miRTarBase - #MIRT001332


—
pre-miRNA Information
pre-miRNA hsa-mir-1-1   
Genomic Coordinates chr20: 62554306 - 62554376
Synonyms MIRN1-1, hsa-mir-1-1, miRNA1-1, MIR1-1
Description Homo sapiens miR-1-1 stem-loop
Comment Lagos-Quintana et al. .
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-1-2   
Genomic Coordinates chr18: 21829004 - 21829088
Synonyms MIRN1-2, hsa-mir-1-2, miRNA1-2, MIR1-2
Description Homo sapiens miR-1-2 stem-loop
Comment Lagos-Quintana et al. .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-1-3p
Sequence 53| UGGAAUGUAAAGAAGUAUGUAU |74
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 20 + 62554354 29233923 MiREDiBase
A-to-I 5 20 + 62554355 29233923 MiREDiBase
A-to-I 9 20 + 62554359 29233923 MiREDiBase
A-to-I 11 20 + 62554361 29233923 MiREDiBase
A-to-I 14 20 + 62554364 29233923 MiREDiBase
A-to-I 17 20 + 62554367 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1273198863 2 dbSNP
rs1395109253 3 dbSNP
rs776480338 14 dbSNP
rs1399433486 15 dbSNP
rs528661852 16 dbSNP
rs772171181 16 dbSNP
rs1433539698 18 dbSNP
rs377171105 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B9HSE2 miR-1 Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Plasma .
B9HSE2 miR-1 Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Plasma Real-time reverse transcription PCR
Gene Information
Gene Symbol SLC25A22   
Synonyms EIEE3, GC-1, GC1, NET44
Description solute carrier family 25 member 22
Transcript NM_024698   
Expression
Putative miRNA Targets on SLC25A22
3'UTR of SLC25A22
(miRNA target sites are highlighted)		 
>SLC25A22|NM_024698|3'UTR
   1 GCCCAGCACCCGCTCCACCCCAGCCAGCTGGGCAGGGCCGGTGTGGGGCTGGAGCCAGGCAGCTAGCCCAGGACGGAGCA
  81 AGGGAAGACCCCTCCCCAGCCCTCCCGTCGGCAGGGGCAGCAGGGGGCAGGGTGCAGGGTCCACATAGGTGGTGCACACG
 161 CAAGCCCCCCGGGGTGCTGCCTGCACCGTTGGGATCAATGTCTCATTTATGTAGAAAATGCAGAAATCTTTACATTCCTC
 241 AAGCTAGCCCCTGCCCCAATCCTGCCCTGGCCTGAACACCCCCAGGGACAGAGCTGGTCTCTGGGCTGGGGGCCCCCGGG
 321 CCTGGGCCGGGCAGGCTGGACCATACCCCCAGTCCACCAGCTCCAGTCTCCACAGCCATCCTGGCCCACACAGGCACCCC
 401 ACACAAACCTATTTATTGAATCTGCTGGACCCAAGCGGCTCTCCAGCCCTTCCGTCCTTCCCCAGCCGCTCTTGTCGCCT
 481 TGGCAGGACTTGACTCTGCCTCCCTGGCCAGCCTTGCAAGAGGACTGGGGTCTCCTGCCCTCTCTGTTGAGCCAGGAATC
 561 CCAAGTGAGGGGTTGCCCTGAGGTCTGACTCTTGGGGCAAGCCCGCCACCCACTGTGGGACTTTCTGGTGGGCTCCTCAG
 641 CTCCCACCCCAGGCTGGGGCCCAGATTGTGAGGTCTGTGTGCATGTGTGTGTGTATGTGTGTGTGCATGCGTGTGTGTGT
 721 TGTGGGGATCTGGCCTGGCCCTTGGGGATGGGGCTGCTGGGGACTGCCCCCCTTCCCGCCGTGGCCAGGCGCTCTGTGTG
 801 CTGTGTGTGCCCCAGGCTCTGTTGACCCCGTCCAGGAACTAACTTACCCAGCTTGGTCTCTCCTGAGTCCTCCACCCTGG
 881 CCTGGGATTGGCCAGGGAGCAGGGCGGGCATTGGGACCAGTGTGGAGCCTGAGGGTGCCTGCCCTGCTCTGGAGGGAGGG
 961 CCAGGAGCTGCCACACCCCCAAGTCCTCTCAGGGCCCACCCTCCTTTTTCAGCCTCTGCATAAGGCCCCTGGGTACACTG
1041 CAGAAGCCCCATCCTTCCCGCCTCCGGGCATAAGGCCCCTGACCACACTTCAGAAGCCCCATCCCCCCTGCCACCGGGCG
1121 ATCCCTGCTGTGAGCCGAAGCTCTCCCTGCCCCGCCCTGGCCATGTGATCGTGTTGGTGACAGACCCTGATGTGCTGGTG
1201 CTGTGTCCCCAAAACCGGGGCCCTCCACAGAGGCCCCTTCCCAGCGACACTACCTGGGGCTCAGGCCTGGACCCCCCCAG
1281 TTCACGGTTGCTCCTGGGAGCTGCCCCTCCCGTCACATCAGAACCTTGGAAGCTGCTGCTGCTGCTTACAGAATTATATT
1361 TTTTTCTTTTGAAGAGTTTTAAGAAGTTGTAACTTTTTGTGTCTTGTCATGTCAGAGAATAAATAAATATTCTAAGTAGA
1441 AAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uaUGUAUGAAGAAAUGUAAGGu 5'
            :|| |  |||||||||||| 
Target 5' atGCAGAAATCTTTACATTCCt 3'
 218 - 239 172.00 -17.60
2 
miRNA  3' uaUGUAU---GAAGA--AAUGUAAGGu 5'
            :||||   |  ||    ||| |:| 
Target 5' ggGCATAAGGCCCCTGACCACACTTCa 3'
 1066 - 1092 94.00 -8.81
3 
miRNA  3' uaUGUAUGAAGAAAUGUAAGgu 5'
            ::||:: | | |:||| |  
Target 5' gtGTATGTGTGTGTGCATGCgt 3'
 691 - 712 92.00 -6.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
590074 4 ClinVar
139147 17 ClinVar
207155 20 ClinVar
159910 34 ClinVar
306257 39 ClinVar
306256 107 ClinVar
882799 171 ClinVar
306255 209 ClinVar
882798 221 ClinVar
306254 328 ClinVar
306253 436 ClinVar
306252 453 ClinVar
306251 510 ClinVar
306250 560 ClinVar
306249 693 ClinVar
306248 706 ClinVar
306247 711 ClinVar
306246 712 ClinVar
881636 746 ClinVar
306245 753 ClinVar
306244 760 ClinVar
881635 778 ClinVar
306243 780 ClinVar
306242 810 ClinVar
306241 841 ClinVar
306240 845 ClinVar
306239 906 ClinVar
881169 937 ClinVar
306238 940 ClinVar
881168 1000 ClinVar
306237 1013 ClinVar
306236 1041 ClinVar
306235 1057 ClinVar
306234 1084 ClinVar
306233 1153 ClinVar
306232 1277 ClinVar
883538 1292 ClinVar
883537 1301 ClinVar
306231 1430 ClinVar
306230 1431 ClinVar
COSN30508279 40 COSMIC
COSN8284092 334 COSMIC
COSN17182988 424 COSMIC
COSN22551888 604 COSMIC
COSN29193840 752 COSMIC
COSN4724191 829 COSMIC
COSN26031279 1013 COSMIC
COSN22883175 1103 COSMIC
rs4963153 453 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs768181465 1 dbSNP
rs1314766783 2 dbSNP
rs1396699166 4 dbSNP
rs748865577 6 dbSNP
rs774988646 7 dbSNP
rs769239083 11 dbSNP
rs745830860 12 dbSNP
rs780956185 13 dbSNP
rs1299691174 15 dbSNP
rs1004867467 16 dbSNP
rs554507285 17 dbSNP
rs1258011670 19 dbSNP
rs796053237 20 dbSNP
rs746754610 21 dbSNP
rs1292043106 28 dbSNP
rs1435974680 30 dbSNP
rs778112073 33 dbSNP
rs74994790 34 dbSNP
rs1418251835 36 dbSNP
rs758687644 38 dbSNP
rs752899555 39 dbSNP
rs558189257 40 dbSNP
rs1268795723 42 dbSNP
rs755059251 45 dbSNP
rs1487919653 51 dbSNP
rs1190391009 60 dbSNP
rs956001281 61 dbSNP
rs1472625449 75 dbSNP
rs1050960871 90 dbSNP
rs1253582537 91 dbSNP
rs1031978352 92 dbSNP
rs1350078196 93 dbSNP
rs1435372823 100 dbSNP
rs1291449234 103 dbSNP
rs1179525366 106 dbSNP
rs4963152 107 dbSNP
rs191895858 109 dbSNP
rs776997448 110 dbSNP
rs1235182973 111 dbSNP
rs1273949669 114 dbSNP
rs1012662868 115 dbSNP
rs1219599367 119 dbSNP
rs946469688 124 dbSNP
rs895500520 126 dbSNP
rs372868529 127 dbSNP
rs552917330 128 dbSNP
rs1255339660 133 dbSNP
rs1476821977 133 dbSNP
rs773841719 137 dbSNP
rs536528731 138 dbSNP
rs1232706360 141 dbSNP
rs1413821010 148 dbSNP
rs897416511 152 dbSNP
rs1329909191 157 dbSNP
rs148144757 159 dbSNP
rs1408190915 160 dbSNP
rs1420675317 162 dbSNP
rs1005716573 164 dbSNP
rs934978871 165 dbSNP
rs888609195 166 dbSNP
rs1049832499 167 dbSNP
rs927581482 170 dbSNP
rs771093127 171 dbSNP
rs557227318 173 dbSNP
rs530664414 181 dbSNP
rs748169209 188 dbSNP
rs1413475536 192 dbSNP
rs1487198291 196 dbSNP
rs1212881036 208 dbSNP
rs537403010 209 dbSNP
rs143796598 210 dbSNP
rs978671518 217 dbSNP
rs551904948 221 dbSNP
rs1157704688 223 dbSNP
rs1358983540 226 dbSNP
rs1335377132 228 dbSNP
rs1368839429 228 dbSNP
rs1004873636 238 dbSNP
rs1445909573 241 dbSNP
rs954716877 243 dbSNP
rs1030248903 244 dbSNP
rs1440472992 253 dbSNP
rs768708575 253 dbSNP
rs959835766 255 dbSNP
rs998075306 257 dbSNP
rs1279224843 258 dbSNP
rs899728617 259 dbSNP
rs1207392352 269 dbSNP
rs528625732 270 dbSNP
rs747226243 273 dbSNP
rs1287565714 274 dbSNP
rs1226466904 278 dbSNP
rs1226797863 286 dbSNP
rs1350315510 287 dbSNP
rs1035818392 294 dbSNP
rs1425046517 310 dbSNP
rs993184950 311 dbSNP
rs561776675 312 dbSNP
rs566262436 313 dbSNP
rs1015833790 315 dbSNP
rs1052199726 317 dbSNP
rs780210144 318 dbSNP
rs1344066569 321 dbSNP
rs1436396912 323 dbSNP
rs187161044 328 dbSNP
rs747104481 329 dbSNP
rs377220453 331 dbSNP
rs1456246356 334 dbSNP
rs529513188 342 dbSNP
rs143320809 344 dbSNP
rs1246439633 348 dbSNP
rs974018608 349 dbSNP
rs1424982085 350 dbSNP
rs1367638376 354 dbSNP
rs544104515 355 dbSNP
rs773829232 366 dbSNP
rs942203600 372 dbSNP
rs867640690 374 dbSNP
rs1323180768 376 dbSNP
rs1330234381 377 dbSNP
rs1434051243 390 dbSNP
rs1280002326 397 dbSNP
rs1341129313 415 dbSNP
rs753651211 418 dbSNP
rs1255663270 427 dbSNP
rs1246107911 428 dbSNP
rs1041489403 430 dbSNP
rs934716534 431 dbSNP
rs1288706026 432 dbSNP
rs954768628 434 dbSNP
rs112476979 436 dbSNP
rs564581592 437 dbSNP
rs1211818883 438 dbSNP
rs974700060 439 dbSNP
rs964347334 449 dbSNP
rs1370229968 452 dbSNP
rs4963153 453 dbSNP
rs1011208209 463 dbSNP
rs893644649 467 dbSNP
rs1030817194 468 dbSNP
rs1403388185 472 dbSNP
rs1299851732 474 dbSNP
rs572635217 476 dbSNP
rs999290342 477 dbSNP
