pre-miRNA Information
pre-miRNA mmu-mir-9-1   
Genomic Coordinates chr3: 88215598 - 88215686
Synonyms Mirn9, Mirn9-1, mmu-mir-9-1, Mir9-1
Description Mus musculus miR-9-1 stem-loop
Comment None
RNA Secondary Structure
pre-miRNA mmu-mir-9-2   
Genomic Coordinates chr13: 83738814 - 83738885
Synonyms Mirn9-2, mmu-mir-9-2, Mir9-2
Description Mus musculus miR-9-2 stem-loop
Comment None
RNA Secondary Structure
pre-miRNA mmu-mir-9-3   
Genomic Coordinates chr7: 79505264 - 79505353
Synonyms Mirn9-3, mmu-mir-9-3, Mir9-3
Description Mus musculus miR-9-3 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-9-5p
Sequence 16| UCUUUGGUUAUCUAGCUGUAUGA |38
Evidence Experimental
Experiments Cloned
Putative Targets

Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BOS25P miR-9 Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Serum Real-time reverse transcription PCR
Gene Information
Gene Symbol Foxg1   
Synonyms 2900064B05Rik, BF-1, Bf1, Hfh9, Hfhbf1
Description forkhead box G1
Transcript NM_001160112   
Other Transcripts NM_008241   
Expression
Putative miRNA Targets on Foxg1
3'UTR of Foxg1
(miRNA target sites are highlighted)
>Foxg1|NM_001160112|3'UTR
   1 CATCCGGGGGACCAGACTGTAAGTGAACGTTTTACACACATTTGCATTGTAAATGATAATTAAAAAAATAAGTCCAGGTA
  81 TTTTTTATTAAGCCCCCCCTCCCCATTTCTGTACGTTTGTTCAGTCTTTAGGGTTGTTTACTATTCTAACACGGTGTGGA
 161 GTGTCAGCGAGGTGCAATGTGGGAGAATACATTGTAGAATATAAGGTTTGGACGTCAAATTATAGTAGAATGTGTATCTA
 241 AATAGTGACTGCTTTGCCATTTCATTCAAACCTGACAAGTCTATCTCAACAGGCTGCCAGATTTCCATGTGTGCAGTATT
 321 ATAAGTTATCATGGAGCTATCTGGTGGACGCAGGCCTTGAGAACAACCTAAATTATGAAGAGAGTTTTAAAATGTTAAAT
 401 TGTAATTTGTATTTAAGAATTTGTAGTAAAGGTGCCCAAGGAATTATATTGGCCATTTATTGTTTTGTCCTTTTTCTTTA
 481 AAGAACTGTTTCTTTCCTTTTGTTTACTTTTAGACCAAAGATTGGATTCTAGCAAATGCACTTGGTATACTAAGTATTAA
 561 AACAAGTAAACAAACAAACGAAAAAGGAAGGTTGTTTAGTTGGCAACACTGCCCATTCAATTGAATCCGAAGGAGACAAA
 641 ATTAAGGATTGCCTTCAGTTTGTGTTGTGTATATTTCGATGTATGTGGTCACTAACAGGTCACTTTTATTTTTTCTAAAT
 721 GTAGTGAAATGTTAATACCTATTGTACTTATAGGTAAACCTTGCAAATATGTAACCTGTGTTGCGCAAATGCCGCATCAA
 801 TTTGAGTGATTGTTAATGTTGTCTTAAAATTTCTTGATTGTGATACTGTGGTCATATGCCCGTGTTTGTCACTTACAAAA
 881 ATGTTTACTATGAACACACAGAAATAAAAAATAGGCTAAATTCATATATATCTTGAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' aguAUGUCGAUCUAUUGGUUUCu 5'
             |||  :|||   ||||||| 
Target 5' gttTACTTTTAG---ACCAAAGa 3'
502 - 521 153.00 -11.70
2
miRNA  3' aguauGUCGAUCUAUUGGUUUcu 5'
               || | :|: :||||:|  
Target 5' -----CATCCGGGGGACCAGAct 3'
1 - 18 118.00 -7.10
3
miRNA  3' agUAUGUCGAUCUAU-UGGUUUcu 5'
            ||:|| || |:|| ||:||:  
Target 5' aaATGCA-CTTGGTATACTAAGta 3'
534 - 556 116.00 -8.60
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions P19
Location of target site 3'UTR
Original Description (Extracted from the article) ... Here we propose that mouse microRNA-9 (miR-9) targets Foxg1 mRNAs for proper generation of Cajal芒鈧鈥淩etzius cells in the medial pallium. ...

- Shibata M; Kurokawa D; Nakao H; Ohmura T; Aizawa S, 2008, The Journal of neuroscience : the official journal of the Society for Neuroscience.

Article - Shibata M; Kurokawa D; Nakao H; Ohmura T; Aizawa S
- The Journal of neuroscience : the official journal of the Society for Neuroscience, 2008
Vertebrate brain hosts a diverse collection of microRNAs, but little is known about their functions in vivo. Here we propose that mouse microRNA-9 (miR-9) targets Foxg1 mRNAs for proper generation of Cajal-Retzius cells in the medial pallium. miR-9 expression is mediolaterally graded, being most intense in the cortical hem; it contrasts with the Foxg1 expression in a reciprocal gradient. The 3' untranslated regions of tetrapod, but not of teleost, Foxg1 mRNAs conserve miR-9 target sequences and are regulated by miR-9. Gain- and loss-of-function analyses of miR-9 showed that miR-9 negatively regulates endogenous Foxg1 protein level. Moreover, miR-9 overexpression in developing telencephalon at E11.5 by electroporation resulted in ectopic Reelin-positive cells over the cortex beyond the marginal zone. In addition, inhibition of endogenous miR-9 function by antisense oligonucleotides caused the regression of Wnt3a-positive cortical hem and reduction of reelin-, p73-, and NeuroD1-positive cells.
