| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-let-7d |
| Genomic Coordinates | chr9: 94178834 - 94178920 |
| Synonyms | LET7D, MIRNLET7D, hsa-let-7d, let-7d, MIRLET7D |
| Description | Homo sapiens let-7d stem-loop |
| Comment | The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies . |
| RNA Secondary Structure |  |
| Associated Diseases |  |
| Mature miRNA Information | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-let-7d-5p | ||||||||||||||
| Sequence | 8| AGAGGUAGUAGGUUGCAUAGUU |29 | ||||||||||||||
| Evidence | Experimental | ||||||||||||||
| Experiments | Cloned | ||||||||||||||
| Editing Events in miRNAs |
|
||||||||||||||
| SNPs in miRNA |
|
||||||||||||||
| Putative Targets | |||||||||||||||
| miRNA Expression profile | |
|---|---|
| Human miRNA Tissue Atlas | |
| miRNAs in Extracellular Vesicles |
|
| Circulating MicroRNA Expression Profiling | |
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | HMGA2 | ||||||||||||||||||||
| Synonyms | BABL, HMGI-C, HMGIC, LIPO, STQTL9 | ||||||||||||||||||||
| Description | high mobility group AT-hook 2 | ||||||||||||||||||||
| Transcript | NM_003483 | ||||||||||||||||||||
| Other Transcripts | NM_003484 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on HMGA2 | |||||||||||||||||||||
| 3'UTR of HMGA2 (miRNA target sites are highlighted) |
>HMGA2|NM_003483|3'UTR 1 GGGGCGCCAACGTTCGATTTCTACCTCAGCAGCAGTTGGATCTTTTGAAGGGAGAAGACACTGCAGTGACCACTTATTCT 81 GTATTGCCATGGTCTTTCCACTTTCATCTGGGGTGGGGTGGGGTGGGGTGGGGGAGGGGGGGGTGGGGTGGGGAGAAATC 161 ACATAACCTTAAAAAGGACTATATTAATCACCTTCTTTGTAATCCCTTCACAGTCCCAGGTTTAGTGAAAAACTGCTGTA 241 AACACAGGGGACACAGCTTAACAATGCAACTTTTAATTACTGTTTTCTTTTTTCTTAACCTACTAATAGTTTGTTGATCT 321 GATAAGCAAGAGTGGGCGGGTGAGAAAAACCGAATTGGGTTTAGTCAATCACTGCACTGCATGCAAACAAGAAACGTGTC 401 ACACTTGTGACGTCGGGCATTCATATAGGAAGAACGCGGTGTGTAACACTGTGTACACCTCAAATACCACCCCAACCCAC 481 TCCCTGTAGTGAATCCTCTGTTTAGAACACCAAAGATAAGGACTAGATACTACTTTCTCTTTTTCGTATAATCTTGTAGA 561 CACTTACTTGATGATTTTTAACTTTTTATTTCTAAATGAGACGAAATGCTGATGTATCCTTTCATTCAGCTAACAAACTA 641 GAAAAGGTTATGTTCATTTTTCAAAAAGGGAAGTAAGCAAACAAATATTGCCAACTCTTCTATTTATGGATATCACACAT 721 ATCAGCAGGAGTAATAAATTTACTCACAGCACTTGTTTTCAGGACAACACTTCATTTTCAGGAAATCTACTTCCTACAGA 801 GCCAAAATGCCATTTAGCAATAAATAACACTTGTCAGCCTCAGAGCATTTAAGGAAACTAGACAAGTAAAATTATCCTCT 881 TTGTAATTTAATGAAAAGGTACAACAGAATAATGCATGATGAACTCACCTAATTATGAGGTGGGAGGAGCGAAATCTAAA 961 TTTCTTTTGCTATAGTTATACATCAATTTAAAAAGCAAAAAAAAAAAAGGGGGGGGCAATCTCTCTCTGTGTCTTTCTCT 1041 CTCTCTCTTCCTCTCCCTCTCTCTTTTCATTGTGTATCAGTTTCCATGAAAGACCTGAATACCACTTACCTCAAATTAAG 1121 CATATGTGTTACTTCAAGTAATACGTTTTGACATAAGATGGTTGACCAAGGTGCTTTTCTTCGGCTTGAGTTCACCATCT 1201 CTTCATTCAAACTGCACTTTTAGCCAGAGATGCAATATATCCCCACTACTCAATACTACCTCTGAATGTTACAACGAATT 1281 TACAGTCTAGTACTTATTACATGCTGCTATACACAAGCAATGCAAGAAAAAAACTTACTGGGTAGGTGATTCTAATCATC 1361 TGCAGTTCTTTTTGTACACTTAATTACAGTTAAAGAAGCAATCTCCTTACTGTGTTTCAGCATGACTATGTATTTTTCTA 1441 TGTTTTTTTAATTAAAAATTTTTAAAATACTTGTTTCAGCTTCTCTGCTAGATTTCTACATTAACTTGAAAATTTTTTAA 1521 CCAAGTCGCTCCTAGGTTCTTAAGGATAATTTTCCTCAATCACACTACACATCACACAAGATTTGACTGTAATATTTAAA 1601 TATTACCCTCCAAGTCTGTACCTCAAATGAATTCTTTAAGGAGATGGACTAATTGACTTGCAAAGACCTACCTCCAGACT 1681 TCAAAAGGAATGAACTTGTTACTTGCAGCATTCATTTGTTTTTTCAATGTTTGAAATAGTTCAAACTGCAGCTAACCCTA 1761 GTCAAAACTATTTTTGTAAAAGACATTTGATAGAAAGGAACACGTTTTTACATACTTTTGCAAAATAAGTAAATAATAAA 1841 TAAAATAAAAGCCAACCTTCAAAGAAACTTGAAGCTTTGTAGGTGAGATGCAACAAGCCCTGCTTTTGCATAATGCAATC 1921 AAAAATATGTGTTTTTAAGATTAGTTGAATATAAGAAAATGCTTGACAAATATTTTCATGTATTTTACACAAATGTGATT 2001 TTTGTAATATGTCTCAACCAGATTTATTTTAAACGCTTCTTATGTAGAGTTTTTATGCCTTTCTCTCCTAGTGAGTGTGC 2081 TGACTTTTTAACATGGTATTATCAACTGGGCCAGGAGGTAGTTTCTCATGACGGCTTTTGTCAGTATGGCTTTTAGTACT 2161 GAAGCCAAATGAAACTCAAAACCATCTCTCTTCCAGCTGCTTCAGGGAGGTAGTTTCAAAGGCCACATACCTCTCTGAGA 2241 CTGGCAGATCGCTCACTGTTGTGAATCACCAAAGGAGCTATGGAGAGAATTAAAACTCAACATTACTGTTAACTGTGCGT 2321 TAAATAAGCAAATAAACAGTGGCTCATAAAAATAAAAGTCGCATTCCATATCTTTGGATGGGCCTTTTAGAAACCTCATT 2401 GGCCAGCTCATAAAATGGAAGCAATTGCTCATGTTGGCCAAACATGGTGCACCGAGTGATTTCCATCTCTGGTAAAGTTA 2481 CACTTTTATTTCCTGTATGTTGTACAATCAAAACACACTACTACCTCTTAAGTCCCAGTATACCTCATTTTTCATACTGA 2561 AAAAAAAAGCTTGTGGCCAATGGAACAGTAAGAACATCATAAAATTTTTATATATATAGTTTATTTTTGTGGGAGATAAA 2641 TTTTATAGGACTGTTCTTTGCTGTTGTTGGTCGCAGCTACATAAGACTGGACATTTAACTTTTCTACCATTTCTGCAAGT 2721 TAGGTATGTTTGCAGGAGAAAAGTATCAAGACGTTTAACTGCAGTTGACTTTCTCCCTGTTCCTTTGAGTGTCTTCTAAC 2801 TTTATTCTTTGTTCTTTATGTAGAATTGCTGTCTATGATTGTACTTTGAATCGCTTGCTTGTTGAAAATATTTCTCTAGT 2881 GTATTATCACTGTCTGTTCTGCACAATAAACATAACAGCCTCTGTGATCCCCATGTGTTTTGATTCCTGCTCTTTGTTAC 2961 AGTTCCATTAAATGAGTAATAAAGTTTGGTCAAAACAGAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | 293-TN |