rs1276261060 480 dbSNP
rs1399267208 480 dbSNP
rs1341669138 483 dbSNP
rs1244898735 501 dbSNP
rs369702292 505 dbSNP
rs886048694 510 dbSNP
rs553046910 512 dbSNP
rs1429477734 525 dbSNP
rs928405287 526 dbSNP
rs542413126 535 dbSNP
rs1385763924 541 dbSNP
rs573790809 551 dbSNP
rs1424464325 552 dbSNP
rs556969774 560 dbSNP
rs1366904566 561 dbSNP
rs183389177 565 dbSNP
rs571647327 579 dbSNP
rs558217557 581 dbSNP
rs1360884796 582 dbSNP
rs1389768293 586 dbSNP
rs1418870132 592 dbSNP
rs1404339366 604 dbSNP
rs1169055556 615 dbSNP
rs1431383579 617 dbSNP
rs1396099558 620 dbSNP
rs1388298360 621 dbSNP
rs1187812637 624 dbSNP
rs1475144355 625 dbSNP
rs535033287 628 dbSNP
rs1005819683 632 dbSNP
rs559351146 641 dbSNP
rs895421517 650 dbSNP
rs1238506036 652 dbSNP
rs566013619 653 dbSNP
rs1247314480 659 dbSNP
rs1483888082 667 dbSNP
rs1201296829 672 dbSNP
rs1450015503 673 dbSNP
rs1199920627 678 dbSNP
rs1037964153 680 dbSNP
rs549458341 682 dbSNP
rs1254115400 683 dbSNP
rs752155405 685 dbSNP
rs1291315692 686 dbSNP
rs1206391785 689 dbSNP
rs952981529 692 dbSNP
rs375467519 693 dbSNP
rs570270747 694 dbSNP
rs1214457813 695 dbSNP
rs1379262477 695 dbSNP
rs1302213176 699 dbSNP
rs1466529839 699 dbSNP
rs1367725598 704 dbSNP
rs1019728232 706 dbSNP
rs139577104 706 dbSNP
rs901337284 706 dbSNP
rs1375784642 710 dbSNP
rs550204204 710 dbSNP
rs111723529 711 dbSNP
rs114476401 712 dbSNP
rs1233113681 715 dbSNP
rs1254769591 721 dbSNP
rs1199413763 726 dbSNP
rs1320018989 726 dbSNP
rs974751122 734 dbSNP
rs947342030 741 dbSNP
rs576938612 746 dbSNP
rs544567754 753 dbSNP
rs1269137831 754 dbSNP
rs139397585 760 dbSNP
rs1368423496 762 dbSNP
rs928445753 769 dbSNP
rs766005705 771 dbSNP
rs1030869137 772 dbSNP
rs1414912192 773 dbSNP
rs1460109608 773 dbSNP
rs999341429 777 dbSNP
rs971863478 778 dbSNP
rs886048693 780 dbSNP
rs1477075131 781 dbSNP
rs1268512371 790 dbSNP
rs1257556087 791 dbSNP
rs1024722451 794 dbSNP
rs1183127012 796 dbSNP
rs908937740 798 dbSNP
rs1484261470 799 dbSNP
rs763350462 803 dbSNP
rs886048692 810 dbSNP
rs1190475653 811 dbSNP
rs953012195 813 dbSNP
rs1478792521 821 dbSNP
rs1204461060 824 dbSNP
rs1313233620 830 dbSNP
rs1281329489 831 dbSNP
rs1217014764 840 dbSNP
rs116673603 841 dbSNP
rs1457712529 845 dbSNP
rs886048691 845 dbSNP
rs1301721181 848 dbSNP
rs1362981502 849 dbSNP
rs1401089548 851 dbSNP
rs1037748447 852 dbSNP
rs1278153537 855 dbSNP
rs1359889132 857 dbSNP
rs1230157373 862 dbSNP
rs1313702591 863 dbSNP
rs1321392579 864 dbSNP
rs942308652 868 dbSNP
rs976061263 870 dbSNP
rs886675681 875 dbSNP
rs542750433 879 dbSNP
rs1229797539 880 dbSNP
rs933484658 881 dbSNP
rs1348413215 886 dbSNP
rs965600937 886 dbSNP
rs1020180656 893 dbSNP
rs923409569 895 dbSNP
rs573754741 896 dbSNP
rs1021683339 901 dbSNP
rs943425806 905 dbSNP
rs118051043 906 dbSNP
rs34712290 906 dbSNP
rs894476789 911 dbSNP
rs17156066 913 dbSNP
rs1428635679 917 dbSNP
rs1344016618 937 dbSNP
rs543726213 940 dbSNP
rs1473664625 944 dbSNP
rs1410224173 945 dbSNP
rs577974181 948 dbSNP
rs1177061623 957 dbSNP
rs1244007186 961 dbSNP
rs1483769337 963 dbSNP
rs558106987 978 dbSNP
rs534970957 982 dbSNP
rs1311750068 986 dbSNP
rs1355518215 996 dbSNP
rs938579581 997 dbSNP
rs1445247555 1000 dbSNP
rs923851069 1001 dbSNP
rs907095642 1005 dbSNP
rs977953428 1007 dbSNP
rs1482660772 1010 dbSNP
rs1181297537 1012 dbSNP
rs542204237 1013 dbSNP
rs970556206 1019 dbSNP
rs572412088 1022 dbSNP
rs1208586465 1026 dbSNP
rs1158462554 1032 dbSNP
rs1440696925 1032 dbSNP
rs1406397068 1033 dbSNP
rs1416611945 1034 dbSNP
rs1036618990 1037 dbSNP
rs1358583537 1038 dbSNP
rs1450563598 1040 dbSNP
rs886048690 1041 dbSNP
rs1024773402 1046 dbSNP
rs1378009488 1047 dbSNP
rs1460499572 1050 dbSNP
rs908970706 1053 dbSNP
rs375049082 1057 dbSNP
rs959352369 1059 dbSNP
rs1229858356 1060 dbSNP
rs1201306812 1064 dbSNP
rs762429573 1065 dbSNP
rs535992217 1066 dbSNP
rs1228725309 1073 dbSNP
rs1006279251 1076 dbSNP
rs966031353 1081 dbSNP
rs1381032787 1082 dbSNP
rs1468293149 1082 dbSNP
rs1172954536 1083 dbSNP
rs768779780 1084 dbSNP
rs1451770444 1087 dbSNP
rs1327140628 1088 dbSNP
rs1333697535 1090 dbSNP
rs1405461417 1090 dbSNP
rs1321228636 1096 dbSNP
rs978000475 1098 dbSNP
rs967500110 1103 dbSNP
rs886728603 1104 dbSNP
rs1344851112 1109 dbSNP
rs1458885782 1109 dbSNP
rs1221130671 1110 dbSNP
rs1343701703 1113 dbSNP
rs1158614880 1114 dbSNP
rs1047977298 1115 dbSNP
rs570129087 1116 dbSNP
rs747118458 1119 dbSNP
rs1021756897 1120 dbSNP
rs1444490845 1124 dbSNP
rs1039585271 1136 dbSNP
rs943495720 1137 dbSNP
rs1424373505 1139 dbSNP
rs1210113900 1141 dbSNP
rs1477539020 1146 dbSNP
rs958720079 1147 dbSNP
rs549994645 1150 dbSNP
rs1259827734 1151 dbSNP
rs17156064 1153 dbSNP
rs1054500269 1154 dbSNP
rs907123054 1158 dbSNP
rs1402984284 1159 dbSNP
rs1036245085 1161 dbSNP
rs934650645 1164 dbSNP
rs924572077 1165 dbSNP
rs1287403665 1170 dbSNP
rs978005672 1171 dbSNP
rs1358074074 1180 dbSNP
rs1210784914 1181 dbSNP
rs970608597 1184 dbSNP
rs1291431192 1185 dbSNP
rs1489969802 1188 dbSNP
rs887605460 1195 dbSNP
rs1264548272 1210 dbSNP
rs1245163402 1217 dbSNP
rs1446485271 1221 dbSNP
rs34592943 1231 dbSNP
rs1048825159 1237 dbSNP
rs1365928953 1239 dbSNP
rs1191203717 1240 dbSNP
rs1299719406 1243 dbSNP
rs570780598 1244 dbSNP
rs547695882 1245 dbSNP
rs1163212990 1249 dbSNP
rs1384310065 1254 dbSNP
rs1422533336 1255 dbSNP
rs991045447 1258 dbSNP
rs1359904745 1260 dbSNP
rs1381129531 1262 dbSNP
rs1315667091 1266 dbSNP
rs1288529830 1268 dbSNP
rs1313928501 1272 dbSNP
rs1357669453 1273 dbSNP
rs1040455145 1275 dbSNP
rs191455128 1277 dbSNP
rs1443080528 1279 dbSNP
rs912808376 1279 dbSNP
rs1351988383 1281 dbSNP
rs977666014 1283 dbSNP
rs1424407010 1285 dbSNP
rs1016422308 1286 dbSNP
rs575292705 1301 dbSNP
rs1191025810 1303 dbSNP
rs990294259 1307 dbSNP
rs1260374587 1308 dbSNP
rs1191429330 1311 dbSNP
rs950392937 1312 dbSNP
rs1396119743 1315 dbSNP
rs1335657342 1324 dbSNP
rs1025914465 1325 dbSNP
rs997738405 1329 dbSNP
rs1449420823 1336 dbSNP
rs902092008 1337 dbSNP
rs367812123 1339 dbSNP
rs1342565848 1347 dbSNP
rs1237433828 1351 dbSNP
rs1003290288 1357 dbSNP
rs1258305392 1366 dbSNP
rs1276724863 1366 dbSNP
rs1226014272 1368 dbSNP
rs1345797613 1372 dbSNP
rs1305847672 1373 dbSNP
rs1294862830 1376 dbSNP
rs779716143 1377 dbSNP
rs559349713 1379 dbSNP
rs971421784 1391 dbSNP
rs1387423796 1393 dbSNP
rs548785686 1398 dbSNP
rs1008137803 1402 dbSNP
rs893255607 1403 dbSNP
rs1418285726 1409 dbSNP
rs887633301 1413 dbSNP
rs1048897855 1415 dbSNP
rs1379357851 1422 dbSNP
rs1469862991 1425 dbSNP
rs755572915 1430 dbSNP
rs529018067 1431 dbSNP
rs900254990 1431 dbSNP
rs944409908 1432 dbSNP
rs1171060120 1436 dbSNP
rs35813865 1439 dbSNP
rs1304050103 1441 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HeLa
Original Description (Extracted from the article) ... Provided by pSILAC database (http://psilac.mdc-berlin.de/) ...

- Selbach M; Schwanhausser B; Thierfelder N; et al., 2008, Nature.

Article - Selbach M; Schwanhausser B; Thierfelder N; et al.
- Nature, 2008
Animal microRNAs (miRNAs) regulate gene expression by inhibiting translation and/or by inducing degradation of target messenger RNAs. It is unknown how much translational control is exerted by miRNAs on a genome-wide scale. We used a new proteomic approach to measure changes in synthesis of several thousand proteins in response to miRNA transfection or endogenous miRNA knockdown. In parallel, we quantified mRNA levels using microarrays. Here we show that a single miRNA can repress the production of hundreds of proteins, but that this repression is typically relatively mild. A number of known features of the miRNA-binding site such as the seed sequence also govern repression of human protein synthesis, and we report additional target sequence characteristics. We demonstrate that, in addition to downregulating mRNA levels, miRNAs also directly repress translation of hundreds of genes. Finally, our data suggest that a miRNA can, by direct or indirect effects, tune protein synthesis from thousands of genes.