LinkOut: [PMID: 18842901]
526 mmu-miR-9-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000453 Stmn1 stathmin 1 4 1
MIRT001913 Foxg1 forkhead box G1 2 1
MIRT003796 Runx1 runt related transcription factor 1 3 1
MIRT005601 Sirt1 sirtuin 1 4 1
MIRT005793 Hes1 hairy and enhancer of split 1 (Drosophila) 3 2
MIRT006708 Zfp521 zinc finger protein 521 3 1
MIRT015114 Fmnl2 formin-like 2 1 1
MIRT015115 Pdhx pyruvate dehydrogenase complex, component X 1 1
MIRT015116 Srcin1 SRC kinase signaling inhibitor 1 1 1
MIRT015117 Sufu suppressor of fused homolog (Drosophila) 1 1
MIRT015118 Lsamp limbic system-associated membrane protein 1 1
MIRT015119 Bptf bromodomain PHD finger transcription factor 1 1
MIRT015120 Tor1aip2 torsin A interacting protein 2 1 1
MIRT015121 Tspan7 tetraspanin 7 1 1
MIRT015122 Ror1 receptor tyrosine kinase-like orphan receptor 1 1 1
MIRT015123 Atp1b1 ATPase, Na+/K+ transporting, beta 1 polypeptide 1 1
MIRT015124 Clock circadian locomotor output cycles kaput 1 1
MIRT015125 Zbtb34 zinc finger and BTB domain containing 34 1 1
MIRT015126 Cdan1 congenital dyserythropoietic anemia, type I (human) 1 1
MIRT015127 Asb7 ankyrin repeat and SOCS box-containing 7 1 1
MIRT015128 Nmt2 N-myristoyltransferase 2 1 1
MIRT015129 Ccdc50 coiled-coil domain containing 50 1 1
MIRT015130 Gzf1 GDNF-inducible zinc finger protein 1 1 1
MIRT015131 Fads2 fatty acid desaturase 2 1 1
MIRT015132 Arf2 ADP-ribosylation factor 2 1 1
MIRT015133 Elovl2 elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2 1 1
MIRT015134 Ctgf connective tissue growth factor 1 1
MIRT015135 Myo5a myosin VA 1 1
MIRT015136 Plat plasminogen activator, tissue 1 1
MIRT015137 Akap9 A kinase (PRKA) anchor protein (yotiao) 9 1 1
MIRT015138 Akt3 thymoma viral proto-oncogene 3 1 1
MIRT015139 Prom1 prominin 1 1 1
MIRT015140 Prrc2b proline-rich coiled-coil 2B 1 1
MIRT015141 Rela v-rel reticuloendotheliosis viral oncogene homolog A (avian) 1 1
MIRT015142 Scn8a sodium channel, voltage-gated, type VIII, alpha 1 1
MIRT015143 Fam63b MINDY lysine 48 deubiquitinase 2 1 1
MIRT015144 Gtf3c4 general transcription factor IIIC, polypeptide 4 1 1
MIRT015145 Chst11 carbohydrate sulfotransferase 11 1 1
MIRT015146 Cplx2 complexin 2 1 1
MIRT015147 B4galt5 UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 5 1 1
MIRT015148 Rnf4 ring finger protein 4 1 1
MIRT015149 Myo6 myosin VI 1 1
MIRT015150 Sidt2 SID1 transmembrane family, member 2 1 1
MIRT015151 Fam115a TRPM8 channel-associated factor 1 1 1
MIRT015152 Rpgrip1l Rpgrip1-like 1 1
MIRT015153 Nkrf NF-kappaB repressing factor 1 1
MIRT015154 Clstn1 calsyntenin 1 1 1
MIRT015155 Paqr8 progestin and adipoQ receptor family member VIII 1 1
MIRT015156 Hdgfrp3 HDGF like 3 1 1
MIRT015157 D3Bwg0562e phospholipid phosphatase related 4 1 1
MIRT015158 Gjc3 gap junction protein, gamma 3 1 1
MIRT015159 Larp4 La ribonucleoprotein domain family, member 4 1 1
MIRT015160 March8 membrane-associated ring finger (C3HC4) 8 1 1
MIRT015161 Spire1 spire homolog 1 (Drosophila) 1 1
MIRT015162 Cnrip1 cannabinoid receptor interacting protein 1 1 1
MIRT015163 Slc30a10 solute carrier family 30, member 10 1 1
MIRT015164 Tspan31 tetraspanin 31 1 1
MIRT015165 Eml1 echinoderm microtubule associated protein like 1 1 1
MIRT015166 Snph syntaphilin 1 1
MIRT015167 Bmp2 bone morphogenetic protein 2 1 1
MIRT015168 4930402H24Rik RIKEN cDNA 4930402H24 gene 1 1
MIRT015169 Fam101b refilin B 1 1
MIRT015170 Fam76a family with sequence similarity 76, member A 1 1
MIRT015171 Sprn shadow of prion protein 1 1
MIRT015172 Ppp2r5d protein phosphatase 2, regulatory subunit B', delta 1 1
MIRT015173 Pik3cd phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit delta 1 1
MIRT015174 Gtdc1 glycosyltransferase-like domain containing 1 1 1
MIRT015175 Cxcl12 chemokine (C-X-C motif) ligand 12 1 1
MIRT015176 Chpt1 choline phosphotransferase 1 1 1
MIRT015177 Heatr5a HEAT repeat containing 5A 1 1
MIRT015178 Gabra1 gamma-aminobutyric acid (GABA) A receptor, subunit alpha 1 1 1
MIRT015179 Hdac2 histone deacetylase 2 1 1
MIRT015180 Ddx17 DEAD (Asp-Glu-Ala-Asp) box polypeptide 17 1 1
MIRT015181 Zfp704 zinc finger protein 704 1 1
MIRT015182 Serpini1 serine (or cysteine) peptidase inhibitor, clade I, member 1 1 1
MIRT015183 Il1rap interleukin 1 receptor accessory protein 1 1
MIRT015184 Zdhhc20 zinc finger, DHHC domain containing 20 1 1
MIRT015185 Celf6 CUGBP, Elav-like family member 6 1 1
MIRT015186 Ak4 adenylate kinase 4 1 1
MIRT015187 Lfng LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase 1 1
MIRT015188 March6 membrane-associated ring finger (C3HC4) 6 1 1
MIRT015189 Arid4a AT rich interactive domain 4A (RBP1-like) 1 1
