miRTarBase - #MIRT001772


—
pre-miRNA Information
pre-miRNA hsa-mir-26a-1   
Genomic Coordinates chr3: 37969404 - 37969480
Synonyms MIR26A, MIRN26A1, MIR26A1
Description Homo sapiens miR-26a-1 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-26a-2   
Genomic Coordinates chr12: 57824609 - 57824692
Synonyms MIRN26A2, MIR26A2
Description Homo sapiens miR-26a-2 stem-loop
Comment miR-26a was cloned from HeLa cells .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-26a-5p
Sequence 10| UUCAAGUAAUCCAGGAUAGGCU |31
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
C-to-U 21 3 + 37969433 17604727 MiREDiBase
C-to-U 21 12 - 57824659 17604727 MiREDiBase
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30516844 7 COSMIC
COSN30543820 11 COSMIC
COSN30447912 11 COSMIC
COSN31502139 13 COSMIC
COSN31591664 19 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1323067579 3 dbSNP
rs1315291543 9 dbSNP
rs1249227702 12 dbSNP
rs1348933092 17 dbSNP
rs1012142515 17 dbSNP
rs1445643611 18 dbSNP
rs756293180 19 dbSNP
rs765258989 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B52VKB miR-26a Monitoring Biomarker (MOI) Clinical/Experimental Data Expression Increase Plasma Quantitative real-time PCR
BI82DS miR-26a-5p Predictive Biomarker (PRD) Clinical/Experimental Data Expression High Peripheral blood Quantitative real-time PCR
Gene Information
Gene Symbol PLAG1   
Synonyms PSA, SGPA, ZNF912
Description PLAG1 zinc finger
Transcript NM_001114634   
Other Transcripts NM_001114635 , NM_002655   
Expression
Putative miRNA Targets on PLAG1
3'UTR of PLAG1
(miRNA target sites are highlighted)		 
>PLAG1|NM_001114634|3'UTR
   1 GATTCTGGGACATGGATTCATTACAGAAATGTATGTGTAGCTGTGCCCTAGATGACCATTTTTATTTTAGTGCCTACTTT
  81 AAAACAGTATAAAAATTTCTGCTTTTGTATAATACAAATTTTCATTAAGCCAGTATAAAATAGAAACTAGCTTTTAAACT
 161 GAGCTTTGGAACCATTTGTGTTCAGTTAAGTTTACCTGGGTATTTTGTCCTGATTCACTGCCAATTGTCACATTTTAAGA
 241 CTTTTTTTTTTCCATATAGGAAAGCCATTATTAGTAGTAAACTTTTACAAATCCCATTTTCAAATTACTTTTAGATCTTA
 321 AAATTTTCATTTTTGTCTAATAACAGTGGCTCTACCTTTTGACATCTGGCTCATTAAAAAATTTAGCAATAGAATGTAAA
 401 TTGTATAAAAAGTTTGTGAATAACTCAAGGGTTTAAATTTTCTTACTAGCTTCTAAATGGATTAATAATCAAGTGCTTCA
 481 AATGAATTAAGAGTCCAGTTTCGGAAGATAATAAATGTTTGTTAGATACACCATAATTTCAGATCAGTATATTCTGAAGA
 561 CTCCCTGTTGTCTGGCTAAAATATTTGCCATCTTTATTATGAGCCTTTAAGGAAAACAAACCCTAAACACAAAGCATCAG
 641 TATTTATAGCAAAAAGAGACTCTGTTAGGTGACATGGCATTTCGTGTCACTTAATAGTTGGCCCTAAATTAGTACACAGG
 721 ATATTTTGTCGTGTTTCATCCTTCTTAACATGCTATCTTTTCATTTAATAATAGTAATAGTGTATGGCATTGGGGTCTTC
 801 AGAGTCGATATATAGGTAGATCTCTTTAGTCTTTTCCACCTTTCACATCCAAGGGGTGGGTCAAGTGCAGCCAGCAATTT
 881 ATTTTCATTGTTGGCCCACGGTTAGTCCATAATCTAGAGCCATTGTGGAACTGCAGCCATGAGGTGTGTTTATCCCACAG
 961 TGGATTGACTCAGCCTCTGTGGGTGACAGACTTCTAAGCAGGAAGATAGACGTGAAGCACATGGTTACATTTGGGAACTT
1041 GTGTAGGGATCATGGCCCCTGTAGCCAGGGTTAAAAACTGGACTTTTTAGAAGTAAAGTAAAAGCATATCGCTTATATCA
1121 TTTCTTGCTGAATTTGATATGTTTTTCTTTCCCTTAAGAATCAAAAGCAGAAAACAAAAACAACAGTCCTACTCCGATGT
1201 TATCTTTCTGATTCAATGTGAATCCATCTTTCCTTGCAATATTTTGGATGGAGAATTTGAAGTTAAATGCATTAGAAAAC
1281 TACCTGATGAACTACCACAAAGTTTTAAGTGACTAGAAATATATACAGTAAAATCCCACTTTCATGCATCTCTGGGAAAT
1361 GATAGGAGTATTGCAAATAAGTTGAGTTTGTAGAGGGTAACAAAGTAAAGTAAAACAAACCTATCTTGGTTAACATGAAA
1441 ATAACAATTGAGAATATATTATATTCACTGAATAATTATAGGCTTTTCCTCACATTAGACAACCAACATAATCTTCTTAA
1521 AGGTCTAATTAATATATTTTTCTAAGGGTCAGTTGGGACATTAACCTAAGAAACATATCTATTAAGCACTTGTTAACACC
1601 TTATTTTAGGACCCTTTCCGTTGGGGATGGGGGCAAGGGTGGGAGGTTTTTAGAAGAGTATATATCTCTTTAAAAAAAAA
1681 CAGAAAGAAAAATATTTCTGAGCACTCATTAGCCCTATATGGAAACTTCTTTCCTTTTTGTAGGGCCAGTTATCACTGCA
1761 GATTGCAATGTTTACCAAGAATTTCTAAAAATGAGTGCAGATTACTGAATATAATACATTATTTAAAATATTTGGGAGTA
1841 GTATAATTTGTGGAGAAATGTAAATTGTAATAATGTAAATGGGGGCTTCAATATATATATATAATACACACACACACACA
1921 CATGCACACATACCGCACTTCATAGAATCAAAGTTGCTCTCTGAAGGAGCTTTGGCTCCTGATATTTTATCATGCTCCTA
2001 TATTTTTTTAATCCTTGGAGCAGTAGTTTTTATACTTATGTATTTAAATTTTATTATGAAAAATTACATTTATTAAAAAA
2081 GTGTGTTCCAAAGGCATTAAAATTATATATGTTAATAAGGAAGTACATTTTTAAATTTTTCAAACTGCTCCTAGCTTTTG
2161 ATTAGGAGAATATTTTTTCTGAAAGTAGGCTTTTCGCTCTGCTTCATTACTGCTTCCTTTAGTTTCTATGAAACAGATTG
2241 CTTACCTAAATCTTTAGTTGAATGATTAGTGTTCAATATTGCTTTAATCACCATATAAAAGGAAAAAAATTGGTGACAGA
2321 GCACAAATAGAAAACCTATTTTTAAATAGAAATCACAAATAGCAAGTGTGGAAGCACTACTTTATTCTGTTTAAAATGTA
2401 CTTAAGAAGTCATCAAATTAGTGAACTGAGACATTGGCCTTAGTAGGCTGTATTCACTGCTAATTTAAAAAAGGGAGTAC
2481 CAGGATTTATTAAGTAAAGCATTTTGGAAATGGGGAATAGCGCCATATATGTATGTATGTGTATGTGTGTGTGTGTGTGT
2561 GTATATATACACACACACACACATACTTAAATCTTGCCCTGCATGAAATTCAAATACATGGAGGCACATCTTCAGGGCAC
2641 CAGTGTTAAAATTTTGGAGTCTTAATTTTCATGTGTACACCTCTTTGCCTGTTCCCACCCCCAGACTTGAAATAACACTT
2721 CAGAGTAAGAGGGAATTCAGCTAATTTGTTTTTAAAATTGACTGTAGTGGTCACTAAACCCTTTTTGAGAGAATTTCTAT
2801 TAAAGATGAGGCAGACTCGCTTATTTGAATTGCACAATGTTCTAACAAGGATGTAACACAGAATTGGCTTTTTTTTCCCT
2881 AGAAAAAGATTGTTTGTTTCTATGTCAACTAGATATGATTAAAAATAAGTATTGCCAATGCTGTTTTCATTCTCTAGTGG
2961 CCAGAATCATTATCCTTGAAATTTCTGGTAGTGCCTTAGCTTGGTTAAAAAAAAAAAAAAAAAAAAAAAAAAGGGATTAA
3041 CATTAAATAAAAGTAGTTTAGAATTTGGGCCTCAGACAAGATATTGAACCTCATTCAGTTTCACTTCCACATGTATGTAC
3121 AAGTTAGGTCACCAAACACGGAAGTGTGAGTGTGGAAGGATCTTGGCACTGTAAGCAATGCTATCCATTGATGTATACAA
3201 GTACCTTTATAGTTATCGATCACTGTTAAAACTTTCATTTTAAAATCCTATTACCAAGTTCAGTTTTTTAAAACTTCAAT
3281 TGTCCTGGCTGATTATGCATCACTCTGTGTGCAACTTTTTTATTTCATTTAGTGTTTCTTTCAAGCTGTGTATTTTTGCC
3361 TATTTGTTGCTTGTGCTTTATTTTTCTTAGTCATTTGTGGAATATAGTGATATATTGTGTTAATTTGGACAGTAGCGGTT
3441 TTTAAAAACCATATACTGACTGAAACATGAGCCAGAGCCGATTGCTTTATTAAGCTAATAATGAATGTTAAAGAGTACAT
3521 ATTTTCAGGATCGTTCATCTAGTGAGCAATACACATATTATAGGCCAATATTTTTTTAAAAAATAGAGCTTGGTCAACCT
3601 CTATACTACACATATTACAAGATATAGCACTTTCAAAATGAATCTAAACCTTTACAGAAACTTTCTTATAGGTTATGCCT
3681 TTTATTTTAAGACTTATTATAATTCAAGTGCCATTAGATGATATATATGTAGGCCTTTGATATATAATGCTTTGTGTACA
3761 AAAATGGTAGATGGTATTTTAAACAGGTACATTTTTACAGTGTTTTCTTATCAATTTGCTATATTGCACAGAATCAGTGT
3841 GTGTCTTTTCATAAGGTTTTACAATGGTTTATTTTTTTACAAGGTTTACGTGTCTCAAAGCACACTGTCTTCCCAGTACG
3921 TAAGTTAAAAAATACCAGTTCACCCAAGTTGCTTCTAGCCTACTGAGATCCATGTGACATTGGAGGAGATCTTTTAAATG
4001 TTTAGTATTCGTCATTAGCAATGGCTGGCTGTTAGTTCTGGTAAATGTGTGCCTAAGTTGAATTTGTCTTGTTTTTCTCA
4081 CACTGTGTCAGCAGCCATGTCTACAACACAGATAAGTCTGTTGTGATCACATAGATCTACATAAGTTGTGCAGTTTTGTG
4161 CTAAAAACCCATAGGGAGCTCCTTTGGGATCATAGAAAAGAAGATCATGCAACCAGCATTGGTGAAGGCACACTCAGATT
4241 GCACTTAGGGCCTTTCTATGATGTTGTCAACCCTCTGAGGATGGAAGGCAGTGTCTTTTGATGTTATCTAGCCTAGAAAT
4321 GACACAGAACTATTGCTAATGTATAAAACACTTCATTATATAAGCTTCAGTGGTACAGATGAACCAGAATGAATGTTTAT
4401 CTTCTCAGAAACACTCCTTCAATATTATATTGGATCATGCTGCTAATGTAACTTGGGCTACAACTCTTCATGGTGCTACA
4481 AACTTCTCTGTCTCATTCAGTCGTATTTTTTTATCCATAGAAAAAGGACTACATTAGGTGTAAAAGTGTACAATATATTT
4561 TTATACTGTGACTTAATTTGTCATTAACAAACTTTTACACCACCACAATGTATTCATGTGCACTTGCAAAAGGAGATCTC
4641 GGACATGCAAATGTTACCAGAACAAACCCAGCTTTTGTCCACAAGGTGACTGTAACTCAGAATGGAAAGTGGGCTTTATA
4721 ATAGGGTGTGGAGTGAAGAACATGCTGTATGTTACTAACAGCCCTTTGAATTTAACAAAAACTGGGAATCCATTAGGAAA
4801 CGGATTGCATCATACCTGAACATAAGCTGGACTGCTGAAATTGTATTTTTAGCTAATGAAAAAGTGTTTGGACTAGTACT
4881 CTAAAAATGTTCTAATGATAAAGTTTTGAGTCAAAATAGAAAAGAAAAAAATCTGCATTCCAGGCCGAATTTTGTATATT
4961 TTTATTGCATTTAAAATTGCTATTCTGTAATATTGGGAAATCAAGTGGCTTATCATGTATATCGTGTACTTAAAATGTAT
5041 TCACAAACTACTGTTGTATTTGTATAAAATATAGACAAAGATCATATTTTTTGTGTGTGTATAAGCTCTGTAAAATAGCA
5121 ATCACATTATGAAGCTGCAGTGATACTACATTTTAAACATTCACATCCAAAGAAGCAGACTATTTATTGTCCATATACCA
5201 GATTTAAAATATTAATTTGCTGCTAATTAAATAATAGTACTGCAGCTTCTTGTGGCCTACAGTGTTATGTTTGCTGTAAG
5281 AATAAGATATGTGAATTCCACAAAATATATGAATAAAATTATAGAATGGCTTTA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ucggauagGACCUAAUGAACUu 5'
                  || | |||:|||| 
Target 5' gaggcagaCTCGCTTATTTGAa 3'
 2808 - 2829 138.00 -8.60
2 
miRNA  3' ucGGAUAGGACCUA------AUGAACUu 5'
            |:|||| || ||      ||||| | 
Target 5' ggCTTATCATGTATATCGTGTACTTAAa 3'
 5007 - 5034 130.00 -8.20
3 
miRNA  3' ucGGAUAGGACCUAAUGAACuu 5'
            ||||| :||  ||:||||  
Target 5' tgCCTAT-TTG--TTGCTTGtg 3'
 3357 - 3375 127.00 -13.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN510063 19 COSMIC
COSN30109995 31 COSMIC
COSN5865225 32 COSMIC
COSN31550831 33 COSMIC
COSN30103325 36 COSMIC
COSN2281276 39 COSMIC
COSN26989305 56 COSMIC
COSN31529263 66 COSMIC
COSN30100442 76 COSMIC
COSN31542155 99 COSMIC
COSN20123585 103 COSMIC
COSN1366243 242 COSMIC
COSN16963509 344 COSMIC
COSN9661385 501 COSMIC
COSN20244098 502 COSMIC
COSN5684209 832 COSMIC
COSN17827170 1012 COSMIC
COSN17182765 1193 COSMIC
COSN28541439 1196 COSMIC
COSN30172842 1493 COSMIC
COSN31549555 1540 COSMIC
COSN20822952 1573 COSMIC
COSN31557544 1574 COSMIC
COSN31486924 1620 COSMIC
COSN29607803 1671 COSMIC
COSN30539071 1671 COSMIC
COSN4940734 1697 COSMIC
COSN31523552 1843 COSMIC
COSN16296047 1905 COSMIC
COSN20105503 1905 COSMIC
COSN28152407 1906 COSMIC
COSN31546676 2139 COSMIC
COSN31547888 2195 COSMIC
COSN31568488 2226 COSMIC
COSN31522014 2302 COSMIC
COSN26174914 2303 COSMIC
COSN31962962 2355 COSMIC
COSN9661383 2356 COSMIC
COSN26581579 2483 COSMIC
COSN31540918 2521 COSMIC
COSN31514783 2543 COSMIC
COSN31535855 2543 COSMIC
COSN29743145 2544 COSMIC
COSN31569273 2553 COSMIC
COSN30175289 2559 COSMIC
COSN28671911 2561 COSMIC
COSN8092111 2563 COSMIC
COSN30176746 2568 COSMIC
COSN28106721 2569 COSMIC
COSN31518509 2570 COSMIC
COSN21627586 2604 COSMIC
COSN31570706 2683 COSMIC
COSN31563318 2702 COSMIC
COSN29665705 2752 COSMIC
COSN31491210 2754 COSMIC
COSN31547126 2821 COSMIC
COSN9661382 2859 COSMIC
COSN20855198 2934 COSMIC
COSN31532475 3007 COSMIC
COSN31561905 3032 COSMIC
COSN26574036 3033 COSMIC
COSN9661381 3211 COSMIC
COSN31568475 3217 COSMIC
