTTAGGAAAATATATCT 2321 TCCTCCTGAGTCTGGGTAATTATACCTCTCCCAAGCCCCCATTGTGTGTTGAAATCCTGTCATGAATCCTTGGTAGCTCT 2401 CTGAGAACAGTGAAGTCCAGGGAAAGGCATCTGGTCTGTCTGGAAAGCAAACATTATGTGGCCTCTGGTAGTTTTTTTCC 2481 TGTAAGAATACTGACTTTCTGGAGTAATGAGTATATATCAGTTATTGTACATGATTGCTTTGTGAAATGTGCAAATGATA 2561 TCACCTATGCAGCCTTGTTTGATTTATTTTCTCTGGTTTGTACTGTTATTAAAAGCATATTGTATTATAGAGCTATTCAG 2641 ATATTTTAAATATAAAGATGTATTGTTTCCGTAATATAGACGTATGGAATATATTTAGGTAATAGATGTATTACTTGGAA 2721 AGTTCTGCTTTGACAAACTGACAAAGTCTAAATGAGCACATGTATCCCAGTGAGCAGTAAATCAATGGAACATCCCAAGA 2801 AGAGGATAAGGATGCTTAAAATGGAAATCATTCTCCAACGATATACAAATTGGACTTGTTCAACTGCTGGATATATGCTA 2881 CCAATAACCCCAGCCCCAACTTAAAATTCTTACATTCAAGCTCCTAAGAGTTCTTAATTTATAACTAATTTTAAAAGAGA 2961 AGTTTCTTTTCTGGTTTTAGTTTGGGAATAATCATTCATTAAAAAAAATGTATTGTGGTTTATGCGAACAGACCAACCTG 3041 GCATTACAGTTGGCCTCTCCTTGAGGTGGGCACAGCCTGGCAGTGTGGCCAGGGGTGGCCATGTAAGTCCCATCAGGACG 3121 TAGTCATGCCTCCTGCATTTCGCTACCCGAGTTTAGTAACAGTGCAGATTCCACGTTCTTGTTCCGATACTCTGAGAAGT 3201 GCCTGATGTTGATGTACTTACAGACACAAGAACAATCTTTGCTATAATTGTATAAAGCCATAAATGTACATAAATTATGT 3281 TTAAATGGCTTGGTGTCTTTCTTTTCTAATTATGCAGAATAAGCTCTTTATTAGGAATTTTTTGTGAAGCTATTAAATAC 3361 TTGAGTTAAGTCTTGTCAGCCACAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | MCF-7 |
| Location of target site | 3'UTR |
| Tools used in this research | miRanda , TargetScan , PicTar |
| Original Description (Extracted from the article) |
...
"Endogenous FOXO1 protein levels were increased by up to 3-fold in a dose-dependent manner upon knockdown of miR-27a
... - Guttilla IK; White BA, 2009, The Journal of biological chemistry. |
| Article |
- Guttilla IK; White BA - The Journal of biological chemistry, 2009
The FOXO1 transcription factor orchestrates the regulation of genes involved in the apoptotic response, cell cycle checkpoints, and cellular metabolism. FOXO1 is a putative tumor suppressor, and the expression of this gene is dysregulated in some cancers, including prostate and endometrial cancers. However, the molecular mechanism resulting in aberrant expression of human FOXO1 in cancer cells is poorly understood. We show here that FOXO1 mRNA is down-regulated in breast tumor samples as compared with normal breast tissue. Silencing of the microRNA processing enzymes, Drosha and Dicer, led to an increase in FOXO1 expression. We also identified functional and specific microRNA target sites in the FOXO1 3'-untranslated region for miR-27a, miR-96, and miR-182, microRNAs that have previously been linked to oncogenic transformation. The three microRNAs, miR-27a, miR-96 and miR-182, were observed to be highly expressed in MCF-7 breast cancer cells, in which the level of FOXO1 protein is very low. Antisense inhibitors to each of these microRNAs led to a significant increase in endogenous FOXO1 expression and to a decrease in cell number in a manner that was blocked by FOXO1 siRNA. Overexpression of FOXO1 resulted in decreased cell viability because of inhibition of cell cycle traverse and induction of cell death. We have identified a novel mechanism of FOXO1 regulation, and targeting of FOXO1 by microRNAs may contribute to transformation or maintenance of an oncogenic state in breast cancer cells.
LinkOut: [PMID: 19574223]
|
| Experimental Support 2 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEC-1-B , Ishiwaka , Clinical specimens |
| Location of target site | 3'UTR |
| Tools used in this research | miRanda , miRBase Target Database , PicTar , TargetScan |
| Original Description (Extracted from the article) |
...
