miRTarBase - #MIRT001202


—
pre-miRNA Information
pre-miRNA hsa-mir-9-1   
Genomic Coordinates chr1: 156420341 - 156420429
Synonyms MIRN9-1, hsa-mir-9-1, miRNA9-1, MIR9-1
Description Homo sapiens miR-9-1 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-9-2   
Genomic Coordinates chr5: 88666853 - 88666939
Synonyms MIRN9-2, hsa-mir-9-2, miRNA9-2, MIR9-2
Description Homo sapiens miR-9-2 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-9-3   
Genomic Coordinates chr15: 89368017 - 89368106
Synonyms MIRN9-3, hsa-mir-9-3, miRNA9-3, MIR9-3
Description Homo sapiens miR-9-3 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-9-5p
Sequence 16| UCUUUGGUUAUCUAGCUGUAUGA |38
Evidence Experimental
Experiments Cloned
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BOS25P miR-9 Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Serum Real-time reverse transcription PCR
Gene Information
Gene Symbol RAB34   
Synonyms NARR, RAB39, RAH
Description RAB34, member RAS oncogene family
Transcript NM_001142624   
Other Transcripts NM_001142625 , NM_001144942 , NM_001144943 , NM_031934   
Expression
Putative miRNA Targets on RAB34
3'UTR of RAB34
(miRNA target sites are highlighted)		 
>RAB34|NM_001142624|3'UTR
   1 GGGCTGAGGAGACTGTTCAGAGACTGCCCAGCCCTAGGGCACTGTGCCACCCTCATTCCTCCAGAGCTTGACCCCTGGAC
  81 ATTTGCACTGACTTTATCCAGACCAAAGAGCTGCCTCTTGGTGGCAGTATTCCCACAGAGGGGTAGCTGGGATCATGCTA
 161 GTCACTTCCTGCCCCCAGGCACCGTGCCAAAGACTGGATGCCCCCTACTCCTCAGGGGACTGTCCAGGGCGCCCAGTGGT
 241 AGTGAGGGAGAGTGTCTCTGTTCTTTTGCTCAGCCTGCTGGGCCCTTTGTGTTTGAGGATGCTTAATGATTCCAGCCTCT
 321 CACTGTGCCTTATGCATTAAAATTTCTTTGTTACGAGCACTTAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' aguaUGUC-GAUCUA---UUGGUUUCu 5'
              || | ||  ||   :||||||| 
Target 5' ttgcACTGACTTTATCCAGACCAAAGa 3'
 83 - 109 147.00 -10.10
2 
miRNA  3' aguAUGUCGAUCUAU----UGGUUUCu 5'
             |:|  | ||: |    :|||||| 
Target 5' tccTGCCCCCAGGCACCGTGCCAAAGa 3'
 167 - 193 130.00 -13.00
3 
miRNA  3' aguaugucgaucuauuGGUUUCu 5'
                          |||:|| 
Target 5' tgccaccctcattcctCCAGAGc 3'
 45 - 67 104.00 -6.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30132775 1 COSMIC
COSM9477752 24 COSMIC
COSM976990 42 COSMIC
COSM7545246 51 COSMIC
COSM8552912 57 COSMIC
COSM6761373 64 COSMIC
COSN30508581 115 COSMIC
COSN30131923 131 COSMIC
COSN30478427 134 COSMIC
COSN30140260 138 COSMIC
COSN31597355 151 COSMIC
COSN30513843 183 COSMIC
COSN25735596 204 COSMIC
COSN20079014 252 COSMIC
COSN31519211 353 COSMIC
COSN1715967 359 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1333889971 1 dbSNP
rs554820498 4 dbSNP
rs201099690 6 dbSNP
rs374517328 8 dbSNP
rs1166203724 9 dbSNP
rs1408432672 10 dbSNP
rs1053977123 11 dbSNP
rs1400100998 12 dbSNP
rs748393028 12 dbSNP
rs778963901 21 dbSNP
rs754805550 24 dbSNP
rs1453498910 26 dbSNP
rs183750490 31 dbSNP
rs569034604 34 dbSNP
rs1438319918 35 dbSNP
rs34368475 35 dbSNP
rs756115440 36 dbSNP
rs1193522649 44 dbSNP
rs749990541 46 dbSNP
rs550799258 48 dbSNP
rs1233128526 51 dbSNP
rs761354185 55 dbSNP
rs774174289 58 dbSNP
rs1443440283 64 dbSNP
rs763599968 66 dbSNP
rs760008128 73 dbSNP
rs1302169685 79 dbSNP
rs1007788131 84 dbSNP
rs1443920575 89 dbSNP
rs1416202257 94 dbSNP
rs775527333 98 dbSNP
rs376505828 99 dbSNP
rs1433075262 109 dbSNP
rs1222607512 128 dbSNP
rs1294542467 141 dbSNP
rs1360287784 143 dbSNP
rs1221773490 146 dbSNP
rs973341723 150 dbSNP
rs1439841089 165 dbSNP
rs1182779229 168 dbSNP
rs3208128 171 dbSNP
rs749381716 172 dbSNP
rs115935042 173 dbSNP
rs1176733412 180 dbSNP
rs1022979481 182 dbSNP
rs933001438 183 dbSNP
rs1162452360 184 dbSNP
rs1387936308 194 dbSNP
rs960179199 201 dbSNP
rs777894521 202 dbSNP
rs1360172081 204 dbSNP
rs1036097235 208 dbSNP
rs1329086023 212 dbSNP
rs941797454 215 dbSNP
rs1433182557 216 dbSNP
rs756381227 224 dbSNP
rs1392277221 228 dbSNP
rs879326232 231 dbSNP
rs1448984831 234 dbSNP
rs571361988 235 dbSNP
rs1245876266 236 dbSNP
rs15199 246 dbSNP
rs958581143 247 dbSNP
rs1341530046 260 dbSNP
rs1196643298 262 dbSNP
rs1183590792 266 dbSNP
rs904405122 268 dbSNP
rs1176482367 272 dbSNP
rs928557961 277 dbSNP
rs574826317 280 dbSNP
rs1445228357 284 dbSNP
rs15200 292 dbSNP
rs1182889611 293 dbSNP
rs1366247894 294 dbSNP
rs566783058 296 dbSNP
rs370000695 309 dbSNP
rs546266438 312 dbSNP
rs981804242 321 dbSNP
rs996491292 327 dbSNP
rs899513341 328 dbSNP
rs1339178358 333 dbSNP
rs752928616 335 dbSNP
rs1040764246 336 dbSNP
rs528119523 346 dbSNP
rs943768754 350 dbSNP
rs865966200 354 dbSNP
rs770170403 355 dbSNP
rs1227181067 358 dbSNP
rs1228181351 360 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions SGC7910
Location of target site 3'UTR
Tools used in this research miRanda , TargetScan , PicTar
Original Description (Extracted from the article) ... we also found miR-433 and miR-9 targeted GRB2 and RAB34 ...

- Luo H; Zhang H; Zhang Z; Zhang X; Ning B; et al., 2009, Journal of experimental & clinical cancer research : CR.

Article - Luo H; Zhang H; Zhang Z; Zhang X; Ning B; et al.
- Journal of experimental & clinical cancer research : CR, 2009
BACKGROUND: MircoRNAs(miRNAs) are short, endogenously non-coding RNAs. The abnormal expression of miRNAs may be valuable for the diagnosis and treatment of tumors. METHODS: To screening the special miRNAs in gastric carcinoma, expression level of miRNAs in gastric carcinoma and normal gaster samples were detected by miRNA gene chip. Then, the expressions of miR-9 and miR-433 in gastric carcinoma tissue and SGC7901 cell line were validated by qRT-PCR. GRB2 and RAB34, targets of miR-433 and miR-9 respectively, were detected by Western blot. RESULTS: We found 19 miRNAs and 7 miRNAs were down-regulated and up-regulated respectively. Compared with normal gaster samples, our data showed that miR-9 and miR-433 were down-regulated in gastric carcinoma. Meanwhile, we also found that miR-433 and miR-9 regulated the expression levels of GRB2 and RAB34 respectively. CONCLUSION: Our data show miR-9 and miR-433 was down-regulated in gastric carcinoma. The targets of miR-433 and miR-9 were tumor-associated proteins GRB2 and RAB34 respectively. This result provided the related information of miRNAs in gastric carcinoma.
LinkOut: [PMID: 19531230]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions SKOV3
Disease MIMAT0000441
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... "Using dual luciferase reporter assay ...

- Li X; Lu Y; Chen Y; Lu W; Xie X, 2013, BMC cancer.

Article - Li X; Lu Y; Chen Y; Lu W; Xie X
- BMC cancer, 2013
BACKGROUND: To assess the feasibility of validating microRNA (miRNA) profile related to paclitaxel-sensitivity in formalin-fixed paraffin-embedded (FFPE) samples of serous ovarian carcinoma (OC) patients. METHODS: Deregulated miRNAs identified by miRNA microarray were further detected in 45 FFPE OC samples using Realtime PCR. Correlations between paired FFPE and frozen tumor samples were analyzed. Survival times were compared between 6 high and low miRNAs groups. Western blot and luciferase reporter assay were used for validating the target of miRNA. RESULTS: Sixteen up-regulated miRNAs and twenty-three down-regulated miRNAs were revealed in pacilitaxel-resistant ST30 cells. The up-regulated miRNAs (miR-320a, 22 and 129-5p) and down-regulated miRNAs (miR-9, 155 and 640) were confirmed in paclitaxel-resistant FFPE tumor samples, compared with paclitaxel-sensitive samples. Higher miR-9 and miR-640 showed better survival time in OC patients. Expressions of miR-9, 155 and 22 in FFPE samples were closely mimicked by those in frozen tissues. RAB34 was validated as a direct target of miR-9. CONCLUSIONS: We validated miRNA profile in pacilitaxel-resistant OC using FFPE samples, which might enable treatment stratification and help us to predict outcomes in OC patients. FFPE samples are feasible materials for miRNA research.