COSN31483073 3261 COSMIC
COSN30165088 3307 COSMIC
COSN31549556 3338 COSMIC
COSN30169605 3400 COSMIC
COSN31778698 3436 COSMIC
COSN30543346 3437 COSMIC
COSN30162406 3480 COSMIC
COSN30544485 3577 COSMIC
COSN26589364 3578 COSMIC
COSN31523560 3648 COSMIC
COSN2281275 3709 COSMIC
COSN4940733 3739 COSMIC
COSN31547104 3750 COSMIC
COSN21520082 3780 COSMIC
COSN6699965 3839 COSMIC
COSN31519048 3845 COSMIC
COSN20105500 3871 COSMIC
COSN26550803 3903 COSMIC
COSN31548709 3905 COSMIC
COSN17078614 4118 COSMIC
COSN23582919 4144 COSMIC
COSN23066532 4200 COSMIC
COSN21143837 4224 COSMIC
COSN17182034 4264 COSMIC
COSN24302584 4322 COSMIC
COSN27776282 4323 COSMIC
COSN2281274 4425 COSMIC
COSN9661380 4502 COSMIC
COSN19330471 4505 COSMIC
COSN31550843 4550 COSMIC
COSN30543172 4797 COSMIC
COSN27073150 4897 COSMIC
COSN31539657 4928 COSMIC
COSN31529840 4962 COSMIC
COSN31517917 5023 COSMIC
COSN22109803 5024 COSMIC
COSN31531346 5064 COSMIC
COSN31544355 5108 COSMIC
rs34715615 3871 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs759676950 2 dbSNP
rs774529289 5 dbSNP
rs1372913133 6 dbSNP
rs1164267320 8 dbSNP
rs770946747 12 dbSNP
rs534097674 15 dbSNP
rs1396820444 19 dbSNP
rs1357819187 27 dbSNP
rs1430765797 30 dbSNP
rs904239542 30 dbSNP
rs754956552 32 dbSNP
rs764795534 35 dbSNP
rs768369873 41 dbSNP
rs1010292003 44 dbSNP
rs1188878067 45 dbSNP
rs1306238253 46 dbSNP
rs746870540 48 dbSNP
rs1213365599 58 dbSNP
rs1442779392 71 dbSNP
rs1299685771 82 dbSNP
rs892730014 87 dbSNP
rs1227386891 89 dbSNP
rs1315380704 92 dbSNP
rs1361126685 96 dbSNP
rs544620120 107 dbSNP
rs1273237996 108 dbSNP
rs1307449996 118 dbSNP
rs575754603 125 dbSNP
rs1205768541 130 dbSNP
rs565363193 133 dbSNP
rs1040631443 135 dbSNP
rs1440434087 137 dbSNP
rs1369062735 140 dbSNP
rs545513736 154 dbSNP
rs1447278416 159 dbSNP
rs1446637664 162 dbSNP
rs1166827917 165 dbSNP
rs573329399 168 dbSNP
rs553547953 174 dbSNP
rs1410473812 176 dbSNP
rs911820184 177 dbSNP
rs1357349633 183 dbSNP
rs1447082505 184 dbSNP
rs1337116642 188 dbSNP
rs1384589584 190 dbSNP
rs986414594 198 dbSNP
rs944938890 199 dbSNP
rs910759541 202 dbSNP
rs1215812018 217 dbSNP
rs1050544914 220 dbSNP
rs146219331 224 dbSNP
rs573999721 227 dbSNP
rs1264100604 236 dbSNP
rs1462840082 243 dbSNP
rs75628621 245 dbSNP
rs60449229 246 dbSNP
rs1188337941 252 dbSNP
rs1241597508 252 dbSNP
rs57439758 252 dbSNP
rs796699592 252 dbSNP
rs1423025997 266 dbSNP
rs1239643362 273 dbSNP
rs1180854764 281 dbSNP
rs962770461 282 dbSNP
rs1455324102 283 dbSNP
rs1015664726 285 dbSNP
rs1326644105 288 dbSNP
rs920635386 290 dbSNP
rs982964020 303 dbSNP
rs972105350 308 dbSNP
rs754010470 318 dbSNP
rs1366149501 329 dbSNP
rs971940548 346 dbSNP
rs1024564867 350 dbSNP
rs1326014291 360 dbSNP
rs1207210431 361 dbSNP
rs1283894779 363 dbSNP
rs74568212 372 dbSNP
rs1218079514 373 dbSNP
rs1245005869 379 dbSNP
rs570941502 383 dbSNP
rs141959330 390 dbSNP
rs999792696 396 dbSNP
rs1157757035 403 dbSNP
rs1385268683 403 dbSNP
rs902952377 405 dbSNP
rs1041414049 407 dbSNP
rs1233682101 410 dbSNP
rs1348734759 416 dbSNP
rs572006436 428 dbSNP
rs1311783081 431 dbSNP
rs1226989306 435 dbSNP
rs1279298326 436 dbSNP
rs1351700612 440 dbSNP
rs1224585057 461 dbSNP
rs761292017 466 dbSNP
rs1225623655 487 dbSNP
rs1372317633 491 dbSNP
rs999993007 501 dbSNP
rs968514424 502 dbSNP
rs565702252 503 dbSNP
rs1223308563 505 dbSNP
rs1271028331 511 dbSNP
rs374933271 524 dbSNP
rs534374241 524 dbSNP
rs1009973846 529 dbSNP
rs75384951 531 dbSNP
rs941314945 533 dbSNP
rs529154613 545 dbSNP
rs563571226 553 dbSNP
rs1311692179 556 dbSNP
rs773730605 558 dbSNP
rs1304405300 561 dbSNP
rs867486724 578 dbSNP
rs1432360486 583 dbSNP
rs908637277 588 dbSNP
rs767825503 594 dbSNP
rs982828173 600 dbSNP
rs1444814770 610 dbSNP
rs971631019 618 dbSNP
rs917389898 620 dbSNP
rs193197511 621 dbSNP
rs1418203406 624 dbSNP
rs1407704352 639 dbSNP
rs991777462 644 dbSNP
rs187474696 650 dbSNP
rs1439411934 661 dbSNP
rs1175849714 666 dbSNP
rs1484494364 668 dbSNP
rs149893654 674 dbSNP
rs1242196904 675 dbSNP
rs1444824016 683 dbSNP
rs183507966 684 dbSNP
rs752821516 694 dbSNP
rs538130901 697 dbSNP
rs1167919043 700 dbSNP
rs999825446 711 dbSNP
rs1288311526 715 dbSNP
rs1335106915 728 dbSNP
rs535270482 730 dbSNP
rs930779272 731 dbSNP
rs573297706 733 dbSNP
rs1317267376 738 dbSNP
rs115512007 740 dbSNP
rs753293903 744 dbSNP
rs1226780079 747 dbSNP
rs940783475 750 dbSNP
rs917292027 755 dbSNP
rs1198556627 769 dbSNP
rs549417499 773 dbSNP
rs1292563496 775 dbSNP
rs1412907588 782 dbSNP
rs1361879759 783 dbSNP
rs1427473535 784 dbSNP
rs1193251303 787 dbSNP
rs1374190676 787 dbSNP
rs1463941742 788 dbSNP
rs958615898 792 dbSNP
rs1174752116 795 dbSNP
rs1289007440 797 dbSNP
rs927173126 803 dbSNP
rs1339018939 806 dbSNP
rs140197300 807 dbSNP
rs1381769549 810 dbSNP
rs1296349081 812 dbSNP
rs1157319308 813 dbSNP
rs1328154010 822 dbSNP
rs1425960974 824 dbSNP
rs1419085637 827 dbSNP
rs1324090010 828 dbSNP
rs996000934 828 dbSNP
rs1474547315 832 dbSNP
rs968983357 842 dbSNP
rs557213685 843 dbSNP
rs537374458 856 dbSNP
rs577187758 859 dbSNP
rs557748001 869 dbSNP
rs941345973 872 dbSNP
rs1430819720 877 dbSNP
rs190913752 883 dbSNP
rs1224105665 892 dbSNP
rs57103486 899 dbSNP
rs1343692783 909 dbSNP
rs950157372 910 dbSNP
rs1289538513 919 dbSNP
rs185367313 923 dbSNP
rs1302538266 925 dbSNP
rs1346050300 933 dbSNP
rs1225161461 944 dbSNP
rs763582058 946 dbSNP
rs995083040 947 dbSNP
rs1381187032 960 dbSNP
rs899369678 964 dbSNP
rs1489674363 968 dbSNP
rs1036524663 983 dbSNP
rs1359384035 991 dbSNP
rs1294894028 996 dbSNP
rs940782184 1003 dbSNP
rs1202081795 1008 dbSNP
rs1395657198 1011 dbSNP
rs1418729145 1012 dbSNP
rs1164740786 1021 dbSNP
rs745756342 1023 dbSNP
rs535635796 1024 dbSNP
rs781309525 1044 dbSNP
rs569895037 1046 dbSNP
rs954634959 1048 dbSNP
rs1427958533 1052 dbSNP
rs979107752 1053 dbSNP
rs1372255777 1055 dbSNP
rs947320004 1057 dbSNP
rs1193118854 1065 dbSNP
rs1469124784 1066 dbSNP
rs1356795363 1068 dbSNP
rs550071782 1093 dbSNP
rs563309254 1108 dbSNP
rs533282906 1110 dbSNP
rs913090600 1111 dbSNP
rs557237500 1112 dbSNP
rs1231669456 1116 dbSNP
rs1251852926 1116 dbSNP
rs571511725 1118 dbSNP
rs1178119628 1119 dbSNP
rs1252981210 1120 dbSNP
rs965101688 1124 dbSNP
rs1442967435 1127 dbSNP
rs1037663630 1137 dbSNP
rs1004798042 1139 dbSNP
rs1426476574 1141 dbSNP
rs1019297983 1162 dbSNP
rs887128631 1168 dbSNP
rs1305237915 1172 dbSNP
rs1462349055 1181 dbSNP
rs1299638591 1186 dbSNP
rs1302849242 1189 dbSNP
rs1380160650 1195 dbSNP
rs114284204 1196 dbSNP
rs1315147810 1200 dbSNP
rs151081651 1202 dbSNP
rs1212282853 1207 dbSNP
rs895895224 1216 dbSNP
rs1307397913 1217 dbSNP
rs1026606266 1224 dbSNP
rs73594274 1225 dbSNP
rs1260345906 1230 dbSNP
rs1439202878 1232 dbSNP
rs1460165572 1236 dbSNP
rs937549400 1248 dbSNP
rs1243969316 1267 dbSNP
rs1473848191 1272 dbSNP
rs1184829822 1274 dbSNP
rs1418762489 1274 dbSNP
rs73594272 1278 dbSNP
rs1461972402 1292 dbSNP
rs1403556069 1294 dbSNP
rs1469099380 1299 dbSNP
rs1371400076 1311 dbSNP
rs1015512304 1312 dbSNP
rs1407818140 1322 dbSNP
rs1269043256 1342 dbSNP
rs979011808 1343 dbSNP
rs946284043 1347 dbSNP
rs142929953 1348 dbSNP
rs1175601363 1362 dbSNP
rs1005030012 1368 dbSNP
rs1444310281 1379 dbSNP
rs11993194 1381 dbSNP
rs74854827 1386 dbSNP
rs895919250 1391 dbSNP
rs1057264947 1394 dbSNP
rs1213771324 1397 dbSNP
rs778992271 1403 dbSNP
rs1241542396 1405 dbSNP
rs937389445 1406 dbSNP
rs1195843918 1414 dbSNP
rs1454827470 1415 dbSNP
rs905899253 1420 dbSNP
rs1480016922 1421 dbSNP
rs1176849530 1423 dbSNP
rs1431019679 1433 dbSNP
rs1398546653 1447 dbSNP
rs563560185 1450 dbSNP
rs1317041791 1476 dbSNP
rs1252631762 1479 dbSNP
rs1432279563 1480 dbSNP
rs987556481 1481 dbSNP
rs1300646832 1488 dbSNP
rs1344146334 1489 dbSNP
rs1043052288 1493 dbSNP
rs1029163561 1503 dbSNP
rs947299315 1504 dbSNP
rs1347422697 1514 dbSNP
rs1222219945 1516 dbSNP
rs913108972 1531 dbSNP
rs15584 1536 dbSNP
rs543672619 1542 dbSNP
rs989068060 1556 dbSNP
rs1195146178 1557 dbSNP
rs1218859070 1560 dbSNP
rs943844106 1561 dbSNP
rs1266736838 1573 dbSNP
rs912377692 1577 dbSNP
rs1479656353 1581 dbSNP
rs182635843 1582 dbSNP
rs953788245 1587 dbSNP
rs919594625 1588 dbSNP
rs1248183328 1589 dbSNP
rs1468288685 1596 dbSNP
rs973727835 1600 dbSNP
rs139723624 1609 dbSNP
rs1408243769 1609 dbSNP
rs755266261 1612 dbSNP
rs1364284707 1619 dbSNP
rs541017265 1620 dbSNP
rs1304144784 1637 dbSNP
rs1241930903 1639 dbSNP
rs1004691959 1643 dbSNP
rs1333122543 1646 dbSNP
rs1440454253 1651 dbSNP
rs1330048488 1662 dbSNP
rs1005126780 1680 dbSNP
rs199621845 1681 dbSNP
rs767723499 1691 dbSNP
rs960217756 1692 dbSNP
rs886367541 1694 dbSNP
rs1358662580 1698 dbSNP
rs1291935574 1705 dbSNP
rs1435920193 1708 dbSNP
rs1180791272 1712 dbSNP
rs745969739 1713 dbSNP
rs1233138688 1720 dbSNP
rs1441112715 1729 dbSNP
rs1035855218 1740 dbSNP
rs1001651634 1742 dbSNP
rs905912217 1744 dbSNP
rs1164408336 1748 dbSNP
rs1393489281 1768 dbSNP
rs1394601870 1770 dbSNP
rs1408613740 1778 dbSNP
rs1024857081 1787 dbSNP
rs1377957220 1792 dbSNP
rs1014671964 1795 dbSNP
rs1471314997 1797 dbSNP
rs1364157928 1800 dbSNP
rs571987335 1802 dbSNP
rs1043453428 1807 dbSNP
rs1267194893 1812 dbSNP
rs1337329641 1829 dbSNP
rs1195037350 1835 dbSNP
rs1056317018 1842 dbSNP
rs1417174507 1855 dbSNP
rs1011552661 1859 dbSNP
rs937413596 1875 dbSNP
rs904723623 1876 dbSNP
rs1444767920 1879 dbSNP
rs1188983584 1883 dbSNP
rs753838503 1884 dbSNP
rs1043224918 1889 dbSNP
rs1474686051 1889 dbSNP
rs1167714659 1890 dbSNP
rs1401398757 1890 dbSNP
rs1467511163 1891 dbSNP
rs1335043298 1892 dbSNP
rs1405590083 1895 dbSNP
rs1485045759 1899 dbSNP
rs1226530430 1904 dbSNP
rs1270555312 1905 dbSNP