"FOXO1 expression was efficiently restored in the Ishikawa cell line upon simultaneous inhibition of miR-9
... - Myatt SS; Wang J; Monteiro LJ; Christian M; et al., 2010, Cancer research. |
| Article |
- Myatt SS; Wang J; Monteiro LJ; Christian M; et al. - Cancer research, 2010
Endometrial cancer is the most common malignancy of the lower female reproductive tract. The tumor suppressor FOXO1 is downregulated in endometrial cancer compared with normal endometrium but the underlying mechanisms are not well understood. Using microRNA (miR) target prediction algorithms, we identified several miRs that potentially bind the 3'-untranslated region of FOXO1 transcripts. Expression profiling of normal and malignant endometrial samples by quantitative real-time PCR and Northern blot analysis revealed an inverse correlation between the levels of FOXO1 protein and the abundance of several of the in silico-predicted miRs, suggesting that loss of FOXO1 expression in endometrial cancer may be mediated by miRs. To determine the role of candidate miRs, we used the endometrial cancer cell lines HEC-1B and Ishikawa, which express FOXO1 at high and low levels, respectively. Expression of miR-9, miR-27, miR-96, miR-153, miR-182, miR-183, or miR-186, but not miR-29a, miR-128, miR-152, or miR-486 mimetics in HEC-1B cells was sufficient to significantly reduce the abundance of FOXO1. Conversely, FOXO1 expression was efficiently restored in the Ishikawa cell line upon simultaneous inhibition of miR-9, miR-27, miR-96, miR-153, miR-183, and miR-186. Moreover, induction of FOXO1 in Ishikawa cells by miR inhibitors was accompanied by G1 cell cycle arrest and cell death, and was attenuated by the small interfering RNA-mediated downregulation of FOXO1 expression. Our findings identify several miRs overexpressed in endometrial cancer that function in concert to repress FOXO1 expression. Further, aberrant miR expression results in deregulated cell cycle control and impaired apoptotic responses, and thus, may be central to endometrial tumorigenesis.
LinkOut: [PMID: 20028871]
|
| Experimental Support 3 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | hESCs (WA-09) | ||||||
| Disease | 2308.0 | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine
... - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al. - Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
|
||||||
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | SKOV3 |
| Location of target site | 3'UTR |
| Original Description (Extracted from the article) |
...
"MiRNA expression in four PTX-resistant cell lines (SKpac-8
... - Huh JH; Kim TH; Kim K; Song JA; Jung YJ; et al., 2013, British journal of cancer. |
| Article |
- Huh JH; Kim TH; Kim K; Song JA; Jung YJ; et al. - British journal of cancer, 2013
BACKGROUND: MicroRNAs are noncoding regulatory RNAs strongly implicated in carcinogenesis, cell survival, and chemosensitivity. Here, microRNAs associated with chemoresistance in ovarian carcinoma, the most lethal of gynaecological malignancies, were identified and their functional effects in chemoresistant ovarian cancer cells were assessed. METHODS: MicroRNA expression in paclitaxel (PTX)-resistant SKpac sublines was compared with that of the PTX-sensitive, parental SKOV3 ovarian cancer cell line using microarray and qRT-PCR. The function of differentially expressed microRNAs in chemoresistant ovarian cancer was further evaluated by apoptosis, cell proliferation, and migration assays. RESULTS: Upregulation of miR-106a and downregulation of miR-591 were associated with PTX resistance in ovarian cancer cells and human tumour samples. Transfection with anti-miR-106a or pre-miR-591 resensitized PTX-resistant SKpac cells to PTX by enhancing apoptosis (23 and 42% increase), and inhibited their cell migration (43 and 56% decrease) and proliferation (64 and 65% decrease). Furthermore, ZEB1 was identified as a novel target gene of miR-591, and BCL10 and caspase-7 were target genes of miR-106a, as identified by immunoblotting and luciferase assay. CONCLUSION: MiR-106a and miR-591 have important roles in conferring PTX resistance to ovarian cancer cells. Modulation of these microRNAs resensitizes PTX-resistant cancer cells by targeting BCL10, caspase-7, and ZEB1.
LinkOut: [PMID: 23807165]
|
| Experimental Support 5 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | SW480 , SW620 | ||||||
| Disease | MIMAT0000095 | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | miRanda , TargetScan | ||||||
| Original Description (Extracted from the article) |
...