LinkOut: [PMID: 18668040]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177610. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_2_12 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA -0.298 0 -0.246 0.01 82 Click to see details
STAD -0.466 0 -0.434 0.01 32 Click to see details
HNSC -0.408 0 -0.379 0.01 42 Click to see details
PRAD -0.206 0.08 -0.185 0.1 50 Click to see details
BLCA -0.291 0.12 -0.234 0.18 18 Click to see details
PAAD -0.687 0.16 -0.800 0.1 4 Click to see details
KIRC -0.098 0.21 -0.094 0.22 68 Click to see details
THCA -0.078 0.28 -0.007 0.48 59 Click to see details
CHOL -0.221 0.28 -0.383 0.15 9 Click to see details
CESC -0.579 0.3 -0.500 0.33 3 Click to see details
COAD 0.306 0.31 0.400 0.25 5 Click to see details
UCEC 0.097 0.35 0.114 0.32 19 Click to see details
KICH -0.07 0.37 -0.012 0.48 25 Click to see details
KIRP -0.028 0.44 -0.121 0.26 31 Click to see details
ESCA -0.05 0.44 -0.245 0.23 11 Click to see details
LUSC -0.019 0.46 0.067 0.35 36 Click to see details
LUAD -0.033 0.46 -0.056 0.43 12 Click to see details
LIHC -0.012 0.47 0.045 0.38 48 Click to see details
PCPG -1 0.5 -1.000 0.5 3 Click to see details
PCPG -1 0.5 -1.000 0.5 3 Click to see details
PCPG -1 0.5 -1.000 0.5 3 Click to see details
923 hsa-miR-1-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000384 CHRNA4 cholinergic receptor nicotinic alpha 4 subunit 1 1
MIRT000385 MYEF2 myelin expression factor 2 3 3
MIRT000386 RHEB Ras homolog, mTORC1 binding 1 1
MIRT000387 RASA1 RAS p21 protein activator 1 1 1
MIRT000389 CDK9 cyclin dependent kinase 9 1 2
MIRT000390 CEBPA CCAAT/enhancer binding protein alpha 1 1
MIRT000391 MEF2A myocyte enhancer factor 2A 3 4
MIRT000392 BCL2 BCL2, apoptosis regulator 1 2
MIRT000393 GATA4 GATA binding protein 4 2 2
MIRT000933 HCN4 hyperpolarization activated cyclic nucleotide gated potassium channel 4 5 2
MIRT001053 HDAC4 histone deacetylase 4 4 5
MIRT001054 FOXP1 forkhead box P1 4 2
MIRT001205 HCN2 hyperpolarization activated cyclic nucleotide gated potassium and sodium channel 2 4 2
MIRT001321 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 2 1
MIRT001322 WDFY1 WD repeat and FYVE domain containing 1 3 2
MIRT001323 UNC93B1 unc-93 homolog B1, TLR signaling regulator 2 1
MIRT001324 UHRF1 ubiquitin like with PHD and ring finger domains 1 2 1
MIRT001325 TPM3 tropomyosin 3 3 2
MIRT001326 TPM2 tropomyosin 2 3 2
MIRT001327 TPM1 tropomyosin 1 3 2
MIRT001328 THBS1 thrombospondin 1 2 1
MIRT001329 SYNE1 spectrin repeat containing nuclear envelope protein 1 2 1
MIRT001330 SSNA1 SS nuclear autoantigen 1 2 1
MIRT001331 SNX6 sorting nexin 6 2 1
MIRT001332 SLC25A22 solute carrier family 25 member 22 2 1
MIRT001333 SLC25A1 solute carrier family 25 member 1 3 2
MIRT001334 SH3BGRL3 SH3 domain binding glutamate rich protein like 3 2 1
MIRT001335 SFXN1 sideroflexin 1 3 2
MIRT001336 SEC23IP SEC23 interacting protein 2 1
MIRT001337 SAC3D1 SAC3 domain containing 1 2 1
MIRT001338 RFT1 RFT1 homolog 2 1
MIRT001339 PWP1 PWP1 homolog, endonuclein 2 1
MIRT001340 PTPRF protein tyrosine phosphatase, receptor type F 2 1
MIRT001341 PTPLB 3-hydroxyacyl-CoA dehydratase 2 2 1
MIRT001342 PTPLAD1 3-hydroxyacyl-CoA dehydratase 3 2 1
MIRT001343 PTMA prothymosin, alpha 8 11
MIRT001344 PTBP2 polypyrimidine tract binding protein 2 2 1
MIRT001345 PTBP1 polypyrimidine tract binding protein 1 2 1
MIRT001346 PRSS21 protease, serine 21 2 1
MIRT001347 PPIB peptidylprolyl isomerase B 2 1
MIRT001348 POLA2 DNA polymerase alpha 2, accessory subunit 2 1
MIRT001350 PICALM phosphatidylinositol binding clathrin assembly protein 3 2
MIRT001351 PDLIM7 PDZ and LIM domain 7 3 2
MIRT001352 NRP1 neuropilin 1 2 1
MIRT001353 NOTCH2 notch 2 3 2
MIRT001354 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 2 1
MIRT001355 MRC2 mannose receptor C type 2 2 1
MIRT001356 MOV10 Mov10 RISC complex RNA helicase 3 2
MIRT001357 MET MET proto-oncogene, receptor tyrosine kinase 6 7
MIRT001358 LRRC8A leucine rich repeat containing 8 VRAC subunit A 3 3
MIRT001359 LRP1 LDL receptor related protein 1 2 1
MIRT001360 F2 coagulation factor II, thrombin 1 1
MIRT001362 ITGB4 integrin subunit beta 4 2 1
MIRT001363 IQGAP3 IQ motif containing GTPase activating protein 3 2 1
MIRT001364 GPD2 glycerol-3-phosphate dehydrogenase 2 6 2
MIRT001365 GOLGA7 golgin A7 2 1
MIRT001366 GNPNAT1 glucosamine-phosphate N-acetyltransferase 1 2 1
MIRT001367 GAK cyclin G associated kinase 2 1
MIRT001368 EHMT2 euchromatic histone lysine methyltransferase 2 2 1
MIRT001369 EHMT1 euchromatic histone lysine methyltransferase 1 2 1
MIRT001370 EGFR epidermal growth factor receptor 2 1
MIRT001371 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 2 1
MIRT001372 CTSC cathepsin C 2 1
MIRT001373 CSRP1 cysteine and glycine rich protein 1 3 2
MIRT001374 CPOX coproporphyrinogen oxidase 2 1
MIRT001375 CORO1C coronin 1C 5 1
MIRT001376 COIL coilin 2 1
MIRT001377 CDCP1 CUB domain containing protein 1 3 2
MIRT001378 CAND1 cullin associated and neddylation dissociated 1 4 3
MIRT001380 BRI3BP BRI3 binding protein 3 2
MIRT001381 BCKDHB branched chain keto acid dehydrogenase E1 subunit beta 2 1
MIRT001382 ATP6V0A1 ATPase H+ transporting V0 subunit a1 2 1
MIRT001383 ASH2L ASH2 like histone lysine methyltransferase complex subunit 2 1
MIRT001384 ARID2 AT-rich interaction domain 2 2 1
MIRT001385 ARID1A AT-rich interaction domain 1A 2 1
MIRT001386 AP3D1 adaptor related protein complex 3 delta 1 subunit 2 1
MIRT001387 AP3B1 adaptor related protein complex 3 beta 1 subunit 2 1
MIRT001388 ANXA2 annexin A2 5 3
MIRT001389 ANPEP alanyl aminopeptidase, membrane 2 1
MIRT001390 ANP32B acidic nuclear phosphoprotein 32 family member B 4 3
MIRT001391 AGRN agrin 2 1
MIRT001392 AGMAT agmatinase 2 1
MIRT001393 ADPGK ADP dependent glucokinase 2 1
MIRT001394 ABHD11 abhydrolase domain containing 11 2 1
MIRT001843 HAND2 heart and neural crest derivatives expressed 2 3 2
MIRT001844 IGF1 insulin like growth factor 1 6 3
MIRT001845 TMSB4X thymosin beta 4, X-linked 2 1
MIRT001847 SH3PXD2B SH3 and PX domains 2B 1 2
MIRT001983 KCNJ2 potassium voltage-gated channel subfamily J member 2 5 5
MIRT001984 GJA1 gap junction protein alpha 1 4 5
MIRT002733 ZNF264 zinc finger protein 264 2 2
MIRT002735 GCFC2 GC-rich sequence DNA-binding factor 2 2 1
MIRT002736 OAT ornithine aminotransferase 3 2
MIRT002737 CLCN3 chloride voltage-gated channel 3 2 1
MIRT002738 POLR2K RNA polymerase II subunit K 2 1
MIRT002739 EPB41L4B erythrocyte membrane protein band 4.1 like 4B 2 2
MIRT002740 DHX15 DEAH-box helicase 15 3 2
MIRT002741 LZTFL1 leucine zipper transcription factor like 1 2 1
MIRT002742 ARF3 ADP ribosylation factor 3 2 1
MIRT002743 OSBPL7 oxysterol binding protein like 7 2 1
MIRT002746 HIST1H3B histone cluster 1 H3 family member b 2 1
MIRT002747 SH2D4A SH2 domain containing 4A 2 1
MIRT002748 TRIM2 tripartite motif containing 2 2 1
MIRT002749 PLEKHG2 pleckstrin homology and RhoGEF domain containing G2 1 1
MIRT002750 RABL2B RAB, member of RAS oncogene family like 2B 2 1
MIRT002751 XPO6 exportin 6 5 3
MIRT002752 ARCN1 archain 1 3 3
MIRT002753 FBLN2 fibulin 2 2 1
MIRT002754 CERS2 ceramide synthase 2 4 4
MIRT002755 PLEKHB2 pleckstrin homology domain containing B2 2 2
MIRT002756 POM121 POM121 transmembrane nucleoporin 3 2
MIRT002758 AXL AXL receptor tyrosine kinase 3 2
MIRT002759 POGK pogo transposable element derived with KRAB domain 3 1
MIRT002760 BLCAP bladder cancer associated protein 2 2
MIRT002761 MXD4 MAX dimerization protein 4 2 1
MIRT002762 KIAA1598 shootin 1 2 1
MIRT002765 EML4 echinoderm microtubule associated protein like 4 2 1
MIRT002766 PGM2 phosphoglucomutase 2 3 1
MIRT002767 TRAPPC3 trafficking protein particle complex 3 2 1
MIRT002768 CHSY1 chondroitin sulfate synthase 1 2 1
MIRT002769 MGC27345 uncharacterized protein MGC27345 1 1
MIRT002771 HIST1H3I histone cluster 1 H3 family member i 1 1
MIRT002772 GCH1 GTP cyclohydrolase 1 2 1
MIRT002776 SERPINB5 serpin family B member 5 2 2
MIRT002777 SLC25A30 solute carrier family 25 member 30 2 2
MIRT002779 ANKRD29 ankyrin repeat domain 29 2 1
MIRT002780 TDP1 tyrosyl-DNA phosphodiesterase 1 2 1
MIRT002782 TPM4 tropomyosin 4 3 3
MIRT002783 PREX1 phosphatidylinositol-3,4,5-trisphosphate dependent Rac exchange factor 1 2 1
MIRT002785 PDCD4 programmed cell death 4 2 2
MIRT002787 RNF138 ring finger protein 138 4 4
MIRT002788 TAGLN2 transgelin 2 6 7
MIRT002789 CHST11 carbohydrate sulfotransferase 11 2 1
MIRT002792 RABL2A RAB, member of RAS oncogene family like 2A 2 1
MIRT002793 LIN7C lin-7 homolog C, crumbs cell polarity complex component 2 2
MIRT002794 H3F3B H3 histone family member 3B 4 6
MIRT002795 SDC4 syndecan 4 2 2
MIRT002797 RABGAP1L RAB GTPase activating protein 1 like 2 1
MIRT002798 CAP1 cyclase associated actin cytoskeleton regulatory protein 1 3 2
MIRT002799 DDX5 DEAD-box helicase 5 3 2
MIRT002800 SLC16A9 solute carrier family 16 member 9 2 2
MIRT002801 ARHGEF18 Rho/Rac guanine nucleotide exchange factor 18 2 2
MIRT002802 INPP5F inositol polyphosphate-5-phosphatase F 2 2
MIRT002804 TH1L negative elongation factor complex member C/D 3 3
MIRT002805 ANKIB1 ankyrin repeat and IBR domain containing 1 2 2
MIRT002806 SERP1 stress associated endoplasmic reticulum protein 1 7 4
MIRT002807 TIMP3 TIMP metallopeptidase inhibitor 3 2 2
MIRT002808 LASP1 LIM and SH3 protein 1 5 3
MIRT002809 HPS4 HPS4, biogenesis of lysosomal organelles complex 3 subunit 2 2 2
MIRT002811 UST uronyl 2-sulfotransferase 2 2
MIRT002812 RAB11FIP2 RAB11 family interacting protein 2 2 1
MIRT002813 PTMAP7 prothymosin, alpha pseudogene 7 1 1
MIRT002814 MMD monocyte to macrophage differentiation associated 2 2
MIRT002815 NETO2 neuropilin and tolloid like 2 3 2