rs1277644076 1907 dbSNP
rs946190565 1909 dbSNP
rs1221451719 1910 dbSNP
rs1262165610 1915 dbSNP
rs200260560 1922 dbSNP
rs891719089 1922 dbSNP
rs145284198 1923 dbSNP
rs1491080904 1923 dbSNP
rs555036795 1923 dbSNP
rs573586591 1923 dbSNP
rs987702825 1923 dbSNP
rs1491339905 1924 dbSNP
rs1280443789 1926 dbSNP
rs1238802527 1928 dbSNP
rs933022279 1930 dbSNP
rs146386822 1935 dbSNP
rs780132826 1938 dbSNP
rs1298795909 1940 dbSNP
rs974521188 1942 dbSNP
rs963139369 1949 dbSNP
rs943956888 1950 dbSNP
rs1282346096 1951 dbSNP
rs1311214886 1959 dbSNP
rs191182522 1965 dbSNP
rs1385963680 1974 dbSNP
rs983289412 1977 dbSNP
rs1460085884 1978 dbSNP
rs535566137 1981 dbSNP
rs781384987 1985 dbSNP
rs950490917 1988 dbSNP
rs1157733331 1989 dbSNP
rs1489531926 1997 dbSNP
rs1025349711 2010 dbSNP
rs1197737890 2010 dbSNP
rs1049518075 2013 dbSNP
rs1013495469 2016 dbSNP
rs932407669 2017 dbSNP
rs919664932 2039 dbSNP
rs1362263456 2051 dbSNP
rs960343265 2058 dbSNP
rs1451317964 2063 dbSNP
rs974160454 2066 dbSNP
rs1159288692 2070 dbSNP
rs1362402480 2075 dbSNP
rs1034336148 2081 dbSNP
rs961102275 2082 dbSNP
rs1474877880 2083 dbSNP
rs1368124236 2091 dbSNP
rs1388285754 2097 dbSNP
rs1304483861 2106 dbSNP
rs569831572 2109 dbSNP
rs1240274652 2120 dbSNP
rs1194707966 2123 dbSNP
rs1356481798 2159 dbSNP
rs1220816427 2161 dbSNP
rs1447166275 2163 dbSNP
rs1248724537 2169 dbSNP
rs1489044128 2169 dbSNP
rs1418674136 2177 dbSNP
rs983741669 2185 dbSNP
rs960268189 2188 dbSNP
rs1283153848 2195 dbSNP
rs1035866444 2200 dbSNP
rs1422821293 2214 dbSNP
rs1203054466 2215 dbSNP
rs1162919799 2225 dbSNP
rs868478737 2228 dbSNP
rs970566261 2238 dbSNP
rs1459290106 2239 dbSNP
rs904629914 2243 dbSNP
rs1043089290 2255 dbSNP
rs1010364939 2267 dbSNP
rs1310816289 2269 dbSNP
rs143948006 2276 dbSNP
rs1052481763 2297 dbSNP
rs1291454157 2302 dbSNP
rs1433008734 2318 dbSNP
rs1322817373 2321 dbSNP
rs1224270430 2322 dbSNP
rs1211120160 2328 dbSNP
rs539695406 2338 dbSNP
rs1199582886 2350 dbSNP
rs1240250422 2352 dbSNP
rs1442912627 2353 dbSNP
rs570720054 2358 dbSNP
rs1317878266 2363 dbSNP
rs921620886 2371 dbSNP
rs547413288 2374 dbSNP
rs1414490794 2375 dbSNP
rs1399234079 2381 dbSNP
rs1168073248 2383 dbSNP
rs1038730695 2389 dbSNP
rs891835447 2390 dbSNP
rs1333018926 2409 dbSNP
rs1396404314 2409 dbSNP
rs941641474 2410 dbSNP
rs908962953 2411 dbSNP
rs1128143 2423 dbSNP
rs1380548665 2449 dbSNP
rs1230461392 2450 dbSNP
rs1294056437 2451 dbSNP
rs1317759410 2453 dbSNP
rs1219613642 2464 dbSNP
rs1260285844 2467 dbSNP
rs950641967 2468 dbSNP
rs1238063987 2471 dbSNP
rs1484195551 2474 dbSNP
rs1184776818 2495 dbSNP
rs565970905 2507 dbSNP
rs146061083 2521 dbSNP
rs1478052913 2522 dbSNP
rs891003446 2525 dbSNP
rs1169099310 2527 dbSNP
rs762148598 2537 dbSNP
rs1172511669 2539 dbSNP
rs917744912 2541 dbSNP
rs529364009 2543 dbSNP
rs1428025981 2545 dbSNP
rs959336685 2545 dbSNP
rs992508851 2545 dbSNP
rs1287686355 2546 dbSNP
rs1340420915 2547 dbSNP
rs1321692566 2549 dbSNP
rs1401028925 2549 dbSNP
rs919743535 2549 dbSNP
rs1218803706 2557 dbSNP
rs186751574 2559 dbSNP
rs1128144 2561 dbSNP
rs1001498751 2563 dbSNP
rs1195594761 2563 dbSNP
rs1213706517 2563 dbSNP
rs1266423778 2563 dbSNP
rs1488553610 2563 dbSNP
rs533408251 2563 dbSNP
rs968652365 2563 dbSNP
rs1398487983 2565 dbSNP
rs1021705652 2566 dbSNP
rs564792112 2567 dbSNP
rs541395297 2568 dbSNP
rs1300442444 2570 dbSNP
rs149010925 2570 dbSNP
rs571978767 2570 dbSNP
rs1128145 2580 dbSNP
rs1289486395 2582 dbSNP
rs1199265274 2584 dbSNP
rs1248124432 2584 dbSNP
rs1450868726 2584 dbSNP
rs527794676 2584 dbSNP
rs1214721809 2586 dbSNP
rs775028637 2591 dbSNP
rs1161039438 2596 dbSNP
rs1389178775 2597 dbSNP
rs1405184328 2601 dbSNP
rs555416726 2601 dbSNP
rs1324574998 2611 dbSNP
rs943392721 2630 dbSNP
rs1440209139 2637 dbSNP
rs1308796919 2644 dbSNP
rs111796461 2645 dbSNP
rs998062513 2654 dbSNP
rs900759805 2660 dbSNP
rs181239887 2661 dbSNP
rs1210231718 2665 dbSNP
rs941715224 2679 dbSNP
rs1197701041 2682 dbSNP
rs1238396334 2682 dbSNP
rs1441056813 2687 dbSNP
rs1216877583 2688 dbSNP
rs565642508 2692 dbSNP
rs73594268 2697 dbSNP
rs1367269743 2698 dbSNP
rs956284604 2702 dbSNP
rs1164213890 2706 dbSNP
rs1416494941 2712 dbSNP
rs1031635908 2714 dbSNP
rs1464378506 2715 dbSNP
rs1008161074 2716 dbSNP
rs1330988988 2717 dbSNP
rs891057349 2722 dbSNP
rs578249712 2728 dbSNP
rs539632200 2733 dbSNP
rs189066516 2742 dbSNP
rs1373482666 2747 dbSNP
rs1449128053 2747 dbSNP
rs1047535811 2750 dbSNP
rs1339814901 2753 dbSNP
rs771052243 2758 dbSNP
rs1439932318 2761 dbSNP
rs185761470 2767 dbSNP
rs898366448 2768 dbSNP
rs1258353231 2771 dbSNP
rs1458788637 2773 dbSNP
rs992023682 2797 dbSNP
rs1254793655 2806 dbSNP
rs959427679 2814 dbSNP
rs554008934 2818 dbSNP
rs149581341 2819 dbSNP
rs979309567 2823 dbSNP
rs12549293 2834 dbSNP
rs939792043 2835 dbSNP
rs886817828 2846 dbSNP
rs181923527 2849 dbSNP
rs1467322076 2859 dbSNP
rs1170893811 2864 dbSNP
rs968727745 2868 dbSNP
rs1021560925 2872 dbSNP
rs868624994 2876 dbSNP
rs1336148066 2877 dbSNP
rs1338299257 2877 dbSNP
rs754869334 2879 dbSNP
rs1395331111 2882 dbSNP
rs926262704 2884 dbSNP
rs1319573215 2885 dbSNP
rs1221235126 2895 dbSNP
rs1468295052 2900 dbSNP
rs1030794683 2901 dbSNP
rs138228101 2902 dbSNP
rs1258913321 2906 dbSNP
rs1487565268 2925 dbSNP
rs1438903181 2928 dbSNP
rs1272305963 2938 dbSNP
rs900662159 2944 dbSNP
rs1226299467 2946 dbSNP
rs1479002885 2948 dbSNP
rs1017910718 2952 dbSNP
rs1377265779 2961 dbSNP
rs948978990 2962 dbSNP
rs749483529 2969 dbSNP
rs1174353369 2971 dbSNP
rs189171827 2979 dbSNP
rs1006461806 2982 dbSNP
rs1298588164 2985 dbSNP
rs887471512 2990 dbSNP
rs1300212513 3003 dbSNP
rs1384841820 3003 dbSNP
rs71256590 3007 dbSNP
rs990684062 3007 dbSNP
rs1283186675 3010 dbSNP
rs866624698 3011 dbSNP
rs1047442411 3033 dbSNP
rs1159230459 3033 dbSNP
rs1216601113 3033 dbSNP
rs1266983752 3033 dbSNP
rs1287357759 3033 dbSNP
rs1292679614 3033 dbSNP
rs1362344653 3033 dbSNP
rs1378486427 3033 dbSNP
rs1421982257 3033 dbSNP
rs1433937673 3033 dbSNP
rs1439161232 3033 dbSNP
rs1456225533 3033 dbSNP
rs1489506353 3033 dbSNP
rs1491398434 3033 dbSNP
rs34779318 3033 dbSNP
rs780726144 3033 dbSNP
rs78916786 3033 dbSNP
rs928941962 3033 dbSNP
rs1211926261 3034 dbSNP
rs1265170881 3034 dbSNP
rs1491537852 3034 dbSNP
rs1457402501 3035 dbSNP
rs956167757 3036 dbSNP
rs1179289640 3041 dbSNP
rs1382118997 3042 dbSNP
rs1368504307 3045 dbSNP
rs1163810070 3049 dbSNP
rs1056581636 3055 dbSNP
rs569813781 3064 dbSNP
rs549904689 3075 dbSNP
rs1299739749 3077 dbSNP
rs1031690022 3088 dbSNP
rs926454245 3096 dbSNP
rs184363858 3100 dbSNP
rs1446929286 3101 dbSNP
rs1332738549 3104 dbSNP
rs986837114 3110 dbSNP
rs1353877210 3112 dbSNP
rs979339219 3119 dbSNP
rs1322760053 3124 dbSNP
rs1326226415 3129 dbSNP
rs1235490599 3138 dbSNP
rs946620783 3139 dbSNP
rs535017497 3140 dbSNP
rs988833233 3152 dbSNP
rs1234604253 3161 dbSNP
rs956202856 3165 dbSNP
rs1375565885 3170 dbSNP
rs1028280702 3175 dbSNP
rs564546607 3177 dbSNP
rs548035549 3178 dbSNP
rs1016768028 3184 dbSNP
rs1168227359 3185 dbSNP
rs1004429235 3186 dbSNP
rs886869665 3187 dbSNP
rs1422503779 3191 dbSNP
rs976571877 3193 dbSNP
rs1179332524 3196 dbSNP
rs1470768532 3205 dbSNP
rs756129133 3216 dbSNP
rs964899892 3217 dbSNP
rs1056253308 3218 dbSNP
rs1417031900 3220 dbSNP
rs1203683156 3232 dbSNP
rs750558082 3234 dbSNP
rs1486679724 3243 dbSNP
rs939063371 3248 dbSNP
rs527985601 3250 dbSNP
rs1310674614 3262 dbSNP
rs1275358765 3268 dbSNP
rs888048248 3270 dbSNP
rs1209473709 3271 dbSNP
rs1308809507 3274 dbSNP
rs1256551897 3279 dbSNP
rs192814519 3280 dbSNP
rs1191256245 3283 dbSNP
rs781660993 3294 dbSNP
rs1478024389 3297 dbSNP
rs541841832 3298 dbSNP
rs189145171 3307 dbSNP
rs993185028 3307 dbSNP
rs1413442913 3310 dbSNP
rs765781388 3313 dbSNP
rs896131418 3314 dbSNP
rs566217755 3316 dbSNP
rs1416597836 3321 dbSNP
rs760429435 3326 dbSNP
rs1311747935 3327 dbSNP
rs35399547 3329 dbSNP
rs1365711661 3330 dbSNP
rs763258794 3332 dbSNP
rs924766686 3333 dbSNP
rs1218744934 3334 dbSNP
rs1346622555 3338 dbSNP
rs1043551986 3339 dbSNP
rs1214446869 3347 dbSNP
rs373584461 3348 dbSNP
rs1488523532 3373 dbSNP
rs986887736 3375 dbSNP
rs1443277292 3385 dbSNP
rs1401615835 3386 dbSNP
rs955447048 3395 dbSNP
rs1244643552 3413 dbSNP
rs545606262 3414 dbSNP
rs376776964 3415 dbSNP
rs1180629282 3417 dbSNP
rs574032791 3422 dbSNP
rs1396426667 3431 dbSNP
rs1437258222 3434 dbSNP
rs576943563 3436 dbSNP
rs553703507 3437 dbSNP
rs1187333200 3451 dbSNP
rs1017233910 3453 dbSNP
rs1320637308 3454 dbSNP
rs1348376505 3460 dbSNP
rs1435948872 3467 dbSNP
rs1004119793 3479 dbSNP
rs1262748732 3480 dbSNP
rs1238032087 3489 dbSNP
rs1216825539 3494 dbSNP
rs535539090 3502 dbSNP
rs1034848792 3505 dbSNP
rs185029334 3510 dbSNP
rs1356025493 3513 dbSNP
rs1292081439 3515 dbSNP
rs1456096340 3517 dbSNP
rs904904130 3519 dbSNP
rs1380252479 3529 dbSNP
rs569842145 3533 dbSNP
rs1010960969 3539 dbSNP
rs952157199 3542 dbSNP
rs191709893 3558 dbSNP
rs142003278 3562 dbSNP
rs775951300 3563 dbSNP
rs960425465 3571 dbSNP
rs74704997 3577 dbSNP
rs1055140415 3578 dbSNP
rs1396924901 3578 dbSNP
rs569950223 3588 dbSNP
rs1463424959 3594 dbSNP
rs1010731318 3603 dbSNP
rs934913936 3604 dbSNP
rs569750521 3609 dbSNP
rs1282340315 3622 dbSNP
rs1419242192 3625 dbSNP
rs371551847 3625 dbSNP
rs924818842 3627 dbSNP
rs776349593 3640 dbSNP
rs1051170342 3646 dbSNP
rs1228640398 3664 dbSNP
rs934077527 3666 dbSNP
rs1164251688 3668 dbSNP
rs1422102091 3669 dbSNP
rs1315633060 3674 dbSNP
rs77755202 3677 dbSNP
rs1238187380 3690 dbSNP
rs1187320241 3696 dbSNP
rs975452181 3697 dbSNP
rs963060650 3699 dbSNP
rs1472699306 3705 dbSNP
rs1485666581 3711 dbSNP
