>EZH2|NM_004456|3'UTR
   1 CATCTGCTACCTCCTCCCCCCTCCTCTGAAACAGCTGCCTTAGCTTCAGGAACCTCGAGTACTGTGGGCAATTTAGAAAA
  81 AGAACATGCAGTTTGAAATTCTGAATTTGCAAAGTACTGTAAGAATAATTTATAGTAATGAGTTTAAAAATCAACTTTTT
 161 ATTGCCTTCTCACCAGCTGCAAAGTGTTTTGTACCAGTGAATTTTTGCAATAATGCAGTATGGTACATTTTTCAACTTTG
 241 AATAAAGAATACTTGAACTTGTCCTTGTTGAATC

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' ucggauaggacCUAAUGAACUu 5' || ||||||| Target 5' ctttgaataaaGAATACTTGAa 3'	236 - 257	147.00	-8.30
2	miRNA 3' ucggaUAGGACCUAAUGA-ACUu 5' | ||| || |||| ||: Target 5' tcaggAACCTCGAGTACTGTGGg 3'	46 - 68	113.00	-8.80
3	miRNA 3' ucgGAU--AGGA--CCUAAUGA-ACUu 5' ||| |||| | || ||| Target 5' ctgCTACCTCCTCCCCCCTCCTCTGAa 3'	4 - 30	79.00	-5.62

Mutant ID	Mutant Position	Mutant Source
259400	22	ClinVar
COSN20104935	16	COSMIC
COSN30513597	18	COSMIC
COSN31574611	123	COSMIC
COSN31564742	191	COSMIC
COSN7968002	208	COSMIC
COSN7656383	227	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1371919884	2	dbSNP
rs754610785	3	dbSNP
rs755736107	3	dbSNP
rs749969922	4	dbSNP
rs1413229782	5	dbSNP
rs770439804	6	dbSNP
rs745948888	7	dbSNP
rs1284594674	10	dbSNP
rs757722069	13	dbSNP
rs368565050	15	dbSNP
rs373732420	16	dbSNP
rs1387932593	17	dbSNP
rs752038271	19	dbSNP
rs763362563	20	dbSNP
rs201597962	21	dbSNP
rs3217095	22	dbSNP
rs753561759	22	dbSNP
rs1190956709	23	dbSNP
rs765595441	24	dbSNP
rs1190173361	25	dbSNP
rs760581114	25	dbSNP
rs759825516	26	dbSNP
rs1248823368	28	dbSNP
rs929618724	32	dbSNP
rs1449218793	34	dbSNP
rs1464179086	41	dbSNP
rs1265646766	42	dbSNP
rs1223606561	56	dbSNP
rs148678300	57	dbSNP
rs1171494357	64	dbSNP
rs144048372	74	dbSNP
rs11541108	84	dbSNP
rs988279632	84	dbSNP
rs1410024952	85	dbSNP
rs1354348266	89	dbSNP
rs1300558826	95	dbSNP
rs1367625706	102	dbSNP
rs956946414	111	dbSNP
rs1255519873	112	dbSNP
rs1467082608	115	dbSNP
rs972290649	116	dbSNP
rs1279934547	117	dbSNP
rs1359676356	117	dbSNP
rs560622782	119	dbSNP
rs8829	120	dbSNP
rs1464779480	131	dbSNP
rs1187069920	132	dbSNP
rs1250222404	133	dbSNP
rs1449717297	133	dbSNP
rs1158238278	138	dbSNP
rs776815138	138	dbSNP
rs1375471721	140	dbSNP
rs1467114972	141	dbSNP
rs537734267	142	dbSNP
rs1413876445	143	dbSNP
rs987910653	145	dbSNP
rs928168090	146	dbSNP
rs1473033750	147	dbSNP
rs746851379	148	dbSNP
rs981324605	161	dbSNP
rs777364681	162	dbSNP
rs1180193614	165	dbSNP
rs1300820364	166	dbSNP
rs570106117	184	dbSNP
rs1029517927	187	dbSNP
rs969507672	191	dbSNP
rs1366995364	192	dbSNP
rs1235507223	193	dbSNP
rs550195890	199	dbSNP
rs1484251932	207	dbSNP
rs565204867	210	dbSNP
rs1207326946	213	dbSNP
rs1238577794	213	dbSNP
rs533468838	218	dbSNP
rs570918453	223	dbSNP
rs1327581661	226	dbSNP
rs545323662	238	dbSNP
rs1010901792	239	dbSNP
rs1270413969	241	dbSNP
rs1434468447	241	dbSNP
rs956687476	260	dbSNP
rs372069007	262	dbSNP