MIRT002816 GNPDA2 glucosamine-6-phosphate deaminase 2 2 2
MIRT002817 ACPL2 2-phosphoxylose phosphatase 1 2 2
MIRT002819 MTX1 metaxin 1 3 2
MIRT002820 ADAR adenosine deaminase, RNA specific 4 3
MIRT002823 ARF4 ADP ribosylation factor 4 3 2
MIRT002824 UHMK1 U2AF homology motif kinase 1 2 2
MIRT002924 KCNE1 potassium voltage-gated channel subfamily E regulatory subunit 1 4 2
MIRT002955 BDNF brain derived neurotrophic factor 2 1
MIRT002956 G6PD glucose-6-phosphate dehydrogenase 6 5
MIRT003203 SOX6 SRY-box 6 2 1
MIRT003524 ATP6V1B2 ATPase H+ transporting V1 subunit B2 3 3
MIRT003525 LARP4 La ribonucleoprotein domain family member 4 2 1
MIRT003526 CNN3 calponin 3 3 2
MIRT003762 ARHGAP29 Rho GTPase activating protein 29 2 1
MIRT003763 CDK14 cyclin dependent kinase 14 2 1
MIRT003764 MTMR12 myotubularin related protein 12 2 2
MIRT003765 PNP purine nucleoside phosphorylase 5 5
MIRT003766 CCSAP centriole, cilia and spindle associated protein 2 1
MIRT003767 XPNPEP3 X-prolyl aminopeptidase 3 2 1
MIRT003768 FAM57A family with sequence similarity 57 member A 2 2
MIRT003769 TNS4 tensin 4 2 1
MIRT003770 SLC44A1 solute carrier family 44 member 1 2 3
MIRT003771 IFT52 intraflagellar transport 52 2 1
MIRT003772 SRXN1 sulfiredoxin 1 3 2
MIRT003847 RBM47 RNA binding motif protein 47 2 2
MIRT003848 C1orf56 chromosome 1 open reading frame 56 2 1
MIRT003849 C12orf49 chromosome 12 open reading frame 49 2 2
MIRT003850 IP6K2 inositol hexakisphosphate kinase 2 2 2
MIRT003851 CNOT6 CCR4-NOT transcription complex subunit 6 2 1
MIRT003852 KLHDC5 kelch like family member 42 2 2
MIRT003853 KIF2A kinesin family member 2A 4 3
MIRT003976 HSPD1 heat shock protein family D (Hsp60) member 1 2 5
MIRT003977 HSPA4 heat shock protein family A (Hsp70) member 4 2 3
MIRT004322 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 4 3
MIRT004467 CALM3 calmodulin 3 2 2
MIRT004602 PPP2R5A protein phosphatase 2 regulatory subunit B'alpha 3 1
MIRT004670 PAX3 paired box 3 6 2
MIRT004983 TSPAN4 tetraspanin 4 2 1
MIRT005072 SRSF9 serine and arginine rich splicing factor 9 7 4
MIRT005089 TWF1 twinfilin actin binding protein 1 6 3
MIRT005273 ZNF384 zinc finger protein 384 2 1
MIRT005274 SNAPIN SNAP associated protein 2 1
MIRT005275 NSUN4 NOP2/Sun RNA methyltransferase family member 4 2 1
MIRT005277 WDR11 WD repeat domain 11 2 1
MIRT005278 MON2 MON2 homolog, regulator of endosome-to-Golgi trafficking 2 1
MIRT005279 TMX1 thioredoxin related transmembrane protein 1 2 1
MIRT005280 RNF213 ring finger protein 213 2 1
MIRT005281 FERMT2 fermitin family member 2 2 1
MIRT005282 HNRNPU heterogeneous nuclear ribonucleoprotein U 2 1
MIRT005283 ARMC10 armadillo repeat containing 10 2 1
MIRT005284 PSMG1 proteasome assembly chaperone 1 2 1
MIRT005285 RRBP1 ribosome binding protein 1 2 1
MIRT005439 IRF2BPL interferon regulatory factor 2 binding protein like 2 1
MIRT005539 TWF2 twinfilin actin binding protein 2 4 1
MIRT005904 CALM2 calmodulin 2 4 4
MIRT005905 GATA6 GATA binding protein 6 1 1
MIRT006132 FN1 fibronectin 1 4 2
MIRT006550 NOTCH3 notch 3 4 3
MIRT006819 SLC8A1 solute carrier family 8 member A1 4 2
MIRT006855 EDN1 endothelin 1 5 6
MIRT007205 PRKCE protein kinase C epsilon 1 1
MIRT007213 FABP3 fatty acid binding protein 3 3 1
MIRT007214 SNAI2 snail family transcriptional repressor 2 3 2
MIRT007222 SOX9 SRY-box 9 1 1
MIRT023484 CDC42BPB CDC42 binding protein kinase beta 1 1
MIRT023485 SRRM1 serine and arginine repetitive matrix 1 1 1
MIRT023486 CD44 CD44 molecule (Indian blood group) 1 1
MIRT023487 SPRY2 sprouty RTK signaling antagonist 2 1 1
MIRT023488 MECR mitochondrial trans-2-enoyl-CoA reductase 1 1
MIRT023489 CUL4B cullin 4B 1 1
MIRT023490 RAB34 RAB34, member RAS oncogene family 1 1
MIRT023491 SOX5 SRY-box 5 1 1
MIRT023492 YTHDC1 YTH domain containing 1 1 1
MIRT023493 DGKH diacylglycerol kinase eta 1 1
MIRT023494 FGFR2 fibroblast growth factor receptor 2 1 1
MIRT023495 OCIAD2 OCIA domain containing 2 1 1
MIRT023496 SYMPK symplekin 1 1
MIRT023497 LIPC lipase C, hepatic type 1 1
MIRT023498 CBR4 carbonyl reductase 4 1 1
MIRT023499 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 1
MIRT023500 AP2S1 adaptor related protein complex 2 sigma 1 subunit 1 1
MIRT023501 IL6 interleukin 6 1 1
MIRT023502 RCC2 regulator of chromosome condensation 2 1 1
MIRT023503 WLS wntless Wnt ligand secretion mediator 1 1
MIRT023504 CRELD2 cysteine rich with EGF like domains 2 1 1
MIRT023505 GNG5 G protein subunit gamma 5 1 1
MIRT023506 AGTRAP angiotensin II receptor associated protein 1 1
MIRT023507 HEATR2 dynein axonemal assembly factor 5 1 1
MIRT023508 UGT8 UDP glycosyltransferase 8 1 1
MIRT023509 ABCB5 ATP binding cassette subfamily B member 5 1 1
MIRT023510 PARD6B par-6 family cell polarity regulator beta 1 1
MIRT023511 ALG3 ALG3, alpha-1,3- mannosyltransferase 1 1
MIRT023512 HIST2H3A histone cluster 2 H3 family member a 1 1
MIRT023513 ACTA1 actin, alpha 1, skeletal muscle 1 1
MIRT023514 SAMD15 sterile alpha motif domain containing 15 1 1
MIRT023515 DRAP1 DR1 associated protein 1 1 1
MIRT023516 MDC1 mediator of DNA damage checkpoint 1 1 1
MIRT023517 CD63 CD63 molecule 1 1
MIRT023518 KNCN kinocilin 1 1
MIRT023519 FANCI Fanconi anemia complementation group I 1 1
MIRT023520 GJB3 gap junction protein beta 3 1 1
MIRT023521 STK24 serine/threonine kinase 24 1 1
MIRT023522 MCM3 minichromosome maintenance complex component 3 1 1
MIRT023523 DMTN dematin actin binding protein 1 1
MIRT023524 SIN3A SIN3 transcription regulator family member A 1 1
MIRT023525 ZNF561 zinc finger protein 561 1 1
MIRT023526 C1orf173 glutamate rich 3 1 1
MIRT023527 BMP7 bone morphogenetic protein 7 1 1
MIRT023528 SLC39A14 solute carrier family 39 member 14 1 1
MIRT023529 MOBP myelin-associated oligodendrocyte basic protein 1 1
MIRT023530 H1FX H1 histone family member X 1 1
MIRT023531 CBX5 chromobox 5 1 1
MIRT023532 ATL3 atlastin GTPase 3 1 1
MIRT023533 BAG5 BCL2 associated athanogene 5 1 1
MIRT023534 CPSF3 cleavage and polyadenylation specific factor 3 1 1
MIRT023535 SGK3 serum/glucocorticoid regulated kinase family member 3 1 1
MIRT023536 ALDH2 aldehyde dehydrogenase 2 family (mitochondrial) 1 1
MIRT023537 USP33 ubiquitin specific peptidase 33 1 1
MIRT023538 RIMS2 regulating synaptic membrane exocytosis 2 1 1
MIRT023539 LETM1 leucine zipper and EF-hand containing transmembrane protein 1 1 1
MIRT023540 RAP1B RAP1B, member of RAS oncogene family 1 1
MIRT023541 GOLPH3 golgi phosphoprotein 3 1 1
MIRT023542 PGD phosphogluconate dehydrogenase 3 2
MIRT023543 UTRN utrophin 1 1
MIRT023544 GPR137C G protein-coupled receptor 137C 1 1
MIRT023545 FBXO33 F-box protein 33 1 1
MIRT023546 ITGA6 integrin subunit alpha 6 2 2
MIRT023547 SRF serum response factor 1 1
MIRT023548 MRPL19 mitochondrial ribosomal protein L19 2 1
MIRT023549 JUP junction plakoglobin 2 1
MIRT023550 KIF5B kinesin family member 5B 2 1
MIRT023551 SLC27A4 solute carrier family 27 member 4 2 1
MIRT023552 GNAI1 G protein subunit alpha i1 2 1
MIRT023553 PLS3 plastin 3 2 1
MIRT023554 MYO1A myosin IA 2 1
MIRT023555 AP1B1 adaptor related protein complex 1 beta 1 subunit 2 2
MIRT023556 FNDC3A fibronectin type III domain containing 3A 4 4
MIRT023557 FLOT2 flotillin 2 2 2
MIRT023558 PSIP1 PC4 and SFRS1 interacting protein 1 2 2
MIRT023559 MYO1B myosin IB 2 2
MIRT023560 CAPN1 calpain 1 1 1
MIRT023561 TAT tyrosine aminotransferase 1 1
MIRT023562 PCDH7 protocadherin 7 1 1
MIRT023563 HNRNPH1 heterogeneous nuclear ribonucleoprotein H1 1 1
MIRT023564 PYGB glycogen phosphorylase B 1 1
MIRT023565 CCDC88C coiled-coil domain containing 88C 1 1
MIRT023566 RBM42 RNA binding motif protein 42 1 1
MIRT023567 ABCB6 ATP binding cassette subfamily B member 6 (Langereis blood group) 1 1
MIRT023568 UNC13D unc-13 homolog D 1 1
MIRT023569 DTX1 deltex E3 ubiquitin ligase 1 1 1
MIRT023570 LGALS1 galectin 1 1 1
MIRT023571 LEPREL2 prolyl 3-hydroxylase 3 1 1
MIRT023572 KLHDC4 kelch domain containing 4 1 1
MIRT023573 SLBP stem-loop binding protein 1 1
MIRT023574 PI16 peptidase inhibitor 16 1 1
MIRT023575 RBM12B RNA binding motif protein 12B 1 1
MIRT023576 CALR calreticulin 1 1
MIRT023577 F2RL1 F2R like trypsin receptor 1 1 1
MIRT023578 SLC25A19 solute carrier family 25 member 19 1 1
MIRT023579 HIST2H2AC histone cluster 2 H2A family member c 1 1
MIRT023580 ABHD12 abhydrolase domain containing 12 1 1
MIRT023581 MCAM melanoma cell adhesion molecule 1 1
MIRT023582 PTPMT1 protein tyrosine phosphatase, mitochondrial 1 1 1
MIRT023583 COQ6 coenzyme Q6, monooxygenase 1 1
MIRT023584 RFC5 replication factor C subunit 5 1 1
MIRT023585 ZNF579 zinc finger protein 579 1 1
MIRT023586 TRIM26 tripartite motif containing 26 1 1
MIRT023587 SPC24 SPC24, NDC80 kinetochore complex component 1 1
MIRT023588 SEC11C SEC11 homolog C, signal peptidase complex subunit 1 1
MIRT023589 SEMG2 semenogelin II 1 1
MIRT023590 RASSF1 Ras association domain family member 1 1 1
MIRT023591 C11orf31 selenoprotein H 1 1
MIRT023592 MACROD1 MACRO domain containing 1 1 1
MIRT023593 HIST1H1B histone cluster 1 H1 family member b 1 1
MIRT023594 PLXDC2 plexin domain containing 2 1 1
MIRT023595 NXPH2 neurexophilin 2 1 1
MIRT023596 SYNE2 spectrin repeat containing nuclear envelope protein 2 1 1
MIRT023597 TRPM6 transient receptor potential cation channel subfamily M member 6 1 1
MIRT023598 CAD carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase 1 1
MIRT023599 SH3TC2 SH3 domain and tetratricopeptide repeats 2 1 1
MIRT023600 VASP vasodilator stimulated phosphoprotein 1 1
MIRT023601 ATP6V1C1 ATPase H+ transporting V1 subunit C1 1 1
MIRT023602 AKAP12 A-kinase anchoring protein 12 1 1
MIRT023603 ATP2B4 ATPase plasma membrane Ca2+ transporting 4 1 1
MIRT023604 CLDN12 claudin 12 1 1