rs760638259 3721 dbSNP
rs539565030 3724 dbSNP
rs796226130 3727 dbSNP
rs1335350240 3741 dbSNP
rs983143751 3745 dbSNP
rs773050710 3750 dbSNP
rs1411706669 3752 dbSNP
rs1034853920 3753 dbSNP
rs1332154982 3758 dbSNP
rs1339761176 3759 dbSNP
rs1415191044 3765 dbSNP
rs867534607 3767 dbSNP
rs969140887 3776 dbSNP
rs1337976082 3777 dbSNP
rs1217714125 3785 dbSNP
rs771830041 3786 dbSNP
rs533193223 3791 dbSNP
rs1340926240 3800 dbSNP
rs1198199939 3814 dbSNP
rs910647550 3816 dbSNP
rs780308794 3821 dbSNP
rs770067254 3824 dbSNP
rs1260134696 3830 dbSNP
rs1052101764 3837 dbSNP
rs1362603720 3841 dbSNP
rs1193272915 3845 dbSNP
rs187587612 3851 dbSNP
rs547676438 3853 dbSNP
rs141248294 3856 dbSNP
rs1170841546 3865 dbSNP
rs1401431786 3868 dbSNP
rs78551271 3871 dbSNP
rs199583518 3872 dbSNP
rs34715615 3872 dbSNP
rs1491147046 3873 dbSNP
rs1358456321 3875 dbSNP
rs1327791539 3879 dbSNP
rs1399142930 3879 dbSNP
rs113113938 3889 dbSNP
rs972370542 3890 dbSNP
rs899984790 3898 dbSNP
rs146133083 3900 dbSNP
rs1212299528 3904 dbSNP
rs1283061513 3917 dbSNP
rs941452113 3919 dbSNP
rs142282793 3920 dbSNP
rs137856188 3929 dbSNP
rs929896689 3935 dbSNP
rs927838275 3936 dbSNP
rs969020945 3939 dbSNP
rs982012919 3960 dbSNP
rs1010595693 3962 dbSNP
rs1454756059 3971 dbSNP
rs969236316 3972 dbSNP
rs1023466597 3974 dbSNP
rs1418901355 3978 dbSNP
rs892329419 3995 dbSNP
rs545852984 3997 dbSNP
rs1386703252 3999 dbSNP
rs1384783694 4001 dbSNP
rs957779251 4005 dbSNP
rs1052713213 4010 dbSNP
rs1031084974 4011 dbSNP
rs1238792749 4018 dbSNP
rs576877485 4019 dbSNP
rs999121472 4020 dbSNP
rs943383656 4023 dbSNP
rs1208350648 4030 dbSNP
rs910552568 4033 dbSNP
rs1049196653 4034 dbSNP
rs1195536975 4040 dbSNP
rs1378432244 4042 dbSNP
rs903457305 4043 dbSNP
rs1029896785 4056 dbSNP
rs116659612 4068 dbSNP
rs1365378920 4075 dbSNP
rs900038830 4086 dbSNP
rs1456177557 4087 dbSNP
rs1481579921 4090 dbSNP
rs1394710736 4099 dbSNP
rs778148048 4102 dbSNP
rs941444581 4104 dbSNP
rs1375330927 4110 dbSNP
rs919318250 4112 dbSNP
rs1308325528 4119 dbSNP
rs1319159612 4121 dbSNP
rs888515513 4141 dbSNP
rs1272821528 4144 dbSNP
rs1335663429 4161 dbSNP
rs1226091532 4163 dbSNP
rs972658110 4168 dbSNP
rs540052474 4171 dbSNP
rs1234635010 4173 dbSNP
rs1236364746 4175 dbSNP
rs1457359984 4178 dbSNP
rs1177756893 4182 dbSNP
rs1213527211 4185 dbSNP
rs939493109 4201 dbSNP
rs1372168174 4203 dbSNP
rs771859102 4205 dbSNP
rs574334217 4216 dbSNP
rs929990115 4219 dbSNP
rs927933637 4231 dbSNP
rs532989741 4233 dbSNP
rs982065269 4237 dbSNP
rs1462034231 4241 dbSNP
rs936545313 4245 dbSNP
rs537777795 4251 dbSNP
rs1376115634 4257 dbSNP
rs947991661 4264 dbSNP
rs1394676907 4271 dbSNP
rs1293003873 4275 dbSNP
rs1356344174 4282 dbSNP
rs576000261 4285 dbSNP
rs956680164 4286 dbSNP
rs1307032049 4298 dbSNP
rs1205259832 4299 dbSNP
rs1253026406 4302 dbSNP
rs989287592 4311 dbSNP
rs1186960351 4336 dbSNP
rs1175739704 4337 dbSNP
rs1476059249 4345 dbSNP
rs1191130184 4346 dbSNP
rs1454919221 4348 dbSNP
rs958042617 4349 dbSNP
rs556291131 4353 dbSNP
rs539874016 4355 dbSNP
rs977795980 4358 dbSNP
rs570852039 4366 dbSNP
rs1464926798 4372 dbSNP
rs954400687 4381 dbSNP
rs1376492670 4392 dbSNP
rs1416975330 4394 dbSNP
rs554280536 4399 dbSNP
rs534113518 4440 dbSNP
rs1281917776 4460 dbSNP
rs998427765 4470 dbSNP
rs1049102614 4490 dbSNP
rs1346712761 4490 dbSNP
rs1280932533 4500 dbSNP
rs753064053 4502 dbSNP
rs1018877481 4503 dbSNP
rs1005689862 4508 dbSNP
rs897904780 4513 dbSNP
rs888600897 4514 dbSNP
rs939556128 4517 dbSNP
rs1453241998 4518 dbSNP
rs568695609 4521 dbSNP
rs1047202543 4522 dbSNP
rs1348701935 4523 dbSNP
rs1396164932 4526 dbSNP
rs35532005 4526 dbSNP
rs994252834 4531 dbSNP
rs1296674677 4533 dbSNP
rs1436990601 4533 dbSNP
rs1344835341 4536 dbSNP
rs1290839249 4546 dbSNP
rs1431834212 4546 dbSNP
rs906568807 4548 dbSNP
rs1365645767 4549 dbSNP
rs981020015 4551 dbSNP
rs948322117 4554 dbSNP
rs1237709951 4556 dbSNP
rs1283217607 4559 dbSNP
rs11782817 4569 dbSNP
rs1435509401 4578 dbSNP
rs764979900 4579 dbSNP
rs1317293695 4591 dbSNP
rs1217576091 4595 dbSNP
rs915470840 4601 dbSNP
rs1467660625 4605 dbSNP
rs79450965 4608 dbSNP
rs1254187674 4617 dbSNP
rs956366249 4617 dbSNP
rs1031202774 4622 dbSNP
rs916475448 4627 dbSNP
rs1054039257 4633 dbSNP
rs532063125 4640 dbSNP
rs965611263 4641 dbSNP
rs1471608565 4649 dbSNP
rs923756714 4650 dbSNP
rs1006697608 4651 dbSNP
rs1188071497 4657 dbSNP
rs888382205 4658 dbSNP
rs747324350 4672 dbSNP
rs1225216877 4677 dbSNP
rs867576581 4687 dbSNP
rs1276030621 4688 dbSNP
rs977849880 4689 dbSNP
rs1353265266 4696 dbSNP
rs1274578343 4700 dbSNP
rs995252475 4706 dbSNP
rs1180348030 4712 dbSNP
rs954452872 4721 dbSNP
rs922948101 4725 dbSNP
rs1261746357 4731 dbSNP
rs1470735895 4733 dbSNP
rs568833676 4734 dbSNP
rs1228243768 4755 dbSNP
rs1415973837 4757 dbSNP
rs1327715098 4760 dbSNP
rs182900997 4764 dbSNP
rs1396860713 4783 dbSNP
rs780271719 4785 dbSNP
rs1006200565 4790 dbSNP
rs952950781 4793 dbSNP
rs1025811784 4797 dbSNP
rs753565381 4801 dbSNP
rs1384196945 4802 dbSNP
rs948185578 4809 dbSNP
rs906578879 4812 dbSNP
rs192540765 4815 dbSNP
rs1294720016 4817 dbSNP
rs113398485 4832 dbSNP
rs895123214 4839 dbSNP
rs540358839 4842 dbSNP
rs936581154 4843 dbSNP
rs923611766 4848 dbSNP
rs1419974199 4850 dbSNP
rs1475079463 4851 dbSNP
rs1188984572 4862 dbSNP
rs923808955 4873 dbSNP
rs1472163494 4877 dbSNP
rs1167344210 4888 dbSNP
rs145504313 4913 dbSNP
rs1411656045 4916 dbSNP
rs1310979252 4921 dbSNP
rs1194872449 4927 dbSNP
rs910948544 4930 dbSNP
rs1248969801 4932 dbSNP
rs372205271 4932 dbSNP
rs1337900747 4933 dbSNP
rs933073779 4943 dbSNP
rs760262413 4947 dbSNP
rs952488128 4956 dbSNP
rs1216892221 4959 dbSNP
rs1278789236 4962 dbSNP
rs528395419 4975 dbSNP
rs964433135 4976 dbSNP
rs1259888350 4978 dbSNP
rs1445424325 4982 dbSNP
rs1192736004 4985 dbSNP
rs367921968 4987 dbSNP
rs75301082 4993 dbSNP
rs1355720285 4997 dbSNP
rs1476419685 5002 dbSNP
rs73594266 5003 dbSNP
rs1025823028 5009 dbSNP
rs1314424133 5016 dbSNP
rs1229806414 5023 dbSNP
rs187682830 5024 dbSNP
rs778648434 5027 dbSNP
rs1438041938 5032 dbSNP
rs1301907156 5042 dbSNP
rs970812981 5050 dbSNP
rs1045094923 5053 dbSNP
rs1025091272 5061 dbSNP
rs1432594993 5066 dbSNP
rs1204825499 5071 dbSNP
rs893974314 5072 dbSNP
rs1326478229 5080 dbSNP
rs1191776059 5081 dbSNP
rs1404760395 5086 dbSNP
rs1454607992 5086 dbSNP
rs1054468479 5088 dbSNP
rs1361911652 5091 dbSNP
rs528977109 5093 dbSNP
rs1169155388 5100 dbSNP
rs935582753 5101 dbSNP
rs1386634301 5108 dbSNP
rs895186009 5109 dbSNP
rs1324555568 5121 dbSNP
rs1371080474 5126 dbSNP
rs868349376 5127 dbSNP
rs1000796578 5132 dbSNP
rs1442352323 5143 dbSNP
rs1389202710 5147 dbSNP
rs754956276 5150 dbSNP
rs1238730207 5157 dbSNP
rs902398618 5158 dbSNP
rs1261550166 5159 dbSNP
rs1448022548 5162 dbSNP
rs924159129 5174 dbSNP
rs1222949309 5176 dbSNP
rs1042216176 5180 dbSNP
rs1195480869 5181 dbSNP
rs1248291277 5186 dbSNP
rs1418320563 5188 dbSNP
rs1287748907 5189 dbSNP
rs1040732796 5195 dbSNP
rs1365185525 5196 dbSNP
rs933184897 5197 dbSNP
rs1163739364 5208 dbSNP
rs1394644425 5219 dbSNP
rs1462530076 5224 dbSNP
rs901666844 5236 dbSNP
rs1038823120 5246 dbSNP
rs1343010890 5255 dbSNP
rs1295833197 5259 dbSNP
rs943645179 5262 dbSNP
rs943106635 5265 dbSNP
rs1391193599 5266 dbSNP
rs1308073757 5267 dbSNP
rs1297109290 5268 dbSNP
rs910979770 5269 dbSNP
rs1352170030 5276 dbSNP
rs1297641518 5290 dbSNP
rs985197243 5291 dbSNP
rs1249571156 5292 dbSNP
rs1226537167 5300 dbSNP
rs1196300144 5304 dbSNP
rs908888276 5307 dbSNP
rs745671816 5308 dbSNP
rs984826017 5323 dbSNP
rs1372896054 5331 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Volinia S; Calin GA; Liu CG; Ambs S; et al.
- Proceedings of the National Academy of Sciences of the United States of America, 2006
Small noncoding microRNAs (miRNAs) can contribute to cancer development and progression and are differentially expressed in normal tissues and cancers. From a large-scale miRnome analysis on 540 samples including lung, breast, stomach, prostate, colon, and pancreatic tumors, we identified a solid cancer miRNA signature composed by a large portion of overexpressed miRNAs. Among these miRNAs are some with well characterized cancer association, such as miR-17-5p, miR-20a, miR-21, miR-92, miR-106a, and miR-155. The predicted targets for the differentially expressed miRNAs are significantly enriched for protein-coding tumor suppressors and oncogenes (P < 0.0001). A number of the predicted targets, including the tumor suppressors RB1 (Retinoblastoma 1) and TGFBR2 (transforming growth factor, beta receptor II) genes were confirmed experimentally. Our results indicate that miRNAs are extensively involved in cancer pathogenesis of solid tumors and support their function as either dominant or recessive cancer genes.
LinkOut: [PMID: 16461460]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Morgan M; Iaconcig A; Muro AF
- Nucleic acids research, 2010