LinkOut: [PMID: 23627607]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer -0.684 1.1e-4 -0.713 4.6e-5 24 Click to see details
GSE42095 Differentiated embryonic stem cells 0.626 7.0e-4 0.592 1.5e-3 23 Click to see details
GSE17306 Multiple myeloma -0.385 3.2e-3 -0.137 1.7e-1 49 Click to see details
GSE26953 Aortic valvular endothelial cells 0.516 4.9e-3 0.491 7.4e-3 24 Click to see details
GSE19783 ER- ER- breast cancer -0.259 1.1e-2 -0.337 1.2e-3 79 Click to see details
GSE19536 Breast cancer -0.215 1.6e-2 -0.322 5.8e-4 99 Click to see details
GSE21687 Ependynoma primary tumors -0.247 2.5e-2 -0.313 5.9e-3 64 Click to see details
GSE32688 Pancreatic cancer 0.323 3.6e-2 0.322 3.6e-2 32 Click to see details
GSE19783 ER+ ER+ breast cancer 0.387 4.6e-2 0.308 9.3e-2 20 Click to see details
GSE27834 Pluripotent stem cells 0.394 6.6e-2 0.382 7.2e-2 16 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.504 8.3e-2 -0.350 1.8e-1 9 Click to see details
GSE28260 Renal cortex and medulla -0.38 1.0e-1 -0.308 1.5e-1 13 Click to see details
GSE14794 Lymphoblastoid cells -0.1 1.7e-1 -0.113 1.4e-1 90 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.188 1.8e-1 0.211 1.6e-1 25 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.16 2.5e-1 0.012 4.8e-1 20 Click to see details
GSE19350 CNS germ cell tumors -0.169 3.0e-1 -0.002 5.0e-1 12 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.093 3.3e-1 0.184 1.9e-1 25 Click to see details
GSE38226 Liver fibrosis -0.038 4.4e-1 -0.281 1.1e-1 21 Click to see details
GSE38226 Liver fibrosis -0.038 4.4e-1 -0.281 1.1e-1 21 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRC 0.309 0.01 0.286 0.01 68 Click to see details
HNSC 0.376 0.01 0.384 0.01 42 Click to see details
UCEC -0.518 0.01 -0.691 0 19 Click to see details
ESCA 0.669 0.01 0.409 0.11 11 Click to see details
CHOL 0.693 0.02 0.550 0.06 9 Click to see details
BRCA -0.203 0.03 -0.229 0.02 84 Click to see details
THCA -0.236 0.04 -0.127 0.17 59 Click to see details
LUAD -0.507 0.05 -0.657 0.01 12 Click to see details
KIRP 0.285 0.06 0.113 0.27 32 Click to see details
PRAD -0.167 0.12 -0.087 0.27 50 Click to see details
CESC -0.917 0.13 -1.000 0.5 3 Click to see details
PAAD -0.632 0.18 -0.400 0.3 4 Click to see details
BLCA -0.165 0.26 -0.428 0.04 18 Click to see details
STAD 0.118 0.26 0.036 0.42 32 Click to see details
COAD 0.16 0.35 0.476 0.12 8 Click to see details
LUSC 0.046 0.39 0.086 0.3 38 Click to see details
LIHC -0.027 0.43 -0.052 0.36 49 Click to see details
PCPG -0.14 0.46 -0.500 0.33 3 Click to see details
KICH 0.023 0.46 0.021 0.46 25 Click to see details
KICH 0.023 0.46 0.021 0.46 25 Click to see details
KICH 0.023 0.46 0.021 0.46 25 Click to see details
329 hsa-miR-9-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000025 MMP13 matrix metallopeptidase 13 2 1
MIRT000026 REST RE1 silencing transcription factor 3 2
MIRT000029 CDH1 cadherin 1 4 3
MIRT000639 POU2F2 POU class 2 homeobox 2 2 1
MIRT000640 BCL6 B-cell CLL/lymphoma 6 2 1
MIRT000641 ETS1 ETS proto-oncogene 1, transcription factor 3 2
MIRT001202 RAB34 RAB34, member RAS oncogene family 5 2
MIRT001736 BACE1 beta-secretase 1 2 1
MIRT001937 PRDM1 PR/SET domain 1 4 3
MIRT003193 NFKB1 nuclear factor kappa B subunit 1 4 7
MIRT003300 FOXO1 forkhead box O1 4 2
MIRT003323 NTRK3 neurotrophic receptor tyrosine kinase 3 3 5
MIRT004982 NR2E1 nuclear receptor subfamily 2 group E member 1 4 1
MIRT005390 ONECUT2 one cut homeobox 2 5 2
MIRT005783 CDX2 caudal type homeobox 2 2 1
MIRT006781 AP3B1 adaptor related protein complex 3 beta 1 subunit 4 1
MIRT006782 CCNG1 cyclin G1 4 2
MIRT006833 SRF serum response factor 2 1
MIRT006892 SIRT1 sirtuin 1 3 2
MIRT006894 TGFBI transforming growth factor beta induced 1 1
MIRT007035 SOCS5 suppressor of cytokine signaling 5 3 2
MIRT007060 ID2 inhibitor of DNA binding 2, HLH protein 2 1
MIRT007326 FOXO3 forkhead box O3 3 1
MIRT007372 CCND1 cyclin D1 1 1
MIRT021318 KLRC1 killer cell lectin like receptor C1 1 1
MIRT021319 DSP desmoplakin 1 1
MIRT021320 POGZ pogo transposable element derived with ZNF domain 1 1
MIRT021321 CCL19 C-C motif chemokine ligand 19 1 1
MIRT021322 EFNA1 ephrin A1 1 1
MIRT021323 SMARCA1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1 1 1
MIRT021324 NRIP3 nuclear receptor interacting protein 3 1 1
MIRT021325 MYF6 myogenic factor 6 1 1
MIRT021326 LRP1 LDL receptor related protein 1 1 1
MIRT021327 SLC35E2 solute carrier family 35 member E2 1 1
MIRT021328 HOXC12 homeobox C12 1 1
MIRT021329 SYNE1 spectrin repeat containing nuclear envelope protein 1 1 1
MIRT021330 STK3 serine/threonine kinase 3 1 1
MIRT021331 SLC7A2 solute carrier family 7 member 2 1 1
MIRT021332 PLEKHB1 pleckstrin homology domain containing B1 1 1
MIRT021333 RASSF8 Ras association domain family member 8 1 1
MIRT021334 PELP1 proline, glutamate and leucine rich protein 1 1 1
MIRT021335 ATG10 autophagy related 10 1 1
MIRT021336 SPTBN1 spectrin beta, non-erythrocytic 1 1 1
MIRT021337 C7orf31 chromosome 7 open reading frame 31 1 1
MIRT021338 CMTM2 CKLF like MARVEL transmembrane domain containing 2 1 1
MIRT021339 CERS4 ceramide synthase 4 1 1
MIRT021340 PPAP2A phospholipid phosphatase 1 1 1
MIRT021341 KCNJ15 potassium voltage-gated channel subfamily J member 15 1 1
MIRT021342 SUMF2 sulfatase modifying factor 2 1 1
MIRT021343 UGDH UDP-glucose 6-dehydrogenase 1 1
MIRT021344 CXXC5 CXXC finger protein 5 1 1
MIRT021345 TCL1B T-cell leukemia/lymphoma 1B 1 1
MIRT021346 EP300 E1A binding protein p300 1 1
MIRT021347 AUH AU RNA binding methylglutaconyl-CoA hydratase 1 1
MIRT021348 TRRAP transformation/transcription domain associated protein 1 1
MIRT021349 DMXL1 Dmx like 1 1 1
MIRT021350 EOGT EGF domain specific O-linked N-acetylglucosamine transferase 1 1
MIRT021351 RCC2 regulator of chromosome condensation 2 1 1
MIRT021352 PIGB phosphatidylinositol glycan anchor biosynthesis class B 1 1
MIRT021353 NAV1 neuron navigator 1 1 1
MIRT021354 ATP6V1C2 ATPase H+ transporting V1 subunit C2 1 1
MIRT021355 PLCB4 phospholipase C beta 4 1 1
MIRT021356 IGF2R insulin like growth factor 2 receptor 1 1
MIRT021357 MDM4 MDM4, p53 regulator 1 1
MIRT021358 AVIL advillin 1 1
MIRT021359 APBB2 amyloid beta precursor protein binding family B member 2 1 1
MIRT021360 CA13 carbonic anhydrase 13 1 1
MIRT021361 FLNB filamin B 1 1
MIRT021362 IREB2 iron responsive element binding protein 2 1 1
MIRT021363 KLRK1 killer cell lectin like receptor K1 1 1
MIRT021364 CDH3 cadherin 3 1 1
MIRT021365 MCC mutated in colorectal cancers 1 1
MIRT021366 SYNE2 spectrin repeat containing nuclear envelope protein 2 1 1
MIRT021367 MAP1B microtubule associated protein 1B 1 1
MIRT021368 NFATC3 nuclear factor of activated T-cells 3 1 1
MIRT021369 SPAG9 sperm associated antigen 9 1 1
MIRT021370 ZNF407 zinc finger protein 407 1 1
MIRT021371 SEC23IP SEC23 interacting protein 1 1
MIRT021372 NBEA neurobeachin 1 1