MIRT015190 Sema6d sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D 1 1
MIRT015191 Tpm1 tropomyosin 1, alpha 1 1
MIRT015192 Slc33a1 solute carrier family 33 (acetyl-CoA transporter), member 1 1 1
MIRT015193 Pcdh7 protocadherin 7 1 1
MIRT015194 Actr1a ARP1 actin-related protein 1A, centractin alpha 1 1
MIRT015195 Epas1 endothelial PAS domain protein 1 1 1
MIRT015196 Rcan2 regulator of calcineurin 2 1 1
MIRT015197 Col4a2 collagen, type IV, alpha 2 1 1
MIRT015198 Narf nuclear prelamin A recognition factor 1 1
MIRT015199 Pld3 phospholipase D family, member 3 1 1
MIRT015200 Scd1 stearoyl-Coenzyme A desaturase 1 1 1
MIRT015201 Tmem248 transmembrane protein 248 1 1
MIRT015202 Unc5c unc-5 netrin receptor C 1 1
MIRT015203 Arhgap6 Rho GTPase activating protein 6 1 1
MIRT015204 Adcy6 adenylate cyclase 6 1 1
MIRT015205 Vipr1 vasoactive intestinal peptide receptor 1 1 1
MIRT015206 Soat1 sterol O-acyltransferase 1 1 1
MIRT015207 Rnf128 ring finger protein 128 1 1
MIRT015208 Prnp prion protein 1 1
MIRT015209 Mapk4 mitogen-activated protein kinase 4 1 1
MIRT015210 Ankrd40 ankyrin repeat domain 40 1 1
MIRT015211 Megf10 multiple EGF-like-domains 10 1 1
MIRT015212 Eml5 echinoderm microtubule associated protein like 5 1 1
MIRT015213 Ufl1 UFM1 specific ligase 1 1 1
MIRT015214 Eif1a eukaryotic translation initiation factor 1A 1 1
MIRT015215 Fxr1 fragile X mental retardation gene 1, autosomal homolog 1 1
MIRT015216 Ccdc6 coiled-coil domain containing 6 1 1
MIRT015217 Ptprg protein tyrosine phosphatase, receptor type, G 1 1
MIRT015218 Zfhx4 zinc finger homeodomain 4 1 1
MIRT015219 Jakmip2 janus kinase and microtubule interacting protein 2 1 1
MIRT015220 Traf3 TNF receptor-associated factor 3 1 1
MIRT015221 Syap1 synapse associated protein 1 1 1
MIRT015222 Smarcd2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2 1 1
MIRT015223 Cnnm2 cyclin M2 1 1
MIRT015224 Itm2c integral membrane protein 2C 1 1
MIRT015225 Socs5 suppressor of cytokine signaling 5 1 1
MIRT015226 Amer2 APC membrane recruitment 2 1 1
MIRT015227 Unc13c unc-13 homolog C (C. elegans) 1 1
MIRT015228 Dnajb4 DnaJ heat shock protein family (Hsp40) member B4 1 1
MIRT015229 Pgrmc1 progesterone receptor membrane component 1 1 1
MIRT015230 Bend6 BEN domain containing 6 1 1
MIRT015231 Pikfyve phosphoinositide kinase, FYVE type zinc finger containing 1 1
MIRT015232 Tbc1d24 TBC1 domain family, member 24 1 1
MIRT015233 Mtmr4 myotubularin related protein 4 1 1
MIRT015234 Sybu syntabulin (syntaxin-interacting) 1 1
MIRT015235 Tmem40 transmembrane protein 40 1 1
MIRT015236 AK010878 GON7, KEOPS complex subunit homolog 1 1
MIRT015237 Aldh3a2 aldehyde dehydrogenase family 3, subfamily A2 1 1
MIRT015238 Eps15 epidermal growth factor receptor pathway substrate 15 1 1
MIRT015239 Egr1 early growth response 1 1 1
MIRT015240 Ocrl OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT015241 Rnf2 ring finger protein 2 1 1
MIRT015242 Mkx mohawk homeobox 1 1
MIRT015243 Rptor regulatory associated protein of MTOR, complex 1 1 1
MIRT015244 P4ha2 procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha II polypeptide 1 1
MIRT015245 Col4a1 collagen, type IV, alpha 1 1 1
MIRT015246 Gpr88 G-protein coupled receptor 88 1 1
MIRT015247 Zmynd8 zinc finger, MYND-type containing 8 1 1
MIRT015248 Ppp3r1 protein phosphatase 3, regulatory subunit B, alpha isoform (calcineurin B, type I) 1 1
MIRT015249 Tmem65 transmembrane protein 65 1 1
MIRT015250 Arpc1b actin related protein 2/3 complex, subunit 1B 1 1
MIRT015251 Guk1 guanylate kinase 1 1 1
MIRT015252 Spred3 sprouty-related, EVH1 domain containing 3 1 1
MIRT015253 Plxnb3 plexin B3 1 1
MIRT015254 Mdk midkine 1 1
MIRT015255 AW549877 expressed sequence AW549877 1 1
MIRT015256 Fut9 fucosyltransferase 9 1 1
MIRT015257 Sumf2 sulfatase modifying factor 2 1 1
MIRT015258 Sertm1 serine rich and transmembrane domain containing 1 1 1
MIRT015259 Ttc14 tetratricopeptide repeat domain 14 1 1
MIRT015260 Flt3 FMS-like tyrosine kinase 3 1 1
MIRT015261 Neto2 neuropilin (NRP) and tolloid (TLL)-like 2 1 1
MIRT015262 Stk11ip serine/threonine kinase 11 interacting protein 1 1
MIRT015263 Cib2 calcium and integrin binding family member 2 1 1
MIRT015264 Zfp36l2 zinc finger protein 36, C3H type-like 2 1 1
MIRT015265 AW554918 expressed sequence AW554918 1 1
MIRT015266 Tmem184b transmembrane protein 184b 1 1
MIRT015267 Slc10a7 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 1 1
MIRT015268 Prrg3 proline rich Gla (G-carboxyglutamic acid) 3 (transmembrane) 1 1
MIRT015269 D430041D05Rik RIKEN cDNA D430041D05 gene 1 1