The cytoplasmic polyadenylation element binding-protein (CPEB) is an RNA-binding protein that participates in translational control. CPEB2, CPEB3 and CPEB4 are paralog proteins very similar among themselves referred as the CPEB2 subfamily. To gain insight into common mechanisms of regulation of the CPEB2 subfamily transcripts, we looked for putative cis-acting elements present in the 3'-UTRs of the three paralogs. We found different families of miRNAs predicted to target all subfamily members. Most predicted target sites for these families are located in paralog positions suggesting that these putative regulatory motifs were already present in the ancestral gene. We validated target sites for miR-92 and miR-26 in the three paralogs using mutagenesis of miRNA-binding sites in reporter constructs combined with over-expression and depletion of miRNAs. Both miR-92 and miR-26 induced a decrease in Luciferase activity associated to a reduction in mRNA levels of the reporter constructs. We also showed that the endogenous miRNAs co-regulate CPEB2, CPEB3 and CPEB4 transcripts, supporting our hypothesis that these genes have a common regulatory mechanism mediated by miRNAs. We also suggest that the ancestral pattern of miRNA-binding motifs was maintained throughout the generation of highly conserved elements in each of the 3'-UTRs.
LinkOut: [PMID: 20660482]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions tissues of pituitary adenoma patients
Disease AGCTT GGTAT TGTAG TTCTT GCC
Location of target site 3'UTR
Tools used in this research previous_study
Original Description (Extracted from the article) ... "Further correlation analysis revealed a significant positive correlation between PLAG1 mRNA and protein expression levels (r=0.635 ...

- Yu C; Li J; Sun F; Cui J; Fang H; Sui G, 2016, Medical science monitor : international medical journal of experimental and clinical research.

Article - Yu C; Li J; Sun F; Cui J; Fang H; Sui G
- Medical science monitor : international medical journal of experimental and clinical research, 2016
BACKGROUND Although pituitary adenoma is a malignant tumor, it can present as invasive growth in some cases. MicroRNA (miR)-26a has been found to be abnormally highly expressed in pituitary adenoma, indicating possible involvement in pathogenesis. As a known target gene of miR-26a, PLAG1 has abnormally low expression in pituitary adenoma. The correlation between miR-26a or PLAG1 expressional abnormality and occurrence of pituitary adenoma is still unknown, as is its association with invasiveness of pituitary adenoma. MATERIAL AND METHODS Pituitary adenoma tissues, including both invasive and non-invasive subtypes, were collected from our Neurosurgery Department, in parallel with normal pituitary tissues from postmortem autopsy. qRT-PCR was used to detect mRNA expression of miR-26a and PLAG1, while Western blotting was used to test PLAG1 protein expression. The correlation between miR-26a and PLAG1, and with pathological features, were analyzed. ROC analysis revealed the utility of miR-26a and PLAG1 in differential diagnosis of invasive/non-invasive pituitary tumors and in analyzing their effects on patient prognosis. RESULTS MiR-26a was remarkably upregulated in pituitary tumors, while PLAG1 was downregulated, especially in invasive pituitary tumors. miR-26a and PLAG1 had higher diagnostic values for differentiating between invasive and non-invasive pituitary tumors (AUC=0.889 and 0.818, respectively). Those patients with miR-26 overexpression and PLAG1 downregulation had unfavorable prognosis. miR-26 and PLAG1 are independent factors affecting patient diagnosis. CONCLUSIONS MiR-26a can facilitate occurrence of pituitary tumor and invasiveness, probably via inhibiting PLAG1 expression.
LinkOut: [PMID: 28012286]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.616 1.9e-3 0.623 1.7e-3 20 Click to see details
GSE42095 Differentiated embryonic stem cells -0.478 1.1e-2 -0.304 7.9e-2 23 Click to see details
GSE14794 Lymphoblastoid cells -0.225 1.6e-2 -0.251 8.5e-3 90 Click to see details
GSE21849 B cell lymphoma 0.391 1.8e-2 0.396 1.7e-2 29 Click to see details
GSE32688 Pancreatic cancer 0.307 4.4e-2 0.309 4.3e-2 32 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.594 4.6e-2 -0.600 4.4e-2 9 Click to see details
GSE19783 ER- ER- breast cancer -0.176 6.0e-2 -0.135 1.2e-1 79 Click to see details
GSE21687 Ependynoma primary tumors 0.168 9.2e-2 0.128 1.6e-1 64 Click to see details
GSE17498 Multiple myeloma -0.206 1.0e-1 -0.082 3.1e-1 40 Click to see details
GSE19350 CNS germ cell tumors -0.389 1.1e-1 -0.217 2.5e-1 12 Click to see details
GSE19783 ER+ ER+ breast cancer 0.249 1.4e-1 0.274 1.2e-1 20 Click to see details
GSE26953 Aortic valvular endothelial cells 0.203 1.7e-1 0.103 3.2e-1 24 Click to see details
GSE19536 Breast cancer -0.09 1.9e-1 -0.049 3.1e-1 100 Click to see details
GSE21032 Prostate cancer 0.093 2.0e-1 0.061 2.9e-1 83 Click to see details
GSE17306 Multiple myeloma 0.078 3.0e-1 0.047 3.7e-1 49 Click to see details
GSE27834 Pluripotent stem cells 0.134 3.1e-1 -0.006 4.9e-1 16 Click to see details
GSE38226 Liver fibrosis -0.105 3.3e-1 -0.245 1.4e-1 21 Click to see details
GSE28260 Renal cortex and medulla 0.117 3.5e-1 0.049 4.4e-1 13 Click to see details
GSE28544 Breast cancer -0.074 3.7e-1 -0.077 3.6e-1 24 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.031 4.4e-1 0.271 9.5e-2 25 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.007 4.9e-1 0.000 5.0e-1 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC -0.246 0.04 -0.202 0.08 49 Click to see details
STAD 0.282 0.06 0.363 0.02 32 Click to see details
BRCA 0.152 0.08 0.170 0.06 84 Click to see details
KICH 0.275 0.09 0.227 0.14 25 Click to see details
THCA 0.175 0.09 0.225 0.04 59 Click to see details
PAAD 0.809 0.1 0.400 0.3 4 Click to see details
UCEC 0.246 0.16 0.196 0.21 19 Click to see details
LUSC 0.157 0.17 0.228 0.08 38 Click to see details
CESC 0.852 0.18 0.500 0.33 3 Click to see details
CHOL -0.321 0.2 -0.417 0.13 9 Click to see details
KIRP 0.115 0.27 0.056 0.38 32 Click to see details
ESCA 0.193 0.28 -0.136 0.35 11 Click to see details
COAD 0.191 0.33 0.119 0.39 8 Click to see details
PCPG -0.474 0.34 -0.500 0.33 3 Click to see details
BLCA 0.077 0.38 -0.036 0.44 18 Click to see details
PRAD -0.028 0.42 -0.062 0.33 50 Click to see details
HNSC 0.027 0.43 -0.019 0.45 42 Click to see details
LUAD 0.024 0.47 0.056 0.43 12 Click to see details
KIRC 0.004 0.49 0.059 0.32 68 Click to see details
KIRC 0.004 0.49 0.059 0.32 68 Click to see details
KIRC 0.004 0.49 0.059 0.32 68 Click to see details
449 hsa-miR-26a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000109 HMGA2 high mobility group AT-hook 2 4 5
MIRT000110 HMGA1 high mobility group AT-hook 1 3 5
MIRT000111 CCNE2 cyclin E2 4 2
MIRT000112 CCND2 cyclin D2 5 10
MIRT001021 CDK8 cyclin dependent kinase 8 2 2
MIRT001022 CDC6 cell division cycle 6 3 3
MIRT001039 LIF LIF, interleukin 6 family cytokine 1 2
MIRT001095 PTEN phosphatase and tensin homolog 4 7
MIRT001771 EZH2 enhancer of zeste 2 polycomb repressive complex 2 subunit 5 11
MIRT001772 PLAG1 PLAG1 zinc finger 3 2
MIRT002315 SERBP1 SERPINE1 mRNA binding protein 1 3 3
MIRT002340 SMAD1 SMAD family member 1 4 6
MIRT003212 MAP3K2 mitogen-activated protein kinase kinase kinase 2 3 2
MIRT003213 RB1 RB transcriptional corepressor 1 5 2
MIRT003803 SMAD4 SMAD family member 4 3 3
MIRT003968 MYC MYC proto-oncogene, bHLH transcription factor 2 2
MIRT004338 CTGF connective tissue growth factor 2 2
MIRT004339 STRADB STE20-related kinase adaptor beta 4 4
MIRT004615 IFNB1 interferon beta 1 3 2
MIRT004676 GSK3B glycogen synthase kinase 3 beta 7 10
MIRT005587 CPEB2 cytoplasmic polyadenylation element binding protein 2 3 2
MIRT005588 CPEB3 cytoplasmic polyadenylation element binding protein 3 4 2
MIRT005589 CPEB4 cytoplasmic polyadenylation element binding protein 4 3 2
MIRT005751 GDAP1 ganglioside induced differentiation associated protein 1 3 1
MIRT005920 MTDH metadherin 5 4
MIRT006306 CDK6 cyclin dependent kinase 6 2 1
MIRT006309 CCNE1 cyclin E1 3 2
MIRT006389 ESR1 estrogen receptor 1 1 1
MIRT006711 ABCA1 ATP binding cassette subfamily A member 1 2 1
MIRT006712 ARL4C ADP ribosylation factor like GTPase 4C 2 1
MIRT007177 E2F7 E2F transcription factor 7 2 7
MIRT007347 NOS2 nitric oxide synthase 2 3 2
MIRT007374 IL6 interleukin 6 2 1
MIRT030358 TGFBR2 transforming growth factor beta receptor 2 3 1
MIRT050053 HIST1H4E histone cluster 1 H4 family member e 1 1
MIRT050054 ZNF814 zinc finger protein 814 1 1
MIRT050055 ZNF233 zinc finger protein 233 1 1
MIRT050056 ABCB7 ATP binding cassette subfamily B member 7 1 1
MIRT050057 SCRN1 secernin 1 1 1
MIRT050058 NABP1 nucleic acid binding protein 1 2 8
MIRT050059 FAM20B FAM20B, glycosaminoglycan xylosylkinase 1 1
MIRT050060 ARCN1 archain 1 1 1
MIRT050061 ANO3 anoctamin 3 1 1
MIRT050062 TFAM transcription factor A, mitochondrial 1 1
MIRT050063 FER FER tyrosine kinase 1 1
MIRT050064 HIAT1 major facilitator superfamily domain containing 14A 1 1
MIRT050065 PPP1CC protein phosphatase 1 catalytic subunit gamma 1 1
MIRT050066 SLC35B4 solute carrier family 35 member B4 1 1
MIRT050067 RASA1 RAS p21 protein activator 1 1 1
MIRT050068 COX1 cytochrome c oxidase subunit I 1 1
MIRT050069 MSL3 MSL complex subunit 3 1 1
MIRT050070 GGA2 golgi associated, gamma adaptin ear containing, ARF binding protein 2 1 1
MIRT050071 GIT2 GIT ArfGAP 2 1 1
MIRT050072 DNMT1 DNA methyltransferase 1 1 1
MIRT050073 MFHAS1 malignant fibrous histiocytoma amplified sequence 1 1 1
MIRT050074 UBA2 ubiquitin like modifier activating enzyme 2 1 1
MIRT050075 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT050076 MTRF1 mitochondrial translation release factor 1 1 1
MIRT050077 WBSCR16 RCC1 like 1 1
MIRT050078 NUAK1 NUAK family kinase 1 1 1
MIRT050079 TUT1 terminal uridylyl transferase 1, U6 snRNA-specific 1 1
MIRT050080 PNMA2 paraneoplastic Ma antigen 2 1 1
MIRT050081 ACTL8 actin like 8 1 1
MIRT050082 HSPA8 heat shock protein family A (Hsp70) member 8 1 1
MIRT050083 DHX15 DEAH-box helicase 15 1 1