"A luciferase reporter assay indicated that miR-96 inhibited luciferase intensity controlled by the 3'UTRs of TP53INP1
... - Gao F; Wang W, 2015, Molecular medicine reports. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Gao F; Wang W - Molecular medicine reports, 2015
MicroRNAs (miRNAs) are a conserved class of small, endogenous, non protein-coding RNA molecules that are capable of regulating gene expression at post-transcriptional levels and are involved in diverse cellular processes, including cancer pathogenesis. It has previously been reported that miRNA-96 (miR-96) is overexpressed in human colorectal cancer (CRC). However, the underlying mechanism of miR-96 regulation in CRC remains to be elucidated. In the present study, miR-96 was confirmed to be upregulated in CRC tissues by reverse transcription quantitative polymerase chain reaction. MTT assay, colony formation assay and cell cycle analysis revealed that miR-96 overexpression led to increased tumor cell viability, colony formation ability and cell cycle progression. By contrast, inhibition of miR-96 resulted in the suppression of cell proliferation. It was also demonstrated that miR-96 reduced the messenger RNA and protein expression levels of tumor protein p53 inducible nuclear protein 1 (TP53INP1), forkhead box protein O1 (FOXO1) and FOXO3a, which are closely associated with cell proliferation. A luciferase reporter assay indicated that miR-96 inhibited luciferase intensity controlled by the 3'UTRs of TP53INP1, FOXO1 and FOXO3a. In conclusion, the results of the present study demonstrated that miR-96 contributed to CRC cell growth and that TP53INP1, FOXO1 and FOXO3a were direct targets of miR-96, suggesting that miR-96 may have the potential to be used in the development of miRNAbased therapies for CRC patients.
LinkOut: [PMID: 25369914]
|
||||||
| Experimental Support 6 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | K1 , TPC1 |
| Disease | papillary thyroid carcinoma |
| Location of target site | 3'UTR |
| Tools used in this research | miRanda , miRBase Target Database , TargetScan |
| Original Description (Extracted from the article) |
...
Luciferase assays revealed that miR-96 is directly targeted to both binding sites of FOXO1 3芒鈧鈩-untranslated region (3芒鈧鈩-UTR) and suppressed the FOXO1 expression
... - Song HM; Luo Y; Li DF; Wei CK; Hua KY; Song et al., 2015, International journal of clinical and experimental pathology. |
| Article |
- Song HM; Luo Y; Li DF; Wei CK; Hua KY; Song et al. - International journal of clinical and experimental pathology, 2015
MicroRNAs (miRNAs) are kind of small non-coding RNAs that negatively regulate gene expression at post-transcription level, and those non-coding RNAs appear to play a key role in tumorigenesis. The aim of this study was to investigate the biological role of miR-96 in papillary thyroid carcinoma (PTC) cell lines. We identified miR-96 to be up-regulated in PTC specimens in comparison to matched normal tissues by microRNA microarray and RT-qPCR analysis (P < 0.05). Next, to explore the potential function of miR-96, PTC cell lines K1 and TPC1 were transiently transfected with miR-96 mimics and inhibitor. Successful transfection being confirmed by RT-qPCR. Ectopic expression of miR-96 promoted proliferation and colony formation ability, and inhibited apoptosis of K1 and TPC1 cells, whereas down-regulated expression of miR-96 suppressed those functions when compared with the control cells. According to a computational prediction, FOXO1 maybe a potential target of miR-96. Luciferase assays revealed that miR-96 is directly targeted to both binding sites of FOXO1 3'-untranslated region (3'-UTR) and suppressed the FOXO1 expression, and subsequently inhibited the expression of Bim protein in PTC cells. Moreover, the expression of FOXO1 had an inverse correlation with expression of miR-96 in PTC specimens by RT-qPCR and western blot analysis. The data from the present study demonstrated that miR-96 can promote proliferation, and inhibit apoptosis in PTC cell lines K1 and TPC1, thus miR-96 may play an oncogenic role in PTC by inhibiting the FOXO1 and regulating AKT/FOXO1/Bim pathway, and it may serve as a novel therapeutic target for miRNA-based PTC therapy.