MIRT015270 Sel1l sel-1 suppressor of lin-12-like (C. elegans) 1 1
MIRT015271 Npc1 Niemann-Pick type C1 1 1
MIRT015272 Lmbrd1 LMBR1 domain containing 1 1 1
MIRT015273 R3hdm1 R3H domain containing 1 1 1
MIRT015274 Kif5c kinesin family member 5C 1 1
MIRT015275 Dtna dystrobrevin alpha 1 1
MIRT015276 Bbs1 Bardet-Biedl syndrome 1 (human) 1 1
MIRT015277 Slc24a2 solute carrier family 24 (sodium/potassium/calcium exchanger), member 2 1 1
MIRT015278 Zfand4 zinc finger, AN1-type domain 4 1 1
MIRT015279 Pcdh8 protocadherin 8 1 1
MIRT015280 Reep1 receptor accessory protein 1 1 1
MIRT015281 Rasd2 RASD family, member 2 1 1
MIRT015282 Opcml opioid binding protein/cell adhesion molecule-like 1 1
MIRT015283 Isyna1 myo-inositol 1-phosphate synthase A1 1 1
MIRT015284 Paip2 polyadenylate-binding protein-interacting protein 2 1 1
MIRT015285 Xxylt1 xyloside xylosyltransferase 1 1 1
MIRT015286 Cd151 CD151 antigen 1 1
MIRT015287 Sptb spectrin beta, erythrocytic 1 1
MIRT015288 Cspp1 centrosome and spindle pole associated protein 1 1 1
MIRT015289 Sra1 steroid receptor RNA activator 1 1 1
MIRT015290 Erlin1 ER lipid raft associated 1 1 1
MIRT015291 Ptprd protein tyrosine phosphatase, receptor type, D 1 1
MIRT015292 Abcf1 ATP-binding cassette, sub-family F (GCN20), member 1 1 1
MIRT015293 Cox6c cytochrome c oxidase subunit VIc 1 1
MIRT015294 Rgp1 RAB6A GEF compex partner 1 1 1
MIRT015295 B4galnt1 beta-1,4-N-acetyl-galactosaminyl transferase 1 1 1
MIRT015296 Reep4 receptor accessory protein 4 1 1
MIRT015297 Car7 carbonic anhydrase 7 1 1
MIRT015298 Camta1 calmodulin binding transcription activator 1 1 1
MIRT015299 Fmn1 formin 1 1 1
MIRT015300 Itga4 integrin alpha 4 1 1
MIRT015301 Rbm27 RNA binding motif protein 27 1 1
MIRT015302 Fnip2 folliculin interacting protein 2 1 1
MIRT015303 Pik3cb phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta 1 1
MIRT015304 Man1a2 mannosidase, alpha, class 1A, member 2 1 1
MIRT015305 Lancl3 LanC lantibiotic synthetase component C-like 3 (bacterial) 1 1
MIRT015306 En2 engrailed 2 1 1
MIRT015307 Amer1 APC membrane recruitment 1 1 1
MIRT015308 Pank3 pantothenate kinase 3 1 1
MIRT015309 Tbc1d22a TBC1 domain family, member 22a 1 1
MIRT015310 Utrn utrophin 1 1
MIRT015311 Bclaf1 BCL2-associated transcription factor 1 1 1
MIRT015312 Plscr3 phospholipid scramblase 3 1 1
MIRT015313 Pbrm1 polybromo 1 1 1
MIRT015314 Dram2 DNA-damage regulated autophagy modulator 2 1 1
MIRT015315 Arid1a AT rich interactive domain 1A (SWI-like) 1 1
MIRT015316 Crebrf CREB3 regulatory factor 1 1
MIRT015317 Rnf19a ring finger protein 19A 1 1
MIRT015318 Shroom4 shroom family member 4 1 1
MIRT015319 Cntn3 contactin 3 1 1
MIRT015320 Ccser2 coiled-coil serine rich 2 1 1
MIRT015321 Ambra1 autophagy/beclin 1 regulator 1 1 1
MIRT015322 Magt1 magnesium transporter 1 1 1
MIRT015323 foxg1 forkhead box G1 1 1
MIRT015324 Nrarp Notch-regulated ankyrin repeat protein 1 1
MIRT015325 Zmat3 zinc finger matrin type 3 1 1
MIRT015326 Rictor RPTOR independent companion of MTOR, complex 2 1 1
MIRT015327 Ptcd1 pentatricopeptide repeat domain 1 1 1
MIRT015328 Ncor1 nuclear receptor co-repressor 1 1 1
MIRT015329 Dzank1 double zinc ribbon and ankyrin repeat domains 1 1 1
MIRT015330 Disp2 dispatched RND tramsporter family member 2 1 1
MIRT015331 Diras2 DIRAS family, GTP-binding RAS-like 2 1 1
MIRT015332 Scn3b sodium channel, voltage-gated, type III, beta 1 1
MIRT015333 Aqp4 aquaporin 4 1 1
MIRT015334 Prrt3 proline-rich transmembrane protein 3 1 1
MIRT015335 Atp6v0a1 ATPase, H+ transporting, lysosomal V0 subunit A1 1 1
MIRT015336 Gramd1b GRAM domain containing 1B 1 1
MIRT015337 Npc2 Niemann-Pick type C2 1 1
MIRT015338 Gria4 glutamate receptor, ionotropic, AMPA4 (alpha 4) 1 1
MIRT015339 Ctdsp1 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 1 1
MIRT015340 Lrrc58 leucine rich repeat containing 58 1 1
MIRT015341 Gm2a GM2 ganglioside activator protein 1 1
MIRT015342 Tacc1 transforming, acidic coiled-coil containing protein 1 1 1
MIRT015343 B3galt1 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1 1 1
MIRT015344 Klhl21 kelch-like 21 1 1
MIRT015345 Ssr1 signal sequence receptor, alpha 1 1
MIRT015346 Kif5a kinesin family member 5A 1 1
MIRT015347 Ndrg2 N-myc downstream regulated gene 2 1 1
MIRT015348 Snx27 sorting nexin family member 27 1 1
MIRT015349 Ttr transthyretin 1 1
MIRT015350 Srek1 splicing regulatory glutamine/lysine-rich protein 1 1 1
MIRT015351 Caly calcyon neuron-specific vesicular protein 1 1
MIRT015352 Rbfox1 RNA binding protein, fox-1 homolog (C. elegans) 1 1 1
MIRT015353 E130309D14Rik coiled-coil domain containing 92B 1 1
MIRT015354 Zic1 zinc finger protein of the cerebellum 1 1 1