| Location of target site | 3'UTR |
| Tools used in this research | miRNAviewer , TargetScan , PicTar |
| Original Description (Extracted from the article) |
...
Both let-7d and let-7g caused significant repression of luciferase activity of full-length 3`UTR as well as the 6/7 fragment
... - Shell S; Park SM; Radjabi AR; Schickel R; et al., 2007, Proceedings of the National Academy of Sciences of the United States of America. |
| Article |
- Shell S; Park SM; Radjabi AR; Schickel R; et al. - Proceedings of the National Academy of Sciences of the United States of America, 2007
The early phases of carcinogenesis resemble embryonic development, often involving the reexpression of embryonic mesenchymal genes. The NCI60 panel of human tumor cell lines can genetically be subdivided into two superclusters (SCs) that correspond to CD95 Type I and II cells. SC1 cells are characterized by a mesenchymal and SC2 cells by an epithelial gene signature, suggesting that SC1 cells represent less differentiated, advanced stages of cancer. miRNAs are small 20- to 22-nucleotide-long noncoding RNAs that inhibit gene expression at the posttranscriptional level. By performing miRNA expression analysis on 10 Type I and 10 Type II cells, we have determined that SC1 cells express low and SC2 cells high levels of the miRNA let-7, respectively, suggesting that let-7 is a marker for less advanced cancers. Expression of the let-7 target high-mobility group A2 (HMGA2), an early embryonic gene, but not of classical epithelial or mesenchymal markers such as E-cadherin or vimentin, inversely correlated with let-7 expression in SC1 and SC2 cells. Using ovarian cancer as a model, we demonstrate that expression of let-7 and HMGA2 is a better predictor of prognosis than classical markers such as E-cadherin, vimentin, and Snail. These data identify loss of let-7 expression as a marker for less differentiated cancer.
LinkOut: [PMID: 17600087]
|
| Experimental Support 2 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HeyA8 , HepG2 |
| Original Description (Extracted from the article) |
...
introduction of let芒鈧鈥7d into HeyA8 or HepG2 cells resulted in reduction of HMGA2 protein expression.
... - Park SM; Shell S; Radjabi AR; Schickel R; et al., 2007, Cell cycle (Georgetown, Tex.). |
| Article |
- Park SM; Shell S; Radjabi AR; Schickel R; et al. - Cell cycle (Georgetown, Tex.), 2007
The microRNA let-7 regulates late embryonic development by suppressing expression of a number of genes such as c-myc and RAS as well as the embryonic gene high mobility group, A2 (HMGA2). We now demonstrate that HMGA2 is more efficiently targeted by let-7 than RAS. Its expression inversely correlates with the expression of let-7 in the NCI60 cells lines, and the expression of RAS does not change when amounts of let-7 that efficiently silence expression of HMGA2 are introduced into tumor cells. We did not find a difference in the expression of HMGA2 between primary ovarian cancer samples and matching metastases, suggesting that the expression of HMGA2 represents an early event during cancer progression. The late repression of HMGA2 by let-7 during embryonic development, and the early reexpression of HMGA2 during cancer development, is in line with the hypothesis that cancer development represents a case of reverse embryogenesis.
LinkOut: [PMID: 17957144]
|
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
| Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | A549 |
| Disease | MIMAT0000065 |
| Location of target site | 3'UTR |
| Original Description (Extracted from the article) |
...