- The Journal of biological chemistry, 2008

MicroRNA (miRNA) are important regulators of many biological processes, but the targets for most miRNA are still poorly defined. In this study, we profiled the expression of miRNA during myogenesis, from proliferating myoblasts through to terminally differentiated myotubes. Microarray results identified six significantly differentially expressed miRNA that were more than 2-fold different in myotubes. From this list, miRNA-26a (miR-26a), an up-regulated miRNA, was further examined. Overexpression of miR-26a in murine myogenic C2C12 cells induced creatine kinase activity, an enzyme that markedly increases during myogenesis. Further, myoD and myogenin mRNA expression levels were also up-regulated. These results suggest that increased expression of miR-26a promotes myogenesis. Through a bioinformatics approach, we identified the histone methyltransferase, Enhancer of Zeste homolog 2 (Ezh2), as a potential target of miR-26a. Overexpression of miR-26a suppressed the activity of a luciferase reporter construct fused with the 3'-untranslated region of Ezh2. In addition, miR-26a overexpression decreased Ezh2 mRNA expression. These results reveal a model of regulation during myogenesis whereby the up-regulation of miR-26a acts to post-transcriptionally repress Ezh2, a known suppressor of skeletal muscle cell differentiation.

- Blood, 2008

The MYC oncogene, which is commonly mutated/amplified in tumors, represents an important regulator of cell growth because of its ability to induce both proliferation and apoptosis. Recent evidence links MYC to altered miRNA expression, thereby suggesting that MYC-regulated miRNAs might contribute to tumorigenesis. To further analyze the impact of MYC-regulated miRNAs, we investigated a murine lymphoma model harboring the MYC transgene in a Tet-off system to control its expression. Microarray-based miRNA expression profiling revealed both known and novel MYC targets. Among the miRNAs repressed by MYC, we identified the potential tumor suppressor miR-26a, which possessed the ability to attenuate proliferation in MYC-dependent cells. Interestingly, miR-26a was also found to be deregulated in primary human Burkitt lymphoma samples, thereby probably being of clinical relevance. Although today only few miRNA targets have been identified in human disease, we could show that ectopic expression of miR-26a influenced cell cycle progression by targeting the bona fide oncogene EZH2, a Polycomb protein and global regulator of gene expression yet unknown to be regulated by miRNAs. Thus, in addition to directly targeting protein-coding genes, MYC modulates genes important to oncogenesis via deregulation of miRNAs, thereby vitally contributing to MYC-induced lymphomagenesis.

- Cell, 2009

Therapeutic strategies based on modulation of microRNA (miRNA) activity hold great promise due to the ability of these small RNAs to potently influence cellular behavior. In this study, we investigated the efficacy of a miRNA replacement therapy for liver cancer. We demonstrate that hepatocellular carcinoma (HCC) cells exhibit reduced expression of miR-26a, a miRNA that is normally expressed at high levels in diverse tissues. Expression of this miRNA in liver cancer cells in vitro induces cell-cycle arrest associated with direct targeting of cyclins D2 and E2. Systemic administration of this miRNA in a mouse model of HCC using adeno-associated virus (AAV) results in inhibition of cancer cell proliferation, induction of tumor-specific apoptosis, and dramatic protection from disease progression without toxicity. These findings suggest that delivery of miRNAs that are highly expressed and therefore tolerated in normal tissues but lost in disease cells may provide a general strategy for miRNA replacement therapies.

- Journal of immunology (Baltimore, Md. : 1950), 2010

IFN-beta production is an inaugural event in the innate immune response to viral infections, with relatively small fold changes in IFN-beta expression resulting in the activation of important antiviral signaling cascades. In our rapid SIV/macaque model of HIV encephalitis, the virus enters the CNS within 4 d of infection, accompanied by a marked IFN-beta response that wanes as SIV replication is controlled. The centrality of IFN-beta to the innate antiviral response in the CNS combines with the potential inflammatory damage associated with long-term activation of this pathway to suggest that IFN-beta may be subject to regulatory fine-tuning in addition to well-established transcriptional and message stability mechanisms of regulation. In this paper, we present for the first time evidence that microRNAs (miRNAs), including miR-26a, -34a, -145, and let-7b, may directly regulate IFN-beta in human and macaque cells. In primary primate macrophages, the main cell type implicated in HIV and SIV infection in the CNS, specific miRNAs reduce, whereas miRNA inhibitors enhance, IFN-beta protein production. The potential biologic significance of this regulation is supported by evidence of an apparent negative feedback loop, with increased expression of three IFN-beta-regulating miRNAs by primate macrophages exposed to recombinant IFN-beta or stimulated to produce IFN-beta. Thus, miRNAs may contribute significantly to the regulation of IFN-beta in innate immune responses.

