miRTarBase - #MIRT001833


—
pre-miRNA Information
pre-miRNA hsa-mir-124-1   
Genomic Coordinates chr8: 9903388 - 9903472
Description Homo sapiens miR-124-1 stem-loop
Comment miR-124 was first identified by cloning studies in mouse . The 5' end of the miRNA may be offset with respect to previous annotations.
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-124-2   
Genomic Coordinates chr8: 64379149 - 64379257
Description Homo sapiens miR-124-2 stem-loop
Comment miR-124 was first identified by cloning studies in mouse . The 5' end of the miRNA may be offset with respect to previous annotations.
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-124-3   
Genomic Coordinates chr20: 63178500 - 63178586
Description Homo sapiens miR-124-3 stem-loop
Comment miR-124 was first identified by cloning studies in mouse . The 5' end of the miRNA may be offset with respect to previous annotations.
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-124-3p
Sequence 53| UAAGGCACGCGGUGAAUGCC |72
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 22 8 - 9903399 17604727 MiREDiBase
A-to-I 22 8 + 64379231 17604727 MiREDiBase
A-to-I 22 20 + 63178573 17604727 MiREDiBase
C-to-U 19 8 - 9903402 20591823 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs34059726 4 dbSNP
rs1287398108 8 dbSNP
rs1482188536 11 dbSNP
rs759034202 11 dbSNP
rs1364752547 12 dbSNP
rs764861083 13 dbSNP
rs749909250 18 dbSNP
rs759045572 19 dbSNP
rs753437646 20 dbSNP
rs1256263272 21 dbSNP
miRNA Oxidation Modification
Oxidation Position Sequence (5'-3') Target Gene Validation Method PMID
4 UAAGGCACGCGGUGAAUGCC MEOX2; EGFR; IGF2BP3; BCAT1 Luciferase reporter assay 37696949
4 UAAGGCACGCGGUGAAUGCC not mentioned qPCR 38912549
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B28CWB miR-124 Safety Biomarker (SAF); Monitoring Biomarker (MOI) Clinical/Experimental Data Expression Increase Plasma Polymerase chain reaction
B28CWB miR-124 Safety Biomarker (SAF); Monitoring Biomarker (MOI) Clinical/Experimental Data Expression Decrease Neuron Reverse transcription-polymerase chain reaction
B28CWB miR-124 Safety Biomarker (SAF); Monitoring Biomarker (MOI) Clinical/Experimental Data Expression Decrease Peripheral blood mononuclear cell Reverse transcription-polymerase chain reaction
Gene Information
Gene Symbol ADIPOR2   
Synonyms ACDCR2, PAQR2
Description adiponectin receptor 2
Transcript NM_024551   
Expression
Putative miRNA Targets on ADIPOR2
3'UTR of ADIPOR2
(miRNA target sites are highlighted)		 
>ADIPOR2|NM_024551|3'UTR
   1 TACCTACCAGTCTCCAGGGACTATGACCCTAAACCAGGGCCTGCGGCACTTGCGGGCCTCCCTGCTGGCTACTGATGCCA
  81 GTACCAGAGGAGCCCCAAAACTTTGACAGCCTCGTGGGCTTTGTGACGGCCCAGGGGCTCTGCGTGGTACATGACTGAGA
 161 AGAGAAAAACAAAAATAAATCATACCTCAAAGGATGGAGTGCATCAATTGGGAGAAAAGGAGACATAGCCCAAACCCTGG
 241 CTTATTCTTGGGATCTACTGATTGCGGGCTCTGCAAGACCCTTGGCAAACTGGCTTCTGATCCATATCATATTTATTTGT
 321 AGAAGATGGCGAAACAGTTTAGCTGGTGGTTCTTTCTTCTCCCTTTCTCTCTCTCTATGACAATAATACAAACCAATTTA
 401 AGTGAACATTTATATCCGATAAGGGGTGGGAGTGTGATTTTAAATGCTCTTTTGGGAGAACAAAGAAATTAATGTAAATA
 481 AGATTTCTAACTGTTTAAATAAGACTTTATATAAATGTTTAAAACATAGGGGTAAGGGAGGGAGGGAGAATTTTTGTATA
 561 GAATGAAACATGCAAGTACCACACACTGTTTGAATTTTGCACAAAAAGTGACTGTAGGATCAGGTGATAGCCCCGGAATG
 641 TACAGTGTCTTGGTGCACCAAGATGCCTTCTAAAGGCTGACATACCTTGGACCCTAATGGGGCAGAGAGTATAGCCCTAG
 721 CCCAGTGGTGACATGACCACTCCCTTTGGGAGGCCTGAGGTAGAGGGGAGTGGTATGTGTTTTCTCAGTGGAAGCAGCAC
 801 ATGAGTGGGTGACAGGATGTTAGATAAAGGCTCTAGTTAGGGTGTCATTGTCATTTGAGAGACTGACACACTCCTAGCAG
 881 CTGGTAAAGGGGTGCTGGAGGCCATGGAGGAGCTCTAGAAACATTAGCATGGGCTGATCTGATTACTTCCTGGCATCCCG
 961 CTCACTTTTATGGGAAGTCTTATTAGAGGGATGGGACAGTTTTCCATATCCTTGCTGTGGAGCTCTGGAACACTCTCTAA
1041 ATTTCCCTCTATTAAAAATCACTGCCCTAACTACACTTCCTCCTTGAGGGAATAGAAATGGACCTTTCTCTGACATAGTT
1121 CTTGGCATGGGAGCCAGCCACAAATGAGATTCTGACGTGTCCAGGTTTCTCCTGAGCTCATCTACATAGATTGGTAGACC
1201 CTTCCTTTGGATTAGGAAAGATGAGTTTTACCTCTGGTACACTGTCTTGGTAAGCCTGGATGTGACAGACACCTCGGCTC
1281 TCCTTGAATAAGAAAGCCAGCAGAACTCTTAAAGCCAGTTGTAGTACGGAGTTGTCAGCACTCACTGAACCTCACTTTAC
1361 AGGGATAAGAGTGGTGTGGCATTTTAAATACAATGGTATGTTATTGCCAGGGAGTGAGGTACAAGACGATGGCTCATGTC
1441 ACAGGCCTACCTGATACGGTGTCAGAGAAAGTGGTGGGGAAAGGATCTGGTTCATGGAATTCTGATCTTGGCCCATAGGT
1521 GAACCACCAAAATAGTGCTCGAGTCTTAGGTTACTGTCATCAAAGACTTGGGATGACTCCATTATATCCTGGGGTTGTGG
1601 GTATTAGAACTAAATATGGAGGTCCTGAGCATGGGGACTGGCGTCCTCAGTAGGTGTTTGGGAATATGGGAAGGGTCTCC
1681 TATTTATTCAATAGAGTTTTCTCAGTTATTTTCCTCCCTTGCCCTTGCAATCTCCAGCAAAAGGTGGGATCTAGGAAGAA
1761 AGAATCCAGTGTAGAAGTTGAGAAGAACTTGAACGTTTTGGTTCTGGATAAGGTCACTGTCCTAGGTGCTAGGTGGACCG
1841 AGCAAAAGACTCAGTGGATGAACTGGTGCAGTGCCTGACAGAATAAAGAACAGTATTAATCCCTTTGAGAAAGCATAGTC
1921 CAGCAGGACAGTGGCCATTTGGACAGAAGCCCACTTAGTTTCTTGGGAGCAACAGCACGTATCAGAAGCCAGACTTGCTC
2001 TTCGGTCATGCACTTTGGGATACAGCGTATAGGTGCAGCCCTGTCACAACACCAACAGAAGTAGCAGCCTCTGGGTGCAG
2081 TCACCCACACCCCAAAGCTGGAAGGATCTGGTTCAACATAGCACAAACCCTTAGGAAAAATGAAATTAACATCACTGATG
2161 TGTAATCCAGTAAAATCTCCCTTTTTCGGGTGTGTATGTGGGCATGTGCCCATTTCTATGTGTGTGTCTACGTGCAGCTC
2241 ACTACCAACAGCCTCATGTGCACTTGACCTGACAGTGCTCGCTGAGAACTCTCACCAGGTTGGCGCCTGAATGCCTTACT
2321 CTCAGCAGTCAGAGGCTTGCTTGCTCTGTGCAGATTTTTAATTTTCTTTTTTGGCCCTAGGCTGGTTGGGACCTCTACAG
2401 CTTCATTCTTTCACCATTAAATAGTGGCCTTTTTCAGTATTTTCCCTCTTCCCCTTTATAAATTATGCTAAAGCCACAAA
2481 GCACATTTTTGGGGATCATAGAAGGTTGGGGTTCCAGAAAGGCATCTGTGTGATGGTTCCATTGATGTGGGATTTCCCTA
2561 CTTGCTGTATTCTCAGTTTCTAATAAAAAGAACCAAATGAAATATGAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ccgUAAGUGGCGCACGGAAu 5'
             || :||   |||:||| 
Target 5' ggaATGTAC--AGTGTCTTg 3'
 635 - 652 129.00 -12.40
2 
miRNA  3' ccgUAAGUG---GCG-CACGGAau 5'
             ||  ||   :|| ||||||  
Target 5' tggATGAACTGGTGCAGTGCCTga 3'
 1855 - 1878 125.00 -12.50
3 
miRNA  3' ccGUAA--GUG-GCGCACGGAau 5'
            ||||  :|: :|:|||:||  
Target 5' ccCATTTCTATGTGTGTGTCTac 3'
 2209 - 2231 120.00 -11.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31507916 7 COSMIC
COSN26965267 21 COSMIC
COSN30519551 46 COSMIC
COSN31511050 47 COSMIC
COSN26567298 56 COSMIC
COSN26965268 75 COSMIC
COSN31612061 114 COSMIC
COSN31489491 115 COSMIC
COSN30120742 129 COSMIC
COSN19135763 132 COSMIC
COSN18736902 135 COSMIC
COSN30113858 176 COSMIC
COSN31512972 365 COSMIC
COSN31519711 466 COSMIC
COSN31595394 646 COSMIC
COSN31570436 708 COSMIC
COSN23693688 960 COSMIC
COSN8704424 1126 COSMIC
COSN10102756 1354 COSMIC
COSN16501347 1562 COSMIC
COSN8704429 1571 COSMIC
COSN22942326 1620 COSMIC
COSN31607878 1889 COSMIC
COSN26550593 1970 COSMIC
COSN26563498 2171 COSMIC
COSN21322422 2183 COSMIC
COSN8704434 2217 COSMIC
COSN30173940 2324 COSMIC
COSN5319435 2440 COSMIC
COSN31571383 2481 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs760004494 3 dbSNP
rs1000788514 6 dbSNP
rs770166457 6 dbSNP
rs376869220 8 dbSNP
rs573669927 9 dbSNP
rs761314663 10 dbSNP
rs773664032 10 dbSNP
rs954028523 11 dbSNP
rs1203311284 15 dbSNP
rs1250037017 20 dbSNP
rs1420094459 22 dbSNP
rs376949602 24 dbSNP
rs776821829 26 dbSNP
rs1477990688 28 dbSNP
rs966185927 28 dbSNP
rs761992740 30 dbSNP
rs1376765500 32 dbSNP
rs972002138 43 dbSNP
rs370259217 45 dbSNP
rs372771001 46 dbSNP
rs966453387 48 dbSNP
rs1447105735 49 dbSNP
rs1375982747 51 dbSNP
rs977917933 54 dbSNP
rs1242720201 55 dbSNP
rs187669714 57 dbSNP
rs1411266497 66 dbSNP
rs575883583 79 dbSNP
rs1190572061 83 dbSNP
rs1260189488 85 dbSNP
rs1180596380 88 dbSNP
rs926924415 93 dbSNP
rs781037676 95 dbSNP
rs1206728421 102 dbSNP
rs1461417240 106 dbSNP
rs1320140316 113 dbSNP
rs1289509638 114 dbSNP
rs1232435382 115 dbSNP
rs1355898954 118 dbSNP
rs957957987 119 dbSNP
rs546485052 128 dbSNP
rs190990632 129 dbSNP
rs896216509 132 dbSNP
rs386759488 134 dbSNP
rs879297712 134 dbSNP
rs730032 135 dbSNP
rs758169 136 dbSNP
rs1335863962 142 dbSNP
rs1388884921 144 dbSNP
rs912610359 145 dbSNP
rs1461666707 147 dbSNP
rs1436878703 171 dbSNP
rs940112154 173 dbSNP
rs1037177031 174 dbSNP
rs898642293 180 dbSNP
rs562083599 196 dbSNP
rs1179014391 209 dbSNP
rs1275896036 211 dbSNP
rs1246315025 229 dbSNP
rs1214513636 234 dbSNP
rs1028233061 235 dbSNP
rs1055378806 241 dbSNP
rs1347791576 253 dbSNP
rs1226418468 266 dbSNP
rs1316256640 267 dbSNP
rs1202116112 270 dbSNP
rs895441535 274 dbSNP
rs1013219475 275 dbSNP
rs1392592379 276 dbSNP
rs1364825070 281 dbSNP
rs1024654395 282 dbSNP
rs1008468368 287 dbSNP
rs763649829 294 dbSNP
rs1441107963 296 dbSNP
rs1019449252 298 dbSNP
rs1157398518 302 dbSNP
rs1457100541 304 dbSNP
rs1259728711 307 dbSNP
rs1427926404 313 dbSNP
rs771232113 320 dbSNP
rs187521934 327 dbSNP
rs1199711382 329 dbSNP
rs1462472195 330 dbSNP
rs550730419 331 dbSNP
rs575453647 332 dbSNP
rs1469989125 334 dbSNP
rs1175403132 344 dbSNP
rs1389186086 347 dbSNP
rs368981439 350 dbSNP
rs192753878 354 dbSNP
rs1241033860 357 dbSNP
rs1261122521 357 dbSNP
rs984779341 359 dbSNP
rs1310377243 366 dbSNP
rs774999225 366 dbSNP
rs562864824 372 dbSNP
rs533077487 376 dbSNP
rs551213793 378 dbSNP
rs1386808826 381 dbSNP
rs756977827 384 dbSNP
rs566339084 395 dbSNP
rs1375378702 400 dbSNP
rs974641907 403 dbSNP
rs1324983937 408 dbSNP
rs1347917754 409 dbSNP
rs1057001164 415 dbSNP
rs1028827271 418 dbSNP
rs112653490 419 dbSNP
rs549156055 425 dbSNP
rs1429357707 438 dbSNP
rs1262091208 442 dbSNP
rs1330319066 450 dbSNP
rs1206674243 454 dbSNP
rs567278877 464 dbSNP
rs1369283508 470 dbSNP
rs986732637 479 dbSNP
rs1230624900 490 dbSNP
rs1482235552 492 dbSNP
rs1259143236 496 dbSNP
rs188309120 497 dbSNP
rs371544429 500 dbSNP
rs1210484484 501 dbSNP
rs1269605131 510 dbSNP
rs1294809347 511 dbSNP
rs1226179920 512 dbSNP
rs1326671625 513 dbSNP
rs912579333 518 dbSNP
rs762405880 526 dbSNP
rs940058475 526 dbSNP
rs1314063925 527 dbSNP
rs1437157008 528 dbSNP
rs1489837501 535 dbSNP
rs1167419913 541 dbSNP
rs1462624647 549 dbSNP
rs1384208940 551 dbSNP
rs1195049550 555 dbSNP
rs555902485 563 dbSNP
rs903635954 564 dbSNP
rs936305835 565 dbSNP
rs1049447074 585 dbSNP
rs1486625032 586 dbSNP
rs889665445 587 dbSNP
rs920059074 589 dbSNP
rs1473414656 592 dbSNP