MIRT023605 CHAMP1 chromosome alignment maintaining phosphoprotein 1 1 1
MIRT023606 PPM1H protein phosphatase, Mg2+/Mn2+ dependent 1H 1 1
MIRT023607 G3BP2 G3BP stress granule assembly factor 2 1 1
MIRT023608 VPS53 VPS53, GARP complex subunit 1 1
MIRT023609 IPO8 importin 8 1 1
MIRT023610 AKAP4 A-kinase anchoring protein 4 1 1
MIRT023611 VMP1 vacuole membrane protein 1 1 1
MIRT023612 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT023613 DKK1 dickkopf WNT signaling pathway inhibitor 1 1 1
MIRT023614 ZNF326 zinc finger protein 326 1 1
MIRT023615 FAM102A family with sequence similarity 102 member A 1 1
MIRT023616 PLXNA4 plexin A4 1 1
MIRT023617 RABEPK Rab9 effector protein with kelch motifs 1 1
MIRT023618 FUBP1 far upstream element binding protein 1 1 1
MIRT023619 MATR3 matrin 3 3 3
MIRT023620 GNAI2 G protein subunit alpha i2 2 1
MIRT023621 CCDC124 coiled-coil domain containing 124 2 1
MIRT023622 RALB RAS like proto-oncogene B 2 1
MIRT023623 GTF3C6 general transcription factor IIIC subunit 6 2 1
MIRT023624 EMD emerin 2 1
MIRT023625 ECHS1 enoyl-CoA hydratase, short chain 1 2 1
MIRT023626 SEPT6 septin 6 2 1
MIRT023627 CACNA2D1 calcium voltage-gated channel auxiliary subunit alpha2delta 1 2 1
MIRT023628 PXDN peroxidasin 3 3
MIRT023629 AMDHD1 amidohydrolase domain containing 1 1 1
MIRT023630 THAP2 THAP domain containing 2 1 1
MIRT023631 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT023632 NAT14 N-acetyltransferase 14 (putative) 1 1
MIRT023633 DDTL D-dopachrome tautomerase like 1 1
MIRT023634 PLCXD2 phosphatidylinositol specific phospholipase C X domain containing 2 1 1
MIRT023635 BTC betacellulin 1 1
MIRT023636 ILVBL ilvB acetolactate synthase like 1 1
MIRT023637 RRM1 ribonucleotide reductase catalytic subunit M1 1 1
MIRT023638 GPR83 G protein-coupled receptor 83 1 1
MIRT023639 PPA2 pyrophosphatase (inorganic) 2 1 1
MIRT023640 DYNC1LI1 dynein cytoplasmic 1 light intermediate chain 1 1 1
MIRT023641 NPTN neuroplastin 1 1
MIRT023642 MAGEB3 MAGE family member B3 1 1
MIRT023643 PSG6 pregnancy specific beta-1-glycoprotein 6 1 1
MIRT023644 ORC3 origin recognition complex subunit 3 1 1
MIRT023645 SFI1 SFI1 centrin binding protein 1 1
MIRT023646 PAXBP1 PAX3 and PAX7 binding protein 1 1 1
MIRT023647 HSPA1A heat shock protein family A (Hsp70) member 1A 1 1
MIRT023648 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT023649 PSG3 pregnancy specific beta-1-glycoprotein 3 1 1
MIRT023650 MPRIP myosin phosphatase Rho interacting protein 1 1
MIRT023651 PRIMA1 proline rich membrane anchor 1 1 1
MIRT023652 ACP2 acid phosphatase 2, lysosomal 1 1
MIRT023653 IL11 interleukin 11 2 2
MIRT023654 EXOC2 exocyst complex component 2 1 1
MIRT023655 C12orf57 chromosome 12 open reading frame 57 1 1
MIRT023656 CDH4 cadherin 4 1 1
MIRT023657 KLHL3 kelch like family member 3 1 1
MIRT023658 MRE11A MRE11 homolog, double strand break repair nuclease 1 1
MIRT023659 SPERT spermatid associated 1 1
MIRT023660 TRPM4 transient receptor potential cation channel subfamily M member 4 1 1
MIRT023661 CAST calpastatin 1 1
MIRT023662 SCAF11 SR-related CTD associated factor 11 1 1
MIRT023663 KCND1 potassium voltage-gated channel subfamily D member 1 1 1
MIRT023664 CHAF1B chromatin assembly factor 1 subunit B 1 1
MIRT023665 SYTL2 synaptotagmin like 2 1 1
MIRT023666 UGGT2 UDP-glucose glycoprotein glucosyltransferase 2 1 1
MIRT023667 SRSF4 serine and arginine rich splicing factor 4 1 1
MIRT023668 ZC3H11A zinc finger CCCH-type containing 11A 1 1
MIRT023669 TMEM106C transmembrane protein 106C 1 1
MIRT023670 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT023671 OSBPL10 oxysterol binding protein like 10 1 1
MIRT023672 KLK12 kallikrein related peptidase 12 1 1
MIRT023673 INTS6 integrator complex subunit 6 1 1
MIRT023674 MKI67 marker of proliferation Ki-67 1 1
MIRT023675 NUP50 nucleoporin 50 3 7
MIRT023676 SHE Src homology 2 domain containing E 1 1
MIRT023677 ABCB7 ATP binding cassette subfamily B member 7 1 1
MIRT023678 PPARG peroxisome proliferator activated receptor gamma 1 1
MIRT023679 MAD2L1 mitotic arrest deficient 2 like 1 2 1
MIRT023680 MKI67IP nucleolar protein interacting with the FHA domain of MKI67 2 1
MIRT023681 ACTN4 actinin alpha 4 2 1
MIRT023682 TNKS1BP1 tankyrase 1 binding protein 1 2 1
MIRT023683 PIGT phosphatidylinositol glycan anchor biosynthesis class T 2 1
MIRT023684 PGRMC2 progesterone receptor membrane component 2 2 1
MIRT023685 COMMD2 COMM domain containing 2 2 1
MIRT023686 CD109 CD109 molecule 2 2
MIRT023687 COPG1 coatomer protein complex subunit gamma 1 2 2
MIRT023688 DSG2 desmoglein 2 2 2
MIRT023689 DCUN1D1 defective in cullin neddylation 1 domain containing 1 2 2
MIRT023690 SMARCA1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1 1 1
MIRT023691 MSH2 mutS homolog 2 1 1
MIRT023692 IKBKAP elongator complex protein 1 1 1
MIRT023693 DHRS1 dehydrogenase/reductase 1 1 1
MIRT023694 CCL14 C-C motif chemokine ligand 14 1 1
MIRT023695 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023696 ETV7 ETS variant 7 1 1
MIRT023697 HMOX1 heme oxygenase 1 1 1
MIRT023698 KAT2A lysine acetyltransferase 2A 1 1
MIRT023699 KANK2 KN motif and ankyrin repeat domains 2 1 1
MIRT023700 SYNPO2L synaptopodin 2 like 1 1
MIRT023701 GLTSCR2 NOP53 ribosome biogenesis factor 1 1
MIRT023702 NCAPD3 non-SMC condensin II complex subunit D3 1 1
MIRT023703 PAFAH1B3 platelet activating factor acetylhydrolase 1b catalytic subunit 3 1 1
MIRT023704 ADAMTSL4 ADAMTS like 4 1 1
MIRT023705 ACADVL acyl-CoA dehydrogenase, very long chain 1 1
MIRT023706 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 1
MIRT023707 HSP90B1 heat shock protein 90 beta family member 1 3 5
MIRT023708 EMP3 epithelial membrane protein 3 1 1
MIRT023709 FAM81A family with sequence similarity 81 member A 2 2
MIRT023710 SPINK1 serine peptidase inhibitor, Kazal type 1 1 1
MIRT023711 AGPAT6 glycerol-3-phosphate acyltransferase 4 1 1
MIRT023712 NT5C1B 5'-nucleotidase, cytosolic IB 3 3
MIRT023713 OXTR oxytocin receptor 1 1
MIRT023714 DPP7 dipeptidyl peptidase 7 1 1
MIRT023715 FAM208A family with sequence similarity 208 member A 1 1
MIRT023716 MPDU1 mannose-P-dolichol utilization defect 1 1 1
MIRT023717 PSG9 pregnancy specific beta-1-glycoprotein 9 1 1
MIRT023718 FHDC1 FH2 domain containing 1 1 1
MIRT023719 ANKFY1 ankyrin repeat and FYVE domain containing 1 1 1
MIRT023720 NR5A2 nuclear receptor subfamily 5 group A member 2 1 1
MIRT023721 NXN nucleoredoxin 1 1
MIRT023722 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023723 H3F3C H3 histone family member 3C 3 9
MIRT023724 HDAC2 histone deacetylase 2 1 1
MIRT023725 LHX4 LIM homeobox 4 1 1
MIRT023726 CDC42 cell division cycle 42 1 1
MIRT023727 ZBTB9 zinc finger and BTB domain containing 9 1 1
MIRT023728 NCAPG non-SMC condensin I complex subunit G 1 1
MIRT023729 AP1S3 adaptor related protein complex 1 sigma 3 subunit 1 1
MIRT023730 BCAP29 B-cell receptor associated protein 29 1 1
MIRT023731 TSHR thyroid stimulating hormone receptor 1 1
MIRT023732 PDE12 phosphodiesterase 12 1 1
MIRT023733 ADAM12 ADAM metallopeptidase domain 12 1 1
MIRT023734 ATP6V1A ATPase H+ transporting V1 subunit A 1 1
MIRT023735 HOOK1 hook microtubule tethering protein 1 1 1
MIRT023736 PFDN1 prefoldin subunit 1 1 1
MIRT023737 TMCC1 transmembrane and coiled-coil domain family 1 1 1
MIRT023738 SUSD1 sushi domain containing 1 1 1
MIRT023739 SEC62 SEC62 homolog, preprotein translocation factor 1 1
MIRT023740 SMARCC1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin subfamily c member 1 1 1
MIRT023741 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 3 2
MIRT023742 NXT2 nuclear transport factor 2 like export factor 2 1 1
MIRT023743 ACTN1 actinin alpha 1 2 1
MIRT023744 EIF4G1 eukaryotic translation initiation factor 4 gamma 1 2 1
MIRT023745 COPZ1 coatomer protein complex subunit zeta 1 2 1
MIRT023746 MOB4 MOB family member 4, phocein 2 1
MIRT023747 RSRC2 arginine and serine rich coiled-coil 2 2 1
MIRT023748 MYO3B myosin IIIB 2 1
MIRT023749 PDIA3 protein disulfide isomerase family A member 3 2 1
MIRT023750 FLNB filamin B 2 1
MIRT023751 CHRAC1 chromatin accessibility complex 1 2 1
MIRT023752 PLS1 plastin 1 2 1
MIRT023753 POM121C POM121 transmembrane nucleoporin C 2 2
MIRT023754 LRRC8C leucine rich repeat containing 8 VRAC subunit C 2 2
MIRT023755 OXCT1 3-oxoacid CoA-transferase 1 2 1
MIRT023756 WASF2 WAS protein family member 2 2 1
MIRT023757 FLNA filamin A 2 2
MIRT023758 IGFBP7 insulin like growth factor binding protein 7 1 1
MIRT023759 FBN1 fibrillin 1 1 1
MIRT023760 PNN pinin, desmosome associated protein 1 1
MIRT023761 NCS1 neuronal calcium sensor 1 1 1
MIRT023762 WDR33 WD repeat domain 33 1 1
MIRT023763 MSH6 mutS homolog 6 1 1
MIRT023764 RAB27B RAB27B, member RAS oncogene family 1 1
MIRT023765 MAN1B1 mannosidase alpha class 1B member 1 1 1
MIRT023766 OASL 2'-5'-oligoadenylate synthetase like 1 1
MIRT023767 IFIT3 interferon induced protein with tetratricopeptide repeats 3 1 1
MIRT023768 TMEM87A transmembrane protein 87A 1 1
MIRT023769 TUBB2B tubulin beta 2B class IIb 1 1
MIRT023770 SNRNP35 small nuclear ribonucleoprotein U11/U12 subunit 35 1 1
MIRT023771 ZNF799 zinc finger protein 799 1 1
MIRT023772 C6orf118 chromosome 6 open reading frame 118 1 1
MIRT023773 HERC2 HECT and RLD domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023774 HINT2 histidine triad nucleotide binding protein 2 1 1
MIRT023775 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 1
MIRT023776 DPY30 dpy-30, histone methyltransferase complex regulatory subunit 1 1
MIRT023777 RGN regucalcin 1 1
MIRT023778 MFSD10 major facilitator superfamily domain containing 10 1 1
MIRT023779 PRKAG1 protein kinase AMP-activated non-catalytic subunit gamma 1 1 1
MIRT023780 CENPF centromere protein F 1 1