LinkOut: [PMID: 26617698]
|
| CLIP-seq Support 1 for dataset SRR359787 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | hESCs (WA-09) / 4-thiouridine, RNase T1 |
| Location of target site | ENST00000379561.5 | 3UTR | UAUGUAACUGAACUUGGUGCCA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 22012620 / SRX103431 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
202 hsa-miR-96-5p Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT001087 | FOXO1 | forkhead box O1 |  |
|
|
|
|
|
|
7 | 6 | |
| MIRT001989 | MITF | melanogenesis associated transcription factor | |
|
2 | 1 | ||||||
| MIRT001991 | ADCY6 | adenylate cyclase 6 | |
|
|
3 | 2 | |||||
| MIRT002447 | HTR1B | 5-hydroxytryptamine receptor 1B | |
|
2 | 1 | ||||||
| MIRT003144 | Mitf | melanogenesis associated transcription factor | |
|
|
3 | 1 | |||||
| MIRT003414 | CDKN1A | cyclin dependent kinase inhibitor 1A | |
|
|
|
|
5 | 1 | |||
| MIRT004352 | PRMT5 | protein arginine methyltransferase 5 | |
|
|
|
4 | 2 | ||||
| MIRT005450 | FOXO3 | forkhead box O3 | |
|
|
|
4 | 1 | ||||
| MIRT005553 | KRAS | KRAS proto-oncogene, GTPase | |
|
|
|
|
5 | 4 | |||
| MIRT006779 | REV1 | REV1, DNA directed polymerase | |
|
|
3 | 1 | |||||
| MIRT006780 | RAD51 | RAD51 recombinase | |
|
|
3 | 1 | |||||
| MIRT027869 | CELSR2 | cadherin EGF LAG seven-pass G-type receptor 2 | |
1 | 1 | |||||||
| MIRT027870 | ODF2 | outer dense fiber of sperm tails 2 | |
1 | 1 | |||||||
| MIRT027871 | IRS1 | insulin receptor substrate 1 | |
1 | 1 | |||||||
| MIRT027872 | MYRIP | myosin VIIA and Rab interacting protein | |
|
2 | 1 | ||||||
| MIRT027873 | RYK | receptor-like tyrosine kinase | |
1 | 1 | |||||||
| MIRT027874 | CAMTA1 | calmodulin binding transcription activator 1 | |
1 | 1 | |||||||
| MIRT027875 | CDON | cell adhesion associated, oncogene regulated | |
1 | 1 | |||||||
| MIRT027876 | MGST1 | microsomal glutathione S-transferase 1 | |
1 | 1 | |||||||
| MIRT027877 | SRXN1 | sulfiredoxin 1 | |
1 | 1 | |||||||
| MIRT027878 | SUPT4H1 | SPT4 homolog, DSIF elongation factor subunit | |
1 | 1 | |||||||
| MIRT027879 | HNRNPDL | heterogeneous nuclear ribonucleoprotein D like | |
1 | 1 | |||||||
| MIRT027880 | ZC3H15 | zinc finger CCCH-type containing 15 | |
1 | 1 | |||||||
| MIRT027881 | ZYX | zyxin | |
1 | 1 | |||||||
| MIRT027882 | ZMIZ1 | zinc finger MIZ-type containing 1 | |
1 | 1 | |||||||
| MIRT027883 | JAZF1 | JAZF zinc finger 1 | |
1 | 1 | |||||||
| MIRT027884 | TRIM4 | tripartite motif containing 4 | |
1 | 1 | |||||||
| MIRT027885 | B4GALT3 | beta-1,4-galactosyltransferase 3 | |
1 | 1 | |||||||
| MIRT027886 | POMP | proteasome maturation protein | |
1 | 1 | |||||||
| MIRT027887 | GTF2A1 | general transcription factor IIA subunit 1 | |
1 | 1 | |||||||
| MIRT027888 | RELA | RELA proto-oncogene, NF-kB subunit | |
1 | 1 | |||||||
| MIRT027889 | SLAIN1 | SLAIN motif family member 1 | |
1 | 1 | |||||||
| MIRT027890 | RPS29 | ribosomal protein S29 | |
1 | 1 | |||||||
| MIRT027891 | PON2 | paraoxonase 2 | |
1 | 1 | |||||||
| MIRT027892 | HMGCS1 | 3-hydroxy-3-methylglutaryl-CoA synthase 1 | |
1 | 1 | |||||||
| MIRT027893 | SLC25A46 | solute carrier family 25 member 46 | |