rs1194741990 594 dbSNP
rs1339655112 595 dbSNP
rs1008146829 601 dbSNP
rs931472925 602 dbSNP
rs1355179332 607 dbSNP
rs1294312774 615 dbSNP
rs751480856 622 dbSNP
rs1055306181 634 dbSNP
rs895366485 635 dbSNP
rs768640748 636 dbSNP
rs1328262610 642 dbSNP
rs896998344 647 dbSNP
rs1458142795 659 dbSNP
rs1164463016 662 dbSNP
rs949630058 664 dbSNP
rs1046075113 671 dbSNP
rs1461154157 672 dbSNP
rs1416836533 673 dbSNP
rs1165398578 683 dbSNP
rs1363247251 683 dbSNP
rs1026337775 684 dbSNP
rs1303015782 698 dbSNP
rs1437944264 704 dbSNP
rs1252088183 707 dbSNP
rs1333718439 710 dbSNP
rs144859773 710 dbSNP
rs999232914 714 dbSNP
rs1235599174 718 dbSNP
rs1327680917 719 dbSNP
rs1393449263 721 dbSNP
rs774011553 726 dbSNP
rs1279540172 734 dbSNP
rs1305371412 738 dbSNP
rs1337574310 756 dbSNP
rs549458954 757 dbSNP
rs1321698462 758 dbSNP
rs1033693534 766 dbSNP
rs1316521111 776 dbSNP
rs1395498883 780 dbSNP
rs959851609 784 dbSNP
rs540144093 788 dbSNP
rs1485913722 805 dbSNP
rs1294020339 824 dbSNP
rs1357294298 843 dbSNP
rs191899682 844 dbSNP
rs1221852607 845 dbSNP
rs1252403991 849 dbSNP
rs1296724188 860 dbSNP
rs1364965354 861 dbSNP
rs1191207468 872 dbSNP
rs1467746364 885 dbSNP
rs1484009563 889 dbSNP
rs992442354 892 dbSNP
rs1215920732 906 dbSNP
rs918051665 913 dbSNP
rs11554734 914 dbSNP
rs1284052742 915 dbSNP
rs542678246 926 dbSNP
rs1249607176 928 dbSNP
rs1032504009 940 dbSNP
rs945516412 943 dbSNP
rs978282069 960 dbSNP
rs893559366 961 dbSNP
rs1371986691 964 dbSNP
rs1305945724 966 dbSNP
rs995931942 969 dbSNP
rs1433205622 972 dbSNP
rs925024618 974 dbSNP
rs561442561 975 dbSNP
rs1387128969 983 dbSNP
rs1028794487 984 dbSNP
rs1453317259 989 dbSNP
rs936410648 991 dbSNP
rs1195072601 994 dbSNP
rs11554736 1017 dbSNP
rs1049820425 1033 dbSNP
rs573570870 1034 dbSNP
rs987330084 1035 dbSNP
rs1216964642 1041 dbSNP
rs1014824364 1047 dbSNP
rs1449232383 1050 dbSNP
rs1371686747 1052 dbSNP
rs1464013837 1054 dbSNP
rs184327324 1070 dbSNP
rs1348630905 1072 dbSNP
rs1305746132 1075 dbSNP
rs1296802374 1077 dbSNP
rs943922315 1079 dbSNP
rs1361533012 1091 dbSNP
rs961669418 1099 dbSNP
rs972798525 1101 dbSNP
rs897100755 1103 dbSNP
rs1311038707 1110 dbSNP
rs1434063543 1111 dbSNP
rs993958123 1113 dbSNP
rs1026809625 1115 dbSNP
rs919966324 1127 dbSNP
rs865841894 1128 dbSNP
rs887829362 1136 dbSNP
rs1380900527 1139 dbSNP
rs931425014 1155 dbSNP
rs761646969 1157 dbSNP
rs1275508975 1158 dbSNP
rs1255884543 1184 dbSNP
rs916770358 1185 dbSNP
rs766558446 1187 dbSNP
rs562291132 1192 dbSNP
rs1282478861 1195 dbSNP
rs189099288 1199 dbSNP
rs1307120337 1200 dbSNP
rs1202437356 1201 dbSNP
rs1274034962 1215 dbSNP
rs1046672959 1216 dbSNP
rs992598719 1222 dbSNP
rs778670521 1232 dbSNP
rs1335499667 1235 dbSNP
rs1291238503 1242 dbSNP
rs1025208425 1243 dbSNP
rs1356020930 1263 dbSNP
rs1314173657 1273 dbSNP
rs1439465758 1275 dbSNP
rs1353539879 1276 dbSNP
rs902802254 1277 dbSNP
rs181830776 1279 dbSNP
rs1183386093 1280 dbSNP
rs1053462439 1283 dbSNP
rs1411321399 1290 dbSNP
rs139802273 1291 dbSNP
rs1475818020 1301 dbSNP
rs1260295438 1309 dbSNP
rs377700019 1313 dbSNP
rs1443680550 1315 dbSNP
rs995900662 1328 dbSNP
rs533115679 1329 dbSNP
rs910990532 1334 dbSNP
rs1467323512 1340 dbSNP
rs1270971121 1341 dbSNP
rs1232526066 1342 dbSNP
rs890272801 1347 dbSNP
rs879168453 1348 dbSNP
rs375357531 1355 dbSNP
rs1168879010 1359 dbSNP
rs1221545463 1360 dbSNP
rs1015253910 1368 dbSNP
rs961990609 1376 dbSNP
rs1298262940 1386 dbSNP
rs146202000 1386 dbSNP
rs560062381 1387 dbSNP
rs1391917843 1389 dbSNP
rs34875796 1392 dbSNP
rs548941354 1394 dbSNP
rs929903589 1395 dbSNP
rs1408740194 1397 dbSNP
rs118072044 1401 dbSNP
rs888299327 1405 dbSNP
rs970881728 1411 dbSNP
rs185798726 1417 dbSNP
rs1468782383 1418 dbSNP
rs1267027675 1423 dbSNP
rs924151274 1427 dbSNP
rs1298418512 1428 dbSNP
rs935607244 1429 dbSNP
rs1055203351 1431 dbSNP
rs1212897811 1439 dbSNP
rs895246367 1450 dbSNP
rs1302281355 1456 dbSNP
rs1013587303 1458 dbSNP
rs1053840365 1459 dbSNP
rs139207148 1460 dbSNP
rs931677720 1465 dbSNP
rs1272403555 1471 dbSNP
rs142589818 1485 dbSNP
rs189034317 1491 dbSNP
rs1452713234 1492 dbSNP
rs966910373 1495 dbSNP
rs999795398 1504 dbSNP
rs1455755902 1505 dbSNP
rs150982950 1506 dbSNP
rs1008646475 1515 dbSNP
rs1036207186 1516 dbSNP
rs774208001 1526 dbSNP
rs573611367 1528 dbSNP
rs897710738 1539 dbSNP
rs765176894 1541 dbSNP
rs2286382 1542 dbSNP
rs180939065 1550 dbSNP
rs1293881190 1555 dbSNP
rs1469471235 1564 dbSNP
rs1382076795 1571 dbSNP
rs1363245168 1572 dbSNP
rs989899279 1578 dbSNP
rs952678931 1580 dbSNP
rs1374879484 1581 dbSNP
rs1174342523 1582 dbSNP
rs574128778 1589 dbSNP
rs544387816 1593 dbSNP
rs1347187002 1604 dbSNP
rs1371614210 1613 dbSNP
rs139590556 1617 dbSNP
rs918255398 1618 dbSNP
rs929872551 1635 dbSNP
rs758828785 1640 dbSNP
rs1484656870 1641 dbSNP
rs12342 1643 dbSNP
rs550919091 1644 dbSNP
rs1346673428 1649 dbSNP
rs1262158607 1650 dbSNP
rs1249309889 1655 dbSNP
rs1227112809 1658 dbSNP
rs1308408231 1662 dbSNP
rs924150758 1665 dbSNP
rs35235944 1667 dbSNP
rs2286381 1671 dbSNP
rs1322490065 1673 dbSNP
rs989734294 1674 dbSNP
rs1397910802 1683 dbSNP
rs569041107 1686 dbSNP
rs751947338 1692 dbSNP
rs377341763 1701 dbSNP
rs1462705406 1707 dbSNP
rs1423996052 1711 dbSNP
rs1044471 1719 dbSNP
rs1474184312 1722 dbSNP
rs1444949524 1725 dbSNP
rs1417155637 1729 dbSNP
rs1188023953 1733 dbSNP
rs373558976 1736 dbSNP
rs1443682798 1743 dbSNP
rs1247847132 1744 dbSNP
rs1194829712 1745 dbSNP
rs1214436192 1747 dbSNP
rs186160725 1749 dbSNP
rs1231905297 1754 dbSNP
rs147857332 1757 dbSNP
rs911608025 1760 dbSNP
rs1294479568 1767 dbSNP
rs531496109 1795 dbSNP
rs1036584245 1796 dbSNP
rs549702604 1797 dbSNP
rs141510300 1807 dbSNP
rs1480277158 1808 dbSNP
rs1392110308 1810 dbSNP
rs761798994 1810 dbSNP
rs1333104902 1815 dbSNP
rs1459724161 1823 dbSNP
rs1410411189 1824 dbSNP
rs1417043643 1831 dbSNP
rs1163735491 1832 dbSNP
rs7965288 1840 dbSNP
rs745464908 1841 dbSNP
rs999553972 1850 dbSNP
rs1032575445 1853 dbSNP
rs894398365 1856 dbSNP
rs1012218856 1861 dbSNP
rs958570509 1866 dbSNP
rs1274220992 1875 dbSNP
rs1007050111 1877 dbSNP
rs1023651892 1881 dbSNP
rs1158470650 1892 dbSNP
rs1350596883 1900 dbSNP
rs7965379 1902 dbSNP
rs965117812 1904 dbSNP
rs976490261 1905 dbSNP
rs1301576509 1906 dbSNP
rs1301139345 1909 dbSNP
rs147038940 1923 dbSNP
rs1031533059 1924 dbSNP
rs951039824 1931 dbSNP
rs779364818 1933 dbSNP
rs1406955047 1934 dbSNP
rs1382769878 1947 dbSNP
rs983776341 1953 dbSNP
rs1419817912 1954 dbSNP
rs909802538 1963 dbSNP
rs1191309007 1966 dbSNP
rs1453435273 1971 dbSNP
rs956886228 1973 dbSNP
rs937292140 1979 dbSNP
rs990095432 1989 dbSNP
rs1217393759 1995 dbSNP
rs1284239523 1995 dbSNP
rs917085406 1999 dbSNP
rs949466168 2004 dbSNP
rs370236885 2005 dbSNP
rs902621513 2013 dbSNP
rs748893641 2014 dbSNP
rs555984880 2017 dbSNP
rs985731667 2025 dbSNP
rs1053819781 2027 dbSNP
rs894023029 2028 dbSNP
rs1361830932 2030 dbSNP
rs566609610 2038 dbSNP
rs781252586 2042 dbSNP
rs2286380 2047 dbSNP
rs1433708924 2050 dbSNP
rs1425503474 2057 dbSNP
rs1182943435 2070 dbSNP
rs1474654793 2071 dbSNP
rs1235026970 2072 dbSNP
rs1194974388 2076 dbSNP
rs1468785119 2085 dbSNP
rs944402186 2087 dbSNP
rs1210346602 2088 dbSNP
rs1312970738 2090 dbSNP
rs1176774621 2101 dbSNP
rs1386094854 2120 dbSNP
rs971828894 2131 dbSNP
rs901352000 2132 dbSNP
rs1269391201 2136 dbSNP
rs919037170 2144 dbSNP
rs998339430 2161 dbSNP
rs930452601 2170 dbSNP
rs34877278 2174 dbSNP
rs111477952 2176 dbSNP
rs948633581 2180 dbSNP
rs1430379500 2187 dbSNP
rs1330638796 2188 dbSNP
rs1335738622 2189 dbSNP
rs1333826987 2191 dbSNP
rs1407883042 2191 dbSNP
rs1441226323 2193 dbSNP
rs1284355797 2195 dbSNP
rs748117322 2197 dbSNP
rs143312255 2198 dbSNP
rs906518440 2205 dbSNP
rs1479087932 2213 dbSNP
rs1483594188 2219 dbSNP
rs545067188 2219 dbSNP
rs1290450697 2221 dbSNP
rs1202625035 2229 dbSNP
rs148347534 2231 dbSNP
rs1359340471 2232 dbSNP
rs991826519 2233 dbSNP
rs1319888569 2236 dbSNP
rs917200590 2237 dbSNP
rs1031080575 2238 dbSNP
rs892548232 2241 dbSNP
rs1011041275 2249 dbSNP
rs1304097446 2252 dbSNP
rs1439492435 2253 dbSNP
rs1353631821 2256 dbSNP
rs949844824 2257 dbSNP
rs977290186 2258 dbSNP
rs1392776229 2268 dbSNP
rs1164768888 2281 dbSNP
rs773006359 2282 dbSNP
rs909685299 2287 dbSNP
rs953607203 2294 dbSNP
rs568726719 2306 dbSNP
rs1204300718 2319 dbSNP
rs759691170 2322 dbSNP
rs935409703 2323 dbSNP
rs765564040 2324 dbSNP
rs1199007658 2326 dbSNP
rs1458897615 2329 dbSNP
rs757815464 2332 dbSNP
rs965735274 2333 dbSNP
rs1384761354 2334 dbSNP
rs1322265263 2339 dbSNP
rs1475695397 2346 dbSNP
rs572359608 2361 dbSNP
rs1169523395 2362 dbSNP
rs11554735 2367 dbSNP
rs1314250982 2370 dbSNP
rs1375651948 2375 dbSNP
rs542569124 2377 dbSNP
rs1394256304 2378 dbSNP
rs1409114594 2384 dbSNP
rs893812592 2388 dbSNP
rs1407819723 2396 dbSNP
rs1325655934 2399 dbSNP
rs942942429 2417 dbSNP
rs972181118 2428 dbSNP
rs1040341722 2438 dbSNP
rs1156984906 2447 dbSNP
rs1400236398 2457 dbSNP
rs1381038184 2460 dbSNP
rs1180692899 2465 dbSNP
rs1452824565 2467 dbSNP
rs901453271 2470 dbSNP
rs1190478747 2476 dbSNP
rs1267202657 2486 dbSNP
rs1488760735 2486 dbSNP
rs998300195 2500 dbSNP
rs1352269282 2506 dbSNP
rs1286120814 2512 dbSNP
rs918978309 2516 dbSNP
rs1241779383 2525 dbSNP
rs1345378186 2527 dbSNP
rs1301002196 2529 dbSNP
rs930401258 2533 dbSNP
rs1387755323 2534 dbSNP
rs763139134 2536 dbSNP
rs1287590935 2543 dbSNP
rs141538159 2545 dbSNP
rs764473778 2552 dbSNP
rs35187506 2557 dbSNP
rs1160538959 2558 dbSNP
rs752070099 2559 dbSNP
rs1005265025 2561 dbSNP
rs1016579614 2563 dbSNP
rs958599851 2564 dbSNP
rs181395173 2566 dbSNP
rs1269224703 2571 dbSNP
rs991201712 2574 dbSNP
rs1487922472 2576 dbSNP
rs1024636921 2580 dbSNP
rs928574818 2586 dbSNP
rs1218235439 2590 dbSNP
rs745699618 2591 dbSNP
rs1255090133 2597 dbSNP
rs767934769 2599 dbSNP
Experimental Support 1 for Non-Functional miRNA-Target Interaction
miRNA:Target xx
Validation Method
Article - Krek A; Grun D; Poy MN; Wolf R; Rosenberg et al.