- Molecular cancer, 2010

BACKGROUND: In prostate cancer (PCa), the common treatment involving androgen ablation alleviates the disease temporarily, but results in the recurrence of highly aggressive and androgen-independent metastatic cancer. Therefore, more effective therapeutic approaches are needed. It is known that aberrant epigenetics contributes to prostate malignancy. Unlike genetic changes, these epigenetic alterations are reversible, which makes them attractive targets in PCa therapy to impede cancer progression. As a histone methyltransferase, Ezh2 plays an essential role in epigenetic regulation. Since Ezh2 is overexpressed and acts as an oncogene in PCa, it has been proposed as a bona fide target of PCa therapy. MicroRNAs (miRNAs) regulate gene expression through modulating protein translation. Recently, the contribution of miRNAs in cancer development is increasingly appreciated. In this report, we present our study showing that microRNA-101 (miR-101) inhibits Ezh2 expression and differentially regulates prostate cancer cells. In addition, the expression of miR-101 alters upon androgen treatment and HIF-1alpha/HIF-1beta induction. RESULT: In our reporter assays, both miR-101 and miR-26a inhibit the expression of a reporter construct containing the 3'-UTR of Ezh2. When ectopically expressed in PC-3, DU145 and LNCaP cells, miR-101 inhibits endogenous Ezh2 expression in all three cell lines, while miR-26a only decreases Ezh2 in DU145. Ectopic miR-101 reduces the invasion ability of PC-3 cells, while restored Ezh2 expression rescues the invasiveness of PC-3 cells. Similarly, miR-101 also inhibits cell invasion and migration of DU145 and LNCaP cells, respectively. Interestingly, ectopic miR-101 exhibits differential effects on the proliferation of PC-3, DU-145 and LNCaP cells and also causes morphological changes of LNCaP cells. In addition, the expression of miR-101 is regulated by androgen receptor and HIF-1alpha/HIF-1beta. While HIF-1alpha/HIF-1beta induced by deferoxamine mesylate (DFO) decreases miR-101 levels, the overall effects of R-1881 on miR-101 expression are stimulatory. CONCLUSIONS: This study indicates that miR-101 targets Ezh2 and decreases the invasiveness of PCa cells, suggesting that miR-101 introduction is a potential therapeutic strategy to combat PCa. MiR-101 differentially regulates prostate cell proliferation. Meanwhile, the expression of miR-101 is also modulated at different physiological conditions, such as androgen stimulation and HIF-1alpha/HIF-1beta induction.

- Carcinogenesis, 2011

The role of miR-26a in carcinogenesis appears to be a complicated one, in the sense that both oncogenic and tumor suppressive effects were reported in cancers such as glioblastoma and hepatocellular carcinoma, respectively. Here, we report for the first time that miR-26a is downregulated in breast cancer specimens and cell lines and its transient transfection initiates apoptosis of breast cancer cell line MCF7 cells. Furthermore, retrovirus-delivered miR-26a impairs the in vitro colony forming and in vivo tumor-loading ability of MCF7 cells. Subsequently, MTDH and EZH2 are identified as two direct targets of miR-26a and they are significantly upregulated in breast cancer. MCF7 xenografts with exogenous miR-26a show that a decrease in expression of both MTDH and EZH2 is accompanied by an increase in apoptosis. Moreover, knockdown of MTDH causes apoptosis while reexpression of MTDH partially reverses the proapoptotic effect of miR-26a in MCF7 cells. Our findings suggest that miR-26a functionally antagonizes human breast carcinogenesis by targeting MTDH and EZH2.