"In this study we determine that let-7d
... - Pandit KV; Corcoran D; Yousef H; Yarlagadda et al., 2010, American journal of respiratory and critical care medicine. |
| Article |
- Pandit KV; Corcoran D; Yousef H; Yarlagadda et al. - American journal of respiratory and critical care medicine, 2010
RATIONALE: Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive, and usually lethal fibrotic lung disease characterized by profound changes in epithelial cell phenotype and fibroblast proliferation. OBJECTIVES: To determine changes in expression and role of microRNAs in IPF. METHODS: RNA from 10 control and 10 IPF tissues was hybridized on Agilent microRNA microarrays and results were confirmed by quantitative real-time polymerase chain reaction and in situ hybridization. SMAD3 binding to the let-7d promoter was confirmed by chromatin immunoprecipitation, electrophoretic mobility shift assay, luciferase assays, and reduced expression of let-7d in response to transforming growth factor-beta. HMGA2, a let-7d target, was localized by immunohistochemistry. In mice, let-7d was inhibited by intratracheal administration of a let-7d antagomir and its effects were determined by immunohistochemistry, immunofluorescence, quantitative real-time polymerase chain reaction, and morphometry. MEASUREMENTS AND MAIN RESULTS: Eighteen microRNAs including let-7d were significantly decreased in IPF. Transforming growth factor-beta down-regulated let-7d expression, and SMAD3 binding to the let-7d promoter was demonstrated. Inhibition of let-7d caused increases in mesenchymal markers N-cadherin-2, vimentin, and alpha-smooth muscle actin (ACTA2) as well as HMGA2 in multiple epithelial cell lines. let-7d was significantly reduced in IPF lungs and the number of epithelial cells expressing let-7d correlated with pulmonary functions. HMGA2 was increased in alveolar epithelial cells of IPF lungs. let-7d inhibition in vivo caused alveolar septal thickening and increases in collagen, ACTA2, and S100A4 expression in SFTPC (pulmonary-associated surfactant protein C) expressing alveolar epithelial cells. CONCLUSIONS: Our results indicate a role for microRNAs in IPF. The down-regulation of let-7d in IPF and the profibrotic effects of this down-regulation in vitro and in vivo suggest a key regulatory role for this microRNA in preventing lung fibrosis. Clinical trial registered with www.clinicaltrials.gov (NCT 00258544).
LinkOut: [PMID: 20395557]
|
| Experimental Support 5 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 8091.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"HITS-CLIP data was present in GSM714642. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
| Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
| Experimental Support 6 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | MCF 7 |
| Disease | 8091.0 |
| Location of target site | 3'UTR |
| Original Description (Extracted from the article) |
...
"HMGA2 was recently identi茂卢聛ed as a target gene of let-7
... - Guo L; Chen C; Shi M; Wang F; Chen X; Diao et al., 2013, Oncogene. |
| Article |
- Guo L; Chen C; Shi M; Wang F; Chen X; Diao et al. - Oncogene, 2013
Inflammation can act as a crucial mediator of epithelial-to-mesenchymal transition (EMT). In this study, we show that oncostatin M (OSM) is expressed in an autocrine/paracrine fashion in invasive breast carcinoma. OSM stimulation promotes spontaneous lung metastasis of MCF-7 xenografts in nude mice. A conspicuous epigenetic transition was induced by OSM stimulation not only in breast cancer cell lines but also in MCF-7 xenografts in nude mice. The expression of miR-200 and let-7 family members in response to OSM stimulation was downregulated in a signal transducer and activator of transcription factor 3 (Stat3)-dependent manner, resulting in comprehensive alterations of the transcription factors and oncoproteins targeted by these microRNAs. Inhibition of Stat3 activation or the ectopic expression of let-7 and miR-200 effectively reversed the mesenchymal phenotype of breast cancer cells. Stat3 promotes the transcription of Lin-28 by directly binding to the Lin-28 promoter, resulting in the repression of let-7 expression and concomitant upregulation of the let-7 target, high-mobility group A protein 2 (HMGA2). Knock down of HMGA2 significantly impairs OSM-driven EMT. Our data indicate that downregulation of let-7 and miR-200 levels initiates and maintains OSM-induced EMT phenotypes, and HMGA2 acts as a master switch of OSM-induced EMT. These findings highlight the importance of Stat3-coordinated Lin-28B-let-7-HMGA2 and miR-200-ZEB1 circuits in the cytokine-mediated phenotypic reprogramming of breast cancer cells.