1 | 1 | |||||||
| MIRT027894 | APPL1 | adaptor protein, phosphotyrosine interacting with PH domain and leucine zipper 1 | |
1 | 1 | |||||||
| MIRT027895 | BAG4 | BCL2 associated athanogene 4 | |
1 | 1 | |||||||
| MIRT027896 | TSPAN14 | tetraspanin 14 | |
1 | 1 | |||||||
| MIRT027897 | CHML | CHM like, Rab escort protein 2 | |
1 | 1 | |||||||
| MIRT027898 | REEP3 | receptor accessory protein 3 | |
1 | 1 | |||||||
| MIRT027899 | TWISTNB | TWIST neighbor | |
1 | 1 | |||||||
| MIRT027900 | ECT2 | epithelial cell transforming 2 | |
1 | 1 | |||||||
| MIRT027901 | XIAP | X-linked inhibitor of apoptosis | |
1 | 1 | |||||||
| MIRT027902 | NKIRAS2 | NFKB inhibitor interacting Ras like 2 | |
1 | 1 | |||||||
| MIRT027903 | DDIT3 | DNA damage inducible transcript 3 | |
1 | 1 | |||||||
| MIRT027904 | RLF | rearranged L-myc fusion | |
1 | 1 | |||||||
| MIRT027905 | MTHFD2L | methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2 like | |
1 | 1 | |||||||
| MIRT027906 | SYNGR2 | synaptogyrin 2 | |
|
2 | 2 | ||||||
| MIRT027907 | ADSS | adenylosuccinate synthase | |
1 | 1 | |||||||
| MIRT027908 | PHF19 | PHD finger protein 19 | |
1 | 1 | |||||||
| MIRT027909 | SGK3 | serum/glucocorticoid regulated kinase family member 3 | |
1 | 1 | |||||||
| MIRT027910 | KDELR1 | KDEL endoplasmic reticulum protein retention receptor 1 | |
1 | 1 | |||||||
| MIRT027911 | UBE2N | ubiquitin conjugating enzyme E2 N | |
1 | 1 | |||||||
| MIRT027912 | CNOT6 | CCR4-NOT transcription complex subunit 6 | |
1 | 1 | |||||||
| MIRT027913 | FBXO21 | F-box protein 21 | |
1 | 1 | |||||||
| MIRT027914 | ARHGEF2 | Rho/Rac guanine nucleotide exchange factor 2 | |
1 | 1 | |||||||
| MIRT027915 | SPIN4 | spindlin family member 4 | |
|
2 | 2 | ||||||
| MIRT027916 | CGGBP1 | CGG triplet repeat binding protein 1 | |
1 | 1 | |||||||
| MIRT027917 | PPP1R12A | protein phosphatase 1 regulatory subunit 12A | |
|
2 | 3 | ||||||
| MIRT027918 | RAB5B | RAB5B, member RAS oncogene family | |
1 | 1 | |||||||
| MIRT027919 | TAOK1 | TAO kinase 1 | |
1 | 1 | |||||||
| MIRT027920 | EFNB2 | ephrin B2 | |
1 | 1 | |||||||
| MIRT027921 | NIPA1 | non imprinted in Prader-Willi/Angelman syndrome 1 | |
1 | 1 | |||||||
| MIRT027922 | YWHAG | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein gamma | |
1 | 1 | |||||||
| MIRT027923 | NHLRC3 | NHL repeat containing 3 | |
1 | 1 | |||||||
| MIRT027924 | SNX16 | sorting nexin 16 | |
1 | 1 | |||||||
| MIRT027925 | EVI5 | ecotropic viral integration site 5 | |
|
2 | 3 | ||||||
| MIRT027926 | PRDM16 | PR/SET domain 16 | |
1 | 1 | |||||||
| MIRT027927 | HOXA9 | homeobox A9 | |
|
2 | 3 | ||||||
| MIRT027928 | PROSC | pyridoxal phosphate binding protein | |
1 | 1 | |||||||
| MIRT027929 | BCL2 | BCL2, apoptosis regulator | |
1 | 1 | |||||||
| MIRT027930 | EIF4G1 | eukaryotic translation initiation factor 4 gamma 1 | |
1 | 1 | |||||||
| MIRT027931 | FAM171A1 | family with sequence similarity 171 member A1 | |
1 | 1 | |||||||
| MIRT027932 | MED1 | mediator complex subunit 1 | |
1 | 1 | |||||||
| MIRT027933 | CNNM3 | cyclin and CBS domain divalent metal cation transport mediator 3 | |
1 | 1 | |||||||
| MIRT027934 | PROK2 | prokineticin 2 | |