- Cancer research, 2011

Several microRNAs (miRNA) have been implicated in nasopharyngeal carcinoma (NPC), a highly invasive and metastatic cancer that is widely prevalent in southern China. In this study, we report that microRNA miR-26a is commonly downregulated in NPC specimens and NPC cell lines with important functional consequences. Ectopic expression of miR-26a dramatically suppressed cell proliferation and colony formation by inducing G(1)-phase cell-cycle arrest. We found that miR-26a strongly reduced the expression of EZH2 oncogene in NPC cells. Similar to the restoring miR-26 expression, EZH2 downregulation inhibited cell growth and cell-cycle progression, whereas EZH2 overexpression rescued the suppressive effect of miR-26a. Mechanistic investigations revealed that miR-26a suppressed the expression of c-myc, the cyclin D3 and E2, and the cyclin-dependent kinase CDK4 and CDK6 while enhancing the expression of CDK inhibitors p14(ARF) and p21(CIP1) in an EZH2-dependent manner. Interestingly, cyclin D2 was regulated by miR-26a but not by EZH2, revealing cyclin D2 as another direct yet mechanistically distinct target of miR-26a. In clinical specimens, EZH2 was widely overexpressed and its mRNA levels were inversely correlated with miR-26a expression. Taken together, our results indicate that miR-26a functions as a growth-suppressive miRNA in NPC, and that its suppressive effects are mediated chiefly by repressing EZH2 expression.

- Cell death & disease, 2010

There is increasing evidence supporting the role of members of the polycomb group (PcG) gene family in tumor development and progression. However, their precise role in tumorigenesis and mechanisms of their regulation remain to be elucidated. Using nasopharyngeal carcinoma (NPC) as a disease model, a comprehensive analysis was undertaken on the clinical significance of EZH2 expression, identification of the cellular processes regulated by EZH2, and the mechanisms of its deregulated expression. Herein, we report EZH2 as being associated with a higher risk of relapse in NPC patients (P = 0.002). Genome-wide microarray and bioinformatics identified several vital cellular processes (such as differentiation, development, and apoptosis) to be regulated by EZH2, corroborated by in vitro lethality, and delayed tumor formation in vivo upon EZH2 depletion. The combination of global microRNA (miR) profiling in primary NPC specimens, and in silico analyses provided several candidate miRs that could regulate EZH2. Using a luciferase-based assay, miR-26a, miR-101, and miR-98 were validated as bona fide regulators of EZH2 expression. In particular, miR-98 was underexpressed in relapsed patient samples, strongly suggesting an important role for the miR-98 and EZH2 axis in NPC biology.

- PloS one, 2011

BACKGROUND: The biological pathways and functional properties by which misexpressed microRNAs (miRNAs) contribute to liver carcinogenesis have been intensively investigated. However, little is known about the upstream mechanisms that deregulate miRNA expressions in this process. In hepatocellular carcinoma (HCC), hepatitis B virus (HBV) X protein (HBx), a transcriptional trans-activator, is frequently expressed in truncated form without carboxyl-terminus but its role in miRNA expression and HCC development is unclear. METHODS: Human non-tumorigenic hepatocytes were infected with lentivirus-expressing full-length and carboxyl-terminal truncated HBx (Ct-HBx) for cell growth assay and miRNA profiling. Chromatin immunoprecipitation microarray was performed to identify the miRNA promoters directly associated with HBx. Direct transcriptional control was verified by luciferase reporter assay. The differential miRNA expressions were further validated in a cohort of HBV-associated HCC tissues using real-time PCR. RESULTS: Hepatocytes expressing Ct-HBx grew significantly faster than the full-length HBx counterparts. Ct-HBx decreased while full-length HBx increased the expression of a set of miRNAs with growth-suppressive functions. Interestingly, Ct-HBx bound to and inhibited the transcriptional activity of some of these miRNA promoters. Notably, some of the examined repressed-miRNAs (miR-26a, -29c, -146a and -190) were also significantly down-regulated in a subset of HCC tissues with carboxyl-terminal HBx truncation compared to their matching non-tumor tissues, highlighting the clinical relevance of our data. CONCLUSION: Our results suggest that Ct-HBx directly regulates miRNA transcription and in turn promotes hepatocellular proliferation, thus revealing a viral contribution of miRNA deregulation during hepatocarcinogenesis.