MIRT021373 SLC2A5 solute carrier family 2 member 5 1 1
MIRT021374 PQLC3 PQ loop repeat containing 3 1 1
MIRT021375 C9orf89 caspase recruitment domain family member 19 1 1
MIRT021376 NCOR2 nuclear receptor corepressor 2 1 1
MIRT021377 P4HA2 prolyl 4-hydroxylase subunit alpha 2 1 1
MIRT021378 MYLK myosin light chain kinase 1 1
MIRT021379 NIN ninein 1 1
MIRT021380 FERMT1 fermitin family member 1 1 1
MIRT021381 PRKD3 protein kinase D3 1 1
MIRT021382 SYAP1 synapse associated protein 1 3 3
MIRT021383 TRPM7 transient receptor potential cation channel subfamily M member 7 1 1
MIRT021384 GPBP1L1 GC-rich promoter binding protein 1 like 1 1 1
MIRT021385 UHMK1 U2AF homology motif kinase 1 1 1
MIRT021386 SLC39A14 solute carrier family 39 member 14 1 1
MIRT021387 SNX7 sorting nexin 7 1 1
MIRT021388 LMNA lamin A/C 1 1
MIRT021389 FBN2 fibrillin 2 1 1
MIRT021390 PXDN peroxidasin 1 1
MIRT021391 TBPL1 TATA-box binding protein like 1 1 1
MIRT021392 NIPA1 non imprinted in Prader-Willi/Angelman syndrome 1 1 1
MIRT021393 FAIM Fas apoptotic inhibitory molecule 1 1
MIRT021394 KMT2D lysine methyltransferase 2D 1 1
MIRT021395 VIM vimentin 1 1
MIRT021396 CHSY1 chondroitin sulfate synthase 1 1 1
MIRT021397 XRN2 5'-3' exoribonuclease 2 1 1
MIRT021398 HIST1H4H histone cluster 1 H4 family member h 2 6
MIRT021399 TWISTNB TWIST neighbor 2 2
MIRT021400 ZBED3 zinc finger BED-type containing 3 3 3
MIRT021401 VEGFA vascular endothelial growth factor A 2 1
MIRT021402 CHMP2B charged multivesicular body protein 2B 2 1
MIRT021403 STMN1 stathmin 1 3 2
MIRT021404 GRN granulin precursor 1 1
MIRT021405 TTC7B tetratricopeptide repeat domain 7B 1 1
MIRT021406 TAGLN transgelin 1 1
MIRT021407 EFCAB14 EF-hand calcium binding domain 14 1 1
MIRT021408 FSTL3 follistatin like 3 1 1
MIRT021409 BIK BCL2 interacting killer 1 1
MIRT021410 SPI1 Spi-1 proto-oncogene 1 1
MIRT021411 HLA-A major histocompatibility complex, class I, A 1 1
MIRT021412 CALML5 calmodulin like 5 1 1
MIRT021413 HTR3A 5-hydroxytryptamine receptor 3A 1 1
MIRT021414 F2 coagulation factor II, thrombin 1 1
MIRT021415 LPXN leupaxin 1 1
MIRT021416 LINC00483 long intergenic non-protein coding RNA 483 1 1
MIRT021417 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT021418 MTX3 metaxin 3 1 1
MIRT021419 AKR1CL1 aldo-keto reductase family 1 member C8, pseudogene 1 1
MIRT021420 IDS iduronate 2-sulfatase 1 1
MIRT021421 ELF3 E74 like ETS transcription factor 3 1 1
MIRT021422 GNAT2 G protein subunit alpha transducin 2 1 1
MIRT021423 SLC30A4 solute carrier family 30 member 4 1 1
MIRT021424 IPO7 importin 7 1 1
MIRT021425 WNT8A Wnt family member 8A 1 1
MIRT021426 GIP gastric inhibitory polypeptide 1 1
MIRT021427 SLC22A5 solute carrier family 22 member 5 1 1
MIRT021428 SPON2 spondin 2 1 1
MIRT021429 MAGEA2B MAGE family member A2B 1 1
MIRT021430 ATL1 atlastin GTPase 1 1 1
MIRT021431 RHOV ras homolog family member V 1 1
MIRT021432 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT021433 LRRTM1 leucine rich repeat transmembrane neuronal 1 1 1
MIRT021434 WNT6 Wnt family member 6 1 1
MIRT021435 NKX2-2 NK2 homeobox 2 1 1
MIRT021436 SLC25A30 solute carrier family 25 member 30 1 1
MIRT021437 CUEDC1 CUE domain containing 1 1 1
MIRT021438 ALDH1A3 aldehyde dehydrogenase 1 family member A3 1 1
MIRT021439 MN1 MN1 proto-oncogene, transcriptional regulator 1 1
MIRT021440 ABCC1 ATP binding cassette subfamily C member 1 1 1
MIRT021441 SLC22A3 solute carrier family 22 member 3 1 1
MIRT021442 AKR1B10 aldo-keto reductase family 1 member B10 1 1
MIRT021443 KIF1B kinesin family member 1B 1 1
MIRT021444 E2F7 E2F transcription factor 7 1 1
MIRT021445 HN1L Jupiter microtubule associated homolog 2 1 1
MIRT021446 SNHG16 small nucleolar RNA host gene 16 1 1
MIRT021447 CYP39A1 cytochrome P450 family 39 subfamily A member 1 1 1
MIRT021448 MORF4L1 mortality factor 4 like 1 1 1
MIRT021449 ARHGEF10 Rho guanine nucleotide exchange factor 10 1 1
MIRT021450 RABGAP1 RAB GTPase activating protein 1 1 1
MIRT021451 TBC1D9 TBC1 domain family member 9 1 1
MIRT021452 ATP11C ATPase phospholipid transporting 11C 1 1
MIRT021453 FRMD4B FERM domain containing 4B 1 1
MIRT021454 SNAI2 snail family transcriptional repressor 2 1 1
MIRT021455 OPTN optineurin 1 1
MIRT021456 FNBP1 formin binding protein 1 1 1
MIRT021457 PTPRK protein tyrosine phosphatase, receptor type K 1 1
MIRT021459 SDC1 syndecan 1 1 1
MIRT021460 EEF2K eukaryotic elongation factor 2 kinase 1 1
MIRT021461 ATP7A ATPase copper transporting alpha 1 1
MIRT021462 CERS2 ceramide synthase 2 1 1
MIRT021463 ACADSB acyl-CoA dehydrogenase, short/branched chain 1 1
MIRT021464 COL12A1 collagen type XII alpha 1 chain 1 1
MIRT021465 PDZK1 PDZ domain containing 1 1 1
MIRT021466 CAPZA1 capping actin protein of muscle Z-line alpha subunit 1 1 1
MIRT021467 PPP4R2 protein phosphatase 4 regulatory subunit 2 1 1
MIRT021468 SERAC1 serine active site containing 1 1 1
MIRT021469 TESK2 testis-specific kinase 2 1 1
MIRT021470 LDLRAP1 low density lipoprotein receptor adaptor protein 1 1 1
MIRT021471 MYH9 myosin heavy chain 9 3 3
MIRT021472 KLF5 Kruppel like factor 5 1 1
MIRT021473 FAM46A family with sequence similarity 46 member A 1 1
MIRT021474 CCNDBP1 cyclin D1 binding protein 1 1 1
MIRT021475 RBFOX2 RNA binding protein, fox-1 homolog 2 1 1
MIRT021476 MAP3K3 mitogen-activated protein kinase kinase kinase 3 1 1
MIRT021477 POU2F1 POU class 2 homeobox 1 1 1
MIRT021478 SYNGR2 synaptogyrin 2 2 2
MIRT021479 SYPL1 synaptophysin like 1 1 1
MIRT021480 GFOD1 glucose-fructose oxidoreductase domain containing 1 1 1
MIRT021481 RNF44 ring finger protein 44 1 1
MIRT021482 TC2N tandem C2 domains, nuclear 1 1
MIRT021483 COLEC12 collectin subfamily member 12 1 1
MIRT021484 ID4 inhibitor of DNA binding 4, HLH protein 1 1
MIRT021485 CNOT6 CCR4-NOT transcription complex subunit 6 1 1
MIRT021486 CD34 CD34 molecule 1 1
MIRT021487 MESDC1 talin rod domain containing 1 1 1
MIRT045780 BOD1L1 biorientation of chromosomes in cell division 1 like 1 1 1
MIRT045781 ITGB3BP integrin subunit beta 3 binding protein 1 1
MIRT045782 QARS glutaminyl-tRNA synthetase 1 1
MIRT045783 KIF1A kinesin family member 1A 1 1
MIRT053098 PPARA peroxisome proliferator activated receptor alpha 1 1
MIRT053115 PRTG protogenin 1 1
MIRT053212 KLF17 Kruppel like factor 17 2 1
MIRT053357 CPEB4 cytoplasmic polyadenylation element binding protein 4 2 1
MIRT053358 CYFIP2 cytoplasmic FMR1 interacting protein 2 2 1
MIRT053359 ENDOD1 endonuclease domain containing 1 2 1
MIRT053360 HBP1 HMG-box transcription factor 1 2 1
MIRT053361 JAK1 Janus kinase 1 2 1
MIRT053362 KLF6 Kruppel like factor 6 2 1
MIRT053363 LHFPL2 LHFPL tetraspan subfamily member 2 2 1
MIRT053364 MAP3K8 mitogen-activated protein kinase kinase kinase 8 2 1
MIRT053365 RAB8B RAB8B, member RAS oncogene family 2 1
MIRT053366 RHAG Rh-associated glycoprotein 2 1
MIRT053367 RHOH ras homolog family member H 2 1
MIRT053368 RYBP RING1 and YY1 binding protein 2 1