MIRT023781 SLC25A10 solute carrier family 25 member 10 1 1
MIRT023782 PLK2 polo like kinase 2 1 1
MIRT023783 IQCD IQ motif containing D 1 1
MIRT023784 CCDC134 coiled-coil domain containing 134 1 1
MIRT023785 ORMDL2 ORMDL sphingolipid biosynthesis regulator 2 1 1
MIRT023786 TRIM9 tripartite motif containing 9 1 1
MIRT023787 PPP2R2A protein phosphatase 2 regulatory subunit Balpha 1 1
MIRT023788 AIM2 absent in melanoma 2 1 1
MIRT023789 PHLDB2 pleckstrin homology like domain family B member 2 1 1
MIRT023790 TPD52L2 tumor protein D52 like 2 1 1
MIRT023791 LNPEP leucyl and cystinyl aminopeptidase 1 1
MIRT023792 RASSF5 Ras association domain family member 5 1 1
MIRT023793 KIF4A kinesin family member 4A 1 1
MIRT023795 PARVA parvin alpha 1 1
MIRT023796 LIFR LIF receptor alpha 1 1
MIRT023797 PSAT1 phosphoserine aminotransferase 1 1 1
MIRT023798 FMNL3 formin like 3 1 1
MIRT023799 EFR3A EFR3 homolog A 1 1
MIRT023800 CCND1 cyclin D1 2 2
MIRT023801 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT023802 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023803 RAPGEF2 Rap guanine nucleotide exchange factor 2 1 1
MIRT023804 SRSF6 serine and arginine rich splicing factor 6 1 1
MIRT023805 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT023806 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023807 SRI sorcin 1 1
MIRT023808 E2F5 E2F transcription factor 5 1 1
MIRT023809 EIF4E eukaryotic translation initiation factor 4E 1 1
MIRT023810 SIGMAR1 sigma non-opioid intracellular receptor 1 2 1
MIRT023811 GPC1 glypican 1 2 1
MIRT023812 LEPREL4 prolyl 3-hydroxylase family member 4 (non-enzymatic) 2 1
MIRT023813 CCDC22 coiled-coil domain containing 22 2 1
MIRT023814 FNDC3B fibronectin type III domain containing 3B 2 2
MIRT023815 PDCD10 programmed cell death 10 2 2
MIRT023816 C12orf10 chromosome 12 open reading frame 10 1 1
MIRT023817 BRDT bromodomain testis associated 1 1
MIRT023818 PROCR protein C receptor 1 1
MIRT023819 CPSF1 cleavage and polyadenylation specific factor 1 1 1
MIRT023820 RFC2 replication factor C subunit 2 1 1
MIRT023821 PACSIN3 protein kinase C and casein kinase substrate in neurons 3 1 1
MIRT023822 BCL6B B-cell CLL/lymphoma 6B 1 1
MIRT023823 HSD17B8 hydroxysteroid 17-beta dehydrogenase 8 1 1
MIRT023824 CXCL3 C-X-C motif chemokine ligand 3 1 1
MIRT023825 AMZ1 archaelysin family metallopeptidase 1 1 1
MIRT023826 FADD Fas associated via death domain 1 1
MIRT023827 CLEC1A C-type lectin domain family 1 member A 1 1
MIRT023828 ANGPTL4 angiopoietin like 4 1 1
MIRT023829 FRG1 FSHD region gene 1 1 1
MIRT023830 IL27RA interleukin 27 receptor subunit alpha 1 1
MIRT023831 CA3 carbonic anhydrase 3 1 1
MIRT023832 PIGS phosphatidylinositol glycan anchor biosynthesis class S 1 1
MIRT023833 MME membrane metalloendopeptidase 1 1
MIRT023834 ETNK1 ethanolamine kinase 1 1 1
MIRT023835 IFIT2 interferon induced protein with tetratricopeptide repeats 2 1 1
MIRT023836 CRYGS crystallin gamma S 1 1
MIRT023837 MCM2 minichromosome maintenance complex component 2 1 1
MIRT023838 GIMAP4 GTPase, IMAP family member 4 1 1
MIRT023839 ACTC1 actin, alpha, cardiac muscle 1 1 1
MIRT023840 ANP32A acidic nuclear phosphoprotein 32 family member A 1 1
MIRT023841 SMC4 structural maintenance of chromosomes 4 1 1
MIRT023842 YTHDF2 YTH N6-methyladenosine RNA binding protein 2 1 1
MIRT023843 ERMN ermin 1 1
MIRT023844 RBM39 RNA binding motif protein 39 1 1
MIRT023845 IFI44 interferon induced protein 44 1 1
MIRT023846 TPSD1 tryptase delta 1 1 1
MIRT023847 DROSHA drosha ribonuclease III 1 1
MIRT023848 TTC37 tetratricopeptide repeat domain 37 1 1
MIRT023849 NUAK1 NUAK family kinase 1 1 1
MIRT023850 ZNF207 zinc finger protein 207 1 1
MIRT023851 GNRHR gonadotropin releasing hormone receptor 1 1
MIRT023852 LEMD3 LEM domain containing 3 1 1
MIRT023853 UBA6 ubiquitin like modifier activating enzyme 6 1 1
MIRT023854 RHOC ras homolog family member C 1 1
MIRT023855 RAB30 RAB30, member RAS oncogene family 1 1
MIRT023856 SCN3A sodium voltage-gated channel alpha subunit 3 1 1
MIRT023857 PRKG2 protein kinase, cGMP-dependent, type II 1 1
MIRT023858 PLCB3 phospholipase C beta 3 1 1
MIRT023859 PIR pirin 1 1
MIRT023860 NAB1 NGFI-A binding protein 1 1 1
MIRT023861 FUBP3 far upstream element binding protein 3 1 1
MIRT023862 HSD17B11 hydroxysteroid 17-beta dehydrogenase 11 1 1
MIRT023863 FMNL2 formin like 2 1 1
MIRT023864 SMARCB1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 1 1
MIRT023865 MRFAP1 Morf4 family associated protein 1 2 1
MIRT023866 CETN3 centrin 3 2 1
MIRT023867 SDPR caveolae associated protein 2 1 1
MIRT023868 LIMS1 LIM zinc finger domain containing 1 2 1
MIRT023869 SUGP1 SURP and G-patch domain containing 1 2 1
MIRT023870 GNB2 G protein subunit beta 2 2 1
MIRT023871 LCP1 lymphocyte cytosolic protein 1 2 1
MIRT023872 CTTN cortactin 2 2
MIRT023873 ZNF48 zinc finger protein 48 1 1
MIRT023874 POLD1 DNA polymerase delta 1, catalytic subunit 1 1
MIRT023875 POLR2I RNA polymerase II subunit I 1 1
MIRT023876 CSTF3 cleavage stimulation factor subunit 3 1 1
MIRT023877 MFN2 mitofusin 2 1 1
MIRT023878 DCTPP1 dCTP pyrophosphatase 1 1 1
MIRT023879 MTHFS methenyltetrahydrofolate synthetase 1 1
MIRT023880 RPP40 ribonuclease P/MRP subunit p40 1 1
MIRT023881 MINPP1 multiple inositol-polyphosphate phosphatase 1 1 1
MIRT023882 RRP36 ribosomal RNA processing 36 1 1
MIRT023883 ITGA1 integrin subunit alpha 1 1 1
MIRT023884 LCA5L LCA5L, lebercilin like 1 1
MIRT023885 UBE2I ubiquitin conjugating enzyme E2 I 1 1
MIRT023886 DEFB125 defensin beta 125 1 1
MIRT023887 TSPAN19 tetraspanin 19 1 1
MIRT023888 BCAS4 breast carcinoma amplified sequence 4 1 1
MIRT023889 S100A11 S100 calcium binding protein A11 1 1
MIRT023890 MCM7 minichromosome maintenance complex component 7 1 1
MIRT023891 AP1M1 adaptor related protein complex 1 mu 1 subunit 1 1
MIRT023892 GSTO1 glutathione S-transferase omega 1 1 1
MIRT023893 CXCL2 C-X-C motif chemokine ligand 2 1 1
MIRT023894 PACS2 phosphofurin acidic cluster sorting protein 2 1 1
MIRT023895 LRWD1 leucine rich repeats and WD repeat domain containing 1 1 1
MIRT023896 STXBP3 syntaxin binding protein 3 1 1
MIRT023897 ABCC4 ATP binding cassette subfamily C member 4 1 1
MIRT023898 PTPN22 protein tyrosine phosphatase, non-receptor type 22 1 1
MIRT023899 TAGLN transgelin 1 1
MIRT023900 EXOC3 exocyst complex component 3 1 1
MIRT023901 DDX60 DExD/H-box helicase 60 1 1
MIRT023902 FADS1 fatty acid desaturase 1 1 1
MIRT023903 SLC26A7 solute carrier family 26 member 7 1 1
MIRT023904 TRPA1 transient receptor potential cation channel subfamily A member 1 1 1
MIRT023905 PPIA peptidylprolyl isomerase A 1 1
MIRT023906 CAPG capping actin protein, gelsolin like 1 1
MIRT023907 TLR4 toll like receptor 4 1 1
MIRT023908 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 1
MIRT023909 TMEM68 transmembrane protein 68 1 1
MIRT023910 SLC35A5 solute carrier family 35 member A5 1 1
MIRT023911 TMOD3 tropomodulin 3 1 1
MIRT023912 ZBTB6 zinc finger and BTB domain containing 6 1 1
MIRT023913 PLEKHH2 pleckstrin homology, MyTH4 and FERM domain containing H2 1 1
MIRT023914 DOK6 docking protein 6 1 1
MIRT023915 SEC61A1 Sec61 translocon alpha 1 subunit 1 1
MIRT023916 SRSF7 serine and arginine rich splicing factor 7 1 1
MIRT023917 ZNF280C zinc finger protein 280C 1 1
MIRT023918 CAPRIN1 cell cycle associated protein 1 1 1
MIRT023919 CLTC clathrin heavy chain 1 1
MIRT023920 SMIM14 small integral membrane protein 14 1 1
MIRT023921 CHMP2A charged multivesicular body protein 2A 2 1
MIRT023922 NUP160 nucleoporin 160 2 1
MIRT023923 CTDNEP1 CTD nuclear envelope phosphatase 1 2 1
MIRT023924 CNIH4 cornichon family AMPA receptor auxiliary protein 4 2 1
MIRT023925 EDF1 endothelial differentiation related factor 1 2 1
MIRT023926 GNAI3 G protein subunit alpha i3 2 1
MIRT023927 MYOCD myocardin 1 1
MIRT023928 ZNF622 zinc finger protein 622 2 1
MIRT023929 GNB1 G protein subunit beta 1 2 1
MIRT023930 CD2AP CD2 associated protein 2 1
MIRT023931 COPB1 coatomer protein complex subunit beta 1 2 2
MIRT023932 HADH hydroxyacyl-CoA dehydrogenase 2 2
MIRT023933 GPAA1 glycosylphosphatidylinositol anchor attachment 1 1 1
MIRT023934 S100G S100 calcium binding protein G 1 1
MIRT023935 APEH acylaminoacyl-peptide hydrolase 1 1
MIRT023936 NDUFS4 NADH:ubiquinone oxidoreductase subunit S4 1 1
MIRT023937 HYI hydroxypyruvate isomerase (putative) 1 1
MIRT023938 ELMOD2 ELMO domain containing 2 1 1
MIRT023939 NUP210 nucleoporin 210 1 1
MIRT023940 GLI2 GLI family zinc finger 2 1 1
MIRT023941 HIF3A hypoxia inducible factor 3 alpha subunit 1 1
MIRT023942 RCOR2 REST corepressor 2 1 1
MIRT023943 SYPL1 synaptophysin like 1 1 1
MIRT023944 LRRC8D leucine rich repeat containing 8 VRAC subunit D 1 1
MIRT023945 GPX1P1 glutathione peroxidase pseudogene 1 1 1
MIRT023946 MCM4 minichromosome maintenance complex component 4 1 1
MIRT023947 HIST2H3D histone cluster 2 H3 family member d 1 1
MIRT023948 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT023949 UNC45A unc-45 myosin chaperone A 1 1
MIRT023950 PSME1 proteasome activator subunit 1 1 1
MIRT023951 FTSJ1 FtsJ RNA methyltransferase homolog 1 1 1
MIRT023952 REM2 RRAD and GEM like GTPase 2 1 1
MIRT023953 ITGA3 integrin subunit alpha 3 1 1
MIRT023954 ISG15 ISG15 ubiquitin-like modifier 1 1
MIRT023955 NT5E 5'-nucleotidase ecto 1 1
MIRT023956 PLGRKT plasminogen receptor with a C-terminal lysine 1 1
MIRT023957 PKD1L1 polycystin 1 like 1, transient receptor potential channel interacting 1 1
MIRT023958 ATP6V1E1 ATPase H+ transporting V1 subunit E1 1 1
MIRT023959 DDX6 DEAD-box helicase 6 1 1
MIRT023960 NOC2L NOC2 like nucleolar associated transcriptional repressor 1 1
MIRT023961 DPY19L1 dpy-19 like C-mannosyltransferase 1 1 1