- Oncology letters, 2013

Nasopharyngeal carcinoma (NPC) is a highly invasive and metastatic type of cancer that is widely prevalent in Southern China. Studies have shown that several microRNAs (miRNAs) are implicated in NPC metastasis. Our previous studies have demonstrated that miRNA miR-26a inhibits cell growth and tumorigenesis of NPC through the repression of enhancer of zeste homolog 2 (EZH2). However, the role of miR-26a in NPC metastasis remains unknown. In this study, we showed that ectopic expression of miR-26a inhibited the migratory and invasive capacities of NPC cells in vitro. Additionally, we used a murine model to investigate the role of miR-26a in NPC metastasis and results showed that miR-26a overexpression suppresses the metastatic behavior of NPC cells in vivo. Furthermore, the data demonstrated that miR-26a decreased the expression levels of EZH2 in vitro and in vivo, suggesting that the antimetastatic effect of miR-26a in NPC was mediated by regulating EZH2. Therefore, these findings indicate that miR-26a functions as an antimetastatic miRNA in NPC and that its antimetastatic effects are mediated mainly by repressing EZH2 expression.

- Cell death & disease, 2015

Despite recent advances in cancer management, colorectal cancer (CRC) remains the third most common cancer and a major health-care problem worldwide. MicroRNAs have recently emerged as key regulators of cancer development and progression by targeting multiple cancer-related genes; however, such regulatory networks are not well characterized in CRC. Thus, the aim of this study was to perform global messenger RNA (mRNA) and microRNA expression profiling in the same CRC samples and adjacent normal tissues and to identify potential miRNA-mRNA regulatory networks. Our data revealed 1273 significantly upregulated and 1902 downregulated genes in CRC. Pathway analysis revealed significant enrichment in cell cycle, integrated cancer, Wnt (wingless-type MMTV integration site family member), matrix metalloproteinase, and TGF-beta pathways in CRC. Pharmacological inhibition of Wnt (using XAV939 or IWP-2) or TGF-beta (using SB-431542) pathways led to dose- and time-dependent inhibition of CRC cell growth. Similarly, our data revealed up- (42) and downregulated (61) microRNAs in the same matched samples. Using target prediction and bioinformatics, ~77% of the upregulated genes were predicted to be targeted by microRNAs found to be downregulated in CRC. We subsequently focused on EZH2 (enhancer of zeste homolog 2 ), which was found to be regulated by hsa-miR-26a-5p and several members of the let-7 (lethal-7) family in CRC. Significant inverse correlation between EZH2 and hsa-miR-26a-5p (R(2)=0.56, P=0.0001) and hsa-let-7b-5p (R(2)=0.19, P=0.02) expression was observed in the same samples, corroborating the belief of EZH2 being a bona fide target for these two miRNAs in CRC. Pharmacological inhibition of EZH2 led to significant reduction in trimethylated histone H3 on lysine 27 (H3K27) methylation, marked reduction in cell proliferation, and migration in vitro. Concordantly, small interfering RNA-mediated knockdown of EZH2 led to similar effects on CRC cell growth in vitro. Therefore, our data have revealed several hundred potential miRNA-mRNA regulatory networks in CRC and suggest targeting relevant networks as potential therapeutic strategy for CRC.

- Oncotarget, 2015

The tumor suppressor p53 and the transcriptional repressor Enhancer of Zeste Homolog 2 (EZH2) have both been implicated in the regulation of epithelial-mesenchymal transition (EMT) and tumor metastasis via their impacts on microRNA expression. Here, we report that mutant p53 (mutp53) promotes EMT in endometrial carcinoma (EC) by disrupting p68-Drosha complex assembly. Overexpression of mutp53 has the opposite effect of wild-type p53 (WTp53), repressing miR-26a expression by reducing pri-miR-26a-1 processing in p53-null EC cells. Re-expression of miR-26a in mutp53 EC cells decreases cell invasion and promotes mesenchymal-epithelial transition (MET). Rescuing miR-26a expression also inhibits EZH2, N-cadherin, Vimentin, and Snail expression and induces E-cadherin expression both in vitro and in vivo. Moreover, patients with higher serum miR-26a levels have a better survival rate. These results suggest that p53 gain-of-function mutations accelerate EC tumor progression and metastasis by interfering with Drosha and p68 binding and pri-miR-26a-1 processing, resulting in reduced miR-26a expression and EZH2 overexpression.