LinkOut: [PMID: 23318420]
|
| Experimental Support 7 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HCT116 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177629. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_4_7
PAR-CLIP data was present in ERX177600. RNA binding protein: AGO2. Condition:p53_V_Ago_CLIP_2_2
PAR-CLIP data was present in ERX177624. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_2
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
| Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
| CLIP-seq Support 1 for dataset GSM714642 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repA |
| Location of target site | ENST00000403681.2 | 3UTR | UACAAUCAAAACACACUACUACCUCUUAAG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM545212 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000403681.2 | 3UTR | UACAAUCAAAACACACUACUACCUCUUAAGUC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | |||||||
|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
370 hsa-let-7d-5p Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT000401 | BDNF | brain derived neurotrophic factor |  |
1 | 1 | |||||||
| MIRT000402 | CDK6 | cyclin dependent kinase 6 | |
1 | 1 | |||||||
| MIRT000403 | CDC25A | cell division cycle 25A | |
1 | 1 | |||||||
| MIRT000405 | BCL2 | BCL2, apoptosis regulator | |
1 | 1 | |||||||
| MIRT000406 | KRAS | KRAS proto-oncogene, GTPase | |
1 | 1 | |||||||
| MIRT002005 | HMGA2 | high mobility group AT-hook 2 | |
|
|
|
|
|
6 | 8 | ||
| MIRT003901 | APP | amyloid beta precursor protein | |
|
2 | 1 | ||||||
| MIRT004347 | DICER1 | dicer 1, ribonuclease III | |
|
|
3 | 1 | |||||
| MIRT004505 | SLC11A2 | solute carrier family 11 member 2 | |
|
|
|
|
|
6 | 5 | ||
| MIRT005549 | PDGFA | platelet derived growth factor subunit A | |
|
|
3 | 1 | |||||
| MIRT006398 | IL13 | interleukin 13 | |
|
2 | 1 | ||||||
| MIRT006406 | MPL | MPL proto-oncogene, thrombopoietin receptor | |
1 | 1 | |||||||
| MIRT032101 | RABGAP1L | RAB GTPase activating protein 1 like | |
1 | 1 | |||||||
| MIRT032102 | DRD3 | dopamine receptor D3 | |
1 | 1 | |||||||
| MIRT032103 | SMOX | spermine oxidase | |
1 | 1 | |||||||
| MIRT032104 | DAD1 | defender against cell death 1 | |
1 | 1 | |||||||
| MIRT032105 | EIF4G2 | eukaryotic translation initiation factor 4 gamma 2 | |
|
|
3 | 5 | |||||
| MIRT032106 | CALCOCO2 | calcium binding and coiled-coil domain 2 | |
1 | 1 | |||||||
| MIRT032107 | GPR63 | G protein-coupled receptor 63 | |
1 | 1 | |||||||
| MIRT032108 | FAM135A | family with sequence similarity 135 member A | |
1 | 1 | |||||||
| MIRT032109 | CPNE1 | copine 1 | |
1 | 1 | |||||||
| MIRT032110 | NR4A1 | nuclear receptor subfamily 4 group A member 1 | |
1 | 1 | |||||||
| MIRT032111 | BUB3 | BUB3, mitotic checkpoint protein | |
1 | 1 | |||||||
| MIRT032112 | TBC1D9B | TBC1 domain family member 9B | |
1 | 1 | |||||||
| MIRT032113 | LARP4B | La ribonucleoprotein domain family member 4B | |
1 | 1 | |||||||
| MIRT032114 | NAA20 | N(alpha)-acetyltransferase 20, NatB catalytic subunit | |
|
2 | 3 | ||||||
| MIRT032115 | FBXO3 | F-box protein 3 | |
1 | 1 | |||||||
| MIRT032116 | ZNF763 | zinc finger protein 763 | |
1 | 1 | |||||||
| MIRT032117 | PCNP | PEST proteolytic signal containing nuclear protein | |
1 | 1 | |||||||
| MIRT032118 | HOMER1 | homer scaffolding protein 1 | |
1 | 1 | |||||||
| MIRT032119 | RBM12 | RNA binding motif protein 12 | |
1 | 1 | |||||||
| MIRT032120 | KMT2A | lysine methyltransferase 2A | |
1 | 1 | |||||||
| MIRT032121 | CBR4 | carbonyl reductase 4 | |
1 | 1 | |||||||
| MIRT032122 | THBS1 | thrombospondin 1 | |
|
2 | 4 | ||||||
| MIRT032123 | TLE4 | transducin like enhancer of split 4 | |
1 | 1 | |||||||
| MIRT032124 | TOMM20 | translocase of outer mitochondrial membrane 20 | |
1 | 1 | |||||||
| MIRT032125 | TMED4 | transmembrane p24 trafficking protein 4 | |
1 | 1 | |||||||
| MIRT032126 | AKAP8 | A-kinase anchoring protein 8 | |
|
2 | 4 | ||||||
| MIRT032127 | TST | thiosulfate sulfurtransferase | |
1 | 1 | |||||||
| MIRT032128 | GPR137B | G protein-coupled receptor 137B | |
1 | 1 | |||||||
| MIRT032129 | RALGAPB | Ral GTPase activating protein non-catalytic beta subunit | |
1 | 1 | |||||||