MIRT053369 SERPINB9 serpin family B member 9 2 1
MIRT053370 TAL1 TAL bHLH transcription factor 1, erythroid differentiation factor 2 1
MIRT053371 TFRC transferrin receptor 2 1
MIRT053372 TRAK2 trafficking kinesin protein 2 2 1
MIRT053373 VAMP5 vesicle associated membrane protein 5 2 1
MIRT053481 MMP2 matrix metallopeptidase 2 1 1
MIRT053482 MMP9 matrix metallopeptidase 9 1 1
MIRT053793 CREB1 cAMP responsive element binding protein 1 3 1
MIRT053794 NF1 neurofibromin 1 3 1
MIRT054041 ELAVL1 ELAV like RNA binding protein 1 3 1
MIRT054042 DICER1 dicer 1, ribonuclease III 5 3
MIRT054196 MALAT1 metastasis associated lung adenocarcinoma transcript 1 (non-protein coding) 4 1
MIRT054369 Cthrc1 collagen triple helix repeat containing 1 3 1
MIRT054715 CXCR4 C-X-C motif chemokine receptor 4 3 3
MIRT054798 FOXP1 forkhead box P1 3 1
MIRT100125 HIST1H2AI histone cluster 1 H2A family member i 2 6
MIRT251627 KCNJ2 potassium voltage-gated channel subfamily J member 2 2 2
MIRT303632 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 4 3
MIRT437375 PRTG protogenin 3 1
MIRT437469 ACAT1 acetyl-CoA acetyltransferase 1 3 1
MIRT437956 HDAC4 histone deacetylase 4 1 1
MIRT437986 DRD2 dopamine receptor D2 1 1
MIRT438117 MIRLET7D microRNA let-7d 1 1
MIRT438536 TGFBR2 transforming growth factor beta receptor 2 3 2
MIRT438746 MTHFD1 methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1 3 1
MIRT438753 BCL2L11 BCL2 like 11 3 1
MIRT442709 UBE4B ubiquitination factor E4B 2 2
MIRT442743 SERINC5 serine incorporator 5 2 2
MIRT444344 GALNTL6 polypeptide N-acetylgalactosaminyltransferase like 6 2 2
MIRT445645 NPY4R neuropeptide Y receptor Y4 2 2
MIRT447217 ATXN7 ataxin 7 2 2
MIRT468282 SFT2D2 SFT2 domain containing 2 2 2
MIRT468533 SERPINH1 serpin family H member 1 2 2
MIRT482004 AMOTL1 angiomotin like 1 2 12
MIRT485305 NFAT5 nuclear factor of activated T-cells 5 2 6
MIRT492094 TAOK1 TAO kinase 1 2 6
MIRT493465 IPPK inositol-pentakisphosphate 2-kinase 2 4
MIRT493883 FAM73B mitoguardin 2 2 4
MIRT497210 CDH7 cadherin 7 2 2
MIRT507388 EN2 engrailed homeobox 2 2 4
MIRT511642 HIST1H3F histone cluster 1 H3 family member f 2 4
MIRT511782 HIST1H2AE histone cluster 1 H2A family member e 2 4
MIRT513555 IL5 interleukin 5 2 2
MIRT517439 HIST2H2AC histone cluster 2 H2A family member c 2 2
MIRT526994 ARL8B ADP ribosylation factor like GTPase 8B 2 2
MIRT530210 NSUN7 NOP2/Sun RNA methyltransferase family member 7 2 2
MIRT534703 RNF103-CHMP3 RNF103-CHMP3 readthrough 2 4
MIRT538532 CHMP3 charged multivesicular body protein 3 2 4
MIRT547741 KIAA1468 KIAA1468 2 2
MIRT548083 GIGYF1 GRB10 interacting GYF protein 1 2 2
MIRT553524 TMEM245 transmembrane protein 245 2 4
MIRT555487 PNRC2 proline rich nuclear receptor coactivator 2 2 2
MIRT558992 CA8 carbonic anhydrase 8 2 2
MIRT609369 SOD2 superoxide dismutase 2 2 2
MIRT609845 ZNF557 zinc finger protein 557 2 2
MIRT610639 PIGM phosphatidylinositol glycan anchor biosynthesis class M 2 2
MIRT620230 PACS1 phosphofurin acidic cluster sorting protein 1 2 2
MIRT622432 NUDT19 nudix hydrolase 19 2 2
MIRT624367 CDK12 cyclin dependent kinase 12 2 2
MIRT624796 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 2 2
MIRT626462 CMKLR1 chemerin chemokine-like receptor 1 2 2
MIRT626610 ACAA2 acetyl-CoA acyltransferase 2 2 4
MIRT629750 SCD5 stearoyl-CoA desaturase 5 2 2
MIRT630036 MTL5 testis expressed metallothionein like protein 2 2
MIRT634055 NUP155 nucleoporin 155 2 2
MIRT637896 SLC19A3 solute carrier family 19 member 3 2 2
MIRT640384 EMC1 ER membrane protein complex subunit 1 2 4
MIRT641973 PCMTD2 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 2 2
MIRT643403 PAX1 paired box 1 2 2
MIRT645378 MKX mohawk homeobox 2 2
MIRT646920 TRIM14 tripartite motif containing 14 2 2
MIRT649452 WDR70 WD repeat domain 70 2 2
MIRT650621 UMPS uridine monophosphate synthetase 2 2
MIRT651245 ZMAT4 zinc finger matrin-type 4 2 2
MIRT653306 SMU1 DNA replication regulator and spliceosomal factor 2 2
MIRT653594 SLC35B3 solute carrier family 35 member B3 2 2
MIRT655095 PI4K2A phosphatidylinositol 4-kinase type 2 alpha 2 2
MIRT656624 LRRC15 leucine rich repeat containing 15 2 2
MIRT656891 KIF1C kinesin family member 1C 2 2
MIRT658522 ESR1 estrogen receptor 1 5 2
MIRT660676 ANKFY1 ankyrin repeat and FYVE domain containing 1 2 2
MIRT663674 TMEM216 transmembrane protein 216 2 2
MIRT679093 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT682590 CPA4 carboxypeptidase A4 2 2
MIRT690125 ZFAND1 zinc finger AN1-type containing 1 2 2
MIRT704058 EDEM3 ER degradation enhancing alpha-mannosidase like protein 3 2 2
MIRT705652 ANP32B acidic nuclear phosphoprotein 32 family member B 2 2
MIRT707304 PRRX1 paired related homeobox 1 2 2
MIRT711360 VPS8 VPS8, CORVET complex subunit 2 2
MIRT712224 RNF146 ring finger protein 146 2 2
MIRT719696 STX6 syntaxin 6 2 2
MIRT722385 TRMT13 tRNA methyltransferase 13 homolog 2 2
MIRT723019 MSR1 macrophage scavenger receptor 1 2 2
MIRT723398 OAF out at first homolog 2 2
MIRT731146 ATG5 autophagy related 5 1 1
MIRT731304 CUL4A cullin 4A 3 1
MIRT731346 IL6 interleukin 6 2 1
MIRT731560 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT731562 PDGFRB platelet derived growth factor receptor beta 1 1
MIRT731820 NRP1 neuropilin 1 3 1
MIRT731992 IGF2BP1 insulin like growth factor 2 mRNA binding protein 1 3 1
MIRT732216 BCL2 BCL2, apoptosis regulator 2 1
MIRT732359 SOX7 SRY-box 7 3 1
MIRT732970 ADIPOQ adiponectin, C1Q and collagen domain containing 3 0
MIRT732971 TUG1 taurine up-regulated 1 (non-protein coding) 3 0
MIRT735865 KRAS KRAS proto-oncogene, GTPase 1 0
MIRT736698 PTEN phosphatase and tensin homolog 3 0
MIRT736828 THBS2 thrombospondin 2 2 0
MIRT737142 EIF5A2 eukaryotic translation initiation factor 5A2 3 0
MIRT755614 SHMT1 serine hydroxymethyltransferase 1 2 1
MIRT755615 KCNMA1 potassium calcium-activated channel subfamily M alpha 1 1 1
MIRT755618 MTHFD1L methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1 like 2 1
MIRT755732 Pdgfrb platelet derived growth factor receptor beta 2 1
MIRT755979 TLR4 toll-like receptor 4 3 1
MIRT756027 CPEB3 cytoplasmic polyadenylation element binding protein 3 5 1
MIRT756101 DACT3 dishevelled binding antagonist of beta catenin 3 3 1
MIRT756215 TOP2B DNA topoisomerase II beta 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-9 Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-9 Ethanol NULL 702 Microarray fetal mouse brains 19091803 2009 up-regulated
miR-9 Atorvastatin approved 60823 Quantitative real-time PCR Cardiomyocyte 23860036 2013 down-regualted
miR-9 Ethanol NULL 702 Quantitative real-time PCR Cerebellar Granule Neurons cells 24554719 2014 down-regulated
miR-9 Glucose NULL 5793 Microarray endothelial cells 24394957 2014 up-regulated
miR-9 Iron-sulfates and Aluminum-sulfates NULL NULL Northern blot human neural cells 17629564 2007 up-regulated