MIRT050084 TCP1 t-complex 1 1 1
MIRT050085 SLC25A5 solute carrier family 25 member 5 1 1
MIRT050086 LSM14A LSM14A, mRNA processing body assembly factor 1 1
MIRT050087 CAMKV CaM kinase like vesicle associated 1 1
MIRT050088 ALG10B ALG10B, alpha-1,2-glucosyltransferase 1 1
MIRT050089 TYW1 tRNA-yW synthesizing protein 1 homolog 1 1
MIRT050090 RPL13A ribosomal protein L13a 1 1
MIRT050091 AGO1 argonaute 1, RISC catalytic component 1 1
MIRT050092 TXLNG taxilin gamma 1 1
MIRT050093 RAB18 RAB18, member RAS oncogene family 1 1
MIRT050094 RPS27A ribosomal protein S27a 1 1
MIRT050095 RPS26 ribosomal protein S26 1 1
MIRT050096 PIKFYVE phosphoinositide kinase, FYVE-type zinc finger containing 1 1
MIRT050097 TP53INP1 tumor protein p53 inducible nuclear protein 1 1 1
MIRT050098 ZNF703 zinc finger protein 703 1 1
MIRT050099 MTRF1L mitochondrial translational release factor 1 like 1 1
MIRT050100 ZNF506 zinc finger protein 506 1 1
MIRT050101 KCTD5 potassium channel tetramerization domain containing 5 1 1
MIRT050102 CTC1 CST telomere replication complex component 1 1 1
MIRT050103 TKT transketolase 1 1
MIRT050104 LYST lysosomal trafficking regulator 1 1
MIRT050105 FAM134A reticulophagy regulator family member 2 1 1
MIRT050106 NKX2-5 NK2 homeobox 5 1 1
MIRT050107 AURKAIP1 aurora kinase A interacting protein 1 1 1
MIRT050108 ATP1A1 ATPase Na+/K+ transporting subunit alpha 1 1 1
MIRT050109 COASY Coenzyme A synthase 1 1
MIRT050110 CTR9 CTR9 homolog, Paf1/RNA polymerase II complex component 1 1
MIRT050111 COX3 cytochrome c oxidase III 1 1
MIRT050112 ELOVL6 ELOVL fatty acid elongase 6 1 1
MIRT050113 PIGT phosphatidylinositol glycan anchor biosynthesis class T 1 1
MIRT050114 TMCC3 transmembrane and coiled-coil domain family 3 1 1
MIRT050115 ARHGEF1 Rho guanine nucleotide exchange factor 1 1 1
MIRT050116 SHC2 SHC adaptor protein 2 1 1
MIRT050117 PSMA3 proteasome subunit alpha 3 1 1
MIRT050118 PTTG1 pituitary tumor-transforming 1 1 1
MIRT050119 RPS24 ribosomal protein S24 1 1
MIRT050120 SPTBN1 spectrin beta, non-erythrocytic 1 1 1
MIRT050121 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT050122 BTBD3 BTB domain containing 3 1 1
MIRT050123 AHR aryl hydrocarbon receptor 1 1
MIRT050124 EEF1B2 eukaryotic translation elongation factor 1 beta 2 1 1
MIRT050125 MRPL51 mitochondrial ribosomal protein L51 1 1
MIRT050126 SETD2 SET domain containing 2 1 1
MIRT050127 LRP6 LDL receptor related protein 6 1 1
MIRT050128 RHOBTB1 Rho related BTB domain containing 1 1 1
MIRT050129 HIST1H4J histone cluster 1 H4 family member j 1 1
MIRT050130 MYO10 myosin X 1 1
MIRT050131 ATP7B ATPase copper transporting beta 1 1
MIRT050132 CSRP2BP lysine acetyltransferase 14 1 1
MIRT050133 RBM39 RNA binding motif protein 39 1 1
MIRT050134 C14orf37 chromosome 14 open reading frame 37 2 3
MIRT050135 SFMBT1 Scm like with four mbt domains 1 1 1
MIRT050136 KIAA1704 GPALPP motifs containing 1 1 1
MIRT050137 ABCB9 ATP binding cassette subfamily B member 9 1 1
MIRT050138 ADM adrenomedullin 2 11
MIRT050139 USP7 ubiquitin specific peptidase 7 1 1
MIRT050140 TTN titin 1 1
MIRT050141 HNRNPU heterogeneous nuclear ribonucleoprotein U 1 1
MIRT050142 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon 1 1
MIRT050143 CEPT1 choline/ethanolamine phosphotransferase 1 1 1
MIRT050144 HOXC8 homeobox C8 1 1
MIRT050145 CTBP1 C-terminal binding protein 1 1 1
MIRT050146 SET SET nuclear proto-oncogene 1 1
MIRT050147 MCM3AP minichromosome maintenance complex component 3 associated protein 1 1
MIRT050148 TPGS2 tubulin polyglutamylase complex subunit 2 1 1
MIRT050149 CA2 carbonic anhydrase 2 1 1
MIRT050150 PCYT1A phosphate cytidylyltransferase 1, choline, alpha 1 1
MIRT050151 ACTN4 actinin alpha 4 1 1
MIRT050152 EPG5 ectopic P-granules autophagy protein 5 homolog 1 1
MIRT050153 OLA1 Obg like ATPase 1 1 1
MIRT050154 RRM2 ribonucleotide reductase regulatory subunit M2 1 1
MIRT050155 BBX BBX, HMG-box containing 1 1
MIRT050156 NUP205 nucleoporin 205 1 1
MIRT050157 C6orf47 chromosome 6 open reading frame 47 1 1
MIRT050158 CFLAR CASP8 and FADD like apoptosis regulator 1 1
MIRT050159 SEC31A SEC31 homolog A, COPII coat complex component 1 1
MIRT050160 GLG1 golgi glycoprotein 1 1 1
MIRT050161 TBC1D16 TBC1 domain family member 16 1 1
MIRT050162 BTBD9 BTB domain containing 9 1 1
MIRT050163 RND2 Rho family GTPase 2 1 1
MIRT050164 TUBG1 tubulin gamma 1 1 1
MIRT050165 AHRR aryl-hydrocarbon receptor repressor 1 1
MIRT050166 CNTD2 cyclin N-terminal domain containing 2 1 1
MIRT050167 UBE2A ubiquitin conjugating enzyme E2 A 1 1
MIRT050168 CCDC43 coiled-coil domain containing 43 1 1
MIRT050169 MSH6 mutS homolog 6 1 1
MIRT050170 HIST4H4 histone cluster 4 H4 1 1
MIRT050171 C17orf51 chromosome 17 open reading frame 51 1 1
MIRT050172 SLC25A30 solute carrier family 25 member 30 1 1
MIRT050173 USB1 U6 snRNA biogenesis phosphodiesterase 1 1 1
MIRT050174 MYH10 myosin heavy chain 10 1 1
MIRT050175 LINS lines homolog 1 1 1
MIRT050176 UBR4 ubiquitin protein ligase E3 component n-recognin 4 1 2
MIRT050177 ZNF207 zinc finger protein 207 1 1
MIRT050178 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 1
MIRT050179 TXNL1 thioredoxin like 1 1 1
MIRT050180 FOXO3 forkhead box O3 1 1
MIRT050181 COPB1 coatomer protein complex subunit beta 1 1 1
MIRT050182 FASN fatty acid synthase 1 1
MIRT050183 SARS seryl-tRNA synthetase 1 1
MIRT050184 DDB1 damage specific DNA binding protein 1 1 1
MIRT050185 PPIA peptidylprolyl isomerase A 1 1
MIRT050186 SLC35A4 solute carrier family 35 member A4 1 1
MIRT050187 TXNDC11 thioredoxin domain containing 11 1 1
MIRT050188 HIST2H2AA3 histone cluster 2 H2A family member a3 1 1
MIRT050189 TRAP1 TNF receptor associated protein 1 1 1
MIRT050190 SDCBP syndecan binding protein 1 1
MIRT050191 ASCC2 activating signal cointegrator 1 complex subunit 2 1 1
MIRT050192 KDM5C lysine demethylase 5C 1 1
MIRT050193 DST dystonin 1 1
MIRT050194 CLIC4 chloride intracellular channel 4 1 1
MIRT050195 WWP2 WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT050196 ATP5A1 ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle 1 1
MIRT050197 RPL13 ribosomal protein L13 1 1
MIRT050198 CNBP CCHC-type zinc finger nucleic acid binding protein 1 1
MIRT052649 MCL1 MCL1, BCL2 family apoptosis regulator 1 1
MIRT052903 CHD1 chromodomain helicase DNA binding protein 1 2 1
MIRT053077 CKS2 CDC28 protein kinase regulatory subunit 2 4 3
MIRT053097 PRKCD protein kinase C delta 4 2
MIRT053251 BAG4 BCL2 associated athanogene 4 2 1
MIRT053574 FGF9 fibroblast growth factor 9 3 1
MIRT054062 ACVR1 activin A receptor type 1 2 1
MIRT054415 AMACR alpha-methylacyl-CoA racemase 3 1
MIRT054432 ATM ATM serine/threonine kinase 3 1
MIRT054484 RCBTB1 RCC1 and BTB domain containing protein 1 3 1
MIRT054645 HGF hepatocyte growth factor 3 1
MIRT054676 LIN28B lin-28 homolog B 3 1
MIRT054677 ZCCHC11 zinc finger CCHC-type containing 11 3 1
MIRT060004 VANGL2 VANGL planar cell polarity protein 2 2 4
MIRT062177 WNK1 WNK lysine deficient protein kinase 1 2 2
MIRT064905 ZBTB18 zinc finger and BTB domain containing 18 2 6
MIRT066809 ZDHHC18 zinc finger DHHC-type containing 18 2 3
MIRT067540 METAP2 methionyl aminopeptidase 2 1 1
MIRT072092 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 5
MIRT072125 RTF1 RTF1 homolog, Paf1/RNA polymerase II complex component 1 1
MIRT073375 ABHD2 abhydrolase domain containing 2 1 1
MIRT075111 C16ORF70 chromosome 16 open reading frame 70 2 5
MIRT080605 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 2 8
MIRT085205 SLC5A3 solute carrier family 5 member 3 2 2
MIRT086007 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 2 2
MIRT087899 TNRC6B trinucleotide repeat containing 6B 2 5
MIRT089450 TET3 tet methylcytosine dioxygenase 3 2 3
MIRT089599 MAT2A methionine adenosyltransferase 2A 2 11
MIRT090517 SLC25A36 solute carrier family 25 member 36 2 2
MIRT097631 POLR3G RNA polymerase III subunit G 1 1
MIRT118410 DNMT3B DNA methyltransferase 3 beta 4 1
MIRT122040 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 1
MIRT133477 EP400 E1A binding protein p400 1 1
MIRT134087 KLHL42 kelch like family member 42 1 1
MIRT136529 KPNA6 karyopherin subunit alpha 6 1 1
MIRT137414 RLF rearranged L-myc fusion 1 1
MIRT137577 RCOR1 REST corepressor 1 1 1
MIRT137722 EIF5 eukaryotic translation initiation factor 5 1 1
MIRT147274 KPNA2 karyopherin subunit alpha 2 2 10
MIRT151691 CHAF1A chromatin assembly factor 1 subunit A 1 1
MIRT156734 FAM126B family with sequence similarity 126 member B 2 2
MIRT159273 RASGRP3 RAS guanyl releasing protein 3 1 1
MIRT166022 SFXN1 sideroflexin 1 1 1
MIRT166592 ZSWIM6 zinc finger SWIM-type containing 6 1 1
MIRT168865 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT168937 IRF4 interferon regulatory factor 4 1 1
MIRT169515 TTK TTK protein kinase 1 1
MIRT169560 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT170138 KLHDC10 kelch domain containing 10 1 1
MIRT175075 DCAF10 DDB1 and CUL4 associated factor 10 1 1
MIRT183141 WEE1 WEE1 G2 checkpoint kinase 2 1
MIRT187790 ANKRD52 ankyrin repeat domain 52 1 1
MIRT191753 ZNF410 zinc finger protein 410 2 2
MIRT193070 MAPK6 mitogen-activated protein kinase 6 2 2
MIRT193726 USP3 ubiquitin specific peptidase 3 1 1
MIRT203408 DYRK1A dual specificity tyrosine phosphorylation regulated kinase 1A 1 1
MIRT206543 RHOQ ras homolog family member Q 2 2
MIRT210981 TET2 tet methylcytosine dioxygenase 2 1 1
MIRT213685 PTPN13 protein tyrosine phosphatase, non-receptor type 13 3 1
MIRT215349 CREBRF CREB3 regulatory factor 2 2