| MIRT032130 | IGF2BP3 | insulin like growth factor 2 mRNA binding protein 3 | |
|
2 | 4 | ||||||
| MIRT032131 | RPUSD2 | RNA pseudouridylate synthase domain containing 2 | |
1 | 1 | |||||||
| MIRT032132 | ZBTB24 | zinc finger and BTB domain containing 24 | |
1 | 1 | |||||||
| MIRT032133 | SPATA2 | spermatogenesis associated 2 | |
1 | 1 | |||||||
| MIRT032134 | GOLT1B | golgi transport 1B | |
1 | 1 | |||||||
| MIRT032135 | ERC1 | ELKS/RAB6-interacting/CAST family member 1 | |
1 | 1 | |||||||
| MIRT032136 | SREK1IP1 | SREK1 interacting protein 1 | |
1 | 1 | |||||||
| MIRT032137 | RFX5 | regulatory factor X5 | |
1 | 1 | |||||||
| MIRT032138 | BIN3 | bridging integrator 3 | |
1 | 1 | |||||||
| MIRT032139 | CEP120 | centrosomal protein 120 | |
|
2 | 3 | ||||||
| MIRT032140 | ZNF526 | zinc finger protein 526 | |
1 | 1 | |||||||
| MIRT032141 | ISL1 | ISL LIM homeobox 1 | |
1 | 1 | |||||||
| MIRT032142 | POLR2D | RNA polymerase II subunit D | |
|
2 | 5 | ||||||
| MIRT032143 | SMCR7L | mitochondrial elongation factor 1 | |
1 | 4 | |||||||
| MIRT032144 | TMEM194A | nuclear envelope integral membrane protein 1 | |
1 | 1 | |||||||
| MIRT032145 | KATNAL1 | katanin catalytic subunit A1 like 1 | |
1 | 1 | |||||||
| MIRT032146 | C12orf4 | chromosome 12 open reading frame 4 | |
|
2 | 3 | ||||||
| MIRT032147 | TMEM2 | transmembrane protein 2 | |
1 | 1 | |||||||
| MIRT032148 | DLC1 | DLC1 Rho GTPase activating protein | |
1 | 1 | |||||||
| MIRT032149 | TMTC3 | transmembrane and tetratricopeptide repeat containing 3 | |
|
2 | 3 | ||||||
| MIRT032150 | SREK1 | splicing regulatory glutamic acid and lysine rich protein 1 | |
1 | 1 | |||||||
| MIRT032151 | ZNF354B | zinc finger protein 354B | |
1 | 1 | |||||||
| MIRT032152 | ZNF200 | zinc finger protein 200 | |
|
2 | 4 | ||||||
| MIRT032153 | ADCY9 | adenylate cyclase 9 | |
1 | 1 | |||||||
| MIRT032154 | TNRC6A | trinucleotide repeat containing 6A | |
1 | 1 | |||||||
| MIRT032155 | STK40 | serine/threonine kinase 40 | |
1 | 1 | |||||||
| MIRT032156 | PCGF3 | polycomb group ring finger 3 | |
|
2 | 6 | ||||||
| MIRT032157 | ZBTB39 | zinc finger and BTB domain containing 39 | |
1 | 1 | |||||||
| MIRT032158 | LIN52 | lin-52 DREAM MuvB core complex component | |
1 | 1 | |||||||
| MIRT032159 | RAD9A | RAD9 checkpoint clamp component A | |
1 | 1 | |||||||
| MIRT032160 | ARRDC4 | arrestin domain containing 4 | |
1 | 1 | |||||||
| MIRT032161 | SLC30A6 | solute carrier family 30 member 6 | |
1 | 1 | |||||||
| MIRT032162 | LBR | lamin B receptor | |
1 | 1 | |||||||
| MIRT032163 | C9orf41 | carnosine N-methyltransferase 1 | |
1 | 1 | |||||||
| MIRT032164 | ESPL1 | extra spindle pole bodies like 1, separase | |
|
2 | 5 | ||||||
| MIRT032165 | ABT1 | activator of basal transcription 1 | |
|
2 | 9 | ||||||
| MIRT032166 | NHLRC3 | NHL repeat containing 3 | |
|
2 | 6 | ||||||
| MIRT032167 | GLMN | glomulin, FKBP associated protein | |
1 | 1 | |||||||
| MIRT032168 | IGDCC4 | immunoglobulin superfamily DCC subclass member 4 | |
|
2 | 6 | ||||||
| MIRT032169 | ZNF644 | zinc finger protein 644 | |
|
2 | 3 | ||||||
| MIRT032170 | C11orf57 | chromosome 11 open reading frame 57 | |
|
2 | 5 | ||||||
| MIRT032171 | FAM104A | family with sequence similarity 104 member A | |
|
2 | 2 | ||||||
| MIRT032172 | SPRYD4 | SPRY domain containing 4 | |
1 | 1 | |||||||
| MIRT032173 | ARID3A | AT-rich interaction domain 3A | |
|
2 | 3 | ||||||
| MIRT032174 | SLC10A7 | solute carrier family 10 member 7 | |
|
2 | 6 | ||||||
| MIRT032175 | ONECUT2 | one cut homeobox 2 | |
|
2 | 3 | ||||||
| MIRT032176 | USP24 | ubiquitin specific peptidase 24 | |
1 | 1 | |||||||
| MIRT032177 | SMARCAD1 | SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 | |
|
2 | 4 | ||||||
| MIRT032178 | TGFBR1 | transforming growth factor beta receptor 1 | |
1 | 1 | |||||||
| MIRT032179 | HAND1 | heart and neural crest derivatives expressed 1 | |
|
2 | 3 | ||||||
| MIRT032180 | KPNA5 | karyopherin subunit alpha 5 | |
|
2 | 8 | ||||||
| MIRT032181 | IGF1R | insulin like growth factor 1 receptor | |
|
2 | 9 | ||||||
| MIRT032182 | TMEM135 | transmembrane protein 135 | |
1 | 1 | |||||||
| MIRT032183 | SLC20A1 | solute carrier family 20 member 1 | |
|
2 | 4 | ||||||
| MIRT032184 | ZNF280B | zinc finger protein 280B | |
1 | 1 | |||||||
| MIRT032185 | LIN28B | lin-28 homolog B | |
1 | 1 | |||||||
| MIRT032186 | IGF2BP1 | insulin like growth factor 2 mRNA binding protein 1 | |
|
2 | 3 | ||||||