miR-9 17beta-estradiol (E2) approved 5757 Microarray MCF-7 breast cancer cells 19528081 2009 down-regulated
miR-9 N-(4-hydroxyphenyl)-retinamide (4HPR) NULL 5288209 Quantitative real-time PCR human retinal pigment epithelial (ARPE-19) cells 20806079 2010 up-regulated
miR-9 Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-9 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-9 Sulindac sulfide approved 5352624 Quantitative real-time PCR HCT116 colon tumor cells 22286762 2012 down-regulated
miR-9 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-9 Bicalutamide approved 2375 Microarray prostate 22674191 2012 down-regulated
miR-9 Goserelin approved 47725 Microarray prostate 22674191 2012 down-regulated
miR-9 Temozolomide approved 5394 Quantitative real-time PCR glioblastoma cells. 22722712 2012 down-regulated
miR-9 All-trans-retinoic acid (ATRA) approved 444795 Northern blot spina bifida rat fetus 17962954 2007 down-regulated
miR-9 Longevinex NULL NULL Quantitative real-time PCR ischemia/reperfusion [I/R] rat model 21203465 2011 down-regulated
miR-9 Longevinex NULL NULL Quantitative real-time PCR normal heart 21203465 2011 up-regulated
miR-9 Resveratrol NULL 445154 Quantitative real-time PCR ischemia/reperfusion [I/R] rat model 21203465 2011 down-regulated
miR-9 Resveratrol NULL 445154 Quantitative real-time PCR normal heart 21203465 2011 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-9-5p (11E)-11-(2-aminoethylidene)-15,16-dimethoxy-20-methyl-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaen-19-one 11452147 NSC725665 sensitive
hsa-miR-9-5p (1r,2s,6e,10s,11r,13s,17r)-11-hydroxy-2,6,10-trimethyl-14-methylidene-16,18-dioxatricyclo[8.6.2.013,17]octadec-6-en-15-one 5469628 NSC690970 resistant
hsa-miR-9-5p (1S,2R,6S)-1,4,10,12-tetraphenyl-4,8,10,11-tetrazatricyclo[6.4.0.02,6]dodec-11-ene-3,5-dione 394280 NSC697646 resistant
hsa-miR-9-5p (1S,2S,4R,7Z,11S)-4,8-dimethyl-12-methylidene-3,14-dioxatricyclo[9.3.0.02,4]tetradec-7-ene-9,13-dione 5459262 NSC672120 resistant
hsa-miR-9-5p (2s,3s,7as)-3-hydroxy-2-[(e)-prop-1-enyl]-2,3,7,7a-tetrahydrofuro[3,4-b]pyran-5-one 24202877 NSC726146 resistant
hsa-miR-9-5p (3-hydroxy-4-methoxyphenyl)-(7-methoxy-1,3-benzodioxol-5-yl)methanone 46949031 NSC758027 sensitive
hsa-miR-9-5p (3E)-3,4-dichloro-2,4-dinitro-1-N,1-N'-diphenylbuta-1,3-diene-1,1-diamine 5470211 NSC698398 resistant
hsa-miR-9-5p (3e)-4-chloro-3-[(6-chloro-2-methylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1h-indol-2-one 5471424 NSC711079 sensitive
hsa-miR-9-5p (3r,3as)-3-phenyl-3a,4-dihydrochromeno[4,3-c]pyrazole-2(3h)-carboxamide 374676 NSC652810 sensitive
hsa-miR-9-5p (3R,5R)-3,5-bis(4-methylphenyl)spiro[cyclohexane-4,2'-indene]-1,1',3'-trione 385845 NSC677244 sensitive
hsa-miR-9-5p (3z)-1-(2,6-dichlorophenyl)-3-[(4-hydroxy-3,5-dimethoxyphenyl)methylidene]indol-2-one 60147866 NSC752703 sensitive
hsa-miR-9-5p (3z)-3-[(2,6-dimethylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-5-hydroxy-1-methylindol-2-one 24205836 NSC736818 sensitive
hsa-miR-9-5p (5E)-2-benzyl-2-[(dimethylamino)methyl]-5-[(2-methoxyphenyl)methylidene]cyclopentan-1-one;hydrochloride 6516829 NSC639521 sensitive
hsa-miR-9-5p (7-acetamido-2-acetyloxy-1-methoxy-10-methylsulfanyl-9-oxo-6,7-dihydro-5H-benzo[a]heptalen-3-yl) acetate 435732 NSC374980 sensitive
hsa-miR-9-5p (e)-1-(2,4-dimethoxyphenyl)-3-(2,4,6-trimethoxyphenyl)prop-2-en-1-one 16753966 NSC751956 sensitive
hsa-miR-9-5p (E)-1-[4-(quinazolin-4-ylamino)phenyl]-3-(2,4,6-trimethoxyphenyl)prop-2-en-1-one 155816064 NSC760015 sensitive
hsa-miR-9-5p (Z)-(2,4-dinitrophenoxy)imino-oxido-(4-phenylmethoxycarbonylpiperazin-1-yl)azanium 11626484 NSC731700 resistant
hsa-miR-9-5p (Z)-(4-butoxycarbonylpiperazin-1-yl)-(2,4-dinitrophenoxy)imino-oxidoazanium 11495269 NSC731701 resistant
hsa-miR-9-5p .alpha.-chloro-n-(p-methoxyphenyl)succinimide 99724 NSC191909 resistant
hsa-miR-9-5p [(3s,8r,10r,13s,17e)-10,13-dimethyl-17-(phenylcarbamoyloxyimino)-1,2,3,4,7,8,9,11,12,14,15,16-dodecahydrocyclopenta[a]phenanthren-3-yl] n-phenylcarbamate 9569960 NSC629229 resistant
hsa-miR-9-5p [(5r,9e,14s,15r,15ar)-5-hydroxy-10,14-dimethyl-3,6-dimethylidene-2-oxo-4,5,7,8,11,12,13,14,15,15a-decahydro-3ah-cyclotetradeca[b]furan-15-yl] acetate 24204960 NSC733752 resistant
hsa-miR-9-5p [(8R,9S,10R,13S,14S,17S)-13-methyl-3-oxo-2,6,7,8,9,10,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-17-yl] N-(2-chloroethyl)-N-nitrosocarbamate 320801 NSC269719 sensitive
hsa-miR-9-5p [(E)-(1-chloro-2-methylpropylidene)amino] N-(4-cyanophenyl)carbamate 5466030 NSC672058 resistant
hsa-miR-9-5p [(E)-1-chloropropylideneamino] N-(4-methoxyphenyl)carbamate 5466263 NSC682833 resistant
hsa-miR-9-5p [(Z)-(1-chloro-2-methylpropylidene)amino] N-(5-fluoro-2-methylphenyl)carbamate 9556257 NSC682835 resistant
hsa-miR-9-5p [1-[[[2-amino-6-chloro-5-[(4-chlorophenyl)diazenyl]pyrimidin-4-yl]amino]methyl]-3-phenylmethoxycyclobutyl]methanol 385284 NSC676395 resistant
hsa-miR-9-5p [1-[[[2-amino-6-chloro-5-[(4-chlorophenyl)diazenyl]pyrimidin-4-yl]amino]methyl]-3-phenylmethoxycyclobutyl]methanol 385284 NSC676395 resistant
hsa-miR-9-5p [3-[(2e,4e,6e,8e)-3,7-dimethyl-9-(2,6,6-trimethylcyclohexen-1-yl)nona-2,4,6,8-tetraenoyl]oxy-5-(5-fluoro-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methyl (2e,4e,6e,8e)-3,7-dimethyl-9-(2,6,6-trimethylcyclohe 5468409 NSC669728 sensitive
hsa-miR-9-5p [4-amino-2-[(4-chlorophenyl)amino]thiazol-5-yl]-(4-methoxyphenyl)methanone 399621 NSC710530 sensitive
hsa-miR-9-5p 1-(2,5,8,11,14,17-hexaoxabicyclo[16.4.0]docosa-1(18),19,21-trien-20-yl)prop-2-en-1-one 375484 NSC655266 resistant
hsa-miR-9-5p 1-(3-chlorophenyl)-2-hexyl-2h-1,3,5-triazine-4,6-diamine;hydrochloride 24180956 NSC3083 sensitive
hsa-miR-9-5p 1-(benzylsulfinyl)-2,4-dinitrobenzene 275684 NSC122656 resistant
hsa-miR-9-5p 1-[(3E)-3,4-dichloro-2,4-dinitro-1-piperidin-1-ylbuta-1,3-dienyl]piperidine 3107921 NSC698394 resistant
hsa-miR-9-5p 1-[(e)-1,3-benzodioxol-5-ylmethylideneamino]-3-(2-chlorophenyl)urea 9572409 NSC715192 sensitive
hsa-miR-9-5p 1-[(Z)-2-cyano-1-pyrrolidin-1-ylethenyl]-3-phenylurea 5468918 NSC679095 sensitive
hsa-miR-9-5p 1-[[2-(2-chloroethyl)-4,5-dimethoxyphenyl]methyl]-6-methoxy-3,4-dihydroisoquinoline;hydrochloride 392600 NSC693142 resistant
hsa-miR-9-5p 1-[3-chloro-4-(4-phenylbutyl)phenyl]-6,6-dimethyl-1,3,5-triazine-2,4-diamine;hydrochloride 24191814 NSC128184 sensitive
hsa-miR-9-5p 1-[4-fluoro-3-(trifluoromethyl)phenyl]-6,6-dimethyl-1,3,5-triazine-2,4-diamine 425379 NSC173516 sensitive
hsa-miR-9-5p 1-adamantyl 4-[(3,6-dioxocyclohexa-1,4-dien-1-yl)methylamino]benzoate 387401 NSC681151 resistant
hsa-miR-9-5p 1-benzyl-3-[[5-(4-chlorophenyl)-7-(p-tolyl)pyrrolo[2,3-d]pyrimidin-4-yl]amino]thiourea 3001721 NSC667707 sensitive
hsa-miR-9-5p 10,16-bis[2-(dimethylamino)ethyl]-5-methoxy-1,9,10,16-tetrazapentacyclo[9.6.2.02,7.08,19.014,18]nonadeca-2(7),3,5,8,11(19),12,14(18)-heptaene-15,17-dione 399630 NSC710547 sensitive