MIRT227685 TBC1D13 TBC1 domain family member 13 2 2
MIRT243962 MAP1B microtubule associated protein 1B 2 2
MIRT250410 TNRC6A trinucleotide repeat containing 6A 2 7
MIRT262152 OTUD1 OTU deubiquitinase 1 1 1
MIRT277212 AKIRIN1 akirin 1 2 2
MIRT286389 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 3
MIRT308147 PDE12 phosphodiesterase 12 2 2
MIRT319694 UBN2 ubinuclein 2 2 3
MIRT327077 KLHL15 kelch like family member 15 2 10
MIRT346489 SSX2IP SSX family member 2 interacting protein 1 1
MIRT438130 ADAM17 ADAM metallopeptidase domain 17 6 3
MIRT438159 PIK3C2A phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha 1 1
MIRT438209 CHEK1 checkpoint kinase 1 2 1
MIRT438638 TDG thymine DNA glycosylase 1 1
MIRT438656 PHB prohibitin 3 1
MIRT444707 ZNF772 zinc finger protein 772 2 2
MIRT448615 OTUD4 OTU deubiquitinase 4 2 2
MIRT451358 UQCR11 ubiquinol-cytochrome c reductase, complex III subunit XI 2 2
MIRT457292 ZBTB45 zinc finger and BTB domain containing 45 2 2
MIRT458763 CES2 carboxylesterase 2 2 2
MIRT458855 CD55 CD55 molecule (Cromer blood group) 2 2
MIRT460261 SLC26A2 solute carrier family 26 member 2 2 2
MIRT461702 ZNF426 zinc finger protein 426 2 2
MIRT465730 TMTC3 transmembrane and tetratricopeptide repeat containing 3 2 2
MIRT466688 TAF13 TATA-box binding protein associated factor 13 2 4
MIRT468541 SERP1 stress associated endoplasmic reticulum protein 1 2 2
MIRT468809 SACS sacsin molecular chaperone 2 11
MIRT470198 PSAT1 phosphoserine aminotransferase 1 2 6
MIRT476009 GTF2A1 general transcription factor IIA subunit 1 2 8
MIRT477228 ETF1 eukaryotic translation termination factor 1 2 4
MIRT477752 EDEM3 ER degradation enhancing alpha-mannosidase like protein 3 2 2
MIRT478346 DDIT4 DNA damage inducible transcript 4 2 2
MIRT478525 CTNS cystinosin, lysosomal cystine transporter 2 2
MIRT480793 BLOC1S2 biogenesis of lysosomal organelles complex 1 subunit 2 2 6
MIRT482242 AGPAT5 1-acylglycerol-3-phosphate O-acyltransferase 5 2 2
MIRT486465 MDM2 MDM2 proto-oncogene 2 10
MIRT487561 LOXL2 lysyl oxidase like 2 2 2
MIRT498663 ZNF664 zinc finger protein 664 2 8
MIRT499509 RNF6 ring finger protein 6 2 6
MIRT502456 FRAT2 FRAT2, WNT signaling pathway regulator 2 6
MIRT502713 CREBZF CREB/ATF bZIP transcription factor 2 6
MIRT502853 CHEK2 checkpoint kinase 2 2 6
MIRT507558 DEPDC1 DEP domain containing 1 2 6
MIRT524742 BRCA1 BRCA1, DNA repair associated 2 2
MIRT527178 LRRTM4 leucine rich repeat transmembrane neuronal 4 2 2
MIRT527909 B3GALT5 beta-1,3-galactosyltransferase 5 2 2
MIRT532895 ZNF451 zinc finger protein 451 2 2
MIRT533588 TOB1 transducer of ERBB2, 1 2 7
MIRT534368 SETD8 lysine methyltransferase 5A 2 4
MIRT535060 PPP2R5D protein phosphatase 2 regulatory subunit B'delta 2 4
MIRT536204 MAD2L1 mitotic arrest deficient 2 like 1 2 2
MIRT537233 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 2 2
MIRT539774 KIAA0408 KIAA0408 2 6
MIRT540867 ZBTB24 zinc finger and BTB domain containing 24 2 2
MIRT541042 SOGA3 SOGA family member 3 2 6
MIRT541350 DDX3X DEAD-box helicase 3, X-linked 2 2
MIRT544949 TUB tubby bipartite transcription factor 2 4
MIRT545809 ZNF608 zinc finger protein 608 2 2
MIRT547008 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 2
MIRT551188 EPB41L3 erythrocyte membrane protein band 4.1 like 3 2 2
MIRT551973 TMEM19 transmembrane protein 19 2 2
MIRT552044 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 2 2
MIRT553325 TSC22D2 TSC22 domain family member 2 2 2
MIRT554367 SFPQ splicing factor proline and glutamine rich 2 2
MIRT555741 PDCD10 programmed cell death 10 2 2
MIRT556346 MAN2A1 mannosidase alpha class 2A member 1 2 3
MIRT560389 TMEM254 transmembrane protein 254 2 2
MIRT560465 SMIM9 small integral membrane protein 9 2 2
MIRT561122 ATP2B1 ATPase plasma membrane Ca2+ transporting 1 2 2
MIRT562626 ARNTL2 aryl hydrocarbon receptor nuclear translocator like 2 2 2
MIRT564084 NSA2 NSA2, ribosome biogenesis homolog 2 2
MIRT564207 SDE2 SDE2 telomere maintenance homolog 2 2
MIRT565191 TSHZ1 teashirt zinc finger homeobox 1 2 2
MIRT567887 CSTF2 cleavage stimulation factor subunit 2 2 2
MIRT568259 BMP2K BMP2 inducible kinase 2 2
MIRT568505 ARF1 ADP ribosylation factor 1 2 2
MIRT572178 CDV3 CDV3 homolog 2 2
MIRT574711 HAUS8 HAUS augmin like complex subunit 8 2 3
MIRT610597 NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit 2 2
MIRT614445 WDR92 WD repeat domain 92 2 2
MIRT615442 FAXC failed axon connections homolog 2 2
MIRT618503 HSPD1 heat shock protein family D (Hsp60) member 1 2 2
MIRT618903 CDK9 cyclin dependent kinase 9 2 2
MIRT620083 TNFAIP8L1 TNF alpha induced protein 8 like 1 2 2
MIRT620286 GLTP glycolipid transfer protein 2 2
MIRT622464 RNF11 ring finger protein 11 2 2
MIRT624644 ASXL3 additional sex combs like 3, transcriptional regulator 2 2
MIRT624697 AQR aquarius intron-binding spliceosomal factor 2 2
MIRT625256 ZNF566 zinc finger protein 566 2 2
MIRT628258 EFCAB14 EF-hand calcium binding domain 14 2 2
MIRT628872 FAM177A1 family with sequence similarity 177 member A1 2 2
MIRT630720 FPR1 formyl peptide receptor 1 2 2
MIRT631887 SLFN13 schlafen family member 13 2 2
MIRT637716 MYOZ3 myozenin 3 2 2
MIRT639892 SSR3 signal sequence receptor subunit 3 2 2
MIRT642506 ORC6 origin recognition complex subunit 6 2 2
MIRT644723 SEPT14 septin 14 2 2
MIRT645341 AGTPBP1 ATP/GTP binding protein 1 2 2
MIRT648886 TUBGCP5 tubulin gamma complex associated protein 5 2 2
MIRT653565 SLC35B3 solute carrier family 35 member B3 2 2
MIRT656095 MTA3 metastasis associated 1 family member 3 2 2
MIRT660204 BMPR1A bone morphogenetic protein receptor type 1A 2 2
MIRT660753 ALDH6A1 aldehyde dehydrogenase 6 family member A1 2 2
MIRT661379 RHCG Rh family C glycoprotein 2 2
MIRT662310 ADM2 adrenomedullin 2 2 2
MIRT662628 MCM8 minichromosome maintenance 8 homologous recombination repair factor 2 2
MIRT663688 ZNF347 zinc finger protein 347 2 2
MIRT665109 FKTN fukutin 2 2
MIRT665262 ZKSCAN1 zinc finger with KRAB and SCAN domains 1 2 2
MIRT666273 SLC31A1 solute carrier family 31 member 1 2 2
MIRT666646 RBM48 RNA binding motif protein 48 2 2
MIRT667511 LUC7L2 LUC7 like 2, pre-mRNA splicing factor 2 2
MIRT669228 C7orf55-LUC7L2 C7orf55-LUC7L2 readthrough 2 2
MIRT669271 C1orf50 chromosome 1 open reading frame 50 2 2
MIRT671783 RGS17 regulator of G protein signaling 17 2 2
MIRT672379 RPL37 ribosomal protein L37 2 2
MIRT673464 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 2
MIRT673600 HPSE heparanase 2 4
MIRT676269 NWD1 NACHT and WD repeat domain containing 1 2 2
MIRT676514 RNF216 ring finger protein 216 2 2
MIRT676653 LRRC27 leucine rich repeat containing 27 2 2
MIRT677335 PHAX phosphorylated adaptor for RNA export 2 2
MIRT677523 OCIAD2 OCIA domain containing 2 2 2
MIRT677548 C19orf52 translocase of inner mitochondrial membrane 29 2 2
MIRT677724 SSR1 signal sequence receptor subunit 1 2 2
MIRT677800 PNPLA3 patatin like phospholipase domain containing 3 2 2
MIRT677885 DCP1A decapping mRNA 1A 2 2
MIRT678104 MICA MHC class I polypeptide-related sequence A 2 2
MIRT678431 PDE4C phosphodiesterase 4C 2 2
MIRT678488 ARHGEF39 Rho guanine nucleotide exchange factor 39 2 2
MIRT678898 TTLL12 tubulin tyrosine ligase like 12 2 2
MIRT679296 SSBP2 single stranded DNA binding protein 2 2 2
MIRT679572 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 2 2
MIRT680003 ZNF860 zinc finger protein 860 2 2
MIRT694963 PLAC8 placenta specific 8 2 2
MIRT697861 UBE2H ubiquitin conjugating enzyme E2 H 2 2
MIRT698310 TMEM2 transmembrane protein 2 2 2
MIRT701712 MTMR12 myotubularin related protein 12 2 2
MIRT705964 ACBD5 acyl-CoA binding domain containing 5 2 2
MIRT714342 DIP2A disco interacting protein 2 homolog A 2 2
MIRT715309 POLR2E RNA polymerase II subunit E 2 2
MIRT717477 PDE4DIP phosphodiesterase 4D interacting protein 2 2
MIRT719604 PRKX protein kinase, X-linked 2 2
MIRT724483 CSNK1A1 casein kinase 1 alpha 1 2 2
MIRT726021 ZNF680 zinc finger protein 680 1 1
MIRT726041 ZNF254 zinc finger protein 254 1 1
MIRT726096 WNT5A Wnt family member 5A 1 1
MIRT726288 TMEM30A transmembrane protein 30A 1 1
MIRT726312 TMCC1 transmembrane and coiled-coil domain family 1 1 1
MIRT726446 SSH2 slingshot protein phosphatase 2 1 1
MIRT726486 SMEK1 protein phosphatase 4 regulatory subunit 3A 1 1
MIRT726514 SLC7A1 solute carrier family 7 member 1 1 1
MIRT726535 SLC38A2 solute carrier family 38 member 2 1 1
MIRT726657 SASS6 SAS-6 centriolar assembly protein 1 1
MIRT726778 REEP4 receptor accessory protein 4 1 1
MIRT726937 PIK3R4 phosphoinositide-3-kinase regulatory subunit 4 1 1
MIRT726989 PDE4B phosphodiesterase 4B 1 1
MIRT727060 NUDT19 nudix hydrolase 19 1 1
MIRT727062 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 1
MIRT727485 HSPA13 heat shock protein family A (Hsp70) member 13 1 1
MIRT727488 HNRNPA0 heterogeneous nuclear ribonucleoprotein A0 1 1
MIRT727508 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT727675 FBXO11 F-box protein 11 1 1
MIRT727780 ELAVL2 ELAV like RNA binding protein 2 1 1
MIRT727786 EIF4G2 eukaryotic translation initiation factor 4 gamma 2 1 1
MIRT727793 EHD1 EH domain containing 1 1 1
MIRT727863 DNMBP dynamin binding protein 1 1
MIRT727903 DCTN4 dynactin subunit 4 1 1
MIRT727941 CPSF2 cleavage and polyadenylation specific factor 2 1 1
MIRT727966 COX5A cytochrome c oxidase subunit 5A 1 1
MIRT728000 CHORDC1 cysteine and histidine rich domain containing 1 3 1
MIRT728203 BID BH3 interacting domain death agonist 1 1
MIRT728213 BCL7B BCL tumor suppressor 7B 1 1