MIRT023962 MCM5 minichromosome maintenance complex component 5 1 1
MIRT023963 HIST2H3C histone cluster 2 H3 family member c 1 1
MIRT023964 EFCAB1 EF-hand calcium binding domain 1 1 1
MIRT023965 LMNB1 lamin B1 1 1
MIRT023966 AIFM2 apoptosis inducing factor, mitochondria associated 2 1 1
MIRT023967 FBXO45 F-box protein 45 1 1
MIRT023968 MYO18A myosin XVIIIA 1 1
MIRT023969 SMEK1 protein phosphatase 4 regulatory subunit 3A 1 1
MIRT023970 HERC5 HECT and RLD domain containing E3 ubiquitin protein ligase 5 1 1
MIRT023971 HS2ST1 heparan sulfate 2-O-sulfotransferase 1 1 1
MIRT023972 LONP2 lon peptidase 2, peroxisomal 1 1
MIRT023973 SMARCA2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 1 1
MIRT023974 DDX42 DEAD-box helicase 42 1 1
MIRT023975 TTC17 tetratricopeptide repeat domain 17 1 1
MIRT023976 SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 1 1
MIRT023977 AFAP1 actin filament associated protein 1 1 1
MIRT023978 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT023979 EML3 echinoderm microtubule associated protein like 3 1 1
MIRT023980 ANKRD17 ankyrin repeat domain 17 1 1
MIRT023981 TRPS1 transcriptional repressor GATA binding 1 1 1
MIRT023982 XPOT exportin for tRNA 1 1
MIRT023983 ALG2 ALG2, alpha-1,3/1,6-mannosyltransferase 1 1
MIRT023984 HIPK3 homeodomain interacting protein kinase 3 1 1
MIRT023985 OSTF1 osteoclast stimulating factor 1 1 1
MIRT023986 IST1 IST1, ESCRT-III associated factor 2 1
MIRT023987 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT023988 PQBP1 polyglutamine binding protein 1 2 1
MIRT023989 BAX BCL2 associated X, apoptosis regulator 2 1
MIRT023990 GNA13 G protein subunit alpha 13 2 1
MIRT023991 FOLR1 folate receptor 1 2 1
MIRT023992 PRDX2 peroxiredoxin 2 2 1
MIRT023993 AHNAK2 AHNAK nucleoprotein 2 2 1
MIRT023994 GNAT2 G protein subunit alpha transducin 2 2 1
MIRT023995 EFTUD2 elongation factor Tu GTP binding domain containing 2 2 1
MIRT023996 KRT75 keratin 75 2 1
MIRT023997 CTBP2 C-terminal binding protein 2 2 1
MIRT023998 DOLPP1 dolichyldiphosphatase 1 2 2
MIRT023999 CXCL1 C-X-C motif chemokine ligand 1 1 1
MIRT024000 KCNN4 potassium calcium-activated channel subfamily N member 4 1 1
MIRT024001 FILIP1 filamin A interacting protein 1 1 1
MIRT024002 PPP1R16A protein phosphatase 1 regulatory subunit 16A 1 1
MIRT024003 MAST4 microtubule associated serine/threonine kinase family member 4 1 1
MIRT024004 ISG20 interferon stimulated exonuclease gene 20 1 1
MIRT024005 PPAP2C phospholipid phosphatase 2 1 1
MIRT024006 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 1 1
MIRT024007 RAB39B RAB39B, member RAS oncogene family 1 1
MIRT024008 HSD3B7 hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7 1 1
MIRT024009 HIST3H3 histone cluster 3 H3 1 1
MIRT024010 MMS22L MMS22 like, DNA repair protein 1 1
MIRT024011 COTL1 coactosin like F-actin binding protein 1 1 1
MIRT024012 HNRNPD heterogeneous nuclear ribonucleoprotein D 1 1
MIRT024013 C12orf40 chromosome 12 open reading frame 40 1 1
MIRT024014 BRPF3 bromodomain and PHD finger containing 3 1 1
MIRT024015 TRIM24 tripartite motif containing 24 1 1
MIRT024016 GATA3 GATA binding protein 3 1 1
MIRT024017 SEMA4D semaphorin 4D 1 1
MIRT024018 POLRMT RNA polymerase mitochondrial 1 1
MIRT024019 TIGD4 tigger transposable element derived 4 1 1
MIRT024020 SRSF5 serine and arginine rich splicing factor 5 1 1
MIRT024021 IMPDH1 inosine monophosphate dehydrogenase 1 1 1
MIRT024022 IFIT1 interferon induced protein with tetratricopeptide repeats 1 1 1
MIRT024023 RBM28 RNA binding motif protein 28 1 1
MIRT024024 CCDC102A coiled-coil domain containing 102A 1 1
MIRT024025 KIF2C kinesin family member 2C 1 1
MIRT024026 CTBP1 C-terminal binding protein 1 1 1
MIRT024027 MCM6 minichromosome maintenance complex component 6 1 1
MIRT024028 GTF2H1 general transcription factor IIH subunit 1 1 1
MIRT024029 FRMD7 FERM domain containing 7 1 1
MIRT024030 CBX2 chromobox 2 1 1
MIRT024031 TKT transketolase 3 2
MIRT024032 LRRC8B leucine rich repeat containing 8 VRAC subunit B 1 1
MIRT024033 CCDC180 coiled-coil domain containing 180 1 1
MIRT024034 RSF1 remodeling and spacing factor 1 1 1
MIRT024035 TBC1D9 TBC1 domain family member 9 1 1
MIRT024036 IPO9 importin 9 1 1
MIRT024037 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 3 3
MIRT024038 KIAA1522 KIAA1522 1 1
MIRT024039 UBR5 ubiquitin protein ligase E3 component n-recognin 5 1 1
MIRT024040 KDM2B lysine demethylase 2B 1 1
MIRT024041 HP1BP3 heterochromatin protein 1 binding protein 3 1 1
MIRT024042 CDC42SE1 CDC42 small effector 1 1 1
MIRT024043 UNC119B unc-119 lipid binding chaperone B 1 1
MIRT024044 CEBPZ CCAAT/enhancer binding protein zeta 1 1
MIRT024045 CCDC170 coiled-coil domain containing 170 1 1
MIRT024046 HNRNPA3 heterogeneous nuclear ribonucleoprotein A3 1 1
MIRT024047 UBAC2 UBA domain containing 2 2 1
MIRT024048 LGALS3BP galectin 3 binding protein 2 1
MIRT024049 DCAKD dephospho-CoA kinase domain containing 2 1
MIRT024050 COL12A1 collagen type XII alpha 1 chain 2 1
MIRT024051 ABCC1 ATP binding cassette subfamily C member 1 2 1
MIRT024052 CAMK2G calcium/calmodulin dependent protein kinase II gamma 2 1
MIRT024053 DBN1 drebrin 1 2 2
MIRT024054 CALM1 calmodulin 1 2 2
MIRT024055 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 1
MIRT024056 ARPC5 actin related protein 2/3 complex subunit 5 1 1
MIRT024057 RGS17 regulator of G protein signaling 17 1 1
MIRT024058 CCL2 C-C motif chemokine ligand 2 1 1
MIRT024059 SLC39A3 solute carrier family 39 member 3 1 1
MIRT024060 SEC16A SEC16 homolog A, endoplasmic reticulum export factor 1 1
MIRT024061 ESYT1 extended synaptotagmin 1 1 1
MIRT024062 ISY1 ISY1 splicing factor homolog 1 1
MIRT024063 TBCD tubulin folding cofactor D 1 1
MIRT024064 NBL1 neuroblastoma 1, DAN family BMP antagonist 1 1
MIRT024065 TELO2 telomere maintenance 2 1 1
MIRT024066 ATP13A1 ATPase 13A1 1 1
MIRT024067 PLXNB2 plexin B2 1 1
MIRT024068 ZNF638 zinc finger protein 638 1 1
MIRT024069 ZNF568 zinc finger protein 568 1 1
MIRT024070 CDH13 cadherin 13 1 1
MIRT024071 FAM167A family with sequence similarity 167 member A 1 1
MIRT024072 F11R F11 receptor 1 1
MIRT024073 KIAA1731 centrosomal protein 295 1 1
MIRT024074 S100A16 S100 calcium binding protein A16 1 1
MIRT024075 TROVE2 TROVE domain family member 2 1 1
MIRT024076 SDR39U1 short chain dehydrogenase/reductase family 39U member 1 1 1
MIRT024077 VAMP7 vesicle associated membrane protein 7 1 1
MIRT024078 RIN1 Ras and Rab interactor 1 1 1
MIRT024079 ARG1 arginase 1 1 1
MIRT024080 DDT D-dopachrome tautomerase 1 1
MIRT024081 FOXN4 forkhead box N4 1 1
MIRT024082 SFN stratifin 1 1
MIRT024083 AKR1D1 aldo-keto reductase family 1 member D1 1 1
MIRT024084 RIPK2 receptor interacting serine/threonine kinase 2 1 1
MIRT024085 L1CAM L1 cell adhesion molecule 1 1
MIRT024086 IL8 C-X-C motif chemokine ligand 8 1 1
MIRT024087 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT024088 OARD1 O-acyl-ADP-ribose deacylase 1 1 1
MIRT024089 DDX50 DExD-box helicase 50 1 1
MIRT024090 C2orf48 chromosome 2 open reading frame 48 1 1
MIRT024091 ARGLU1 arginine and glutamate rich 1 1 1
MIRT024092 C10orf137 erythroid differentiation regulatory factor 1 1 1
MIRT024093 DFNA5 DFNA5, deafness associated tumor suppressor 1 1
MIRT024094 RXFP1 relaxin/insulin like family peptide receptor 1 1 1
MIRT024095 SSR1 signal sequence receptor subunit 1 1 1
MIRT024096 MIER1 MIER1 transcriptional regulator 1 1
MIRT024097 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT024098 ACTB actin beta 1 1
MIRT024099 TRA2B transformer 2 beta homolog 1 1
MIRT024100 CSNK2A2 casein kinase 2 alpha 2 1 1
MIRT024101 ANP32E acidic nuclear phosphoprotein 32 family member E 3 3
MIRT024102 G3BP1 G3BP stress granule assembly factor 1 1 1
MIRT024103 THY1 Thy-1 cell surface antigen 2 1
MIRT024104 CDH2 cadherin 2 2 1
MIRT024105 C1orf27 chromosome 1 open reading frame 27 2 1
MIRT024106 FLNC filamin C 2 1
MIRT024107 CDK4 cyclin dependent kinase 4 2 1
MIRT024108 CRIP2 cysteine rich protein 2 2 2
MIRT024109 EPB41L2 erythrocyte membrane protein band 4.1 like 2 2 2
MIRT035536 SP1 Sp1 transcription factor 1 1
MIRT046543 FBXO22 F-box protein 22 1 1
MIRT046544 SOS2 SOS Ras/Rho guanine nucleotide exchange factor 2 1 1
MIRT054150 ETS1 ETS proto-oncogene 1, transcription factor 3 1
MIRT054707 FASN fatty acid synthase 2 1
MIRT054889 PIK3CA phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha 3 1
MIRT192334 KLF13 Kruppel like factor 13 2 2
MIRT215738 C5ORF51 chromosome 5 open reading frame 51 2 4
MIRT269374 WEE1 WEE1 G2 checkpoint kinase 2 2
MIRT332729 QSER1 glutamine and serine rich 1 2 2
MIRT394616 PPP2R1B protein phosphatase 2 scaffold subunit Abeta 2 2
MIRT437776 TH tyrosine hydroxylase 1 1
MIRT437777 TH tyrosine hydroxylase 1 1
MIRT437822 MPL MPL proto-oncogene, thrombopoietin receptor 4 1
MIRT437831 API5 apoptosis inhibitor 5 3 1
MIRT437883 SPRED1 sprouty related EVH1 domain containing 1 3 1
MIRT437918 ASPH aspartate beta-hydroxylase 1 1
MIRT438458 ND1 NADH dehydrogenase, subunit 1 (complex I) 1 1
MIRT438459 COX1 cytochrome c oxidase subunit I 1 1
MIRT438811 FRS2 fibroblast growth factor receptor substrate 2 3 1
MIRT438813 FZD7 frizzled class receptor 7 3 1
MIRT438862 AGO1 argonaute 1, RISC catalytic component 1 1
MIRT442950 ASXL2 additional sex combs like 2, transcriptional regulator 2 2
MIRT446165 C8A complement C8 alpha chain 2 2
MIRT446281 C17orf102 chromosome 17 open reading frame 102 2 2
MIRT448537 RIMS4 regulating synaptic membrane exocytosis 4 2 2
MIRT448837 FGD4 FYVE, RhoGEF and PH domain containing 4 2 2
MIRT449399 TOX4 TOX high mobility group box family member 4 2 2
MIRT449446 STAMBP STAM binding protein 2 2
MIRT452043 NT5C1B-RDH14 NT5C1B-RDH14 readthrough 2 2