hsa-miR-9-5p 11-hydroxyusambarine chlorhydrate 401426 NSC715082 sensitive
hsa-miR-9-5p 11,16-diphenyl-11,16-diazapentacyclo[6.5.5.02,7.09,13.014,18]octadeca-2,4,6-triene-10,12,15,17-tetrone 363087 NSC627652 sensitive
hsa-miR-9-5p 14-[2-(dimethylamino)ethyl]-n-[3-[3-[[14-[2-(dimethylamino)ethyl]-4-methoxy-8,14,15-triazatetracyclo[7.6.1.02,7.013,16]hexadeca-1(15),2(7),3,5,9,11,13(16)-heptaene-10-carbonyl]amino]propyl-methylamino 135426710 NSC710552 sensitive
hsa-miR-9-5p 16-methoxy-4-(4-methoxyphenyl)-9-propan-2-yl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 390916 NSC689137 sensitive
hsa-miR-9-5p 2-((2,7-dimethoxy-9-acridinyl)sulfinyl)-n,n-diethylethanamine 395392 NSC699928 resistant
hsa-miR-9-5p 2-(1-propynyl)-3,17.beta.-estradiol 388008 NSC682429 sensitive
hsa-miR-9-5p 2-(2-chlorophenyl)-3-[5-(1,2,4-triazol-4-ylmethyl)-1,3,4-oxadiazol-2-yl]-1,3-thiazolidin-4-one 45029357 NSC746513 sensitive
hsa-miR-9-5p 2-(2-hydroxyethyl)-8-phenyl-5,12,14-trioxa-2-azatetracyclo[7.7.0.03,7.011,15]hexadeca-1(16),3(7),9,11(15)-tetraen-6-one 50900736 NSC750211 sensitive
hsa-miR-9-5p 2-(naphthalen-2-yl)-1-(3,4,5-trimethoxyphenyl)-1h-imidazole 11559546 NSC736993 sensitive
hsa-miR-9-5p 2-[(e)-[2-chloro-6-(4-nitrophenyl)imidazo[2,1-b][1,3]thiazol-5-yl]methylideneamino]guanidine;hydrochloride 9572530 NSC720135 sensitive
hsa-miR-9-5p 2-[(e)-[6-(2,4-dichloro-5-nitrophenyl)-2,3-dihydroimidazo[2,1-b][1,3]thiazol-5-yl]methylideneamino]guanidine 16099260 NSC722867 sensitive
hsa-miR-9-5p 2-[(Z)-2-[3-[3-methoxy-5-(trifluoromethyl)phenyl]-1,2,4-triazol-1-yl]ethenyl]-1,3,4-oxadiazole 57524026 NSC757569 sensitive
hsa-miR-9-5p 2-[16-(3,4-dimethoxyphenyl)-12,14-diphenyl-10-oxa-3,5,6,8,12,13-hexazatetracyclo[7.7.0.02,6.011,15]hexadeca-1(9),2,4,7,11(15),13-hexaen-4-yl]acetonitrile 391834 NSC691421 resistant
hsa-miR-9-5p 2-[2-chloro-4-(4,6-diamino-2,2-dimethyl-1,3,5-triazin-1-yl)phenoxy]-1-morpholin-4-ylethanone;ethanesulfonic acid 284536 NSC140380 sensitive
hsa-miR-9-5p 2-amino-1-N,9-N-bis[10-[(4-hydroxyphenyl)methyl]-7,11,14-trimethyl-2,5,9,12,15-pentaoxo-3-propan-2-yl-8-oxa-1,4,11,14-tetrazabicyclo[14.3.0]nonadecan-6-yl]-4,6-dimethyl-3-oxophenoxazine-1,9-dicarboxamide 16129921 NSC684901 sensitive
hsa-miR-9-5p 2-ethylaminoestradiol 384235 NSC673652 sensitive
hsa-miR-9-5p 2-methoxy-4-(3,4,5-trimethoxybenzyl)phenol 368064 NSC638388 sensitive
hsa-miR-9-5p 2-methylthieno[3,2-f][1]benzothiole-4,8-dione 375901 NSC656238 sensitive
hsa-miR-9-5p 2-methylthio-1,4-naphthoquinone 96324 NSC67209 resistant
hsa-miR-9-5p 2,3-bis(4,5-dimethyl-3,6-dioxo-cyclohexa-1,4-dien-1-yl)-5,6-dimethyl-1,4-benzoquinone 394545 NSC698090 resistant
hsa-miR-9-5p 2,3-dichloro-5,6,7,8-tetrahydronaphthalene-1,4-diol 320303 NSC267319 resistant
hsa-miR-9-5p 2,4-dimethylpentan-3-yl 4-[(3,6-dioxocyclohexa-1,4-dien-1-yl)methylamino]benzoate 387690 NSC681719 resistant
hsa-miR-9-5p 2,4-dinitro-1-benzofuran 332391 NSC329127 resistant
hsa-miR-9-5p 2,5-bis[(dimethylamino)methyl]cyclopentan-1-one;hydrochloride 368963 NSC131233 resistant
hsa-miR-9-5p 2,6-dimethoxy-4-(7-methyl-6-(1-piperidinyl)-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-8-yl)phenol 383126 NSC671167 sensitive
hsa-miR-9-5p 2,7-dimethoxy-9-[[2-(diethylamino)ethyl]thio]acridine 395391 NSC699927 resistant
hsa-miR-9-5p 3-(1H-indol-3-yl)-N-[[3-[[[3-(1H-indol-3-yl)-2-bicyclo[2.2.1]heptanyl]amino]methyl]phenyl]methyl]bicyclo[2.2.1]heptan-2-amine 397159 NSC704562 sensitive
hsa-miR-9-5p 3-(4-methoxyphenyl)-4-methyl-8-pyrrolidin-1-yl-8H-thieno[2,3-b]pyrrolizin-4-ium;iodide 388538 NSC683518 sensitive
hsa-miR-9-5p 3-(4,6-diamino-2,2-dimethyl-1,3,5-triazin-1-yl)benzonitrile 271921 NSC115928 sensitive
hsa-miR-9-5p 3-[(2,3-dimethoxyphenyl)methyl]-7,8-dimethoxy-5-methylsulfanyl-2,5-dihydro-1H-3-benzazepin-4-one 359177 NSC619859 sensitive
hsa-miR-9-5p 3-[(e)-carbazol-9-yliminomethyl]-4-hydroxy-5-methoxybenzaldehyde 135436314 NSC718153 sensitive
hsa-miR-9-5p 3-[3-[2-chloro-4-(4,6-diamino-2,2-dimethyl-1,3,5-triazin-1-yl)phenoxy]propylcarbamoylamino]benzenesulfonyl fluoride;ethanesulfonic acid 275314 NSC122060 sensitive
hsa-miR-9-5p 3-[3-[4-(4,6-diamino-2,2-dimethyl-1,3,5-triazin-1-yl)phenyl]propanoylamino]benzenesulfonyl fluoride;ethanesulfonic acid 270820 NSC113908 sensitive
hsa-miR-9-5p 3-[4-[3-(4,6-diamino-2,2-dimethyl-1,3,5-triazin-1-yl)phenyl]butyl]benzenesulfonyl fluoride;ethanesulfonic acid 277387 NSC126228 sensitive
hsa-miR-9-5p 3-[5-(4-amino-2,6-dibromophenyl)-1,3,4-oxadiazol-2-yl]-1-(1H-benzimidazol-2-yl)propan-1-one 71451481 NSC761980 sensitive
hsa-miR-9-5p 3-benzyl-2-[(2e)-2-[(4-bromophenyl)methylidene]hydrazinyl]-5,6,7,8-tetrahydro-[1]benzothiolo[2,3-d]pyrimidin-4-one 45028588 NSC743399 sensitive
hsa-miR-9-5p 3-bromo-n-[(5-chloro-2-hydroxyphenyl)carbamothioyl]benzamide 3967840 NSC215721 sensitive
hsa-miR-9-5p 3-chloro-4-[4-[3-(4,6-diamino-2,2-dimethyl-1,3,5-triazin-1-yl)phenyl]butyl]benzenesulfonyl fluoride;ethanesulfonic acid 278058 NSC127157 sensitive
hsa-miR-9-5p 3-phenacyliden-5-brom-2-indolinon 5351299 NSC294961 resistant
hsa-miR-9-5p 3-piperidinone, 3,5-bis[(3,4-dichlorophenyl)methylene]- 5388806 NSC638643 sensitive
hsa-miR-9-5p 4-(6-hydrazino-7-methyl-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-8-yl)-2,6-dimethoxyphenol 383133 NSC671174 sensitive
hsa-miR-9-5p 4-[(3E)-3,4-dichloro-1-morpholin-4-yl-2,4-dinitrobuta-1,3-dienyl]morpholine 1618703 NSC698395 resistant
hsa-miR-9-5p 4-amino-5-(5-chloro-1-benzofuran-2-carbonyl)-2-(4-chloro-2-methylanilino)thiophene-3-carbonitrile 328931 NSC309895 sensitive
hsa-miR-9-5p 4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1H-2-benzofuran-1-yl)-N-[3-(trifluoromethyl)phenyl]butanamide 369471 NSC641241 sensitive
hsa-miR-9-5p 4-piperidinone, 1-methyl-2,6-bis[(2-nitrophenyl)methylene]- 5468197 NSC673650 resistant
hsa-miR-9-5p 5-amino-10,16-bis[2-(dimethylamino)ethyl]-1,9,10,16-tetrazapentacyclo[9.6.2.02,7.08,19.014,18]nonadeca-2(7),3,5,8,11(19),12,14(18)-heptaene-15,17-dione 399633 NSC710550 sensitive
hsa-miR-9-5p 5-fluoranyl-7-nitro-quinolin-8-ol 260644 NSC92207 sensitive
hsa-miR-9-5p 5-fluoro-4-methoxy-1-(5-oxo-2H-furan-2-yl)pyrimidin-2-one 330094 NSC315844 resistant
hsa-miR-9-5p 5-iodo-2-{[(2)-3-phenylprop-2-enoyl]amino}benzamide 45029271 NSC745962 sensitive
hsa-miR-9-5p 5-phenoxysulfonyl-1-methyl-4-nitroimidazole 81400 NSC38087 resistant
hsa-miR-9-5p 5,6-bis[(5-methyl-1,3,4-thiadiazol-2-yl)sulfanyl]pyrazine-2,3-dicarbonitrile 395616 NSC700361 resistant
hsa-miR-9-5p 6-(2-fluorophenyl)-5H-[1,3]dioxolo[4,5-g]quinoline-8-thione 3910131 NSC700269 sensitive
hsa-miR-9-5p 6-(3-aminopropyl)-3-nitro-9-phenylindeno[1,2-c]isoquinoline-5,11-dione;hydrochloride 17755120 NSC737671 sensitive
hsa-miR-9-5p 6-(4-methylphenyl)-2-(4-methylsulfonylphenyl)-4,5-dihydropyridazin-3-one 72375194 NSC762908 sensitive
hsa-miR-9-5p 6-(pyridin-3-yl)[1,3]dioxolo[4,5-g]quinolin-8(5h)-one 375864 NSC656162 sensitive