- Journal of hematology & oncology, 2016

BACKGROUND: Our previous study reported that microRNA-26a (miR-26a) inhibited tumor progression by inhibiting tumor angiogenesis and intratumoral macrophage infiltration in hepatocellular carcinoma (HCC). The direct roles of miR-26a on tumor cell invasion remain poorly understood. In this study, we aim to explore the mechanism of miR-26a in modulating epithelial-mesenchymal transition (EMT) in HCC. METHODS: In vitro cell morphology and cell migration were compared between the hepatoma cell lines HCCLM3 and HepG2, which were established in the previous study. Overexpression and down-regulation of miR-26a were induced in these cell lines, and Western blot and immunofluorescence assays were used to detect the expression of EMT markers. Xenograft nude mouse models were used to observe tumor growth and pulmonary metastasis. Immunohistochemical assays were conducted to study the relationships between miR-26a expression and enhancer of zeste homolog 2 (EZH2) and E-cadherin expression in human HCC samples. RESULTS: Down-regulation of miR-26a in HCCLM3 and HepG2 cells resulted in an EMT-like cell morphology and high motility in vitro and increased in tumor growth and pulmonary metastasis in vivo. Through down-regulation of EZH2 expression and up-regulation of E-cadherin expression, miR-26a inhibited the EMT process in vitro and in vivo. Luciferase reporter assay showed that miR-26a directly interacted with EZH2 messenger RNA (mRNA). Furthermore, the expression of miR-26a was positively correlated with E-cadherin expression and inversely correlated with EZH2 expression in human HCC tissue. CONCLUSIONS: miR-26a inhibited the EMT process in HCC by down-regulating EZH2 expression.

- Brain tumor pathology, 2016

Enhancer of Zeste homologue2 (EZH2) is an epigenetic regulator that functions as oncogene in astrocytic tumors, however, EZH2 regulation remains little studied. In this study, we measured EZH2 levels in low (Gr-II,DA) and high grade (Gr-IV,GBM) astrocytic tumors and found significant increased EZH2 transcript level with grade(median DA-8.5, GBM-28.9).However, a different trend was reflected in protein levels, with GBMs showing high EZH2 LI(median-26.5) compared to DA (median 0.3). This difference in correlation of EZH2 protein and RNA levels suggested post-transcriptional regulation of EZH2, likely mediated by miRNAs. We selected eleven miRNAs that strongly predicted to target EZH2 and measured their expression. Three miRNAs (miR-26a-5p,miR27a-3p and miR-498) showed significant correlation with EZH2 protein, suggesting them as regulators of EZH2, however miR-26a-5p levels decreased with grade. ChIP analyses revealed H3K27me3 modifications in miR-26a promoter suggesting feedback loop between EZH2 and miR26a. We further measured six downstream miRNA targets of EZH2 and found significant downregulation of four (miR-181a/b and 200b/c) in GBM. Interestingly, EZH2 associated miRNAs were predicted to target 25 genes in glioma-pathway, suggesting their role in tumor formation or progression. Collectively, our work suggests EZH2 and its miRNA interactors may serve as promising biomarkers for progression of astrocytic tumors and may offer novel therapeutic strategies.

- International journal of oncology, 2016

Accumulating evidence demonstrates the important roles of microRNAs (miRNAs) in tumor development and progression. miR-26a has been reported to be downregulated in several types of cancers including hepatocellular carcinoma, but the underlying mechanism of how miR-26a is repressed remains largely unknown. In the present study, we performed western blot analysis, qRT-PCR, luciferase reporter assay and chromatin immunoprecipitation assay to investigate the relationship between miR-26a and the enhancer of zest homologue 2 (EZH2). CCK-8 assay and colony formation assay were carried out to explore the effect of miR-26a on HCC cells proliferation. We demonstrated that miR-26a was epigenetically repressed by EZH2-mediated H3K27 trimethylation within the miR-26a promoter. Moreover, we confirmed that EZH2 was also a direct target of miR-26a in HCC cells, thus, creating a double-negative feedback loop. Furthermore, miR-26a restoration increased the expressions of its host genes (CTDSPL and CTDSP2). Overexpression of EZH2 abrogated miR-26a induction of CTDSPL and CTDSP2. Restoring the balance of the double-negative feedback loop by miR-26a overpression or EZH2 silence significantly inhibited HCC cell growth. Overexpression of EZH2 rescued the growth inhibition effect of miR-26a. These findings suggest that an imbalanced double-negative feedback loop between EZH2 and miR-26a exists in HCC cells, which contributes to miR-26a deregulation and regulates tumor cells proliferation.