MIRT015355 Foxk2 forkhead box K2 1 1
MIRT015356 Actn4 actinin alpha 4 1 1
MIRT015357 Scamp1 secretory carrier membrane protein 1 1 1
MIRT015358 Ppp1r13b protein phosphatase 1, regulatory (inhibitor) subunit 13B 1 1
MIRT015359 Ptgds prostaglandin D2 synthase (brain) 1 1
MIRT015360 Lgi1 leucine-rich repeat LGI family, member 1 1 1
MIRT015361 Pard6g par-6 family cell polarity regulator gamma 1 1
MIRT015362 Ist1 increased sodium tolerance 1 homolog (yeast) 1 1
MIRT015363 Arpp21 cyclic AMP-regulated phosphoprotein, 21 1 1
MIRT015364 Sphkap SPHK1 interactor, AKAP domain containing 1 1
MIRT015365 Tgfbr3 transforming growth factor, beta receptor III 1 1
MIRT015366 Rasa1 RAS p21 protein activator 1 1 1
MIRT015367 Adcy1 adenylate cyclase 1 1 1
MIRT015368 Pea15a phosphoprotein enriched in astrocytes 15A 1 1
MIRT015369 Fam53c family with sequence similarity 53, member C 1 1
MIRT015370 Clasp1 CLIP associating protein 1 1 1
MIRT015371 Igf2 insulin-like growth factor 2 1 1
MIRT015372 Snap25 synaptosomal-associated protein 25 1 1
MIRT015373 Arhgdia Rho GDP dissociation inhibitor (GDI) alpha 1 1
MIRT015374 Hapln1 hyaluronan and proteoglycan link protein 1 1 1
MIRT015375 Senp8 SUMO/sentrin specific peptidase 8 1 1
MIRT015376 Cds2 CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 1 1
MIRT015377 Rbm25 RNA binding motif protein 25 1 1
MIRT015378 Ank3 ankyrin 3, epithelial 1 1
MIRT015379 Zdhhc7 zinc finger, DHHC domain containing 7 1 1
MIRT015380 Cecr2 CECR2, histone acetyl-lysine reader 1 1
MIRT015381 Pcnx pecanex homolog (Drosophila) 1 1
MIRT015382 Ptbp2 polypyrimidine tract binding protein 2 1 1
MIRT015383 Tgfbr2 transforming growth factor, beta receptor II 1 1
MIRT015384 Rnf144a ring finger protein 144A 1 1
MIRT015385 Kcnc1 potassium voltage gated channel, Shaw-related subfamily, member 1 1 1
MIRT015386 Shank2 SH3/ankyrin domain gene 2 1 1
MIRT015387 Vamp3 vesicle-associated membrane protein 3 1 1
MIRT015388 Rapgef6 Rap guanine nucleotide exchange factor (GEF) 6 1 1
MIRT015389 Atf1 activating transcription factor 1 1 1
MIRT015390 Cbln4 cerebellin 4 precursor protein 1 1
MIRT015391 Furin furin (paired basic amino acid cleaving enzyme) 1 1
MIRT015392 Ncor2 nuclear receptor co-repressor 2 1 1
MIRT015393 Carm1 coactivator-associated arginine methyltransferase 1 1 1
MIRT015394 Abcd1 ATP-binding cassette, sub-family D (ALD), member 1 1 1
MIRT015395 Hipk1 homeodomain interacting protein kinase 1 1 1
MIRT015396 Frmd4a FERM domain containing 4A 1 1
MIRT015397 Adamts9 a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 9 1 1
MIRT015398 Rbm24 RNA binding motif protein 24 1 1
MIRT015399 Sacm1l SAC1 suppressor of actin mutations 1-like (yeast) 1 1
MIRT015400 Map6 microtubule-associated protein 6 1 1
MIRT015401 Cxcr4 chemokine (C-X-C motif) receptor 4 1 1
MIRT015402 Lmbrd2 LMBR1 domain containing 2 1 1
MIRT015403 Scn2b sodium channel, voltage-gated, type II, beta 1 1
MIRT015404 Bcl6 B cell leukemia/lymphoma 6 1 1
MIRT015405 Smap2 small ArfGAP 2 1 1
MIRT015406 Rap1b RAS related protein 1b 1 1
MIRT015407 Grhl1 grainyhead-like 1 (Drosophila) 1 1
MIRT015408 Tmc7 transmembrane channel-like gene family 7 1 1
MIRT015409 Pitpnc1 phosphatidylinositol transfer protein, cytoplasmic 1 1 1
MIRT015410 M6pr mannose-6-phosphate receptor, cation dependent 1 1
MIRT015411 AI504432 expressed sequence AI504432 1 1
MIRT015412 Lzts3 leucine zipper, putative tumor suppressor family member 3 1 1
MIRT015413 Mmp16 matrix metallopeptidase 16 1 1
MIRT015414 Ap1s2 adaptor-related protein complex 1, sigma 2 subunit 1 1
MIRT015415 Slc31a2 solute carrier family 31, member 2 1 1
MIRT015416 Asxl3 additional sex combs like 3 (Drosophila) 1 1
MIRT015417 Foxp4 forkhead box P4 1 1
MIRT015418 Lin28b lin-28 homolog B (C. elegans) 1 1
MIRT015419 Nhsl1 NHS-like 1 1 1
MIRT015420 Pxdn peroxidasin 1 1
MIRT015421 Ybx3 Y box protein 3 1 1
MIRT015422 Pvrl1 nectin cell adhesion molecule 1 1 1
MIRT015423 Gfap glial fibrillary acidic protein 1 1
MIRT015424 Elovl5 ELOVL family member 5, elongation of long chain fatty acids (yeast) 1 1
MIRT015425 Elfn2 leucine rich repeat and fibronectin type III, extracellular 2 1 1
MIRT015426 Pacs2 phosphofurin acidic cluster sorting protein 2 1 1
MIRT015427 Prkcb protein kinase C, beta 1 1
MIRT015428 Exoc2 exocyst complex component 2 1 1
MIRT015429 Cdh10 cadherin 10 1 1
MIRT015430 Abr active BCR-related gene 1 1
MIRT015431 Slc38a7 solute carrier family 38, member 7 1 1
MIRT015432 Ggt7 gamma-glutamyltransferase 7 1 1
MIRT015433 Fam219a family with sequence similarity 219, member A 1 1
MIRT015434 Adcyap1r1 adenylate cyclase activating polypeptide 1 receptor 1 1 1