hsa-miR-9-5p 6-[(3,5-dimethoxy-N-methylanilino)methyl]-5-methylpyrido[2,3-d]pyrimidine-2,4-diamine;hydrochloride 382164 NSC669615 sensitive
hsa-miR-9-5p 6-amino-5,6-dihydrocyclopenta[c]thiophen-4-one hydrochloride 396928 NSC704113 resistant
hsa-miR-9-5p 6,7-bis(hydroxymethyl)-8-(3,4,5-trimethoxyphenyl)-5,6,7,8-tetrahydrobenzo[f][1,3]benzodioxol-5-ol 235235 NSC36373 sensitive
hsa-miR-9-5p 7-chloro-1-methyl-phenothiazone 369386 NSC641150 sensitive
hsa-miR-9-5p 7-chlorobenzo[c]quinolizin-11-ium-6-amine;chloride 386892 NSC679795 sensitive
hsa-miR-9-5p 7-epi-10-deacetylbaccatin iii 6712096 NSC656178 sensitive
hsa-miR-9-5p 8-(3,4-dimethoxyphenyl)-2-(2-hydroxyethyl)-5-oxa-2-azatetracyclo[7.7.0.03,7.011,15]hexadeca-1(9),3(7),10,15-tetraen-6-one 54579427 NSC751500 sensitive
hsa-miR-9-5p 8-(4-hydroxy-3,5-dimethoxyphenyl)-7-methyl-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-6-ol 383128 NSC671169 sensitive
hsa-miR-9-5p 8-(6-fluorohexyl)-3-methyl-1-phenyl-1,3,8-triazaspiro[4.5]decan-4-one;hydrochloride 380336 NSC665863 resistant
hsa-miR-9-5p 8-[(2e)-2-(3-butyl-4-oxo-1,3-thiazolidin-2-ylidene)hydrazinyl]-1,3-dimethyl-7h-purine-2,6-dione 9572578 NSC720616 sensitive
hsa-miR-9-5p 8-[4-(4-fluorophenyl)-4-oxobutyl]-1-phenyl-3-propan-2-yl-1,3,8-triazaspiro[4.5]decan-4-one;hydrochloride 380261 NSC665740 resistant
hsa-miR-9-5p 8-benzyl-1-phenyl-3-oxa-1,8-diazaspiro[4.5]decan-4-one 380263 NSC665741 sensitive
hsa-miR-9-5p 8-hydroxy-5-iodoquinoline 96111 NSC53183 sensitive
hsa-miR-9-5p 9-(2-chloroethylsulfinyl)-2,7-dimethoxy-acridine 395390 NSC699926 resistant
hsa-miR-9-5p 9-benzyl-6-chloro-8-ethenyl-9h-purine 401179 NSC714380 resistant
hsa-miR-9-5p 9-ethoxy-2,5,11-trimethyl-6h-pyrido[4,3-b]carbazol-2-ium acetate 373614 NSC650263 sensitive
hsa-miR-9-5p 9-tert-butyl-4-(4-methoxyphenyl)-16-methyl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 376302 NSC657017 sensitive
hsa-miR-9-5p 9-tert-butyl-4-(4-nitrophenyl)-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14,16,18-tetraene-3,5-dione 381785 NSC668851 resistant
hsa-miR-9-5p Acnistin f 495538 NSC657923 resistant
hsa-miR-9-5p Antibiotic x-14766a 434840 NSC359239 sensitive
hsa-miR-9-5p Antineoplastic-643001 5351386 NSC643001 sensitive
hsa-miR-9-5p Basic fuchsin 12447 NSC10466 sensitive
hsa-miR-9-5p Bc 76 246230 NSC58905 sensitive
hsa-miR-9-5p Benzo[1,2-b:4,5-b']dithiophene-4,8-diol, diacetate 393649 NSC695914 sensitive
hsa-miR-9-5p Benzo[g]quinoxaline-5,10-dione, 5,10-dihydro-2,3-dimethyl- 353644 NSC602617 sensitive
hsa-miR-9-5p Bioxiran 11254 NSC629 sensitive
hsa-miR-9-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-9-5p Cgp 57380 11644425 NSC741567 resistant
hsa-miR-9-5p Chemdivam_000505 403081 NSC717553 sensitive
hsa-miR-9-5p Chloroform;(1S,12R)-20-methyl-16-nitro-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-2,4(8),9,13(18),14,16-hexaene-11,19-dione 45027874 NSC730009 sensitive
hsa-miR-9-5p Chromeno[2,3-f]quinolin-7-one 385093 NSC676028 resistant
hsa-miR-9-5p Di-n-octyl-secalonsaure a 430141 NSC268925 sensitive
hsa-miR-9-5p Di-p-tolyliodinium bromide 54601177 NSC8985 sensitive
hsa-miR-9-5p Diethoxybis(1,4-naphthochinone-2-olato)titanium(iv) 368297 NSC638842 sensitive
hsa-miR-9-5p Diethyl (E)-2-(5-methyl-2,4-dioxo-3-prop-2-ynylpyrimidin-1-yl)but-2-enedioate 5469887 NSC693986 resistant
hsa-miR-9-5p Diethylcyanine 5717105 NSC97374 sensitive
hsa-miR-9-5p Diisopropoxybis(1,4-naphthochinone-2-olato)titanium(iv) 368058 NSC638383 sensitive
hsa-miR-9-5p Dimethyl 3-bromo-3-(bromomethyl)cyclopropane-1,2-dicarboxylate 395481 NSC700122 resistant
hsa-miR-9-5p Dndi1417002 395921 NSC701016 resistant
hsa-miR-9-5p Emd-534085 23634407 NSC763564 sensitive
hsa-miR-9-5p Ethyl (2Z)-2-[(2-chlorophenyl)methylidene]-5-methyl-3-oxo-[1,3]thiazolo[2,3-b][1,3]thiazol-4-ium-6-carboxylate 5478638 NSC658291 sensitive
hsa-miR-9-5p Ethyl 2-ethyl-1-oxo-1,2-dihydropyrimido[1,6-a]benzimidazole-4-carboxylate 395848 NSC700851 resistant
hsa-miR-9-5p Eupachlorin 5458217 NSC114567 resistant
hsa-miR-9-5p Go-y032 1714173 NSC751465 sensitive
hsa-miR-9-5p Gw832467x 6539439 NSC756401 resistant
hsa-miR-9-5p Hexachlorophene 3598 NSC757055 sensitive
hsa-miR-9-5p Iodine green 54605107 NSC8673 sensitive
hsa-miR-9-5p Kijanimicin sodium salt 54707591 NSC329515 sensitive
hsa-miR-9-5p L-cysteine, s-[(4-chlorophenyl)diphenylmethyl]- 275977 NSC123138 sensitive
hsa-miR-9-5p L-cysteine, s-[(4-methylphenyl)diphenylmethyl]- (9ci) 275978 NSC123139 sensitive
hsa-miR-9-5p L-cysteine, s-[bis(4-methylphenyl)phenylmethyl]- 275979 NSC123140 sensitive
hsa-miR-9-5p Lmpk12050091 165203 NSC646923 sensitive
hsa-miR-9-5p Ls-144126 135538372 NSC42369 sensitive
hsa-miR-9-5p Methyl (e)-3-[2-[[methyl-(4-methylphenyl)-oxo-lambda6-sulfanylidene]amino]phenyl]prop-2-enoate 24202623 NSC716715 sensitive
hsa-miR-9-5p Methyl (Z)-4-[(5-bromothiophen-2-yl)methylideneamino]-4,4-dicyanobut-2-enoate 5470186 NSC698282 resistant
hsa-miR-9-5p Methyl (Z)-4,4-dicyano-4-(thiophen-2-ylmethylideneamino)but-2-enoate 5470184 NSC698280 resistant
hsa-miR-9-5p Methyl (Z)-4,4-dicyano-4-[(3-methylthiophen-2-yl)methylideneamino]but-2-enoate 5470185 NSC698281 resistant
hsa-miR-9-5p Methyl 5-(3,5-dimethoxybenzyl)-2-hydroxy-5h-benzo[b]carbazole-1-carboxylate 404480 NSC720716 sensitive
hsa-miR-9-5p Methyl 5-(hydroxyamino)-2,6-dimethyl-4-[2-(trifluoromethyl)phenyl]pyridine-3-carboxylate 382124 NSC669517 resistant
hsa-miR-9-5p N'-carbamimidoyl-2-chloro-6-(2,5-dimethoxy-4-nitrophenyl)imidazo[2,1-b][1,3]thiazole-5-carboximidamide;hydrochloride 24202932 NSC726311 sensitive
hsa-miR-9-5p N-(1,2,3-trihydroxy-10-methylsulfanyl-9-oxo-6,7-dihydro-5h-benzo[a]heptalen-7-yl)benzamide 369939 NSC642306 sensitive
hsa-miR-9-5p N-[(e)-[6-(2,5-dimethylanilino)-1-(4-hydroxyphenyl)-2-methyl-1,6-dioxohexan-3-ylidene]amino]-2-hydroxynaphthalene-1-carboxamide 9555801 NSC630357 sensitive
hsa-miR-9-5p N-[2-(dimethylamino)ethyl]-1-[3-[3-[[4-[2-(dimethylamino)ethylcarbamoyl]-9-oxo-10h-acridin-1-yl]amino]propyl-methylamino]propylamino]-9-oxo-10h-acridine-4-carboxamide 399637 NSC710554 sensitive
hsa-miR-9-5p N-[4-[[[2-(4-chloroanilino)pyridine-3-carbonyl]amino]sulfamoyl]phenyl]acetamide 16126694 NSC737147 sensitive
hsa-miR-9-5p N-anthracen-2-yl-8-chloro-5,5-dioxoimidazo[1,2-b][1,4,2]benzodithiazine-7-carboxamide 403255 NSC717956 sensitive
hsa-miR-9-5p N-benzyl-1-[10-[4-(benzylamino)-2-methylquinolin-1-ium-1-yl]decyl]-2-methylquinolin-1-ium-4-amine;perchlorate 387881 NSC682094 sensitive
hsa-miR-9-5p N-cyclohexyl-4-[(2,4-diaminopteridin-6-yl)methyl-methylamino]benzamide 393097 NSC694482 sensitive
hsa-miR-9-5p N,N'-bis[(6-methoxynaphthalen-2-yl)methyl]hexane-1,6-diamine;hydrochloride 385310 NSC676426 sensitive
hsa-miR-9-5p N~2~,n~4~-di(1-adamantyl)-6-chloro-1,3,5-triazine-2,4-diamine 394865 NSC698954 sensitive
hsa-miR-9-5p Neuro_000210 435731 NSC374979 sensitive