| MIRT051710 | CACNG8 | calcium voltage-gated channel auxiliary subunit gamma 8 | |
1 | 1 | |||||||
| MIRT051711 | PRR13 | proline rich 13 | |
1 | 1 | |||||||
| MIRT051712 | ZNF746 | zinc finger protein 746 | |
1 | 1 | |||||||
| MIRT051713 | SLC35A4 | solute carrier family 35 member A4 | |
1 | 1 | |||||||
| MIRT051714 | RPL31 | ribosomal protein L31 | |
1 | 1 | |||||||
| MIRT051715 | TPD52L2 | tumor protein D52 like 2 | |
1 | 1 | |||||||
| MIRT051716 | MRPL51 | mitochondrial ribosomal protein L51 | |
1 | 1 | |||||||
| MIRT051717 | CTDP1 | CTD phosphatase subunit 1 | |
1 | 1 | |||||||
| MIRT051718 | RPS6 | ribosomal protein S6 | |
1 | 1 | |||||||
| MIRT051719 | SENP5 | SUMO1/sentrin specific peptidase 5 | |
1 | 1 | |||||||
| MIRT051720 | PAXBP1 | PAX3 and PAX7 binding protein 1 | |
1 | 1 | |||||||
| MIRT051721 | DHX57 | DExH-box helicase 57 | |
1 | 1 | |||||||
| MIRT051722 | H2AFX | H2A histone family member X | |
1 | 1 | |||||||
| MIRT051723 | DSC3 | desmocollin 3 | |
1 | 1 | |||||||
| MIRT051724 | CIZ1 | CDKN1A interacting zinc finger protein 1 | |
1 | 1 | |||||||
| MIRT051725 | NCOA1 | nuclear receptor coactivator 1 | |
1 | 1 | |||||||
| MIRT051726 | LRRC42 | leucine rich repeat containing 42 | |
1 | 1 | |||||||
| MIRT051727 | UTP6 | UTP6, small subunit processome component | |
1 | 1 | |||||||
| MIRT063194 | ADIPOR2 | adiponectin receptor 2 | |
|
2 | 2 | ||||||
| MIRT068153 | TXLNA | taxilin alpha | |
|
2 | 2 | ||||||
| MIRT068788 | FNDC3A | fibronectin type III domain containing 3A | |
|
2 | 2 | ||||||
| MIRT073005 | ARID3B | AT-rich interaction domain 3B | |
|
2 | 6 | ||||||
| MIRT076222 | SMCR8 | Smith-Magenis syndrome chromosome region, candidate 8 | |
|
2 | 6 | ||||||
| MIRT083299 | ZCCHC3 | zinc finger CCHC-type containing 3 | |
|
2 | 2 | ||||||
| MIRT084975 | BACH1 | BTB domain and CNC homolog 1 | |
|
|
|
4 | 3 | ||||
| MIRT095765 | GRPEL2 | GrpE like 2, mitochondrial | |
|
2 | 10 | ||||||
| MIRT112241 | MDM4 | MDM4, p53 regulator | |
|
2 | 4 | ||||||
| MIRT118585 | STK4 | serine/threonine kinase 4 | |
|
2 | 2 | ||||||
| MIRT120920 | PDE12 | phosphodiesterase 12 | |
|
2 | 8 | ||||||
| MIRT123316 | CALU | calumenin | |
|
2 | 2 | ||||||
| MIRT123975 | POLR3D | RNA polymerase III subunit D | |
|
2 | 2 | ||||||
| MIRT152271 | TNFSF9 | TNF superfamily member 9 | |
|
2 | 2 | ||||||
| MIRT153846 | NCOA3 | nuclear receptor coactivator 3 | |
|
2 | 2 | ||||||
| MIRT168582 | HMGA1 | high mobility group AT-hook 1 | |
|
2 | 4 | ||||||
| MIRT180602 | CRY2 | cryptochrome circadian clock 2 | |
|
2 | 2 | ||||||
| MIRT187716 | SUOX | sulfite oxidase | |
|
2 | 2 | ||||||
| MIRT191403 | NAA30 | N(alpha)-acetyltransferase 30, NatC catalytic subunit | |
|
2 | 2 | ||||||
| MIRT193100 | MAPK6 | mitogen-activated protein kinase 6 | |
|
2 | 2 | ||||||
| MIRT215719 | C5ORF51 | chromosome 5 open reading frame 51 | |
|
2 | 10 | ||||||
| MIRT218814 | CDKN1A | cyclin dependent kinase inhibitor 1A | |
|
2 | 2 | ||||||
| MIRT240329 | UBXN2B | UBX domain protein 2B | |
|
2 | 2 | ||||||
| MIRT243472 | TRIM71 | tripartite motif containing 71 | |
|
2 | 2 | ||||||
| MIRT244068 | EDN1 | endothelin 1 | |
|
2 | 2 | ||||||
| MIRT252329 | SALL3 | spalt like transcription factor 3 | |
|
2 | 2 | ||||||
| MIRT255313 | CDV3 | CDV3 homolog | |
|
2 | 2 | ||||||
| MIRT259276 | PGRMC1 | progesterone receptor membrane component 1 | |
|
2 | 2 | ||||||
| MIRT259478 | TXLNG | taxilin gamma | |
|
2 | 2 | ||||||
| MIRT260706 | CLDN12 | claudin 12 | |
|
2 | 6 | ||||||
| MIRT266211 | PEX11B | peroxisomal biogenesis factor 11 beta | |
|
2 | 2 | ||||||
| MIRT266625 | CHTOP | chromatin target of PRMT1 | |
|
2 | 2 | ||||||
| MIRT268838 | C1ORF21 | chromosome 1 open reading frame 21 | |
|
2 | 2 | ||||||
| MIRT284527 | PDP2 | pyruvate dehyrogenase phosphatase catalytic subunit 2 | |
|
2 | 2 | ||||||
| MIRT294445 | ZNF264 | zinc finger protein 264 | |
|
2 | 2 | ||||||
| MIRT297012 | RRM2 | ribonucleotide reductase regulatory subunit M2 | |
|
2 | 2 | ||||||
| MIRT300036 | BZW1 | basic leucine zipper and W2 domains 1 | |
|
2 | 4 | ||||||
| MIRT300892 | KREMEN1 | kringle containing transmembrane protein 1 | |
|
2 | 2 | ||||||
| MIRT303319 | MXD1 | MAX dimerization protein 1 | |
|
2 | 2 | ||||||
| MIRT309845 | NAT8L | N-acetyltransferase 8 like | |
|
2 | 2 | ||||||
| MIRT322427 | PPP2R2A | protein phosphatase 2 regulatory subunit Balpha | |
|
2 | 2 | ||||||
| MIRT324730 | ACER2 | alkaline ceramidase 2 | |
|
2 | 2 | ||||||