MIRT015435 4931406P16Rik RIKEN cDNA 4931406P16 gene 1 1
MIRT015436 Vps37a vacuolar protein sorting 37A 1 1
MIRT015437 Ptch1 patched 1 1 1
MIRT015438 Lonrf2 LON peptidase N-terminal domain and ring finger 2 1 1
MIRT015439 Hs6st1 heparan sulfate 6-O-sulfotransferase 1 1 1
MIRT015440 Hist3h2ba histone cluster 3, H2ba 1 1
MIRT015441 Csrnp2 cysteine-serine-rich nuclear protein 2 1 1
MIRT015442 Tef thyrotroph embryonic factor 1 1
MIRT015443 Pnma2 paraneoplastic antigen MA2 1 1
MIRT015444 Gucy1b3 guanylate cyclase 1, soluble, beta 3 1 1
MIRT015445 Wdr37 WD repeat domain 37 1 1
MIRT015446 Vbp1 von Hippel-Lindau binding protein 1 1 1
MIRT015447 Cxxc5 CXXC finger 5 1 1
MIRT015448 Opn3 opsin 3 1 1
MIRT015449 Ror2 receptor tyrosine kinase-like orphan receptor 2 1 1
MIRT015450 Sfrp1 secreted frizzled-related protein 1 1 1
MIRT015451 Fem1c fem-1 homolog c (C.elegans) 1 1
MIRT015452 Abhd10 abhydrolase domain containing 10 1 1
MIRT015453 Eaf1 ELL associated factor 1 1 1
MIRT015454 Smc2 structural maintenance of chromosomes 2 1 1
MIRT015455 Hecw2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT015456 Grin2b glutamate receptor, ionotropic, NMDA2B (epsilon 2) 1 1
MIRT015457 Ankrd63 ankyrin repeat domain 63 1 1
MIRT015458 Dhcr24 24-dehydrocholesterol reductase 1 1
MIRT015459 Scrn1 secernin 1 1 1
MIRT015460 Polr3k polymerase (RNA) III (DNA directed) polypeptide K 1 1
MIRT015461 Trim25 tripartite motif-containing 25 1 1
MIRT015462 Morc2a microrchidia 2A 1 1
MIRT015463 Usp46 ubiquitin specific peptidase 46 1 1
MIRT015464 Clp1 CLP1, cleavage and polyadenylation factor I subunit 1 1
MIRT015465 Prkar2a protein kinase, cAMP dependent regulatory, type II alpha 1 1
MIRT015466 Ctnnb1 catenin (cadherin associated protein), beta 1 1 1
MIRT015467 Specc1l sperm antigen with calponin homology and coiled-coil domains 1-like 1 1
MIRT015468 Pcmtd2 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 1 1
MIRT015469 Sestd1 SEC14 and spectrin domains 1 1 1
MIRT015470 Fnip1 folliculin interacting protein 1 1 1
MIRT015471 Nf1 neurofibromin 1 1 1
MIRT015472 Adam11 a disintegrin and metallopeptidase domain 11 1 1
MIRT015473 Rab9b RAB9B, member RAS oncogene family 1 1
MIRT015474 Mdga2 MAM domain containing glycosylphosphatidylinositol anchor 2 1 1
MIRT015475 Creb1 cAMP responsive element binding protein 1 1 1
MIRT015476 Ankrd12 ankyrin repeat domain 12 1 1
MIRT015477 Esyt2 extended synaptotagmin-like protein 2 1 1
MIRT015478 Ttyh2 tweety family member 2 1 1
MIRT015479 Antxr2 anthrax toxin receptor 2 1 1
MIRT015480 Kmt2a lysine (K)-specific methyltransferase 2A 1 1
MIRT015481 Nr2c1 nuclear receptor subfamily 2, group C, member 1 1 1
MIRT015482 B4galt1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 1 1
MIRT015483 Tmed8 transmembrane p24 trafficking protein 8 1 1
MIRT015484 Kcns2 K+ voltage-gated channel, subfamily S, 2 1 1
MIRT015485 Wnk1 WNK lysine deficient protein kinase 1 1 1
MIRT015486 Dbt dihydrolipoamide branched chain transacylase E2 1 1
MIRT015487 Tanc2 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2 1 1
MIRT015488 Dmtf1 cyclin D binding myb-like transcription factor 1 1 1
MIRT015489 Abca1 ATP-binding cassette, sub-family A (ABC1), member 1 1 1
MIRT015490 Zic3 zinc finger protein of the cerebellum 3 1 1
MIRT015491 Kif21a kinesin family member 21A 1 1
MIRT015492 Dock9 dedicator of cytokinesis 9 1 1
MIRT015493 Lphn3 adhesion G protein-coupled receptor L3 1 1
MIRT015494 Slc1a1 solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1 1 1
MIRT015495 Rundc3b RUN domain containing 3B 1 1
MIRT015496 Padi2 peptidyl arginine deiminase, type II 1 1
MIRT015497 2700089E24Rik small integral membrane protein 10 like 1 1 1
MIRT015498 Impa1 inositol (myo)-1(or 4)-monophosphatase 1 1 1
MIRT015499 Plbd2 phospholipase B domain containing 2 1 1
MIRT015500 Tln2 talin 2 1 1
MIRT015501 Gm12258 predicted gene 12258 1 1
MIRT015502 Cdk13 cyclin-dependent kinase 13 1 1
MIRT015503 Sec31a Sec31 homolog A (S. cerevisiae) 1 1
MIRT015504 Zfp282 zinc finger protein 282 1 1
MIRT015505 Slc12a5 solute carrier family 12, member 5 1 1
MIRT015506 Ppm1l protein phosphatase 1 (formerly 2C)-like 1 1
MIRT015507 Zfhx3 zinc finger homeobox 3 1 1
MIRT015508 Tnks tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 1 1
MIRT015509 Kcnh5 potassium voltage-gated channel, subfamily H (eag-related), member 5 1 1
MIRT015510 Tmem136 transmembrane protein 136 1 1
MIRT015511 Nptx1 neuronal pentraxin 1 1 1
MIRT015512 Clip1 CAP-GLY domain containing linker protein 1 1 1
MIRT015513 Cdc73 cell division cycle 73, Paf1/RNA polymerase II complex component 1 1