hsa-miR-9-5p NSC644919 NSC644919 sensitive
hsa-miR-9-5p NSC688995 NSC688995 sensitive
hsa-miR-9-5p NSC751830 NSC751830 resistant
hsa-miR-9-5p Pipamperone 4830 NSC759178 sensitive
hsa-miR-9-5p Sanguilutine pseudobase 371258 NSC645317 sensitive
hsa-miR-9-5p Sb-223133 22464120 NSC756420 resistant
hsa-miR-9-5p Simvastatin 54454 NSC633782 approved sensitive
hsa-miR-9-5p Sphinxolide f 5470536 NSC702924 resistant
hsa-miR-9-5p Spiropitan 5265 NSC170983 resistant
hsa-miR-9-5p Stereoisomer of nsc 674066-o NSC674067 sensitive
hsa-miR-9-5p Suavedol 65631 NSC141545 sensitive
hsa-miR-9-5p Tiazofurin 323701 NSC286193 sensitive
hsa-miR-9-5p Timtec1_008492 397075 NSC704388 sensitive
hsa-miR-9-5p Triciribine phosphate 43860 NSC280594 resistant
hsa-miR-9-5p Vorinostat 5311 NSC701852 approved sensitive
hsa-miR-9-5p Waol a fd-211 10354084 NSC726144 resistant
hsa-miR-9-5p Trail sensitive High Non-Small Cell Lung Cancer cell line (CALU-1, A459, H460)
hsa-miR-9-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-9-5p Etoposide 36462 NSC141540 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-9-5p Imatinib 5291 NSC743414 approved sensitive High Myelogenous Leukemia cell line (MYL)
hsa-miR-9-5p Daunorubicin 30323 NSC82151 approved resistant High Lymphoblastic Leukemia tissue
hsa-miR-9-5p Prednisolone 5755 NSC9120 approved resistant High Lymphoblastic Leukemia tissue
hsa-miR-9-5p Vincristine 5978 approved resistant High Lymphoblastic Leukemia tissue
hsa-miR-9-5p L-Asparaginase resistant High Lymphoblastic Leukemia tissue
hsa-miR-9-5p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (SUIT-2, CAPAN-1)
hsa-miR-9-5p Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer tissue and cell line (SKOV3)
hsa-miR-9-5p Temozolomide 5394 NSC362856 approved resistant Low Glioblastoma cell line (U87, T98G, BT145, BT164)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer tissue and cell line (C13, OV2008, A2780)
hsa-miR-9-5p Rucaparib phosphate 9931953 sensitive Low Ovarian Cancer tissue and cell line (C13)
hsa-miR-9-5p Docetaxel 148124 NSC628503 approved sensitive High Prostate Cancer cell line (PC-3)
hsa-miR-9-5p Temozolomide 5394 NSC362856 approved resistant Low Glioblastoma cell line (U87, T98G)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer tissue and cell line
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved sensitive Low Primary Epithelial Ovarian Cancer Primary Epithelial Ovarian Cancer Single Cells
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-miR-9-5p Paclitaxel 36314 NSC125973 approved sensitive Low Epithelial Ovarian Cancer tissue and cell line (SKOV3, A2780)
hsa-miR-9-5p Dexamethasone 5743 NSC34521 approved resistant High Myeloma cell line (MM1R, MM1S)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer tissue
hsa-miR-9-5p Doxorubicin 31703 NSC123127 approved sensitive High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-9-5p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (TAMR4)
hsa-miR-9-5p Temozolomide 5394 NSC362856 approved resistant Low Glioblastoma cell line (A172, U-251MG)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved resistant Low Urothelial Bladder Cancer cell line (T24)
hsa-miR-9-5p Gemcitabine 60750 NSC613327 approved resistant Low Urothelial Bladder Cancer cell line (T24)
hsa-miR-9-5p Cetuximab sensitive Low Hepatocellular Carcinoma cell line (Hep3B, Huh-7)
hsa-miR-9-5p [5-[2,4-Bis((3S)-3-methylmorpholin-4-yl)pyrido[2,3-d]pyrimidin-7-yl]-2-methoxyphenyl]methanol 25262965 NSC758871 resistant Low Breast Cancer cell line (MCF-7)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-9-5p Sunitinib 5329102 NSC750690 approved resistant High Renal Cell Cancer tissue
hsa-miR-9-5p Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (500nM)
hsa-miR-9-5p Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-miR-9-5p Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (2uM)
hsa-miR-9-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (500nM)
hsa-miR-9-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-miR-9-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (2uM)
hsa-miR-9-5p Daunorubicin 30323 NSC82151 approved sensitive Low Myeloid Leukemia cell line (THP-1, KG-1, HL60, Kasumi-1F)
hsa-miR-9-5p Temozolomide 5394 NSC362856 approved sensitive Low Glioma cell line (U251)
hsa-miR-9-5p Alkannin 72521 resistant Low Oral Cancer cell line (CAL-27, SCC-9)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved sensitive Low Gastric Cancer cell line (MKN45, HGC-27)
hsa-miR-9-5p Etoposide 36462 NSC141540 approved resistant Low Leukemia cell line (K562)
hsa-miR-9-5p Imatinib 5291 NSC743414 approved resistant Low Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-9-5p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-miR-9-5p Gefitinib 123631 NSC715055 approved sensitive Low Colorectal Cancer cell line (HCT-116)
hsa-miR-9-5p Regorafenib 11167602 NSC763932 approved sensitive Low Colorectal Cancer cell line (HCT-116)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved sensitive Low Hepatocellular Carcinoma cell line (HepG2, Hep3B, Huh-7, SNU387, SNU449)
hsa-miR-9-5p Gefitinib 123631 NSC715055 approved sensitive High Non-Small Cell Lung Cancer cell line (HCC827)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved sensitive Low Gastric Cancer cell line (MGC803)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved resistant Low Triple-Negative Breast Cancer cell line (HEK-293T, MDA-MB-468)
hsa-miR-9-5p Tamoxifen 2733525 NSC180973 approved resistant Low Breast Cancer cell line (MCF-7)
hsa-miR-9-5p Fluorouracil 3385 NSC19893 approved sensitive Low Colorectal Cancer cell line (HCT-116, HT-29)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-9-5p Temozolomide 5394 NSC362856 approved sensitive Low Glioma cell line (U87, U251)
hsa-miR-9-5p Temozolomide 5394 NSC362856 approved resistant High Glioblastoma cell line (U251)
hsa-miR-9-5p Temozolomide 5394 NSC362856 approved sensitive cell line (U251)
hsa-miR-9-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-9-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)
hsa-miR-9-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-9-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-9-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM11)
hsa-miR-9-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-9-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-9-5p Exemestane 60198 NSC713563 approved resistant cell line (MCF-7)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-9-5p Fluorouracil 3385 NSC19893 approved resistant cell line (HCT15)
hsa-miR-9-5p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (RPMI2650)
hsa-miR-9-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-9-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (H23)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved resistant cell line (OVCAR3)

Error report submission