- Nature genetics, 2005
MicroRNAs are small noncoding RNAs that recognize and bind to partially complementary sites in the 3' untranslated regions of target genes in animals and, by unknown mechanisms, regulate protein production of the target transcript. Different combinations of microRNAs are expressed in different cell types and may coordinately regulate cell-specific target genes. Here, we present PicTar, a computational method for identifying common targets of microRNAs. Statistical tests using genome-wide alignments of eight vertebrate genomes, PicTar's ability to specifically recover published microRNA targets, and experimental validation of seven predicted targets suggest that PicTar has an excellent success rate in predicting targets for single microRNAs and for combinations of microRNAs. We find that vertebrate microRNAs target, on average, roughly 200 transcripts each. Furthermore, our results suggest widespread coordinate control executed by microRNAs. In particular, we experimentally validate common regulation of Mtpn by miR-375, miR-124 and let-7b and thus provide evidence for coordinate microRNA control in mammals.
LinkOut: [PMID: 15806104]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21687 Ependynoma primary tumors 0.351 2.2e-3 0.145 1.3e-1 64 Click to see details
GSE28544 Breast cancer -0.444 1.5e-2 -0.371 3.7e-2 24 Click to see details
GSE42095 Differentiated embryonic stem cells -0.406 2.7e-2 -0.289 9.1e-2 23 Click to see details
GSE17306 Multiple myeloma -0.205 7.9e-2 0.385 3.2e-3 49 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.24 1.5e-1 0.188 2.1e-1 20 Click to see details
GSE32688 Pancreatic cancer -0.158 1.9e-1 -0.116 2.6e-1 32 Click to see details
GSE38226 Liver fibrosis -0.175 2.2e-1 -0.103 3.3e-1 21 Click to see details
GSE17498 Multiple myeloma -0.118 2.3e-1 -0.110 2.5e-1 40 Click to see details
GSE26953 Aortic valvular endothelial cells 0.109 3.1e-1 0.022 4.6e-1 24 Click to see details
GSE14794 Lymphoblastoid cells 0.052 3.1e-1 0.058 2.9e-1 90 Click to see details
GSE19350 CNS germ cell tumors 0.132 3.4e-1 0.294 1.8e-1 12 Click to see details
GSE27834 Pluripotent stem cells -0.109 3.4e-1 -0.182 2.5e-1 16 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.245 3.8e-1 0.400 3.0e-1 4 Click to see details
GSE28260 Renal cortex and medulla 0.09 3.8e-1 0.147 3.2e-1 13 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.042 4.2e-1 -0.054 4.0e-1 25 Click to see details
GSE21849 B cell lymphoma -0.025 4.5e-1 0.214 1.3e-1 29 Click to see details
GSE21849 B cell lymphoma -0.025 4.5e-1 0.214 1.3e-1 29 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.786 0.01 0.767 0.01 9 Click to see details
KIRC -0.355 0.1 -0.186 0.25 15 Click to see details
HNSC 0.378 0.23 0.257 0.31 6 Click to see details
PRAD -0.387 0.31 -0.400 0.3 4 Click to see details
THCA 0.119 0.34 0.068 0.4 15 Click to see details
KICH -0.16 0.4 -0.100 0.44 5 Click to see details
KIRP 0.079 0.4 -0.014 0.48 12 Click to see details
KIRP 0.079 0.4 -0.014 0.48 12 Click to see details
KIRP 0.079 0.4 -0.014 0.48 12 Click to see details
KIRP 0.079 0.4 -0.014 0.48 12 Click to see details
KIRP 0.079 0.4 -0.014 0.48 12 Click to see details
KIRP 0.079 0.4 -0.014 0.48 12 Click to see details
KIRP 0.079 0.4 -0.014 0.48 12 Click to see details
1468 hsa-miR-124-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000360 SOX9 SRY-box 9 5 5
MIRT000362 BDNF brain derived neurotrophic factor 2 2
MIRT000478 EFNB1 ephrin B1 4 1
MIRT001168 NR3C2 nuclear receptor subfamily 3 group C member 2 3 1
MIRT001825 BACE1 beta-secretase 1 2 1
MIRT001827 RAVER2 ribonucleoprotein, PTB binding 2 3 1
MIRT001828 MAGT1 magnesium transporter 1 3 1
MIRT001830 SUCLG2 succinate-CoA ligase GDP-forming beta subunit 3 1
MIRT001831 SURF4 surfeit 4 3 1
MIRT001832 ELOVL5 ELOVL fatty acid elongase 5 3 1
MIRT001833 ADIPOR2 adiponectin receptor 2 1 1
MIRT001834 MTPN myotrophin 1 1
MIRT002025 CEBPA CCAAT/enhancer binding protein alpha 4 3
MIRT002560 DFFB DNA fragmentation factor subunit beta 2 2
MIRT002561 TRIM29 tripartite motif containing 29 2 1
MIRT002563 CDC14B cell division cycle 14B 2 2
MIRT002564 RARG retinoic acid receptor gamma 2 1
MIRT002565 PARP16 poly(ADP-ribose) polymerase family member 16 4 4
MIRT002566 ARPC1B actin related protein 2/3 complex subunit 1B 2 2
MIRT002567 PTPN12 protein tyrosine phosphatase, non-receptor type 12 2 2
MIRT002568 EYA4 EYA transcriptional coactivator and phosphatase 4 2 1
MIRT002569 TARBP1 TAR (HIV-1) RNA binding protein 1 2 2
MIRT002570 MAD2L2 mitotic arrest deficient 2 like 2 2 2
MIRT002571 LMNB1 lamin B1 4 4
MIRT002572 G3BP1 G3BP stress granule assembly factor 1 4 4
MIRT002574 UHRF1 ubiquitin like with PHD and ring finger domains 1 2 1
MIRT002575 CPNE3 copine 3 2 1
MIRT002576 SLC17A5 solute carrier family 17 member 5 2 2
MIRT002577 DHCR24 24-dehydrocholesterol reductase 2 1
MIRT002578 ACTR8 ARP8 actin related protein 8 homolog 2 1
MIRT002579 MYH9 myosin heavy chain 9 5 2
MIRT002580 ELF4 E74 like ETS transcription factor 4 5 2
MIRT002581 MAPK1IP1L mitogen-activated protein kinase 1 interacting protein 1 like 2 2
MIRT002583 CDCA7 cell division cycle associated 7 2 2
MIRT002585 SLC15A4 solute carrier family 15 member 4 2 2
MIRT002586 STOM stomatin 2 2
MIRT002587 MTMR6 myotubularin related protein 6 2 2
MIRT002588 POLR3G RNA polymerase III subunit G 2 1
MIRT002589 ANXA8 annexin A8 2 1
MIRT002590 OSBPL8 oxysterol binding protein like 8 2 2
MIRT002592 BTG3 BTG anti-proliferation factor 3 2 2
MIRT002594 VAMP3 vesicle associated membrane protein 3 3 5
MIRT002595 USP48 ubiquitin specific peptidase 48 2 1
MIRT002596 PTTG1IP PTTG1 interacting protein 2 2
MIRT002597 PGM1 phosphoglucomutase 1 2 2
MIRT002598 CYP1B1 cytochrome P450 family 1 subfamily B member 1 2 2
MIRT002599 TOM1L1 target of myb1 like 1 membrane trafficking protein 2 1
MIRT002600 SMAD5 SMAD family member 5 2 1
MIRT002601 NFIC nuclear factor I C 2 2
MIRT002602 RYK receptor-like tyrosine kinase 2 1
MIRT002604 CTGF connective tissue growth factor 3 3
MIRT002605 CHSY1 chondroitin sulfate synthase 1 4 4
MIRT002606 GNG10 G protein subunit gamma 10 2 2
MIRT002607 GMCL1P1 germ cell-less, spermatogenesis associated 1 pseudogene 1 1 1
MIRT002610 MAPK14 mitogen-activated protein kinase 14 4 4
MIRT002611 NEK6 NIMA related kinase 6 2 1
MIRT002612 MAN2A1 mannosidase alpha class 2A member 1 2 2
MIRT002613 CTDSP2 CTD small phosphatase 2 2 2
MIRT002614 BLOC1S6 biogenesis of lysosomal organelles complex 1 subunit 6 2 2
MIRT002615 DEPDC1 DEP domain containing 1 2 2
MIRT002616 RELA RELA proto-oncogene, NF-kB subunit 3 1
MIRT002617 KATNA1 katanin catalytic subunit A1 2 2
MIRT002618 SLC22A5 solute carrier family 22 member 5 2 2
MIRT002619 RASSF5 Ras association domain family member 5 2 2
MIRT002620 TNFRSF21 TNF receptor superfamily member 21 2 2
MIRT002623 DCTD dCMP deaminase 2 2
MIRT002624 CD59 CD59 molecule (CD59 blood group) 2 2
MIRT002625 CDK4 cyclin dependent kinase 4 6 12
MIRT002630 HTATIP2 HIV-1 Tat interactive protein 2 2 2
MIRT002631 ALDH9A1 aldehyde dehydrogenase 9 family member A1 2 2
MIRT002633 SSFA2 sperm specific antigen 2 2 2
MIRT002635 NEK9 NIMA related kinase 9 4 4
MIRT002636 PAPSS2 3'-phosphoadenosine 5'-phosphosulfate synthase 2 2 2
MIRT002637 ANKRD27 ankyrin repeat domain 27 2 2
MIRT002638 APEX2 apurinic/apyrimidinic endodeoxyribonuclease 2 2 2
MIRT002639 GSN gelsolin 4 4
MIRT002641 SLC30A7 solute carrier family 30 member 7 2 1
MIRT002642 CDK6 cyclin dependent kinase 6 6 10
MIRT002643 HEBP2 heme binding protein 2 2 1
MIRT002644 AHRR aryl-hydrocarbon receptor repressor 2 2
MIRT002645 GINM1 glycoprotein integral membrane 1 2 2
MIRT002646 SERPINB6 serpin family B member 6 2 2
MIRT002647 PTBP1 polypyrimidine tract binding protein 1 7 8
MIRT002649 IFRD2 interferon related developmental regulator 2 4 4
MIRT002652 DVL2 dishevelled segment polarity protein 2 2 2
MIRT002653 AHR aryl hydrocarbon receptor 4 3
MIRT002655 PLP2 proteolipid protein 2 5 2
MIRT002657 PODXL podocalyxin like 2 2
MIRT002658 CTNND1 catenin delta 1 2 2
MIRT002659 RHOV ras homolog family member V 1 2
MIRT002660 SP1 Sp1 transcription factor 4 4
MIRT002662 ACAA2 acetyl-CoA acyltransferase 2 3 3
MIRT002663 NME4 NME/NM23 nucleoside diphosphate kinase 4 2 1
MIRT002665 SLC16A1 solute carrier family 16 member 1 7 10
MIRT002667 MDFIC MyoD family inhibitor domain containing 2 1
MIRT002668 ARFIP1 ADP ribosylation factor interacting protein 1 2 2
MIRT002670 DNM2 dynamin 2 2 2
MIRT002672 PGRMC2 progesterone receptor membrane component 2 2 2
MIRT002673 FAM35A family with sequence similarity 35 member A 2 1
MIRT002674 ZBED3 zinc finger BED-type containing 3 2 2
MIRT002675 B4GALT1 beta-1,4-galactosyltransferase 1 5 3
MIRT002676 MPHOSPH9 M-phase phosphoprotein 9 2 1
MIRT002677 GTPBP8 GTP binding protein 8 (putative) 2 1
MIRT002678 F11R F11 receptor 2 2
MIRT002679 GNAI3 G protein subunit alpha i3 2 1
MIRT002682 SLC25A30 solute carrier family 25 member 30 2 2
MIRT002684 SERP1 stress associated endoplasmic reticulum protein 1 3 3
MIRT002687 PHF19 PHD finger protein 19 2 2
MIRT002689 INO80C INO80 complex subunit C 2 2
MIRT002690 STX2 syntaxin 2 2 1
MIRT002692 TRIP11 thyroid hormone receptor interactor 11 2 1
MIRT002693 TLN1 talin 1 2 2
MIRT002694 SWAP70 SWAP switching B-cell complex subunit 70 2 1
MIRT002695 ARHGEF1 Rho guanine nucleotide exchange factor 1 2 2
MIRT002696 ELOVL1 ELOVL fatty acid elongase 1 2 2
MIRT002697 IQGAP1 IQ motif containing GTPase activating protein 1 5 4
MIRT002698 ABHD5 abhydrolase domain containing 5 2 2
MIRT002699 RNPEPL1 arginyl aminopeptidase like 1 2 2
MIRT002700 STX10 syntaxin 10 2 3
MIRT002701 TEAD1 TEA domain transcription factor 1 2 2
MIRT002702 FAM177A1 family with sequence similarity 177 member A1 2 2
MIRT002703 FCHO2 FCH domain only 2 2 2
MIRT002706 CREB3L2 cAMP responsive element binding protein 3 like 2 2 1
MIRT002707 AK2 adenylate kinase 2 2 1
MIRT002709 TTC7A tetratricopeptide repeat domain 7A 2 2
MIRT002711 HADHB hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit 2 2
MIRT002712 LRRC1 leucine rich repeat containing 1 4 4
MIRT002714 TWIST2 twist family bHLH transcription factor 2 2 1
MIRT002715 AP1M2 adaptor related protein complex 1 mu 2 subunit 2 2
MIRT002716 SNAI2 snail family transcriptional repressor 2 4 5
MIRT002717 SYNGR2 synaptogyrin 2 2 2
MIRT002718 TJP2 tight junction protein 2 2 2
MIRT002719 CAV1 caveolin 1 5 3
MIRT002720 LAMC1 laminin subunit gamma 1 4 4