1 | 1 | |||||||
| MIRT027935 | ATXN1 | ataxin 1 | |
1 | 1 | |||||||
| MIRT027936 | FRS2 | fibroblast growth factor receptor substrate 2 | |
1 | 1 | |||||||
| MIRT027937 | PRKCE | protein kinase C epsilon | |
1 | 1 | |||||||
| MIRT027938 | SLC39A1 | solute carrier family 39 member 1 | |
1 | 1 | |||||||
| MIRT035550 | SCARB1 | scavenger receptor class B member 1 | |
|
|
3 | 2 | |||||
| MIRT048714 | FAM105B | OTU deubiquitinase with linear linkage specificity | |
1 | 1 | |||||||
| MIRT048715 | SNX7 | sorting nexin 7 | |
1 | 1 | |||||||
| MIRT048716 | EEF1A1 | eukaryotic translation elongation factor 1 alpha 1 | |
1 | 1 | |||||||
| MIRT048717 | PAPD5 | poly(A) RNA polymerase D5, non-canonical | |
1 | 1 | |||||||
| MIRT048718 | GAPDH | glyceraldehyde-3-phosphate dehydrogenase | |
1 | 1 | |||||||
| MIRT048719 | THAP9 | THAP domain containing 9 | |
1 | 1 | |||||||
| MIRT048720 | MOXD1 | monooxygenase DBH like 1 | |
1 | 1 | |||||||
| MIRT048721 | ITPR3 | inositol 1,4,5-trisphosphate receptor type 3 | |
1 | 1 | |||||||
| MIRT048722 | ALKBH5 | alkB homolog 5, RNA demethylase | |
1 | 1 | |||||||
| MIRT048723 | ADNP2 | ADNP homeobox 2 | |
1 | 1 | |||||||
| MIRT048724 | DYNC1H1 | dynein cytoplasmic 1 heavy chain 1 | |
1 | 1 | |||||||
| MIRT048725 | PGAM1 | phosphoglycerate mutase 1 | |
1 | 1 | |||||||
| MIRT048726 | FLII | FLII, actin remodeling protein | |
1 | 1 | |||||||
| MIRT048727 | PMS2 | PMS1 homolog 2, mismatch repair system component | |
1 | 1 | |||||||
| MIRT048728 | TMPO | thymopoietin | |
1 | 1 | |||||||
| MIRT048729 | KLHL15 | kelch like family member 15 | |
1 | 1 | |||||||
| MIRT048730 | SMIM12 | small integral membrane protein 12 | |
1 | 1 | |||||||
| MIRT048731 | EDEM1 | ER degradation enhancing alpha-mannosidase like protein 1 | |
1 | 1 | |||||||
| MIRT048732 | DEK | DEK proto-oncogene | |
1 | 1 | |||||||
| MIRT048733 | PRKAR1A | protein kinase cAMP-dependent type I regulatory subunit alpha | |
1 | 1 | |||||||
| MIRT048734 | YTHDC2 | YTH domain containing 2 | |
1 | 1 | |||||||
| MIRT048735 | ACTN4 | actinin alpha 4 | |
1 | 1 | |||||||
| MIRT048736 | TERF2 | telomeric repeat binding factor 2 | |
1 | 1 | |||||||
| MIRT048737 | HNRNPA1 | heterogeneous nuclear ribonucleoprotein A1 | |
1 | 1 | |||||||
| MIRT048738 | PAQR4 | progestin and adipoQ receptor family member 4 | |
1 | 1 | |||||||
| MIRT053181 | ALK | ALK receptor tyrosine kinase | |
|
|
3 | 1 | |||||
| MIRT053390 | CCNG1 | cyclin G1 | |
1 | 1 | |||||||
| MIRT053391 | RAB35 | RAB35, member RAS oncogene family | |
1 | 1 | |||||||
| MIRT053392 | CASP2 | caspase 2 | |
1 | 1 | |||||||
| MIRT053393 | SOX5 | SRY-box 5 | |
1 | 1 | |||||||
| MIRT053394 | ABCD1 | ATP binding cassette subfamily D member 1 | |
1 | 1 | |||||||
| MIRT053395 | PPP1R9B | protein phosphatase 1 regulatory subunit 9B | |
1 | 1 | |||||||
| MIRT053396 | ATG7 | autophagy related 7 | |
1 | 1 | |||||||
| MIRT053397 | RASA1 | RAS p21 protein activator 1 | |
1 | 1 | |||||||
| MIRT053398 | CCND2 | cyclin D2 | |
1 | 1 | |||||||
| MIRT053783 | GSK3B | glycogen synthase kinase 3 beta | |
|
|
|
4 | 1 | ||||
| MIRT054654 | ZEB1 | zinc finger E-box binding homeobox 1 | |
|
|