MIRT728306 ARPP19 cAMP regulated phosphoprotein 19 1 1
MIRT728331 AP1S3 adaptor related protein complex 1 sigma 3 subunit 1 1
MIRT728396 ACSL3 acyl-CoA synthetase long chain family member 3 1 1
MIRT731168 ITGA5 integrin subunit alpha 5 2 1
MIRT731390 DUSP4 dual specificity phosphatase 4 3 1
MIRT732062 NRAS NRAS proto-oncogene, GTPase 3 1
MIRT732063 E2F2 E2F transcription factor 2 3 1
MIRT732182 PTGS2 prostaglandin-endoperoxide synthase 2 6 2
MIRT732280 JAG1 jagged 1 3 1
MIRT732490 NRP1 neuropilin 1 1 0
MIRT732621 MS multiple sclerosis 1 0
MIRT733344 CREB1 cAMP responsive element binding protein 1 4 0
MIRT733365 ADIPOQ adiponectin, C1Q and collagen domain containing 1 0
MIRT733699 NORAD non-coding RNA activated by DNA damage 2 0
MIRT733700 UBE3A ubiquitin protein ligase E3A 2 0
MIRT733702 CCND1 cyclin D1 2 0
MIRT733703 TGFBR1 transforming growth factor beta receptor 1 2 0
MIRT734551 SHC4 SHC adaptor protein 4 2 0
MIRT734552 PFDN4 prefoldin subunit 4 2 0
MIRT734721 CD38 CD38 molecule 3 0
MIRT736775 MAP2 microtubule associated protein 2 2 0
MIRT736838 USP35 ubiquitin specific peptidase 35 2 0
MIRT736852 EIF2A eukaryotic translation initiation factor 2A 2 0
MIRT737078 ULK1 unc-51 like autophagy activating kinase 1 3 0
MIRT737079 SNHG6 small nucleolar RNA host gene 6 3 0
MIRT737091 ULK2 unc-51 like autophagy activating kinase 2 3 0
MIRT737491 FLI1 Fli-1 proto-oncogene, ETS transcription factor 2 0
MIRT755414 NEK6 NIMA related kinase 6 3 1
MIRT755509 ICAM1 intercellular adhesion molecule 1 1 1
MIRT755687 RUNX2 runt related transcription factor 2 3 1
MIRT755688 SPP1 secreted phosphoprotein 1 3 1
MIRT755689 ALPL alkaline phosphatase, liver/bone/kidney 3 1
MIRT756239 NEAT1 nuclear paraspeckle assembly transcript 1 (non-protein coding) 2 1
MIRT756240 FANCE Fanconi anemia complementation group E 3 1
MIRT756287 ZBTB7C zinc finger and BTB domain containing 7C 3 1
MIRT756352 PLCB1 phospholipase C beta 1 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-26a Hydroxamic acid HDACi LAQ824 NULL NULL Microarray breast cancer cell line SKBr3 16452179 2006 down-regulated
miR-26a Curcumin NULL 969516 Microarray BxPC-3 human pancreatic carcinoma cell line 18347134 2008 down-regulated
miR-26a Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 down-regulated
miR-26a Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 up-regulated
miR-26a Morphine approved 5288826 Microarray human monocyte-derived macrophages (h-mdms) infection with HIV-1 20564181 2010 down-regulated
miR-26a Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-26a Enoxacin approved 3229 Quantitative real-time PCR HCT-116 and RKO colon cancer cell lines 21368194 2011 up-regulated
miR-26a Metformin approved 4091 Quantitative real-time PCR pancreatic cancer cells 22086681 2012 up-regulated
miR-26a Metformin approved 4091 Quantitative real-time PCR pancreatic cancer cells 22086681 2012 up-regulated
miR-26a Tamoxifen approved 2733526 Quantitative real-time PCR breast cancer 22094936 2012 up-regulated
miR-26a CDF(analogues of curcumin) NULL NULL Quantitative real-time PCR pancreatic cancer cells 22108826 2012 up-regulated
miR-26a Metformin approved 4091 Quantitative real-time PCR Pancreatic Neoplasms 22245693 2012 up-regulated
miR-26a Trastuzumab approved NULL Microarray HER2-positive breast cancer 22384020 2012 up-regulated
miR-26a Trastuzumab approved NULL Quantitative real-time PCR HER2-positive breast cancer 22384020 2012 up-regulated
miR-26a 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-26a 5-aminoimidazole-4-carboxamide-1-β-d-ribofuranoside (AICAR) NULL 16078949 Microarray hepatocytes 23107762 2013 down-regulated
miR-26a Sevoflurane approved 5206 Quantitative real-time PCR lung cell 23124245 2012 down-regulated
miR-26a Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse liver 19270793 2009 up-regulated
miR-26a Budesonide approved 5281004 Microarray neonatal mice liver 20145010 2010 up-regulated
miR-26a Phenethyl isothiocyanate(PEITC) NULL 16741 Microarray neonatal mice liver 20145010 2010 up-regulated
miR-26a Atorvastatin approved 60823 Quantitative real-time PCR Cardiomyocyte 23860036 2013 down-regualted
miR-26a Nicotine approved 89594 Microarray Rat adrenal pheochromocytoma PC12 cell 18845019 2009 up-regulated
miR-26a Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 down-regulated
miR-26a Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-26a Marine fungal metabolite 1386A NULL NULL Microarray MCF-7 breast cancer cells. 22159329 2012 up-regulated
miR-26a Trastuzumab approved NULL Microarray BT474 cells 22384020 2012 up-regulated
miR-26a Trastuzumab approved NULL Microarray SKBR3 cells. 22384020 2012 up-regulated
miR-26a Vitamin D3 approved 5280795 Quantitative real-time PCR Plasma 22594500 2012 up-regulated
miR-26a Vitamin D3 approved 5280795 Quantitative real-time PCR Plasma 22594500 2012 up-regulated
miR-26a Temozolomide approved 5394 Quantitative real-time PCR glioblastoma cells. 22722712 2012 down-regulated
miR-26a Phenethyl isothiocyanate(PEITC) NULL 16741 Microarray neonatal mice liver 20145010 2010 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-26a-5p [(1R,2R,3E,7S,11E,13S,15S)-15-hydroxy-7-methyl-5-oxo-6-oxabicyclo[11.3.0]hexadeca-3,11-dien-2-yl] (2R)-2-(dimethylamino)-3-methylbutanoate;hydrochloride 45028997 NSC745103 resistant
hsa-miR-26a-5p 1-[(E)-[phenyl(pyridin-2-yl)methylidene]amino]-3-(2-pyridin-2-ylethyl)thiourea 9571616 NSC689531 sensitive
hsa-miR-26a-5p 1-[phenyl(2-pyridinyl)methylene]-4-(2-methylphenyl)thiosemicarbazide 6148953 NSC668326 sensitive
hsa-miR-26a-5p 1-cyclohexyl-3-[(e)-[phenyl(2-pyridyl)methylene]amino]urea 6179448 NSC689539 sensitive
hsa-miR-26a-5p 2',6'-dibromospiro[7,8-dihydro-6h-pyrido[2,3-g]quinoline-9,4'-cyclohexa-2,5-diene]-1',5,10-trione 383051 NSC671095 resistant
hsa-miR-26a-5p 2-hydroxy-N-[(E)-1-[6-[(E)-N-[(2-hydroxybenzoyl)amino]-C-methylcarbonimidoyl]pyridin-2-yl]ethylideneamino]benzamide 5779747 NSC617573 sensitive
hsa-miR-26a-5p 2,7-dicyanoxanthone 363841 NSC629107 resistant
hsa-miR-26a-5p 3-[(Z)-[phenyl(pyridin-2-yl)methylidene]amino]-1,1-bis(pyridin-2-ylmethyl)thiourea 5466413 NSC689533 sensitive
hsa-miR-26a-5p 3-imino-n-(4-methylphenyl)-5-(methylthio)-1-phenyl-2,3-dihydro-1h-pyrazole-4-carboxamide 390314 NSC687606 resistant
hsa-miR-26a-5p 3,5,12,14-tetrabutyl-7,10-dithia-8,9-diselena-3,5,12,14-tetrazatricyclo[9.3.0.02,6]tetradeca-1(11),2(6)-diene-4,13-diselone 395765 NSC700584 sensitive
hsa-miR-26a-5p 4-amino-2-(4-chloroanilino)-5-(4-methylbenzoyl)-n-phenyl-1h-pyrrole-3-carbothioamide 5472799 NSC721554 resistant
hsa-miR-26a-5p 4-amino-8-chloro-2-(4-chlorophenyl)iminopyrimido[2,1-b][1,3]benzothiazole-3-carbonitrile 45029233 NSC745678 resistant
hsa-miR-26a-5p 5-chloro-N-[(E)-[phenyl(pyridin-2-yl)methylidene]amino]pyridin-2-amine 6519698 NSC693627 sensitive
hsa-miR-26a-5p 5-chloro-n-[(e)-1-pyridin-2-ylethylideneamino]-1,3-benzothiazol-2-amine 9572096 NSC703111 sensitive
hsa-miR-26a-5p 5-fluoro-n-[(e)-1-pyridin-2-ylethylideneamino]-1,3-benzothiazol-2-amine 9572046 NSC693634 sensitive
hsa-miR-26a-5p 5-nitro-n-[(e)-[phenyl(pyridin-2-yl)methylidene]amino]pyridin-2-amine 6519692 NSC693620 sensitive
hsa-miR-26a-5p 7-[3,4-dihydroxy-5-(hydroxymethyl)tetrahydrofuran-2-yl]-3h-thieno[3,4-d]pyrimidine-4-thione 3005067 NSC670036 sensitive
hsa-miR-26a-5p 9-[(2e)-2-(4-chlorophenyl)-2-hydroxyiminoethoxy]chromeno[3,4-b]chromene-6,12-dione 9572588 NSC721045 resistant
hsa-miR-26a-5p 9-acridinamine, n-(4-ethoxyphenyl)-, monohydrochloride 2788193 NSC165714 resistant
hsa-miR-26a-5p Crambescidin 800 trihydrochloride 400719 NSC713155 resistant
hsa-miR-26a-5p Crotonosid 223996 NSC12161 sensitive
hsa-miR-26a-5p Cryptophycin b 5468424 NSC670038 resistant
hsa-miR-26a-5p Laurusin 135476719 NSC106486 sensitive
hsa-miR-26a-5p N'-(2-hydroxy-5-(hydroxy(oxido)amino)benzylidene)-1-piperidinecarbothiohydrazide 135484941 NSC689530 sensitive
hsa-miR-26a-5p N-(2-hydroxy-5-methylphenyl)-4-[[[2-(trifluoromethyl)pyridin-4-yl]amino]methyl]benzamide 54613415 NSC748715 sensitive
hsa-miR-26a-5p N-[(e)-[(4-methoxyphenyl)-pyridin-2-ylmethylidene]amino]pyridin-2-amine 9630043 NSC693622 sensitive
hsa-miR-26a-5p N-[(e)-1-pyrimidin-2-ylethylideneamino]-1,3-benzothiazol-2-amine 9572048 NSC693636 sensitive
hsa-miR-26a-5p N,N'-bis[5-[[5-[(3-amino-3-iminopropyl)carbamoyl]-1-methylpyrrol-3-yl]carbamoyl]-1-methylpyrrol-3-yl]butanediamide;hydrochloride 367397 NSC637124 resistant
hsa-miR-26a-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-26a-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-26a-5p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-26a-5p Docetaxel 148124 NSC628503 approved resistant Low Lung Cancer tissue
hsa-miR-26a-5p Docetaxel 148124 NSC628503 approved resistant Low Gastric Cancer tissue
hsa-miR-26a-5p Fluorouracil 3385 NSC19893 approved resistant High Colon Cancer cell line (KM12C)
hsa-miR-26a-5p Paclitaxel 36314 NSC125973 approved sensitive Low Breast Cancer cell line (MDA-MB-231, MCF-7, MDA-MB-435, MDA-MB-468, MCF-10A, 184A1)
hsa-miR-26a-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (RKO)
hsa-miR-26a-5p Imatinib 5291 NSC743414 approved sensitive High Chronic Myeloid Leukemia tissue
hsa-miR-26a-5p Platinum-based doublet chemotherapy resistant High Lung Adenocarcinoma tissue
hsa-miR-26a-5p Cisplatin 5460033 NSC119875 approved resistant Low Ovarian Cancer tissue
hsa-miR-26a-5p Cetuximab resistant High Colon Cancer cell line
hsa-miR-26a-5p Cisplatin