MIRT002721 DNAJC1 DnaJ heat shock protein family (Hsp40) member C1 2 2
MIRT002722 CDCA7L cell division cycle associated 7 like 2 2
MIRT002723 PLOD3 procollagen-lysine,2-oxoglutarate 5-dioxygenase 3 2 2
MIRT002724 SHC3 SHC adaptor protein 3 1 1
MIRT002726 CERS2 ceramide synthase 2 2 2
MIRT002728 LITAF lipopolysaccharide induced TNF factor 2 2
MIRT002729 CTDSP1 CTD small phosphatase 1 5 6
MIRT002730 CD164 CD164 molecule 5 7
MIRT002731 ITGB1 integrin subunit beta 1 5 5
MIRT002901 JAKMIP1 janus kinase and microtubule interacting protein 1 1 1
MIRT002902 CHODL chondrolectin 1 1
MIRT002903 GAS2L1 growth arrest specific 2 like 1 3 2
MIRT002904 TSPAN15 tetraspanin 15 1 1
MIRT002905 RFFL ring finger and FYVE like domain containing E3 ubiquitin protein ligase 2 2
MIRT002906 ERH ERH, mRNA splicing and mitosis factor 1 1
MIRT002907 ZFP36L2 ZFP36 ring finger protein like 2 2 2
MIRT002908 FAM104A family with sequence similarity 104 member A 1 1
MIRT002909 PLSCR3 phospholipid scramblase 3 2 2
MIRT002910 CAPRIN2 caprin family member 2 2 2
MIRT002911 FA2H fatty acid 2-hydroxylase 1 1
MIRT002912 SENP8 SUMO/sentrin peptidase family member, NEDD8 specific 2 2
MIRT002913 PGF placental growth factor 1 1
MIRT002914 PDLIM7 PDZ and LIM domain 7 2 2
MIRT002915 MYO10 myosin X 3 3
MIRT002917 E2F5 E2F transcription factor 5 2 2
MIRT002918 NFATC1 nuclear factor of activated T-cells 1 5 3
MIRT002919 ARRDC1 arrestin domain containing 1 1 1
MIRT002920 MMADHC methylmalonic aciduria and homocystinuria, cblD type 1 1
MIRT002921 NID1 nidogen 1 2 2
MIRT002922 RHOG ras homolog family member G 5 3
MIRT002923 PRKD1 protein kinase D1 1 1
MIRT003051 RDH10 retinol dehydrogenase 10 3 2
MIRT003523 ELK3 ELK3, ETS transcription factor 3 2
MIRT003839 ATP6V0E1 ATPase H+ transporting V0 subunit e1 3 2
MIRT004039 TMBIM1 transmembrane BAX inhibitor motif containing 1 2 2
MIRT004042 PPP1R13L protein phosphatase 1 regulatory subunit 13 like 5 4
MIRT004075 ARHGAP29 Rho GTPase activating protein 29 2 1
MIRT004100 TSC22D4 TSC22 domain family member 4 4 6
MIRT004101 NAA15 N(alpha)-acetyltransferase 15, NatA auxiliary subunit 2 2
MIRT004119 SYPL1 synaptophysin like 1 4 4
MIRT004120 SEC11A SEC11 homolog A, signal peptidase complex subunit 2 2
MIRT004283 CDK2 cyclin dependent kinase 2 4 2
MIRT004284 CCL2 C-C motif chemokine ligand 2 4 2
MIRT004503 PEA15 phosphoprotein enriched in astrocytes 15 2 1
MIRT004546 NR3C1 nuclear receptor subfamily 3 group C member 1 7 3
MIRT004548 TSC22D3 TSC22 domain family member 3 2 1
MIRT004724 VIM vimentin 5 2
MIRT004725 SMYD3 SET and MYND domain containing 3 4 2
MIRT004726 E2F6 E2F transcription factor 6 4 1
MIRT004880 OAF out at first homolog 2 2
MIRT004883 TMEM109 transmembrane protein 109 2 2
MIRT004884 TUBB6 tubulin beta 6 class V 2 1
MIRT004885 C12orf23 transmembrane protein 263 2 2
MIRT004886 SLC50A1 solute carrier family 50 member 1 2 2
MIRT004890 UHMK1 U2AF homology motif kinase 1 2 2
MIRT004891 LIMCH1 LIM and calponin homology domains 1 2 2
MIRT004892 ENDOD1 endonuclease domain containing 1 2 2
MIRT004893 HADH hydroxyacyl-CoA dehydrogenase 2 2
MIRT004894 GCA grancalcin 2 1
MIRT004895 C11orf75 single-pass membrane protein with coiled-coil domains 4 2 2
MIRT004896 FAM83H family with sequence similarity 83 member H 2 2
MIRT004897 ASPRV1 aspartic peptidase retroviral like 1 2 1
MIRT004898 VPS37C VPS37C, ESCRT-I subunit 2 2
MIRT004899 SPDL1 spindle apparatus coiled-coil protein 1 2 2
MIRT004903 RBM47 RNA binding motif protein 47 2 2
MIRT004906 DRAM1 DNA damage regulated autophagy modulator 1 2 1
MIRT004907 NECAP2 NECAP endocytosis associated 2 2 2
MIRT004908 TSKU tsukushi, small leucine rich proteoglycan 2 2
MIRT004912 CHST14 carbohydrate sulfotransferase 14 2 1
MIRT004913 FAM57A family with sequence similarity 57 member A 2 2
MIRT004925 FAM129B family with sequence similarity 129 member B 2 1
MIRT004926 CLDND1 claudin domain containing 1 2 2
MIRT004927 ZCCHC24 zinc finger CCHC-type containing 24 2 2
MIRT004928 LDLRAP1 low density lipoprotein receptor adaptor protein 1 2 2
MIRT004929 ARAF A-Raf proto-oncogene, serine/threonine kinase 2 2
MIRT004930 KANK1 KN motif and ankyrin repeat domains 1 2 2
MIRT005083 NFKBIZ NFKB inhibitor zeta 4 1
MIRT005655 ECI2 enoyl-CoA delta isomerase 2 2 2
MIRT006451 AR androgen receptor 3 2
MIRT006478 ROCK2 Rho associated coiled-coil containing protein kinase 2 3 1
MIRT006479 EZH2 enhancer of zeste 2 polycomb repressive complex 2 subunit 7 6
MIRT006541 IL6R interleukin 6 receptor 4 1
MIRT006562 HMGA1 high mobility group AT-hook 1 4 1
MIRT006776 ROCK1 Rho associated coiled-coil containing protein kinase 1 3 3
MIRT006837 PIK3CA phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha 6 2
MIRT007235 FXN frataxin 1 1
MIRT007282 MECP2 methyl-CpG binding protein 2 1 1
MIRT022113 SPTA1 spectrin alpha, erythrocytic 1 1 1
MIRT022115 FOXF2 forkhead box F2 1 1
MIRT022116 LRRC4 leucine rich repeat containing 4 1 1
MIRT022117 SGK1 serum/glucocorticoid regulated kinase 1 1 1
MIRT022118 DEFB118 defensin beta 118 1 1
MIRT022119 RFT1 RFT1 homolog 1 1
MIRT022120 USH2A usherin 1 1
MIRT022121 ARMCX2 armadillo repeat containing, X-linked 2 1 1
MIRT022122 BAG5 BCL2 associated athanogene 5 1 1
MIRT022123 ARHGAP22 Rho GTPase activating protein 22 1 1
MIRT022124 VNN2 vanin 2 1 1
MIRT022125 YBX3 Y-box binding protein 3 1 1
MIRT022126 TRIM38 tripartite motif containing 38 1 1
MIRT022127 C9orf85 chromosome 9 open reading frame 85 1 1
MIRT022128 PLA2G4C phospholipase A2 group IVC 1 1
MIRT022129 MVP major vault protein 1 1
MIRT022130 SEC24D SEC24 homolog D, COPII coat complex component 1 1
MIRT022131 XRCC2 X-ray repair cross complementing 2 1 1
MIRT022132 HLA-A major histocompatibility complex, class I, A 1 1
MIRT022133 GMPR2 guanosine monophosphate reductase 2 1 1
MIRT022134 SNX18 sorting nexin 18 3 3
MIRT022135 TBXA2R thromboxane A2 receptor 1 1
MIRT022136 SH2D3A SH2 domain containing 3A 1 1
MIRT022137 MFAP4 microfibril associated protein 4 1 1
MIRT022138 MICAL2 microtubule associated monooxygenase, calponin and LIM domain containing 2 1 1
MIRT022139 EREG epiregulin 1 1
MIRT022140 LRRC2 leucine rich repeat containing 2 1 1
MIRT022141 BIRC2 baculoviral IAP repeat containing 2 1 1
MIRT022142 ADPRH ADP-ribosylarginine hydrolase 1 1
MIRT022143 XKRX XK related, X-linked 1 1
MIRT022144 LAMA4 laminin subunit alpha 4 1 1
MIRT022145 EFNA1 ephrin A1 1 1
MIRT022146 LSM10 LSM10, U7 small nuclear RNA associated 1 1
MIRT022147 ADCY6 adenylate cyclase 6 1 1
MIRT022148 WISP2 WNT1 inducible signaling pathway protein 2 1 1
MIRT022149 ADAM15 ADAM metallopeptidase domain 15 1 1
MIRT022150 DSEL dermatan sulfate epimerase-like 1 1
MIRT022151 EPB41L5 erythrocyte membrane protein band 4.1 like 5 1 1
MIRT022152 ZHX3 zinc fingers and homeoboxes 3 1 1
MIRT022153 SMPD4 sphingomyelin phosphodiesterase 4 1 1
MIRT022154 MAML1 mastermind like transcriptional coactivator 1 1 1
MIRT022155 SLC46A3 solute carrier family 46 member 3 1 1
MIRT022156 RRAS RAS related 4 2
MIRT022157 NUDT19 nudix hydrolase 19 1 1
MIRT022158 FAM134B reticulophagy regulator 1 1 1
MIRT022159 SPRY2 sprouty RTK signaling antagonist 2 1 1
MIRT022160 MTHFSD methenyltetrahydrofolate synthetase domain containing 1 1
MIRT022161 JAG2 jagged 2 1 1
MIRT022162 STK36 serine/threonine kinase 36 1 1
MIRT022163 METAP2 methionyl aminopeptidase 2 1 1
MIRT022164 KDELR2 KDEL endoplasmic reticulum protein retention receptor 2 1 1
MIRT022165 ECE1 endothelin converting enzyme 1 1 1
MIRT022166 SBNO2 strawberry notch homolog 2 1 1
MIRT022167 PRRX1 paired related homeobox 1 4 2
MIRT022168 TOR3A torsin family 3 member A 1 1
MIRT022169 LHX2 LIM homeobox 2 1 1
MIRT022170 RAB34 RAB34, member RAS oncogene family 1 1
MIRT022171 ARHGAP28 Rho GTPase activating protein 28 1 1
MIRT022172 COL4A1 collagen type IV alpha 1 chain 1 1
MIRT022173 USP10 ubiquitin specific peptidase 10 2 1
MIRT022174 GPATCH4 G-patch domain containing 4 2 1
MIRT022175 DHX33 DEAH-box helicase 33 2 1
MIRT022176 LIN7C lin-7 homolog C, crumbs cell polarity complex component 2 1
MIRT022177 DDX51 DEAD-box helicase 51 2 1
MIRT022178 ZNF740 zinc finger protein 740 2 1
MIRT022179 GRSF1 G-rich RNA sequence binding factor 1 2 1
MIRT022180 COLGALT1 collagen beta(1-O)galactosyltransferase 1 2 1
MIRT022181 FAM35BP family with sequence similarity 35, member A pseudogene 2 2
MIRT022182 FAM171B family with sequence similarity 171 member B 1 1
MIRT022183 IL6 interleukin 6 1 1
MIRT022184 CAPN11 calpain 11 1 1
MIRT022185 DYNC2H1 dynein cytoplasmic 2 heavy chain 1 1 1
MIRT022186 CABP1 calcium binding protein 1 1 1
MIRT022187 METTL7A methyltransferase like 7A 1 1
MIRT022188 FGF1 fibroblast growth factor 1 1 1
MIRT022189 SERPINE1 serpin family E member 1 1 1
MIRT022190 RBMS1 RNA binding motif single stranded interacting protein 1 2 1
MIRT022191 SLC43A3 solute carrier family 43 member 3 1 1
MIRT022192 PUS1 pseudouridylate synthase 1 1 1
MIRT022193 CALCRL calcitonin receptor like receptor 1 1
MIRT022194 SAMD11 sterile alpha motif domain containing 11 1 1
MIRT022195 SOGA2 microtubule crosslinking factor 1 1 1
MIRT022196 AVEN apoptosis and caspase activation inhibitor 1 1
MIRT022197 ZNHIT6 zinc finger HIT-type containing 6 1 1
MIRT022198 CDRT4 CMT1A duplicated region transcript 4 1 1
MIRT022199 GPR161 G protein-coupled receptor 161 1 1
MIRT022200 EPGN epithelial mitogen 1 1
MIRT022201 FAM65B RHO family interacting cell polarization regulator 2 1 1
MIRT022202 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT022203 ERCC5 ERCC excision repair 5, endonuclease 1 1
MIRT022204 TAX1BP3 Tax1 binding protein 3 1 1
MIRT022205 CHRDL1 chordin like 1 1 1
MIRT022206 CCDC3 coiled-coil domain containing 3 1 1
MIRT022207 MVK mevalonate kinase 1 1
MIRT022208 INF2 inverted formin, FH2 and WH2 domain containing 1 1
MIRT022209 ZNF410 zinc finger protein 410 1 1
MIRT022210 PPP2R1B protein phosphatase 2 scaffold subunit Abeta 1 1
MIRT022211 CYBRD1 cytochrome b reductase 1 1 1
MIRT022212 LNX2 ligand of numb-protein X 2 1 1
MIRT022213 TMEM79 transmembrane protein 79 1 1
MIRT022214 MRPL49 mitochondrial ribosomal protein L49 3 3
MIRT022215 DNMBP dynamin binding protein 1 1
MIRT022216 OGFOD2 2-oxoglutarate and iron dependent oxygenase domain containing 2 1 1
MIRT022217 CPNE8 copine 8 1 1
MIRT022218 TRAIP TRAF interacting protein 1 1
MIRT022219 RAD51AP1 RAD51 associated protein 1 1 1
MIRT022220 CTSH cathepsin H 1 1
MIRT022221 GRB2 growth factor receptor bound protein 2 4 1
MIRT022222 ADCY9 adenylate cyclase 9 1 1