MIRT456019 PSMA7 proteasome subunit alpha 7 2 2
MIRT456593 CHML CHM like, Rab escort protein 2 2 2
MIRT458330 SALL2 spalt like transcription factor 2 2 2
MIRT461318 MRPS27 mitochondrial ribosomal protein S27 2 2
MIRT464025 WBP2 WW domain binding protein 2 2 2
MIRT466871 STX6 syntaxin 6 2 2
MIRT469336 RGP1 RGP1 homolog, RAB6A GEF complex partner 1 2 2
MIRT472374 TSPAN1 tetraspanin 1 2 2
MIRT477574 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 2
MIRT478271 DDX19B DEAD-box helicase 19B 2 2
MIRT480680 BSCL2 BSCL2, seipin lipid droplet biogenesis associated 2 2
MIRT482899 SMKR1 small lysine rich protein 1 2 6
MIRT484249 ANK1 ankyrin 1 2 2
MIRT485161 RAB5C RAB5C, member RAS oncogene family 2 8
MIRT485306 NFAT5 nuclear factor of activated T-cells 5 2 8
MIRT512088 CRK CRK proto-oncogene, adaptor protein 2 4
MIRT512352 ARPP19 cAMP regulated phosphoprotein 19 2 4
MIRT519968 ZCCHC3 zinc finger CCHC-type containing 3 2 2
MIRT526409 TFAM transcription factor A, mitochondrial 2 2
MIRT527095 VSTM5 V-set and transmembrane domain containing 5 2 2
MIRT530393 SULT1B1 sulfotransferase family 1B member 1 2 2
MIRT535608 NUDT21 nudix hydrolase 21 2 2
MIRT561977 LRRC59 leucine rich repeat containing 59 2 2
MIRT563131 ZNF215 zinc finger protein 215 2 2
MIRT564856 ZBED3 zinc finger BED-type containing 3 2 2
MIRT576357 Pxdn peroxidasin 2 2
MIRT609377 FAM216B family with sequence similarity 216 member B 2 2
MIRT616891 ATP5E ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit 2 2
MIRT639512 FYB FYN binding protein 1 2 2
MIRT675449 SRP19 signal recognition particle 19 2 2
MIRT687226 PLAGL2 PLAG1 like zinc finger 2 2 2
MIRT689969 ZNF185 zinc finger protein 185 with LIM domain 2 2
MIRT695511 ALPI alkaline phosphatase, intestinal 2 2
MIRT698425 TM4SF1 transmembrane 4 L six family member 1 2 2
MIRT698740 STX12 syntaxin 12 2 2
MIRT718002 ZNF79 zinc finger protein 79 2 2
MIRT720102 SPTLC3 serine palmitoyltransferase long chain base subunit 3 2 2
MIRT731362 KRAS KRAS proto-oncogene, GTPase 3 2
MIRT731787 NAIP NLR family apoptosis inhibitory protein 3 1
MIRT731842 VEGFA vascular endothelial growth factor A 3 1
MIRT734608 IL10 interleukin 10 1 0
MIRT734810 MINOS1 mitochondrial inner membrane organizing system 1 3 0
MIRT734830 STAR steroidogenic acute regulatory protein 2 0
MIRT735354 MB myoglobin 1 0
MIRT735770 WNT4 Wnt family member 4 3 0
MIRT736437 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 0
MIRT736987 YY1 YY1 transcription factor 1 0
MIRT756120 CXCR4 C-X-C motif chemokine receptor 4 5 1
MIRT756237 NEAT1 nuclear paraspeckle assembly transcript 1 (non-protein coding) 1 1
MIRT756238 GNA12 G protein subunit alpha 12 1 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-1 Anthocyanin NULL 145858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Caffeic acid NULL 689043 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Catechin approved 9064 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Curcumin NULL 969516 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Ferulic acid NULL 445858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Hesperidin NULL 10621 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Quercetin NULL 5280343 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-1 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Quantitative real-time PCR myocardial differentiation of mouse ES cells 19521018 2009 down-regulated
miR-1 Sulfonyl-hydrazone-1 (SHZ) NULL NULL Quantitative real-time PCR Murine broblast-derived Induced pluripotent stem cells 21445862 2011 up-regulated
miR-1 Cocaine NULL 446220 Next-generation sequencing ventral striatum 21708909 2011 up-regulated
miR-1 Atorvastatin approved 60823 Quantitative real-time PCR Cardiomyocyte 23860036 2013 down-regualted
miR-1 Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miR-1 Docosahexaenoic acid NULL 445580 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 Palmitic acid approved 985 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 17beta-estradiol (E2) approved 5757 Microarray MCF-7AKT breast cancer cells 19528081 2009 down-regulated
miR-1 Essential amino acids (EAA) NULL NULL Quantitative real-time PCR skeletal muscle of young adults 19828686 2009 up-regulated
miR-1 Hydrogen peroxide (H2O2) NULL 784 Quantitative real-time PCR Human umbilical vein endothelial cells 21527937 2011 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Microarray apoptosis-resistant breast cancer cells 21971930 2011 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-1 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-1 Bicalutamide approved 2375 Microarray prostate 22674191 2012 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR cardia 22889704 2012 up-regulated
miR-1 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-1 Quinidine approved 441074 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 up-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 down-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR post-infarction rat cardiomyocytes 21220930 2011 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miR-1 Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-1-3p Doxorubicin 31703 NSC123127 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549, H1299, N417, BEAS-2B)
hsa-miR-1-3p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-1-3p Verapamil 2520 NSC272366 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-1-3p Imatinib 5291 NSC743414 approved sensitive High Myelogenous Leukemia cell line (MYL)
hsa-miR-1-3p Cyclopamine 442972 NSC734950 sensitive Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-1-3p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-1-3p Fluoropyrimidine + Oxaliplatin/Paclitaxel resistant Low Gastric Cancer tissue
hsa-miR-1-3p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HT-29)
hsa-miR-1-3p Platinum-based doublet chemotherapy resistant Low Lung Adenocarcinoma tissue
hsa-miR-1-3p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (Calu6)
hsa-miR-1-3p Mitoxantrone 4212 NSC279836 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-1-3p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-miR-1-3p Cisplatin 5460033 NSC119875 approved sensitive Low Urothelial Bladder Cancer cell line (T24)
hsa-miR-1-3p Gemcitabine 60750 NSC613327 approved sensitive Low Urothelial Bladder Cancer cell line (T24)
hsa-miR-1-3p Gefitinib 123631 NSC715055 approved sensitive Low Esophageal Squamous Cell Carcinoma tissue
hsa-miR-1-3p Cyflumetofen 11496052 sensitive Low Normal tissue
hsa-miR-1-3p Gefitinib 123631 NSC715055 approved sensitive Low Non-Small Cell Lung Cancer cell line (PC‐9, HCC‐827)
hsa-miR-1-3p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer tissue and cell line (A549, H1299)
hsa-miR-1-3p Radioactivity Iodine sensitive High Papillary Thyroid Cancer tissue
hsa-miR-1-3p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7, MCF-7-CC)
hsa-miR-1-3p Doxorubicin 31703 NSC123127 approved sensitive Low Gastric Cancer cell line (SGC7901)
hsa-miR-1-3p Vincristine 5978 approved sensitive Low Gastric Cancer cell line (SGC7901)
hsa-miR-1-3p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375)
hsa-miR-1-3p Bromocriptine 31101 NSC169774 approved resistant Low Prolactinoma tissue
hsa-miR-1-3p Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (MGC803)
hsa-miR-1-3p Cisplatin 5460033 NSC119875 approved sensitive Low Breast Cancer cell line (MCF-7, ZR-7530)
hsa-miR-1-3p Paclitaxel 36314 NSC125973 approved sensitive Low Breast Cancer cell line (MCF-7, ZR-7530)
hsa-miR-1-3p Sorafenib 216239 NSC747971 approved sensitive Low Hepatocellular Carcinoma cell line (Hep3B, HepG2)
hsa-miR-1-3p Doxorubicin 31703 NSC123127 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-miR-1-3p Paclitaxel 36314 NSC125973 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-miR-1-3p Etoposide 36462 NSC141540 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-miR-1-3p Vinorelbine 44424639 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-miR-1-3p Vincristine 5978 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-miR-1-3p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (H460, A549)
hsa-miR-1-3p Antiepileptic Drug sensitive High Pediatric Epilepsy tissue
hsa-miR-1-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-1-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-1-3p Palbociclib 5330286 NSC758247 approved resistant cell line (T47D)
hsa-miR-1-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-1-3p Prednisone/Azathioprine/Methotrexate/Cyclophosphamide/Mycophenolate mofetil sensitive tissue (myasthenia gravis)
hsa-miR-1-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM36)
hsa-miR-1-3p Sunitinib 5329102 NSC750690 approved sensitive tissue (clear cell renal cell carcinoma)
hsa-miR-1-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-1-3p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-1-3p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-1-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-1-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-1-3p Platinum-based doublet chemotherapy resistant tissue (lung adenocarcinoma)
hsa-miR-1-3p Tamoxifen 2733525 NSC180973 approved sensitive cell line (TamR4)
hsa-miR-1-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR70)
hsa-miR-1-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-1-3p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-1-3p Cisplatin 5460033 NSC119875 approved resistant cell line (OVCAR3)
hsa-miR-1-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-1-3p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide sensitive cell line (Bads-200)

Error report submission