MIRT015514 Maea macrophage erythroblast attacher 1 1
MIRT015515 Zzz3 zinc finger, ZZ domain containing 3 1 1
MIRT015516 Armcx2 armadillo repeat containing, X-linked 2 1 1
MIRT015517 Dnajc14 DnaJ heat shock protein family (Hsp40) member C14 1 1
MIRT015518 Ube3c ubiquitin protein ligase E3C 1 1
MIRT015519 Erc2 ELKS/RAB6-interacting/CAST family member 2 1 1
MIRT015520 Tmem109 transmembrane protein 109 1 1
MIRT015521 Acly ATP citrate lyase 1 1
MIRT015522 Thrsp thyroid hormone responsive 1 1
MIRT015523 Mapt microtubule-associated protein tau 1 1
MIRT015524 St8sia3 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3 1 1
MIRT015525 Hpcal4 hippocalcin-like 4 1 1
MIRT015526 Rad9b RAD9 checkpoint clamp component B 1 1
MIRT015527 Klf8 Kruppel-like factor 8 1 1
MIRT015528 Ccnf cyclin F 1 1
MIRT015529 Psme4 proteasome (prosome, macropain) activator subunit 4 1 1
MIRT015530 Fam43a family with sequence similarity 43, member A 1 1
MIRT015531 Efnb2 ephrin B2 1 1
MIRT015532 Unk unkempt family zinc finger 1 1
MIRT015533 Rfx7 regulatory factor X, 7 1 1
MIRT015534 Gria2 glutamate receptor, ionotropic, AMPA2 (alpha 2) 1 1
MIRT015535 Atp2b3 ATPase, Ca++ transporting, plasma membrane 3 1 1
MIRT015536 Zbtb24 zinc finger and BTB domain containing 24 1 1
MIRT015537 Nelfb negative elongation factor complex member B 1 1
MIRT015538 Elmod3 ELMO/CED-12 domain containing 3 1 1
MIRT015539 Zcchc14 zinc finger, CCHC domain containing 14 1 1
MIRT015540 N28178 PHD finger protein 24 1 1
MIRT015541 Pds5b PDS5 cohesin associated factor B 1 1
MIRT015542 Atp1a2 ATPase, Na+/K+ transporting, alpha 2 polypeptide 1 1
MIRT015543 Mmd monocyte to macrophage differentiation-associated 1 1
MIRT015544 Ttyh3 tweety family member 3 1 1
MIRT015545 Dlg4 discs, large homolog 4 (Drosophila) 1 1
MIRT015546 Ccdc91 coiled-coil domain containing 91 1 1
MIRT015547 Eef1d eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) 1 1
MIRT015548 Stat2 signal transducer and activator of transcription 2 1 1
MIRT015549 Tomm6 translocase of outer mitochondrial membrane 6 homolog (yeast) 1 1
MIRT015550 Myo10 myosin X 1 1
MIRT015551 Zbed3 zinc finger, BED type containing 3 1 1
MIRT015552 Wtip WT1-interacting protein 1 1
MIRT015553 Nup50 nucleoporin 50 1 1
MIRT015554 Smyd1 SET and MYND domain containing 1 1 1
MIRT015555 Zfp275 zinc finger protein 275 1 1
MIRT015556 Tsc1 tuberous sclerosis 1 1 1
MIRT015557 Rasgrp1 RAS guanyl releasing protein 1 1 1
MIRT015558 Srrm2 serine/arginine repetitive matrix 2 1 1
MIRT015559 Uvssa UV stimulated scaffold protein A 1 1
MIRT015560 Surf6 surfeit gene 6 1 1
MIRT015561 Elovl6 ELOVL family member 6, elongation of long chain fatty acids (yeast) 1 1
MIRT015562 Myo18a myosin XVIIIA 1 1
MIRT015563 Nos1 nitric oxide synthase 1, neuronal 1 1
MIRT015564 Syne1 spectrin repeat containing, nuclear envelope 1 1 1
MIRT015565 Tram1 translocating chain-associating membrane protein 1 1 1
MIRT015566 Adamts3 a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 3 1 1
MIRT015567 Syt11 synaptotagmin XI 1 1
MIRT015568 Epm2aip1 EPM2A (laforin) interacting protein 1 1 1
MIRT015569 Gnai1 guanine nucleotide binding protein (G protein), alpha inhibiting 1 1 1
MIRT015570 Psd3 pleckstrin and Sec7 domain containing 3 1 1
MIRT015571 Flnb filamin, beta 1 1
MIRT015572 Agfg1 ArfGAP with FG repeats 1 1 1
MIRT015573 Reep5 receptor accessory protein 5 1 1
MIRT015574 Kalrn kalirin, RhoGEF kinase 1 1
MIRT015575 Chl1 cell adhesion molecule L1-like 1 1
MIRT015576 Megf9 multiple EGF-like-domains 9 1 1
MIRT015577 Fstl1 follistatin-like 1 1 1
MIRT015578 Ctdsp2 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2 1 1
MIRT015579 Bsn bassoon 1 1
MIRT015580 Fbxw11 F-box and WD-40 domain protein 11 1 1
MIRT015581 Bche butyrylcholinesterase 1 1
MIRT015582 Creb3l2 cAMP responsive element binding protein 3-like 2 1 1
MIRT015583 Celsr2 cadherin, EGF LAG seven-pass G-type receptor 2 1 1
MIRT015584 Atp8a1 ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1 1 1
MIRT015585 Flt1 FMS-like tyrosine kinase 1 1 1
MIRT015586 Slc6a6 solute carrier family 6 (neurotransmitter transporter, taurine), member 6 1 1
MIRT015587 Klf7 Kruppel-like factor 7 (ubiquitous) 1 1
MIRT015588 Rgs7bp regulator of G-protein signalling 7 binding protein 1 1
MIRT015589 Tubgcp4 tubulin, gamma complex associated protein 4 1 1
MIRT015590 Prps2 phosphoribosyl pyrophosphate synthetase 2 1 1
MIRT015591 Wipf1 WAS/WASL interacting protein family, member 1 1 1
MIRT015592 Wasf2 WAS protein family, member 2 1 1
MIRT015593 C1ql3 C1q-like 3 1 1
MIRT015594 Psen1 presenilin 1 1 1
MIRT015595 Elmod2 ELMO/CED-12 domain containing 2 1 1