MIRT022223 SNX17 sorting nexin 17 1 1
MIRT022224 MSRB3 methionine sulfoxide reductase B3 1 1
MIRT022225 FAM129A family with sequence similarity 129 member A 1 1
MIRT022226 RNF141 ring finger protein 141 1 1
MIRT022227 LYSMD3 LysM domain containing 3 3 3
MIRT022228 UNC5D unc-5 netrin receptor D 1 1
MIRT022229 KLF6 Kruppel like factor 6 2 2
MIRT022230 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT022231 DCAF16 DDB1 and CUL4 associated factor 16 1 1
MIRT022232 PI4K2B phosphatidylinositol 4-kinase type 2 beta 3 7
MIRT022233 GATA6 GATA binding protein 6 1 1
MIRT022234 KLF4 Kruppel like factor 4 1 1
MIRT022235 SERTAD2 SERTA domain containing 2 1 1
MIRT022236 RAB27A RAB27A, member RAS oncogene family 4 1
MIRT022237 CD55 CD55 molecule (Cromer blood group) 2 1
MIRT022238 ATAD3A ATPase family, AAA domain containing 3A 2 1
MIRT022239 PLOD1 procollagen-lysine,2-oxoglutarate 5-dioxygenase 1 2 1
MIRT022240 RFC3 replication factor C subunit 3 2 1
MIRT022241 PPAN peter pan homolog (Drosophila) 2 1
MIRT022242 KRT17P2 keratin 17 pseudogene 2 2 1
MIRT022243 HELLS helicase, lymphoid specific 2 1
MIRT022244 LAS1L LAS1 like, ribosome biogenesis factor 2 1
MIRT022245 NGDN neuroguidin 2 1
MIRT022246 PIAS1 protein inhibitor of activated STAT 1 2 1
MIRT022247 JUP junction plakoglobin 2 1
MIRT022248 GNB4 G protein subunit beta 4 2 1
MIRT022249 TRIM25 tripartite motif containing 25 2 1
MIRT022250 RCC2 regulator of chromosome condensation 2 2 1
MIRT022251 SEPT9 septin 9 2 1
MIRT022252 ENAH ENAH, actin regulator 2 1
MIRT022253 DIS3 DIS3 homolog, exosome endoribonuclease and 3'-5' exoribonuclease 2 1
MIRT022254 LDLR low density lipoprotein receptor 2 2
MIRT022255 PDAP1 PDGFA associated protein 1 1 1
MIRT022256 CCDC102B coiled-coil domain containing 102B 1 1
MIRT022257 TSEN54 tRNA splicing endonuclease subunit 54 1 1
MIRT022258 ZNF483 zinc finger protein 483 1 1
MIRT022259 ADARB1 adenosine deaminase, RNA specific B1 1 1
MIRT022260 DHRS3 dehydrogenase/reductase 3 1 1
MIRT022261 SLC1A3 solute carrier family 1 member 3 1 1
MIRT022262 TMEM156 transmembrane protein 156 1 1
MIRT022263 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT022264 CKS2 CDC28 protein kinase regulatory subunit 2 1 1
MIRT022265 AFAP1L1 actin filament associated protein 1 like 1 1 1
MIRT022266 ID3 inhibitor of DNA binding 3, HLH protein 1 1
MIRT022267 EDN1 endothelin 1 1 1
MIRT022268 IGFBP1 insulin like growth factor binding protein 1 1 1
MIRT022269 CLIC3 chloride intracellular channel 3 1 1
MIRT022270 E2F4 E2F transcription factor 4 1 1
MIRT022271 SPHK1 sphingosine kinase 1 4 3
MIRT022272 OCA2 OCA2 melanosomal transmembrane protein 1 1
MIRT022273 SDCCAG8 serologically defined colon cancer antigen 8 1 1
MIRT022274 TMEM5 transmembrane protein 5 1 1
MIRT022275 PRKCB protein kinase C beta 1 1
MIRT022276 COL17A1 collagen type XVII alpha 1 chain 1 1
MIRT022277 HOXC4 homeobox C4 1 1
MIRT022278 ATOH8 atonal bHLH transcription factor 8 1 1
MIRT022279 SULT1E1 sulfotransferase family 1E member 1 1 1
MIRT022280 RILPL2 Rab interacting lysosomal protein like 2 1 1
MIRT022281 TMEM44 transmembrane protein 44 1 1
MIRT022282 RPS15 ribosomal protein S15 1 1
MIRT022283 RPS6KA4 ribosomal protein S6 kinase A4 1 1
MIRT022284 NSMAF neutral sphingomyelinase activation associated factor 1 1
MIRT022285 PTH2R parathyroid hormone 2 receptor 1 1
MIRT022286 NUB1 negative regulator of ubiquitin like proteins 1 1 1
MIRT022287 ROM1 retinal outer segment membrane protein 1 1 1
MIRT022288 ACADL acyl-CoA dehydrogenase, long chain 1 1
MIRT022289 NASP nuclear autoantigenic sperm protein 1 1
MIRT022290 RFWD3 ring finger and WD repeat domain 3 1 1
MIRT022291 FAM63B MINDY lysine 48 deubiquitinase 2 1 1
MIRT022292 HMGN4 high mobility group nucleosomal binding domain 4 1 1
MIRT022293 TSN translin 1 1
MIRT022294 SNX12 sorting nexin 12 1 1
MIRT022295 POLA1 DNA polymerase alpha 1, catalytic subunit 1 1
MIRT022296 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 1
MIRT022297 MALL mal, T-cell differentiation protein like 1 1
MIRT022298 MOBP myelin-associated oligodendrocyte basic protein 1 1
MIRT022299 KLHL24 kelch like family member 24 1 1
MIRT022300 FGFR1 fibroblast growth factor receptor 1 1 1
MIRT022301 TMEM128 transmembrane protein 128 1 1
MIRT022302 RIPK4 receptor interacting serine/threonine kinase 4 3 3
MIRT022303 BVES blood vessel epicardial substance 1 1
MIRT022304 HEATR5A HEAT repeat containing 5A 1 1
MIRT022305 C11orf82 DNA damage induced apoptosis suppressor 1 1
MIRT022306 CMTM7 CKLF like MARVEL transmembrane domain containing 7 1 1
MIRT022307 EMD emerin 1 1
MIRT022308 PTPRB protein tyrosine phosphatase, receptor type B 1 1
MIRT022309 GPM6B glycoprotein M6B 1 1
MIRT022310 RASSF1 Ras association domain family member 1 1 1
MIRT022311 TUB tubby bipartite transcription factor 1 1
MIRT022312 PALLD palladin, cytoskeletal associated protein 1 1
MIRT022313 PHF17 jade family PHD finger 1 1 1
MIRT022314 SIX4 SIX homeobox 4 1 1
MIRT022315 INA internexin neuronal intermediate filament protein alpha 2 1
MIRT022316 DNM3 dynamin 3 2 1
MIRT022317 NOL8 nucleolar protein 8 2 1
MIRT022318 EHD2 EH domain containing 2 2 1
MIRT022319 AURKB aurora kinase B 2 1
MIRT022320 SRSF3 serine and arginine rich splicing factor 3 2 1
MIRT022321 NOSIP nitric oxide synthase interacting protein 2 1
MIRT022322 SPIN1 spindlin 1 2 1
MIRT022323 PPIF peptidylprolyl isomerase F 2 1
MIRT022324 FRAS1 Fraser extracellular matrix complex subunit 1 2 1
MIRT022325 FLOT2 flotillin 2 2 1
MIRT022326 MVD mevalonate diphosphate decarboxylase 1 1
MIRT022327 LIN28A lin-28 homolog A 1 1
MIRT022328 TUBA3D tubulin alpha 3d 1 1
MIRT022329 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT022330 LIN7A lin-7 homolog A, crumbs cell polarity complex component 1 1
MIRT022331 AKAP4 A-kinase anchoring protein 4 1 1
MIRT022332 AGTR2 angiotensin II receptor type 2 1 1
MIRT022333 NCAPH2 non-SMC condensin II complex subunit H2 1 1
MIRT022334 DRG2 developmentally regulated GTP binding protein 2 1 1
MIRT022335 SLC13A2 solute carrier family 13 member 2 1 1
MIRT022336 MFAP5 microfibril associated protein 5 1 1
MIRT022337 CALR calreticulin 1 1
MIRT022338 WBSCR16 RCC1 like 1 1
MIRT022339 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT022340 GPR123 adhesion G protein-coupled receptor A1 1 1
MIRT022341 FAM109B family with sequence similarity 109 member B 1 1
MIRT022342 TNFRSF12A TNF receptor superfamily member 12A 1 1
MIRT022343 FBXO18 F-box protein, helicase, 18 1 1
MIRT022344 IKBKE inhibitor of nuclear factor kappa B kinase subunit epsilon 1 1
MIRT022345 CSPG4 chondroitin sulfate proteoglycan 4 1 1
MIRT022346 KIAA0930 KIAA0930 1 1
MIRT022347 ANXA6 annexin A6 1 1
MIRT022348 VKORC1 vitamin K epoxide reductase complex subunit 1 1 1
MIRT022349 DISP1 dispatched RND transporter family member 1 1 1
MIRT022350 SYNC syncoilin, intermediate filament protein 1 1
MIRT022351 KIAA1804 mitogen-activated protein kinase kinase kinase 21 1 1
MIRT022352 CDC42EP3 CDC42 effector protein 3 1 1
MIRT022353 SEC22C SEC22 homolog C, vesicle trafficking protein 1 1
MIRT022355 C14orf178 chromosome 14 open reading frame 178 1 1
MIRT022356 SDC4 syndecan 4 1 1
MIRT022357 ZNF440 zinc finger protein 440 1 1
MIRT022358 MYPN myopalladin 1 1
MIRT022359 TPP1 tripeptidyl peptidase 1 1 1
MIRT022360 ATP8B2 ATPase phospholipid transporting 8B2 1 1
MIRT022361 SLC31A2 solute carrier family 31 member 2 1 1
MIRT022362 GFPT2 glutamine-fructose-6-phosphate transaminase 2 1 1
MIRT022363 IGFBP3 insulin like growth factor binding protein 3 1 1
MIRT022364 TMEM45A transmembrane protein 45A 1 1
MIRT022365 CDCP1 CUB domain containing protein 1 1 1
MIRT022366 PUS3 pseudouridylate synthase 3 1 1
MIRT022367 MAP3K8 mitogen-activated protein kinase kinase kinase 8 1 1
MIRT022368 TPST2 tyrosylprotein sulfotransferase 2 4 1
MIRT022369 C8orf22 pancreatic progenitor cell differentiation and proliferation factor like 1 1
MIRT022370 NFIA nuclear factor I A 1 1
MIRT022371 GMCL1 germ cell-less, spermatogenesis associated 1 2 2
MIRT022372 SLC1A4 solute carrier family 1 member 4 1 1
MIRT022373 PPP1R3B protein phosphatase 1 regulatory subunit 3B 1 1
MIRT022374 ESYT2 extended synaptotagmin 2 1 1
MIRT022375 ANXA11 annexin A11 1 1
MIRT022376 GNB2L1 receptor for activated C kinase 1 2 1
MIRT022377 SEPT2 septin 2 2 1
MIRT022378 BEND3 BEN domain containing 3 2 1
MIRT022379 MBNL1 muscleblind like splicing regulator 1 2 1
MIRT022380 CUX2 cut like homeobox 2 2 1
MIRT022381 MCAM melanoma cell adhesion molecule 2 1
MIRT022382 EIF2S2 eukaryotic translation initiation factor 2 subunit beta 2 1
MIRT022383 SNRPB small nuclear ribonucleoprotein polypeptides B and B1 2 1
MIRT022384 CDC27 cell division cycle 27 2 1
MIRT022385 PGM5 phosphoglucomutase 5 2 1
MIRT022386 NOL10 nucleolar protein 10 2 1
MIRT022387 NOC3L NOC3 like DNA replication regulator 2 1
MIRT022388 WTAP WT1 associated protein 2 1
MIRT022389 EIF3M eukaryotic translation initiation factor 3 subunit M 2 1
MIRT022390 MED20 mediator complex subunit 20 2 1
MIRT022391 AURKA aurora kinase A 2 1
MIRT022392 GNAI2 G protein subunit alpha i2 2 1
MIRT022393 NMNAT1 nicotinamide nucleotide adenylyltransferase 1 2 1
MIRT022394 LMNA lamin A/C 2 1
MIRT022395 ACAT2 acetyl-CoA acetyltransferase 2 1 1
MIRT022396 RBPMS RNA binding protein with multiple splicing 1 1
MIRT022397 GBP1 guanylate binding protein 1 1 1
MIRT022398 TAF1A TATA-box binding protein associated factor, RNA polymerase I subunit A 1 1
MIRT022399 PYCARD PYD and CARD domain containing 1 1
MIRT022400 SQRDL sulfide quinone oxidoreductase 1 1
MIRT022401 PSG3 pregnancy specific beta-1-glycoprotein 3 1 1
MIRT022402 TMEFF2 transmembrane protein with EGF like and two follistatin like domains 2 1 1
MIRT022403 DENND2D DENN domain containing 2D 1 1
MIRT022404 PTGES prostaglandin E synthase 1 1
MIRT022405 SAMD10 sterile alpha motif domain containing 10 1 1
MIRT022406 ANO1 anoctamin 1 1 1
MIRT022407 PDGFC platelet derived growth factor C 1 1
MIRT022408 TMEM121 transmembrane protein 121 1 1
MIRT022409 FNDC4 fibronectin type III domain containing 4 1 1
MIRT022410 ANKRD36B ankyrin repeat domain 36B 1 1
MIRT022411 PLEKHB1 pleckstrin homology domain containing B1 1 1
MIRT022412 Hes1 hairy and enhancer of split 1 (Drosophila) 1 1
MIRT022413 LOXL1 lysyl oxidase like 1 1 1
MIRT022414 TPRA1 transmembrane protein adipocyte associated 1 1 1
MIRT022415 IPCEF1 interaction protein for cytohesin exchange factors 1 1 1
MIRT022416 CLN5 CLN5, intracellular trafficking protein 1 1