| MIRT402056 | ATP6V1F | ATPase H+ transporting V1 subunit F | |
|
2 | 4 | ||||||
| MIRT437855 | EIF2C1 | argonaute 1, RISC catalytic component | |
|
|
3 | 1 | |||||
| MIRT438633 | TNFRSF10B | TNF receptor superfamily member 10b | |
|
2 | 1 | ||||||
| MIRT439136 | ZEB2 | zinc finger E-box binding homeobox 2 | 0 | 1 | ||||||||
| MIRT439137 | MYC | MYC proto-oncogene, bHLH transcription factor | 0 | 1 | ||||||||
| MIRT442021 | NDUFA4P1 | NDUFA4, mitochondrial complex associated pseudogene 1 | |
|
2 | 2 | ||||||
| MIRT445659 | ATP6V1G1 | ATPase H+ transporting V1 subunit G1 | |
|
2 | 6 | ||||||
| MIRT447137 | KIF27 | kinesin family member 27 | |
|
2 | 2 | ||||||
| MIRT448263 | ZNF774 | zinc finger protein 774 | |
|
2 | 2 | ||||||
| MIRT449006 | ANKRD46 | ankyrin repeat domain 46 | |
|
2 | 2 | ||||||
| MIRT449954 | FMNL3 | formin like 3 | |
|
2 | 2 | ||||||
| MIRT451156 | C19orf53 | chromosome 19 open reading frame 53 | |
|
2 | 2 | ||||||
| MIRT451625 | MEIS3P1 | Meis homeobox 3 pseudogene 1 | |
|
2 | 2 | ||||||
| MIRT451694 | C1RL | complement C1r subcomponent like | |
|
2 | 2 | ||||||
| MIRT452093 | NUCB2 | nucleobindin 2 | |
|
2 | 2 | ||||||
| MIRT452432 | QDPR | quinoid dihydropteridine reductase | |
|
2 | 2 | ||||||
| MIRT452944 | DISC1 | disrupted in schizophrenia 1 | |
|
2 | 2 | ||||||
| MIRT453402 | RHD | Rh blood group D antigen | |
|
2 | 6 | ||||||
| MIRT454165 | HIST1H2BK | histone cluster 1 H2B family member k | |
|
2 | 2 | ||||||
| MIRT454281 | FXN | frataxin | |
|
2 | 2 | ||||||
| MIRT454540 | RABL2A | RAB, member of RAS oncogene family like 2A | |
|
2 | 2 | ||||||
| MIRT454855 | ACOT9 | acyl-CoA thioesterase 9 | |
|
2 | 4 | ||||||
| MIRT455677 | GLO1 | glyoxalase I | |
|
2 | 2 | ||||||
| MIRT457249 | RABL2B | RAB, member of RAS oncogene family like 2B | |
|
2 | 2 | ||||||
| MIRT457678 | ZNF587 | zinc finger protein 587 | |
|
2 | 2 | ||||||
| MIRT457888 | THEM6 | thioesterase superfamily member 6 | |
|
2 | 4 | ||||||
| MIRT458017 | MRPL12 | mitochondrial ribosomal protein L12 | |
|
2 | 2 | ||||||
| MIRT458280 | FUT10 | fucosyltransferase 10 | |
|
2 | 2 | ||||||
| MIRT459737 | RRM1 | ribonucleotide reductase catalytic subunit M1 | |
|
2 | 2 | ||||||
| MIRT460454 | NOM1 | nucleolar protein with MIF4G domain 1 | |
|
2 | 4 | ||||||
| MIRT460501 | FAM105A | family with sequence similarity 105 member A | |
|
2 | 6 | ||||||
| MIRT460939 | NOA1 | nitric oxide associated 1 | |
|
2 | 4 | ||||||
| MIRT461093 | OPA3 | OPA3, outer mitochondrial membrane lipid metabolism regulator | |
|
2 | 2 | ||||||
| MIRT461365 | COL8A1 | collagen type VIII alpha 1 chain | |
|
2 | 2 | ||||||
| MIRT462383 | YAE1D1 | Yae1 domain containing 1 | |
|
2 | 2 | ||||||
| MIRT462781 | ZNF8 | zinc finger protein 8 | |
|
2 | 2 | ||||||
| MIRT463418 | ZC3HAV1L | zinc finger CCCH-type containing, antiviral 1 like | |
|
2 | 2 | ||||||
| MIRT463663 | YWHAZ | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta | |
|
2 | 2 | ||||||
| MIRT464266 | VCL | vinculin | |
|
2 | 2 | ||||||
| MIRT465125 | TSC22D2 | TSC22 domain family member 2 | |
|
2 | 4 | ||||||
| MIRT466186 | TMED5 | transmembrane p24 trafficking protein 5 | |
|
2 | 4 | ||||||
| MIRT466720 | SYNJ2BP | synaptojanin 2 binding protein | |
|
2 | 2 | ||||||
| MIRT469103 | RNF144B | ring finger protein 144B | |
|
2 | 2 | ||||||
| MIRT469713 | RAB40C | RAB40C, member RAS oncogene family | |
|
2 | 2 | ||||||
| MIRT470424 | PPP1R15B | protein phosphatase 1 regulatory subunit 15B | |
|
2 | 2 | ||||||
| MIRT470860 | PLXND1 | plexin D1 | |
|
2 | 2 | ||||||
| MIRT471270 | PGM2L1 | phosphoglucomutase 2 like 1 | |
|
2 | 2 | ||||||
| MIRT471965 | NR6A1 | nuclear receptor subfamily 6 group A member 1 | |
|
2 | 2 | ||||||
| MIRT472738 | MTUS1 | microtubule associated scaffold protein 1 | |
|
2 | 6 | ||||||
| MIRT473135 | MLLT10 | MLLT10, histone lysine methyltransferase DOT1L cofactor | |
|
2 | 2 | ||||||
| MIRT473829 | MAP2K7 | mitogen-activated protein kinase kinase 7 | |
|
2 | 2 | ||||||
| MIRT473941 | LYN | LYN proto-oncogene, Src family tyrosine kinase | |
|
2 | 2 | ||||||
| MIRT474024 | LRRC20 | leucine rich repeat containing 20 | |
|
2 | 2 | ||||||
| MIRT474501 | KLHDC8B | kelch domain containing 8B | |
|
2 | 2 | ||||||
| MIRT474760 | KIAA0930 | KIAA0930 | |
|
2 | 2 | ||||||
| MIRT474908 | KCTD21 | potassium channel tetramerization domain containing 21 | |
|
2 | 2 | ||||||
| MIRT475332 | IFNLR1 | interferon lambda receptor 1 | |
|
2 | 2 | ||||||