MIRT015596 Fbxl16 F-box and leucine-rich repeat protein 16 1 1
MIRT015597 Rassf3 Ras association (RalGDS/AF-6) domain family member 3 1 2
MIRT015598 Nek9 NIMA (never in mitosis gene a)-related expressed kinase 9 1 1
MIRT015599 Nedd4 neural precursor cell expressed, developmentally down-regulated 4 1 1
MIRT015600 Dusp6 dual specificity phosphatase 6 1 1
MIRT015601 Dact3 dishevelled-binding antagonist of beta-catenin 3 1 1
MIRT015602 Aatk apoptosis-associated tyrosine kinase 1 1
MIRT015603 Fyttd1 forty-two-three domain containing 1 1 1
MIRT015604 Chst15 carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15 1 1
MIRT015605 Zbtb41 zinc finger and BTB domain containing 41 1 1
MIRT015606 Colec12 collectin sub-family member 12 1 1
MIRT015607 Erg ETS transcription factor 1 2
MIRT015608 Lrig2 leucine-rich repeats and immunoglobulin-like domains 2 1 1
MIRT015609 Adam10 a disintegrin and metallopeptidase domain 10 1 1
MIRT015610 Slc9a1 solute carrier family 9 (sodium/hydrogen exchanger), member 1 1 1
MIRT015611 Tenm4 teneurin transmembrane protein 4 1 1
MIRT015612 Zkscan1 zinc finger with KRAB and SCAN domains 1 1 1
MIRT015613 Ank2 ankyrin 2, brain 1 1
MIRT015614 Acer3 alkaline ceramidase 3 1 1
MIRT015615 Snx25 sorting nexin 25 1 1
MIRT015616 Cpeb2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT015617 Foxn2 forkhead box N2 1 1
MIRT438393 Camkk2 calcium/calmodulin-dependent protein kinase kinase 2, beta 2 1
MIRT577729 Slc10a2 solute carrier family 10, member 2 1 5
MIRT580388 Slc35g1 solute carrier family 35, member G1 1 1
MIRT580705 Stam2 signal transducing adaptor molecule (SH3 domain and ITAM motif) 2 1 1
MIRT580785 Sos1 son of sevenless homolog 1 (Drosophila) 1 1
MIRT580937 Slc30a7 solute carrier family 30 (zinc transporter), member 7 1 1
MIRT592815 Bcl2l11 BCL2-like 11 (apoptosis facilitator) 1 1
MIRT599887 Acer1 alkaline ceramidase 1 1 1
MIRT600715 Ky kyphoscoliosis peptidase 1 1
MIRT601064 Cdc14b CDC14 cell division cycle 14B 1 1
MIRT603126 Utp23 UTP23 small subunit processome component 1 1
MIRT603356 Slc14a2 solute carrier family 14 (urea transporter), member 2 1 1
MIRT603869 Ilvbl ilvB (bacterial acetolactate synthase)-like 1 1
MIRT605494 Slc16a7 solute carrier family 16 (monocarboxylic acid transporters), member 7 1 1
MIRT606672 Fbxl17 F-box and leucine-rich repeat protein 17 1 1
MIRT755882 Cdh1 cadherin 1 1 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-9 Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-9 Ethanol NULL 702 Microarray fetal mouse brains 19091803 2009 up-regulated
miR-9 Atorvastatin approved 60823 Quantitative real-time PCR Cardiomyocyte 23860036 2013 down-regualted
miR-9 Ethanol NULL 702 Quantitative real-time PCR Cerebellar Granule Neurons cells 24554719 2014 down-regulated
miR-9 Glucose NULL 5793 Microarray endothelial cells 24394957 2014 up-regulated
miR-9 Iron-sulfates and Aluminum-sulfates NULL NULL Northern blot human neural cells 17629564 2007 up-regulated
miR-9 17beta-estradiol (E2) approved 5757 Microarray MCF-7 breast cancer cells 19528081 2009 down-regulated
miR-9 N-(4-hydroxyphenyl)-retinamide (4HPR) NULL 5288209 Quantitative real-time PCR human retinal pigment epithelial (ARPE-19) cells 20806079 2010 up-regulated
miR-9 Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-9 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-9 Sulindac sulfide approved 5352624 Quantitative real-time PCR HCT116 colon tumor cells 22286762 2012 down-regulated
miR-9 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-9 Bicalutamide approved 2375 Microarray prostate 22674191 2012 down-regulated
miR-9 Goserelin approved 47725 Microarray prostate 22674191 2012 down-regulated
miR-9 Temozolomide approved 5394 Quantitative real-time PCR glioblastoma cells. 22722712 2012 down-regulated
miR-9 All-trans-retinoic acid (ATRA) approved 444795 Northern blot spina bifida rat fetus 17962954 2007 down-regulated
miR-9 Longevinex NULL NULL Quantitative real-time PCR ischemia/reperfusion [I/R] rat model 21203465 2011 down-regulated
miR-9 Longevinex NULL NULL Quantitative real-time PCR normal heart 21203465 2011 up-regulated
miR-9 Resveratrol NULL 445154 Quantitative real-time PCR ischemia/reperfusion [I/R] rat model 21203465 2011 down-regulated
miR-9 Resveratrol NULL 445154 Quantitative real-time PCR normal heart 21203465 2011 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
mmu-miR-9-5p Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer tissue and cell line (C13, OV2008, A2780)
mmu-miR-9-5p Rucaparib phosphate 9931953 sensitive Low Ovarian Cancer tissue and cell line (C13)

Error report submission