MIRT022417 AMIGO2 adhesion molecule with Ig like domain 2 1 1
MIRT022418 CTAGE5 melanoma inhibitory activity 2 1 1
MIRT022419 ICAM5 intercellular adhesion molecule 5 1 1
MIRT022420 ATP8B3 ATPase phospholipid transporting 8B3 1 1
MIRT022421 GSTK1 glutathione S-transferase kappa 1 1 1
MIRT022422 PLA2G7 phospholipase A2 group VII 1 1
MIRT022423 DDX19A DEAD-box helicase 19A 1 1
MIRT022424 CPOX coproporphyrinogen oxidase 1 1
MIRT022425 DPH5 diphthamide biosynthesis 5 1 1
MIRT022426 NEDD4 neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase 1 1
MIRT022427 LAMP2 lysosomal associated membrane protein 2 1 1
MIRT022428 MEPE matrix extracellular phosphoglycoprotein 1 1
MIRT022429 RAB3IL1 RAB3A interacting protein like 1 1 1
MIRT022430 CAST calpastatin 1 1
MIRT022431 ZNF451 zinc finger protein 451 1 1
MIRT022432 AKT3 AKT serine/threonine kinase 3 6 3
MIRT022433 ANGPTL7 angiopoietin like 7 1 1
MIRT022434 UNC5B unc-5 netrin receptor B 1 1
MIRT022435 FAXDC2 fatty acid hydroxylase domain containing 2 1 1
MIRT022436 KIF26A kinesin family member 26A 1 1
MIRT022437 GK5 glycerol kinase 5 (putative) 1 1
MIRT022438 BMPR1A bone morphogenetic protein receptor type 1A 1 1
MIRT022439 ARMC1 armadillo repeat containing 1 1 1
MIRT022440 MDK midkine 1 1
MIRT022441 PLSCR4 phospholipid scramblase 4 1 1
MIRT022442 SLC44A1 solute carrier family 44 member 1 1 1
MIRT022443 CNN3 calponin 3 1 1
MIRT022444 PTPRZ1 protein tyrosine phosphatase, receptor type Z1 1 1
MIRT022445 TWSG1 twisted gastrulation BMP signaling modulator 1 1 1
MIRT022446 ASCC2 activating signal cointegrator 1 complex subunit 2 1 1
MIRT022447 SHE Src homology 2 domain containing E 1 1
MIRT022448 IL11 interleukin 11 1 1
MIRT022449 TCTA T-cell leukemia translocation altered 1 1
MIRT022450 YBX1 Y-box binding protein 1 2 1
MIRT022451 ANAPC5 anaphase promoting complex subunit 5 2 1
MIRT022452 ILF2 interleukin enhancer binding factor 2 2 1
MIRT022453 BRE BRISC and BRCA1 A complex member 2 2 1
MIRT022454 TFB2M transcription factor B2, mitochondrial 2 1
MIRT022455 BCCIP BRCA2 and CDKN1A interacting protein 2 1
MIRT022456 SCAF11 SR-related CTD associated factor 11 2 1
MIRT022457 CKAP4 cytoskeleton associated protein 4 2 1
MIRT022458 G3BP2 G3BP stress granule assembly factor 2 2 1
MIRT022459 NFIB nuclear factor I B 2 1
MIRT022460 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT022461 ASCC3 activating signal cointegrator 1 complex subunit 3 1 1
MIRT022462 DNAJC25 DnaJ heat shock protein family (Hsp40) member C25 1 1
MIRT022463 TNFRSF25 TNF receptor superfamily member 25 1 1
MIRT022464 FLG filaggrin 1 1
MIRT022465 STC2 stanniocalcin 2 1 1
MIRT022466 PSG9 pregnancy specific beta-1-glycoprotein 9 1 1
MIRT022467 MESDC2 mesoderm development LRP chaperone 1 1
MIRT022468 KRT33A keratin 33A 1 1
MIRT022469 ADAMTS1 ADAM metallopeptidase with thrombospondin type 1 motif 1 1 1
MIRT022470 FHDC1 FH2 domain containing 1 1 1
MIRT022471 SS18L2 SS18 like 2 1 1
MIRT022472 GAS6 growth arrest specific 6 1 1
MIRT022473 NUP50 nucleoporin 50 1 1
MIRT022474 DRD4 dopamine receptor D4 1 1
MIRT022475 AIF1L allograft inflammatory factor 1 like 1 1
MIRT022476 USP49 ubiquitin specific peptidase 49 1 1
MIRT022477 TMEM54 transmembrane protein 54 1 1
MIRT022478 KCNC4 potassium voltage-gated channel subfamily C member 4 1 1
MIRT022479 KDSR 3-ketodihydrosphingosine reductase 1 1
MIRT022480 KCNK1 potassium two pore domain channel subfamily K member 1 1 1
MIRT022481 TRIM4 tripartite motif containing 4 1 1
MIRT022482 MALSU1 mitochondrial assembly of ribosomal large subunit 1 1 1
MIRT022483 FAM171A1 family with sequence similarity 171 member A1 1 1
MIRT022484 NEU4 neuraminidase 4 1 1
MIRT022485 FGF5 fibroblast growth factor 5 1 1
MIRT022486 SLC16A6 solute carrier family 16 member 6 1 1
MIRT022487 HFM1 HFM1, ATP dependent DNA helicase homolog 1 1
MIRT022488 HKDC1 hexokinase domain containing 1 1 1
MIRT022489 CCDC71 coiled-coil domain containing 71 1 1
MIRT022490 C6orf89 chromosome 6 open reading frame 89 1 1
MIRT022491 SLC2A4RG SLC2A4 regulator 1 1
MIRT022492 PHF21B PHD finger protein 21B 1 1
MIRT022493 EOGT EGF domain specific O-linked N-acetylglucosamine transferase 1 1
MIRT022494 FRMD3 FERM domain containing 3 1 1
MIRT022495 ROR1 receptor tyrosine kinase like orphan receptor 1 1 1
MIRT022496 STX18 syntaxin 18 1 1
MIRT022497 FAM76A family with sequence similarity 76 member A 1 1
MIRT022498 DZIP1 DAZ interacting zinc finger protein 1 1 1
MIRT022499 PTP4A1 protein tyrosine phosphatase type IVA, member 1 1 1
MIRT022500 ABCC3 ATP binding cassette subfamily C member 3 1 1
MIRT022501 KIAA1704 GPALPP motifs containing 1 1 1
MIRT022502 FXR1 FMR1 autosomal homolog 1 1 1
MIRT022503 NKAP NFKB activating protein 1 1
MIRT022504 BTC betacellulin 1 1
MIRT022505 FMOD fibromodulin 1 1
MIRT022506 NRG1 neuregulin 1 1 1
MIRT022507 BCL6 B-cell CLL/lymphoma 6 1 1
MIRT022508 PQLC3 PQ loop repeat containing 3 1 1
MIRT022509 SHPK sedoheptulokinase 1 1
MIRT022510 C3orf58 chromosome 3 open reading frame 58 1 1
MIRT022511 TOMM34 translocase of outer mitochondrial membrane 34 1 1
MIRT022512 IQCE IQ motif containing E 1 1
MIRT022513 SLC26A2 solute carrier family 26 member 2 1 1
MIRT022514 FAM199X family with sequence similarity 199, X-linked 1 1
MIRT022515 THAP2 THAP domain containing 2 1 1
MIRT022516 SERTAD4 SERTA domain containing 4 1 1
MIRT022517 RYR3 ryanodine receptor 3 1 1
MIRT022518 PIK3C2A phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha 1 1
MIRT022519 TCOF1 treacle ribosome biogenesis factor 1 2 1
MIRT022520 CHRAC1 chromatin accessibility complex 1 2 1
MIRT022521 NPM3 nucleophosmin/nucleoplasmin 3 2 1
MIRT022522 CD2BP2 CD2 cytoplasmic tail binding protein 2 2 1
MIRT022523 TOPBP1 DNA topoisomerase II binding protein 1 2 1
MIRT022524 TTLL3 tubulin tyrosine ligase like 3 2 1
MIRT022525 SYNE1 spectrin repeat containing nuclear envelope protein 1 2 1
MIRT022526 DSG2 desmoglein 2 2 1
MIRT022527 RBPJ recombination signal binding protein for immunoglobulin kappa J region 2 1
MIRT022528 TLR3 toll like receptor 3 1 1
MIRT022529 AARS alanyl-tRNA synthetase 1 1
MIRT022530 RAET1E retinoic acid early transcript 1E 1 1
MIRT022531 HMOX1 heme oxygenase 1 1 1
MIRT022532 KAT2A lysine acetyltransferase 2A 1 1
MIRT022533 SECTM1 secreted and transmembrane 1 1 1
MIRT022534 KIAA1199 cell migration inducing hyaluronan binding protein 1 1
MIRT022535 C8orf33 chromosome 8 open reading frame 33 1 1
MIRT022536 MAPK11 mitogen-activated protein kinase 11 1 1
MIRT022537 TIMP3 TIMP metallopeptidase inhibitor 3 1 1
MIRT022538 RIBC2 RIB43A domain with coiled-coils 2 1 1
MIRT022539 PRB2 proline rich protein BstNI subfamily 2 1 1
MIRT022540 HSD17B2 hydroxysteroid 17-beta dehydrogenase 2 1 1
MIRT022541 TUBE1 tubulin epsilon 1 1 1
MIRT022542 PTGS2 prostaglandin-endoperoxide synthase 2 1 1
MIRT022543 LOXL4 lysyl oxidase like 4 1 1
MIRT022544 POP5 POP5 homolog, ribonuclease P/MRP subunit 1 1
MIRT022545 SSNA1 SS nuclear autoantigen 1 1 1
MIRT022546 ID1 inhibitor of DNA binding 1, HLH protein 1 1
MIRT022547 MYH7B myosin heavy chain 7B 1 1
MIRT022548 RHBDL2 rhomboid like 2 1 1
MIRT022550 YKT6 YKT6 v-SNARE homolog 1 1
MIRT022551 PLA2G4A phospholipase A2 group IVA 1 1
MIRT022552 FBXL18 F-box and leucine rich repeat protein 18 1 1
MIRT022553 NT5C1B 5'-nucleotidase, cytosolic IB 1 1
MIRT022554 TBX2 T-box 2 1 1
MIRT022555 MBD6 methyl-CpG binding domain protein 6 1 1
MIRT022556 SLC38A2 solute carrier family 38 member 2 1 1
MIRT022557 CSGALNACT1 chondroitin sulfate N-acetylgalactosaminyltransferase 1 1 1
MIRT022558 CD86 CD86 molecule 1 1
MIRT022559 HAUS6 HAUS augmin like complex subunit 6 1 1
MIRT022560 LDLRAD4 low density lipoprotein receptor class A domain containing 4 1 1
MIRT022561 TSPAN6 tetraspanin 6 1 1
MIRT022562 COL4A4 collagen type IV alpha 4 chain 1 1
MIRT022563 CNKSR3 CNKSR family member 3 1 1
MIRT022564 SLC25A36 solute carrier family 25 member 36 1 1
MIRT022565 TGOLN2 trans-golgi network protein 2 1 1
MIRT022566 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT022567 RAB11FIP5 RAB11 family interacting protein 5 1 1
MIRT022568 LRRC8C leucine rich repeat containing 8 VRAC subunit C 1 1
MIRT022569 ACADVL acyl-CoA dehydrogenase, very long chain 1 1
MIRT022570 BCAP29 B-cell receptor associated protein 29 1 1
MIRT022571 FRMD6 FERM domain containing 6 1 1
MIRT022572 NXN nucleoredoxin 1 1
MIRT022573 PTPN11 protein tyrosine phosphatase, non-receptor type 11 1 1
MIRT022574 FBXO17 F-box protein 17 1 1
MIRT022575 SNTA1 syntrophin alpha 1 1 1
MIRT022576 ZMPSTE24 zinc metallopeptidase STE24 1 1
MIRT022577 SLC9A9 solute carrier family 9 member A9 1 1
MIRT022578 NRP1 neuropilin 1 3 1
MIRT022579 SNX16 sorting nexin 16 1 1
MIRT022580 AK3 adenylate kinase 3 1 1
MIRT022581 ANKS6 ankyrin repeat and sterile alpha motif domain containing 6 1 1
MIRT022582 RRP15 ribosomal RNA processing 15 homolog 1 1
MIRT022583 WASF2 WAS protein family member 2 1 1
MIRT022584 DENND6A DENN domain containing 6A 1 1
MIRT022585 RBM24 RNA binding motif protein 24 1 1
MIRT022586 RNFT1 ring finger protein, transmembrane 1 1 1
MIRT022587 COL1A1 collagen type I alpha 1 chain 2 1
MIRT022588 MOGS mannosyl-oligosaccharide glucosidase 2 1
MIRT022589 KANK2 KN motif and ankyrin repeat domains 2 2 1
MIRT022590 SNRPF small nuclear ribonucleoprotein polypeptide F 2 1
MIRT022591 PARN poly(A)-specific ribonuclease 2 1
MIRT022592 TIMM13 translocase of inner mitochondrial membrane 13 2 1
MIRT022593 MUC1 mucin 1, cell surface associated 2 1
MIRT022594 PRPH peripherin 2 1
MIRT022595 CDKN2AIP CDKN2A interacting protein 2 1
MIRT022596 PHC2 polyhomeotic homolog 2 2 1
MIRT022597 DCUN1D5 defective in cullin neddylation 1 domain containing 5 2 1
MIRT022598 ANAPC7 anaphase promoting complex subunit 7 2 1
MIRT022599 FAM175B abraxas 2, BRISC complex subunit 1 1
MIRT022600 SGSM3 small G protein signaling modulator 3 1 1
MIRT022601 SPATA9 spermatogenesis associated 9 1 1
MIRT022602 PPAP2B phospholipid phosphatase 3 1 1
MIRT022603 MFSD10 major facilitator superfamily domain containing 10 1 1
MIRT022604 IFI44L interferon induced protein 44 like 1 1
MIRT022605 COL6A2 collagen type VI alpha 2 chain 1 1
MIRT022606 LAMC1 laminin subunit gamma 1 1 1
MIRT022607 PRKAG1 protein kinase AMP-activated non-catalytic subunit gamma 1 1 1
MIRT022608 Mapk14 mitogen-activated protein kinase 14 1 1
MIRT022609 SLC39A11 solute carrier family 39 member 11 1 1
MIRT022610 MTCH1 mitochondrial carrier 1 1 1
MIRT022611 HOXA3 homeobox A3 1 1