3 | 1 | |||||
| MIRT054656 | SNAI2 | snail family transcriptional repressor 2 | |
|
|
3 | 1 | |||||
| MIRT054678 | SLC1A1 | solute carrier family 1 member 1 | |
|
2 | 1 | ||||||
| MIRT054679 | SLC6A6 | solute carrier family 6 member 6 | |
|
4 | 2 | ||||||
| MIRT078464 | MAP3K3 | mitogen-activated protein kinase kinase kinase 3 | |
|
2 | 2 | ||||||
| MIRT079298 | NPTX1 | neuronal pentraxin 1 | |
|
2 | 2 | ||||||
| MIRT203592 | BRWD1 | bromodomain and WD repeat domain containing 1 | |
|
2 | 2 | ||||||
| MIRT257150 | TMEM170B | transmembrane protein 170B | |
|
2 | 2 | ||||||
| MIRT282640 | IGF1R | insulin like growth factor 1 receptor | |
|
2 | 2 | ||||||
| MIRT291999 | SIN3B | SIN3 transcription regulator family member B | |
|
2 | 2 | ||||||
| MIRT437837 | IARS | isoleucyl-tRNA synthetase | |
1 | 1 | |||||||
| MIRT438045 | RECK | reversion inducing cysteine rich protein with kazal motifs | |
|
|
|
|
5 | 3 | |||
| MIRT438129 | TRIB3 | tribbles pseudokinase 3 | |
|
2 | 1 | ||||||
| MIRT438804 | SYCP1 | synaptonemal complex protein 1 | |
1 | 1 | |||||||
| MIRT452671 | GPR156 | G protein-coupled receptor 156 | |
|
2 | 2 | ||||||
| MIRT453461 | PITPNM3 | PITPNM family member 3 | |
|
2 | 2 | ||||||
| MIRT454765 | STOML3 | stomatin like 3 | |
|
2 | 2 | ||||||
| MIRT462316 | CWC25 | CWC25 spliceosome associated protein homolog | |
|
2 | 2 | ||||||
| MIRT467855 | SLC25A25 | solute carrier family 25 member 25 | |
|
2 | 2 | ||||||
| MIRT468527 | SERPINH1 | serpin family H member 1 | |
|
2 | 2 | ||||||
| MIRT470490 | PPP1R11 | protein phosphatase 1 regulatory inhibitor subunit 11 | |
|
2 | 2 | ||||||
| MIRT477660 | EFHD2 | EF-hand domain family member D2 | |
|
2 | 2 | ||||||
| MIRT479790 | CCND1 | cyclin D1 | |
|
|
|
4 | 2 | ||||
| MIRT481283 | ATXN1L | ataxin 1 like | |
|
2 | 2 | ||||||
| MIRT491594 | CCL22 | C-C motif chemokine ligand 22 | |
|
2 | 2 | ||||||
| MIRT500672 | TSKU | tsukushi, small leucine rich proteoglycan | |
|
2 | 2 | ||||||
| MIRT501010 | SPPL2A | signal peptide peptidase like 2A | |
|
2 | 4 | ||||||
| MIRT501681 | PFN1 | profilin 1 | |
|
2 | 8 | ||||||
| MIRT501919 | MBD4 | methyl-CpG binding domain 4, DNA glycosylase | |
|
2 | 4 | ||||||
| MIRT502390 | GATSL2 | cytosolic arginine sensor for mTORC1 subunit 2 | |
|
2 | 2 | ||||||
| MIRT503221 | ACER2 | alkaline ceramidase 2 | |
|
2 | 2 | ||||||
| MIRT503540 | RPL7L1 | ribosomal protein L7 like 1 | |
|
2 | 6 | ||||||
| MIRT505703 | SESN2 | sestrin 2 | |
|
2 | 2 | ||||||
| MIRT509888 | RPS23 | ribosomal protein S23 | |
|
2 | 4 | ||||||
| MIRT525372 | SYNM | synemin | |
|
2 | 2 | ||||||
| MIRT529420 | MALT1 | MALT1 paracaspase | |
|
2 | 2 | ||||||
| MIRT533377 | UBE2D4 | ubiquitin conjugating enzyme E2 D4 (putative) | |
|
2 | 4 | ||||||
| MIRT533469 | TRIM71 | tripartite motif containing 71 | |
|
2 | 2 | ||||||
| MIRT533595 | TNRC6A | trinucleotide repeat containing 6A | |
|
2 | 2 | ||||||
| MIRT535082 | PODXL | podocalyxin like | |
|
2 | 2 | ||||||
| MIRT541183 | MORF4L1 | mortality factor 4 like 1 | |
|
2 | 2 | ||||||
| MIRT544139 | PGK1 | phosphoglycerate kinase 1 | |
|
2 | 2 | ||||||
| MIRT547915 | HOXA5 | homeobox A5 | |
|
2 | 2 | ||||||