MIRT022612 CHST6 carbohydrate sulfotransferase 6 1 1
MIRT022613 RAB32 RAB32, member RAS oncogene family 4 1
MIRT022614 ZNF549 zinc finger protein 549 1 1
MIRT022615 ANKRD42 ankyrin repeat domain 42 1 1
MIRT022616 DOK7 docking protein 7 1 1
MIRT022617 TGM1 transglutaminase 1 1 1
MIRT022618 MMP26 matrix metallopeptidase 26 1 1
MIRT022619 CABLES1 Cdk5 and Abl enzyme substrate 1 1 1
MIRT022620 FAM83D family with sequence similarity 83 member D 1 1
MIRT022621 PTP4A2 protein tyrosine phosphatase type IVA, member 2 1 1
MIRT022622 ETNPPL ethanolamine-phosphate phospho-lyase 1 1
MIRT022623 MAPKAPK3 mitogen-activated protein kinase-activated protein kinase 3 1 1
MIRT022624 CPM carboxypeptidase M 1 1
MIRT022625 PEMT phosphatidylethanolamine N-methyltransferase 1 1
MIRT022626 SKIL SKI like proto-oncogene 1 1
MIRT022627 DAPK1 death associated protein kinase 1 1 1
MIRT022628 MXD4 MAX dimerization protein 4 1 1
MIRT022629 DBNL drebrin like 1 1
MIRT022630 ABHD4 abhydrolase domain containing 4 1 1
MIRT022631 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT022632 TMED10 transmembrane p24 trafficking protein 10 1 1
MIRT022633 ANKS1B ankyrin repeat and sterile alpha motif domain containing 1B 1 1
MIRT022634 NARG2 interactor of little elongation complex ELL subunit 2 1 1
MIRT022635 HSPB7 heat shock protein family B (small) member 7 1 1
MIRT022636 SLC25A39 solute carrier family 25 member 39 1 1
MIRT022637 SNX7 sorting nexin 7 1 1
MIRT022638 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 1
MIRT022639 MKLN1 muskelin 1 1 1
MIRT022640 ATRIP ATR interacting protein 1 1
MIRT022641 MVB12A multivesicular body subunit 12A 1 1
MIRT022642 IMPACT impact RWD domain protein 1 1
MIRT022643 FAM133A family with sequence similarity 133 member A 1 1
MIRT022644 NR4A3 nuclear receptor subfamily 4 group A member 3 1 1
MIRT022645 CYP2U1 cytochrome P450 family 2 subfamily U member 1 1 1
MIRT022646 DHRS1 dehydrogenase/reductase 1 1 1
MIRT022647 MSRA methionine sulfoxide reductase A 1 1
MIRT022648 POC1B POC1 centriolar protein B 1 1
MIRT022649 UMPS uridine monophosphate synthetase 1 1
MIRT022650 GRM1 glutamate metabotropic receptor 1 1 1
MIRT022651 GIT2 GIT ArfGAP 2 1 1
MIRT022652 TP53INP1 tumor protein p53 inducible nuclear protein 1 1 1
MIRT022653 EGR2 early growth response 2 1 1
MIRT022654 KRI1 KRI1 homolog 2 1
MIRT022655 MISP mitotic spindle positioning 2 1
MIRT022656 ALDOB aldolase, fructose-bisphosphate B 2 1
MIRT022657 IFI16 interferon gamma inducible protein 16 2 1
MIRT022658 RAVER1 ribonucleoprotein, PTB binding 1 2 1
MIRT022659 DCTN3 dynactin subunit 3 2 1
MIRT022660 QKI QKI, KH domain containing RNA binding 2 1
MIRT022661 DDIT4 DNA damage inducible transcript 4 1 1
MIRT022662 TGFB1I1 transforming growth factor beta 1 induced transcript 1 1 1
MIRT022663 FAM206A family with sequence similarity 206 member A 1 1
MIRT022664 ZNF655 zinc finger protein 655 1 1
MIRT022665 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT022666 NTF4 neurotrophin 4 1 1
MIRT022667 CCDC142 coiled-coil domain containing 142 1 1
MIRT022668 DCC DCC netrin 1 receptor 1 1
MIRT022669 ZNF395 zinc finger protein 395 1 1
MIRT022670 EVI2A ecotropic viral integration site 2A 1 1
MIRT022671 QSER1 glutamine and serine rich 1 1 1
MIRT022672 PDSS1 decaprenyl diphosphate synthase subunit 1 1 1
MIRT022673 NSUN7 NOP2/Sun RNA methyltransferase family member 7 1 1
MIRT022674 FAM105A family with sequence similarity 105 member A 1 1
MIRT022675 PGGT1B protein geranylgeranyltransferase type I subunit beta 1 1
MIRT022676 RSAD1 radical S-adenosyl methionine domain containing 1 1 1
MIRT022677 BABAM1 BRISC and BRCA1 A complex member 1 1 1
MIRT022678 ABCG8 ATP binding cassette subfamily G member 8 1 1
MIRT022679 COL8A2 collagen type VIII alpha 2 chain 1 1
MIRT022680 TSR2 TSR2, ribosome maturation factor 1 1
MIRT022681 TRIM65 tripartite motif containing 65 1 1
MIRT022682 CTHRC1 collagen triple helix repeat containing 1 1 1
MIRT022683 C1orf85 glycosylated lysosomal membrane protein 1 1
MIRT022684 OASL 2'-5'-oligoadenylate synthetase like 1 1
MIRT022685 ITGB1 integrin subunit beta 1 1 1
MIRT022686 USP5 ubiquitin specific peptidase 5 1 1
MIRT022687 IFIT3 interferon induced protein with tetratricopeptide repeats 3 1 1
MIRT022688 ITPRIP inositol 1,4,5-trisphosphate receptor interacting protein 1 1
MIRT022689 VIT vitrin 1 1
MIRT022690 TUBB2B tubulin beta 2B class IIb 1 1
MIRT022691 IGFBP4 insulin like growth factor binding protein 4 1 1
MIRT022692 C1orf198 chromosome 1 open reading frame 198 1 1
MIRT022693 CDV3 CDV3 homolog 1 1
MIRT022694 FAM19A2 family with sequence similarity 19 member A2, C-C motif chemokine like 1 1
MIRT022695 FECH ferrochelatase 1 1
MIRT022696 VAMP8 vesicle associated membrane protein 8 1 1
MIRT022697 FNDC3B fibronectin type III domain containing 3B 1 1
MIRT022698 KCNS3 potassium voltage-gated channel modifier subfamily S member 3 1 1
MIRT022699 MAP3K7CL MAP3K7 C-terminal like 1 1
MIRT022700 FMNL2 formin like 2 1 1
MIRT022701 FAM89A family with sequence similarity 89 member A 1 1
MIRT022702 ICMT isoprenylcysteine carboxyl methyltransferase 3 5
MIRT022703 GPC1 glypican 1 1 1
MIRT022704 PRDM13 PR/SET domain 13 1 1
MIRT022705 PNP purine nucleoside phosphorylase 1 1
MIRT022706 ACOT11 acyl-CoA thioesterase 11 1 1
MIRT022707 SLC35F3 solute carrier family 35 member F3 1 1
MIRT022708 RPP25L ribonuclease P/MRP subunit p25 like 1 1
MIRT022709 RHBDF1 rhomboid 5 homolog 1 1 1
MIRT022710 TXLNA taxilin alpha 1 1
MIRT022711 MST4 serine/threonine kinase 26 1 1
MIRT022712 NUFIP2 NUFIP2, FMR1 interacting protein 2 3 3
MIRT022713 TMED1 transmembrane p24 trafficking protein 1 1 1
MIRT022714 GGA2 golgi associated, gamma adaptin ear containing, ARF binding protein 2 1 1
MIRT022715 PPARA peroxisome proliferator activated receptor alpha 1 1
MIRT022716 TPD52L2 tumor protein D52 like 2 1 1
MIRT022717 LRRC58 leucine rich repeat containing 58 4 4
MIRT022718 ANAPC4 anaphase promoting complex subunit 4 2 1
MIRT022719 IGFBP7 insulin like growth factor binding protein 7 2 1
MIRT022720 CCT3 chaperonin containing TCP1 subunit 3 2 1
MIRT022721 NONO non-POU domain containing octamer binding 2 1
MIRT022722 THOC6 THO complex 6 2 1
MIRT022723 CTNNB1 catenin beta 1 2 1
MIRT022724 CLTA clathrin light chain A 2 1
MIRT022725 TFAP4 transcription factor AP-4 5 1
MIRT022726 ACTR3 ARP3 actin related protein 3 homolog 2 1
MIRT022727 CHMP2B charged multivesicular body protein 2B 1 1
MIRT022728 EIF4E eukaryotic translation initiation factor 4E 2 1
MIRT022729 PTBP3 polypyrimidine tract binding protein 3 4 3
MIRT022730 RPL23 ribosomal protein L23 1 1
MIRT022731 BCL6B B-cell CLL/lymphoma 6B 1 1
MIRT022732 S100A2 S100 calcium binding protein A2 1 1
MIRT022733 LINC00174 long intergenic non-protein coding RNA 174 1 1
MIRT022734 DNAH5 dynein axonemal heavy chain 5 1 1
MIRT022735 CARD14 caspase recruitment domain family member 14 1 1
MIRT022736 ANO6 anoctamin 6 1 1
MIRT022737 GREM1 gremlin 1, DAN family BMP antagonist 1 1
MIRT022738 TRPV3 transient receptor potential cation channel subfamily V member 3 1 1
MIRT022739 NPR1 natriuretic peptide receptor 1 1 1
MIRT022740 ANGPTL4 angiopoietin like 4 1 1
MIRT022741 HTRA3 HtrA serine peptidase 3 1 1
MIRT022742 WRAP53 WD repeat containing antisense to TP53 1 1
MIRT022743 NTHL1 nth like DNA glycosylase 1 1 1
MIRT022744 DPYD dihydropyrimidine dehydrogenase 1 1
MIRT022745 GABBR2 gamma-aminobutyric acid type B receptor subunit 2 1 1
MIRT022746 DNAJC25-GNG10 DNAJC25-GNG10 readthrough 1 1
MIRT022747 IL27RA interleukin 27 receptor subunit alpha 1 1
MIRT022748 GNRHR gonadotropin releasing hormone receptor 1 1
MIRT022749 TTC8 tetratricopeptide repeat domain 8 1 1
MIRT022750 STK38L serine/threonine kinase 38 like 1 1
MIRT022751 TUBB4A tubulin beta 4A class IVa 1 1
MIRT022752 IFIT2 interferon induced protein with tetratricopeptide repeats 2 1 1
MIRT022754 NRF1 nuclear respiratory factor 1 1 1
MIRT022755 EIF2AK2 eukaryotic translation initiation factor 2 alpha kinase 2 1 1
MIRT022756 NID2 nidogen 2 1 1
MIRT022757 MARCH11 membrane associated ring-CH-type finger 11 1 1
MIRT022758 ADAMTSL5 ADAMTS like 5 1 1
MIRT022759 SCN3A sodium voltage-gated channel alpha subunit 3 1 1
MIRT022760 NDE1 nudE neurodevelopment protein 1 1 1
MIRT022761 BEX1 brain expressed X-linked 1 1 1
MIRT022762 GDA guanine deaminase 1 1
MIRT022763 PDE3B phosphodiesterase 3B 1 1
MIRT022764 RECK reversion inducing cysteine rich protein with kazal motifs 1 1
MIRT022765 CTNS cystinosin, lysosomal cystine transporter 1 1
MIRT022766 MKX mohawk homeobox 1 1
MIRT022767 SGMS1 sphingomyelin synthase 1 1 1
MIRT022768 AKT2 AKT serine/threonine kinase 2 1 1
MIRT022769 LAPTM4A lysosomal protein transmembrane 4 alpha 1 1
MIRT022770 SLC7A1 solute carrier family 7 member 1 1 1
MIRT022771 ZNF548 zinc finger protein 548 1 1
MIRT022772 NLRX1 NLR family member X1 1 1
MIRT022773 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT022774 SDF2L1 stromal cell derived factor 2 like 1 1 1
MIRT022775 DACT1 dishevelled binding antagonist of beta catenin 1 1 1
MIRT022776 POGLUT1 protein O-glucosyltransferase 1 1 1
MIRT022777 AMMECR1 Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 1 1
MIRT022778 VPS4B vacuolar protein sorting 4 homolog B 1 1
MIRT022779 TRIP12 thyroid hormone receptor interactor 12 1 1
MIRT022780 TMEM184B transmembrane protein 184B 1 1
MIRT022781 C9orf41 carnosine N-methyltransferase 1 3 3
MIRT022782 KIF16B kinesin family member 16B 1 1
MIRT022783 ITSN2 intersectin 2 1 1
MIRT022784 FAM122B family with sequence similarity 122B 1 1
MIRT022785 CCDC68 coiled-coil domain containing 68 1 1
MIRT022786 AKT1S1 AKT1 substrate 1 1 1
MIRT022787 PHF6 PHD finger protein 6 1 1
MIRT022788 MBD3 methyl-CpG binding domain protein 3 2 1
MIRT022789 FLII FLII, actin remodeling protein 2 1
MIRT022790 CSRP1 cysteine and glycine rich protein 1 2 1
MIRT022791 GOLGA7 golgin A7 2 1
MIRT022792 DPF2 double PHD fingers 2 2 1
MIRT022793 MLLT4 afadin, adherens junction formation factor 2 1
MIRT022794 RHOC ras homolog family member C 2 1
MIRT022795 ABCF2 ATP binding cassette subfamily F member 2 2 1
MIRT022796 DKC1 dyskerin pseudouridine synthase 1 2 1
MIRT022797 CCDC86 coiled-coil domain containing 86 2 1
MIRT022798 LARP1 La ribonucleoprotein domain family member 1 2 1
MIRT022799 HADHA hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit 2 1
MIRT022800 EFHD2 EF-hand domain family member D2 2 1
MIRT022801 ANXA5 annexin A5 2 1
MIRT022802 SPOCD1 SPOC domain containing 1 1 1
MIRT022803 GPX7 glutathione peroxidase 7 1 1
MIRT022804 EPDR1 ependymin related 1 1 1
MIRT022805 KIAA1217 KIAA1217 1 1
MIRT022806 CNNM2 cyclin and CBS domain divalent metal cation transport mediator 2 1 1
MIRT022807 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT022808 GCSAML germinal center associated signaling and motility like 1 1
MIRT022809 SLC38A5 solute carrier family 38 member 5 1 1
MIRT022810 DSCAML1 DS cell adhesion molecule like 1 1 1
MIRT022811 CCM2L CCM2 like scaffolding protein 1 1
MIRT022812 BARX1 BARX homeobox 1 1 1
MIRT022813 THPO thrombopoietin 1 1
MIRT022814 ATG4A autophagy related 4A cysteine peptidase 1 1
MIRT022815 SLC35A2 solute carrier family 35 member A2 1 1
MIRT022816 VASN vasorin 1 1
MIRT022817 F3 coagulation factor III, tissue factor 1 1
MIRT022818 AAMDC adipogenesis associated Mth938 domain containing 1 1
MIRT022819 NUPR1 nuclear protein 1, transcriptional regulator 1 1
MIRT022820 LRRC42 leucine rich repeat containing 42 1 1
MIRT022821 MTUS2 microtubule associated scaffold protein 2 1 1
MIRT022822 ROBO3 roundabout guidance receptor 3 1 1
MIRT022823 CCNA1 cyclin A1 1 1
MIRT022824 C4BPB complement component 4 binding protein beta 1 1
MIRT022825 FAR1 fatty acyl-CoA reductase 1 1 1
MIRT022826 CBR3 carbonyl reductase 3 1 1
MIRT022827 TRPC6 transient receptor potential cation channel subfamily C member 6 1 1
MIRT022828 RASSF2 Ras association domain family member 2 1 1
MIRT022829 FAM65C RIPOR family member 3 1 1
MIRT022830 PREB prolactin regulatory element binding 1 1
MIRT022831 SMPDL3A sphingomyelin phosphodiesterase acid like 3A 1 1
MIRT022832 FGFBP1 fibroblast growth factor binding protein 1 1 1
MIRT022833 LRRC15 leucine rich repeat containing 15 1 1
MIRT022834 CCDC121 coiled-coil domain containing 121 1 1
MIRT022835 TMEM104 transmembrane protein 104 3 3
MIRT022836 HRH1 histamine receptor H1 1 1
MIRT022837 LIMD1 LIM domains containing 1 1 1
MIRT022838 LRRFIP2 LRR binding FLII interacting protein 2 1 1
MIRT022839 RAB31 RAB31, member RAS oncogene family 1 1
MIRT022840 PLEKHG4 pleckstrin homology and RhoGEF domain containing G4 1 1
MIRT022841 PARP9 poly(ADP-ribose) polymerase family member 9 1 1
MIRT022842 GCH1 GTP cyclohydrolase 1 1 1
MIRT022843 SPTY2D1 SPT2 chromatin protein domain containing 1 1 1
MIRT022844 GXYLT1 glucoside xylosyltransferase 1 3 7
MIRT022845 ZBTB6 zinc finger and BTB domain containing 6 1 1
MIRT022846 FSTL1 follistatin like 1 4 1
MIRT022847 RPIA ribose 5-phosphate isomerase A 1 1
MIRT022848 LPP LIM domain containing preferred translocation partner in lipoma 1 1
MIRT022849 SHMT2 serine hydroxymethyltransferase 2 2 1
MIRT022850 TUBA1A tubulin alpha 1a 1 1
MIRT022851 PES1 pescadillo ribosomal biogenesis factor 1 2 1
MIRT022852 ALDH3B2 aldehyde dehydrogenase 3 family member B2 2 1
MIRT022853 MCM7 minichromosome maintenance complex component 7 2 1
MIRT022854 POLR2J RNA polymerase II subunit J 2 1
MIRT022855 KIAA0101 PCNA clamp associated factor 2 1
MIRT022856 CAPRIN1 cell cycle associated protein 1 2 1
MIRT022857 CNP 2',3'-cyclic nucleotide 3' phosphodiesterase 2 1
MIRT022858 PACSIN3 protein kinase C and casein kinase substrate in neurons 3 2 1
MIRT022859 ADD3 adducin 3 2 1
MIRT022860 FOXRED2 FAD dependent oxidoreductase domain containing 2 2 1
MIRT022861 RRAS2 RAS related 2 2 1
MIRT022862 MSN moesin 2 1
MIRT022863 DDX3X DEAD-box helicase 3, X-linked 2 1
MIRT022864 TP63 tumor protein p63 1 1
MIRT022865 CCDC41 centrosomal protein 83 1 1
MIRT022866 SH2D1B SH2 domain containing 1B 1 1
MIRT022867 ELP2 elongator acetyltransferase complex subunit 2 1 1
MIRT022868 P4HA3 prolyl 4-hydroxylase subunit alpha 3 1 1
MIRT022869 CLMP CXADR like membrane protein 1 1
MIRT022870 RASIP1 Ras interacting protein 1 1 1
MIRT022871 GOLT1B golgi transport 1B 1 1
MIRT022872 IVD isovaleryl-CoA dehydrogenase 1 1
MIRT022873 NAT6 N-acetyltransferase 6 1 1
MIRT022874 ANKS3 ankyrin repeat and sterile alpha motif domain containing 3 1 1
MIRT022875 CSTF3 cleavage stimulation factor subunit 3 1 1
MIRT022876 EIF4EBP1 eukaryotic translation initiation factor 4E binding protein 1 1 1
MIRT022877 MRPS11 mitochondrial ribosomal protein S11 1 1
MIRT022878 ID4 inhibitor of DNA binding 4, HLH protein 1 1
MIRT022879 CXXC1 CXXC finger protein 1 1 1
MIRT022880 XBP1 X-box binding protein 1 1 1
MIRT022881 NTMT1 N-terminal Xaa-Pro-Lys N-methyltransferase 1 1 1
MIRT022882 SNAI1 snail family transcriptional repressor 1 1 1
MIRT022883 RHOA ras homolog family member A 1 1
MIRT022884 NCF2 neutrophil cytosolic factor 2 1 1
MIRT022885 CDO1 cysteine dioxygenase type 1 1 1
MIRT022886 WNT5B Wnt family member 5B 1 1
MIRT022887 TMEM179B transmembrane protein 179B 1 1
MIRT022888 USP47 ubiquitin specific peptidase 47 1 1
MIRT022889 LCA5L LCA5L, lebercilin like 1 1
MIRT022890 CRB1 crumbs 1, cell polarity complex component 1 1
MIRT022891 CD2AP CD2 associated protein 1 1
MIRT022892 HN1L Jupiter microtubule associated homolog 2 1 1
MIRT022893 MAP3K4 mitogen-activated protein kinase kinase kinase 4 1 1
MIRT022894 GRAMD3 GRAM domain containing 2B 1 1
MIRT022895 AIM1 crystallin beta-gamma domain containing 1 1 1
MIRT022896 LRIG1 leucine rich repeats and immunoglobulin like domains 1 1 1
MIRT022897 CENPQ centromere protein Q 1 1
MIRT022898 RUNX2 runt related transcription factor 2 1 1
MIRT022899 SMCR7L mitochondrial elongation factor 1 1 1
MIRT022900 QSOX1 quiescin sulfhydryl oxidase 1 1 1
MIRT022901 RAB38 RAB38, member RAS oncogene family 1 1
MIRT022902 CCBL2 kynurenine aminotransferase 3 1 1
MIRT022903 H6PD hexose-6-phosphate dehydrogenase/glucose 1-dehydrogenase 3 3
MIRT022904 PARP14 poly(ADP-ribose) polymerase family member 14 1 1
MIRT022905 RAB2A RAB2A, member RAS oncogene family 1 1
MIRT022906 KIF13A kinesin family member 13A 1 1
MIRT022907 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT022908 PRPS1 phosphoribosyl pyrophosphate synthetase 1 1 1
MIRT022909 ERF ETS2 repressor factor 1 1
MIRT022910 CTDSPL CTD small phosphatase like 1 1
MIRT022911 MLLT3 MLLT3, super elongation complex subunit 1 1
MIRT022912 PSKH1 protein serine kinase H1 1 1
MIRT022913 SLITRK4 SLIT and NTRK like family member 4 1 1
MIRT022914 EVI5 ecotropic viral integration site 5 1 1
MIRT022915 TBX22 T-box 22 1 1
MIRT022916 KCNK2 potassium two pore domain channel subfamily K member 2 1 1
MIRT022917 WIPF1 WAS/WASL interacting protein family member 1 1 1
MIRT022918 HIPK3 homeodomain interacting protein kinase 3 1 1
MIRT022919 BMP6 bone morphogenetic protein 6 1 1
MIRT022920 STT3A STT3A, catalytic subunit of the oligosaccharyltransferase complex 1 1
MIRT022921 SNX9 sorting nexin 9 2 1
MIRT022922 RPRD1B regulation of nuclear pre-mRNA domain containing 1B 2 1
MIRT022923 GLIPR2 GLI pathogenesis related 2 2 1
MIRT022924 GAR1 GAR1 ribonucleoprotein 2 1
MIRT022925 POLR2L RNA polymerase II subunit L 2 1
MIRT022926 PABPC4 poly(A) binding protein cytoplasmic 4 2 1
MIRT022927 SERPINH1 serpin family H member 1 2 1
MIRT022928 KDM2A lysine demethylase 2A 2 1
MIRT022929 HNRNPCL1 heterogeneous nuclear ribonucleoprotein C-like 1 2 1
MIRT022930 ALDH18A1 aldehyde dehydrogenase 18 family member A1 2 1
MIRT022931 CDKN2A cyclin dependent kinase inhibitor 2A 2 1
MIRT022932 EIF3B eukaryotic translation initiation factor 3 subunit B 2 1
MIRT022933 SP3 Sp3 transcription factor 2 1
MIRT022934 DDX6 DEAD-box helicase 6 2 1
MIRT022935 GAB3 GRB2 associated binding protein 3 1 1
MIRT022936 SAMSN1 SAM domain, SH3 domain and nuclear localization signals 1 1 1
MIRT022937 CCDC11 cilia and flagella associated protein 53 1 1
MIRT022938 GUK1 guanylate kinase 1 1 1
MIRT022939 TRIM7 tripartite motif containing 7 1 1
MIRT022940 MRPS12 mitochondrial ribosomal protein S12 1 1
MIRT022941 CC2D2A coiled-coil and C2 domain containing 2A 1 1
MIRT022942 CHSY3 chondroitin sulfate synthase 3 1 1
MIRT022943 MLEC malectin 1 1
MIRT022944 TREX2 three prime repair exonuclease 2 1 1
MIRT022945 CPA6 carboxypeptidase A6 1 1
MIRT022946 SYNJ2BP synaptojanin 2 binding protein 1 1
MIRT022947 SULT1B1 sulfotransferase family 1B member 1 1 1
MIRT022948 PEX16 peroxisomal biogenesis factor 16 1 1
MIRT022949 NRTN neurturin 1 1
MIRT022950 PPRC1 peroxisome proliferator-activated receptor gamma, coactivator-related 1 1 1
MIRT022951 APPL2 adaptor protein, phosphotyrosine interacting with PH domain and leucine zipper 2 1 1
MIRT022952 TMEM43 transmembrane protein 43 1 1
MIRT022953 UGT1A10 UDP glucuronosyltransferase family 1 member A10 1 1
MIRT022954 LAMA1 laminin subunit alpha 1 1 1
MIRT022955 PRSS50 protease, serine 50 1 1
MIRT022956 LSMEM2 leucine rich single-pass membrane protein 2 1 1
MIRT022957 SEC14L3 SEC14 like lipid binding 3 1 1
MIRT022958 CEBPE CCAAT/enhancer binding protein epsilon 1 1
MIRT022959 NNMT nicotinamide N-methyltransferase 1 1
MIRT022960 MAP2K3 mitogen-activated protein kinase kinase 3 1 1
MIRT022961 RNF144B ring finger protein 144B 1 1
MIRT022962 CABP7 calcium binding protein 7 1 1
MIRT022963 FTSJ1 FtsJ RNA methyltransferase homolog 1 1 1
MIRT022964 RUFY3 RUN and FYVE domain containing 3 1 1
MIRT022965 SULF1 sulfatase 1 1 1
MIRT022966 TPST1 tyrosylprotein sulfotransferase 1 1 1
MIRT022967 SLC22A3 solute carrier family 22 member 3 1 1
MIRT022968 TPCN2 two pore segment channel 2 1 1
MIRT022969 SLC25A16 solute carrier family 25 member 16 1 1
MIRT022970 CA12 carbonic anhydrase 12 1 1
MIRT022971 ZFYVE26 zinc finger FYVE-type containing 26 1 1
MIRT022972 KLF9 Kruppel like factor 9 1 1
MIRT022973 ADCY3 adenylate cyclase 3 1 1
MIRT022974 CCT5 chaperonin containing TCP1 subunit 5 1 1
MIRT022975 HS2ST1 heparan sulfate 2-O-sulfotransferase 1 1 1
MIRT022976 CD151 CD151 molecule (Raph blood group) 4 2
MIRT022977 CDH11 cadherin 11 1 1
MIRT022978 IL7 interleukin 7 1 1
MIRT022979 ITGA3 integrin subunit alpha 3 3 3
MIRT022980 FBLIM1 filamin binding LIM protein 1 1 1
MIRT022981 ARPP21 cAMP regulated phosphoprotein 21 1 1
MIRT022982 CCDC28A coiled-coil domain containing 28A 1 1
MIRT022983 DCAF5 DDB1 and CUL4 associated factor 5 1 1
MIRT022984 TRPS1 transcriptional repressor GATA binding 1 1 1
MIRT022985 PGM2 phosphoglucomutase 2 1 1
MIRT022986 PLEKHF2 pleckstrin homology and FYVE domain containing 2 1 1
MIRT022987 ZWINT ZW10 interacting kinetochore protein 3 3
MIRT022988 RANBP10 RAN binding protein 10 1 1
MIRT022989 TMEM41A transmembrane protein 41A 3 3
MIRT022990 ANPEP alanyl aminopeptidase, membrane 2 1
MIRT022991 PSME3 proteasome activator subunit 3 2 1
MIRT022992 PBX1 PBX homeobox 1 2 1
MIRT022993