| MIRT555926 | NUP43 | nucleoporin 43 | |
|
2 | 2 | ||||||
| MIRT557240 | CRAMP1L | cramped chromatin regulator homolog 1 | |
|
2 | 2 | ||||||
| MIRT557939 | FAM73A | mitoguardin 1 | |
|
2 | 2 | ||||||
| MIRT558455 | DDAH1 | dimethylarginine dimethylaminohydrolase 1 | |
|
2 | 2 | ||||||
| MIRT561177 | TNFRSF10A | TNF receptor superfamily member 10a | |
|
2 | 2 | ||||||
| MIRT562310 | GINM1 | glycoprotein integral membrane 1 | |
|
2 | 2 | ||||||
| MIRT566586 | NUP50 | nucleoporin 50 | |
|
2 | 2 | ||||||
| MIRT573341 | TUBD1 | tubulin delta 1 | |
|
2 | 2 | ||||||
| MIRT576270 | Cd59a | CD59a antigen | |
1 | 1 | |||||||
| MIRT612971 | GID4 | GID complex subunit 4 homolog | |
|
2 | 6 | ||||||
| MIRT614998 | GABRB1 | gamma-aminobutyric acid type A receptor beta1 subunit | |
|
2 | 2 | ||||||
| MIRT622020 | STK17B | serine/threonine kinase 17b | |
|
2 | 2 | ||||||
| MIRT640562 | CPE | carboxypeptidase E | |
|
2 | 2 | ||||||
| MIRT642241 | PAK4 | p21 (RAC1) activated kinase 4 | |
|
2 | 2 | ||||||
| MIRT646584 | ANKRD36 | ankyrin repeat domain 36 | |
|
2 | 2 | ||||||
| MIRT648861 | ABCA6 | ATP binding cassette subfamily A member 6 | |
|
2 | 2 | ||||||
| MIRT652226 | TRAPPC3L | trafficking protein particle complex 3 like | |
|
2 | 2 | ||||||
| MIRT655805 | NOTCH2 | notch 2 | |
|
2 | 2 | ||||||
| MIRT656982 | KDM5A | lysine demethylase 5A | |
|
2 | 2 | ||||||
| MIRT658778 | EIF4EBP2 | eukaryotic translation initiation factor 4E binding protein 2 | |
|
2 | 2 | ||||||
| MIRT660466 | ASH1L | ASH1 like histone lysine methyltransferase | |
|
2 | 2 | ||||||
| MIRT668470 | EXOSC2 | exosome component 2 | |
|
2 | 2 | ||||||
| MIRT689954 | ZNF185 | zinc finger protein 185 with LIM domain | |
|
2 | 2 | ||||||
| MIRT690112 | ZFAND1 | zinc finger AN1-type containing 1 | |
|
2 | 2 | ||||||
| MIRT697755 | USP5 | ubiquitin specific peptidase 5 | |
|
2 | 2 | ||||||
| MIRT705941 | ACY1 | aminoacylase 1 | |
|
2 | 2 | ||||||
| MIRT705981 | ABHD14A-ACY1 | ABHD14A-ACY1 readthrough | |
|
2 | 2 | ||||||
| MIRT723429 | MIPOL1 | mirror-image polydactyly 1 | |
|
2 | 2 | ||||||
| MIRT723490 | WDR33 | WD repeat domain 33 | |
|
2 | 2 | ||||||
| MIRT725556 | CTSB | cathepsin B | |
|
2 | 2 | ||||||
| MIRT731565 | PTPN9 | protein tyrosine phosphatase, non-receptor type 9 | |
|
|
3 | 1 | |||||
| MIRT732322 | MTSS1 | MTSS1, I-BAR domain containing | |
|
|
3 | 1 | |||||
| MIRT732695 | HBEGF | heparin binding EGF like growth factor | |
|
|
3 | 0 | |||||
| MIRT734622 | GDNF | glial cell derived neurotrophic factor | |
1 | 0 | |||||||
| MIRT735085 | PAX6 | paired box 6 | |
|
2 | 0 | ||||||
| MIRT735992 | FHL1 | four and a half LIM domains 1 | |
5 | 1 | |||||||
| MIRT736590 | ZDHHC5 | zinc finger DHHC-type containing 5 | |
|
|
3 | 0 | |||||
| MIRT736666 | PIK3R1 | phosphoinositide-3-kinase regulatory subunit 1 | |
|
|
3 | 0 | |||||
| MIRT755968 | DTL | denticleless E3 ubiquitin protein ligase homolog | 3 | 1 | ||||||||
| MIRT756106 | PTEN | phosphatase and tensin homolog | 3 | 1 | ||||||||
| MIRT756475 | ARHGAP6 | Rho GTPase activating protein 6 | 3 | 1 | ||||||||
| miRNA-Drug Associations | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|