| MIRT475380 | ICOSLG | inducible T-cell costimulator ligand | |
|
2 | 2 | ||||||
| MIRT475734 | HERPUD1 | homocysteine inducible ER protein with ubiquitin like domain 1 | |
|
2 | 4 | ||||||
| MIRT476549 | GABPB1 | GA binding protein transcription factor beta subunit 1 | |
|
2 | 4 | ||||||
| MIRT476974 | FAM83G | family with sequence similarity 83 member G | |
|
2 | 4 | ||||||
| MIRT477679 | EFHD2 | EF-hand domain family member D2 | |
|
2 | 2 | ||||||
| MIRT479750 | CCND1 | cyclin D1 | |
|
2 | 2 | ||||||
| MIRT481194 | ATXN7L3B | ataxin 7 like 3B | |
|
2 | 4 | ||||||
| MIRT481239 | ATXN7L3 | ataxin 7 like 3 | |
|
2 | 2 | ||||||
| MIRT481364 | ATG9A | autophagy related 9A | |
|
2 | 2 | ||||||
| MIRT481389 | ATG12 | autophagy related 12 | |
|
2 | 2 | ||||||
| MIRT481653 | AREL1 | apoptosis resistant E3 ubiquitin protein ligase 1 | |
|
2 | 2 | ||||||
| MIRT481853 | AP1S1 | adaptor related protein complex 1 sigma 1 subunit | |
|
2 | 2 | ||||||
| MIRT482185 | AHR | aryl hydrocarbon receptor | |
|
2 | 2 | ||||||
| MIRT482221 | AHCYL2 | adenosylhomocysteinase like 2 | |
|
2 | 2 | ||||||
| MIRT485297 | PLAGL2 | PLAG1 like zinc finger 2 | |
|
2 | 2 | ||||||
| MIRT486660 | ZNF28 | zinc finger protein 28 | |
|
2 | 2 | ||||||
| MIRT489414 | TUBB2A | tubulin beta 2A class IIa | |
|
2 | 2 | ||||||
| MIRT491865 | ZBTB5 | zinc finger and BTB domain containing 5 | |
|
2 | 8 | ||||||
| MIRT492211 | SOCS1 | suppressor of cytokine signaling 1 | |
|
2 | 2 | ||||||
| MIRT492625 | PMAIP1 | phorbol-12-myristate-13-acetate-induced protein 1 | |
|
2 | 2 | ||||||
| MIRT493322 | LIMD2 | LIM domain containing 2 | |
|
2 | 2 | ||||||
| MIRT493902 | FAM43A | family with sequence similarity 43 member A | |
|
2 | 4 | ||||||
| MIRT495969 | TBC1D19 | TBC1 domain family member 19 | |
|
2 | 2 | ||||||
| MIRT496113 | SNX17 | sorting nexin 17 | |
|
2 | 2 | ||||||
| MIRT497876 | SLC12A7 | solute carrier family 12 member 7 | |
|
2 | 2 | ||||||
| MIRT498118 | PLEKHO1 | pleckstrin homology domain containing O1 | |
|
2 | 4 | ||||||
| MIRT499406 | PLCG2 | phospholipase C gamma 2 | |
|
2 | 4 | ||||||
| MIRT499494 | GGA3 | golgi associated, gamma adaptin ear containing, ARF binding protein 3 | |
|
2 | 2 | ||||||
| MIRT499654 | SDR42E1 | short chain dehydrogenase/reductase family 42E, member 1 | |
|
2 | 2 | ||||||
| MIRT499943 | MFSD8 | major facilitator superfamily domain containing 8 | |
|
2 | 2 | ||||||
| MIRT499998 | HIST1H2BD | histone cluster 1 H2B family member d | |
|
2 | 4 | ||||||
| MIRT500899 | STRN | striatin | |
|
2 | 4 | ||||||
| MIRT501113 | SLC5A6 | solute carrier family 5 member 6 | |
|
2 | 4 | ||||||
| MIRT501209 | SUMO1 | small ubiquitin-like modifier 1 | |
|
2 | 2 | ||||||
| MIRT501247 | SEMA4C | semaphorin 4C | |
|
2 | 6 | ||||||
| MIRT501327 | RNFT1 | ring finger protein, transmembrane 1 | |
|
2 | 2 | ||||||
| MIRT501349 | RNF44 | ring finger protein 44 | |
|
2 | 4 | ||||||
| MIRT501388 | RBFOX2 | RNA binding protein, fox-1 homolog 2 | |
|
2 | 10 | ||||||
| MIRT501442 | RAB11FIP4 | RAB11 family interacting protein 4 | |
|
2 | 2 | ||||||
| MIRT501752 | NSD1 | nuclear receptor binding SET domain protein 1 | |
|
2 | 2 | ||||||
| MIRT501941 | MBD2 | methyl-CpG binding domain protein 2 | |
|
2 | 8 | ||||||
| MIRT502121 | KMT2D | lysine methyltransferase 2D | |
|
2 | 4 | ||||||
| MIRT502783 | CEP135 | centrosomal protein 135 | |
|
2 | 2 | ||||||
| MIRT502840 | CELF1 | CUGBP Elav-like family member 1 | |
|
2 | 2 | ||||||
| MIRT505579 | SMC1A | structural maintenance of chromosomes 1A | |
|
2 | 6 | ||||||
| MIRT506360 | NUP155 | nucleoporin 155 | |
|
2 | 6 | ||||||
| MIRT507243 | FIGN | fidgetin, microtubule severing factor | |
|
2 | 8 | ||||||
| MIRT507689 | COIL | coilin | |
|
2 | 6 | ||||||
| MIRT508402 | C1orf210 | chromosome 1 open reading frame 210 | |
|
2 | 6 | ||||||
| MIRT508666 | DIABLO | diablo IAP-binding mitochondrial protein | |
|
2 | 4 | ||||||
| MIRT508933 | AK4 | adenylate kinase 4 | |
|
2 | 4 | ||||||
| MIRT510392 | ZNF566 | zinc finger protein 566 | |
|
2 | 6 | ||||||
| MIRT510514 | YOD1 | YOD1 deubiquitinase | |
|
2 | 6 | ||||||
| MIRT511387 | IKZF3 | IKAROS family zinc finger 3 | |
|
2 | 4 | ||||||
| MIRT512747 | CD59 | CD59 molecule (CD59 blood group) | |
|
2 | 4 | ||||||
| MIRT515955 | C9orf156 | tRNA methyltransferase O | |
|
2 | 2 | ||||||
| MIRT516084 | ZBTB8OS | zinc finger and BTB domain containing 8 opposite strand | |
|
2 | 4 | ||||||
| MIRT521390 | RDX | radixin | |
|
2 | 4 | ||||||
| MIRT522349 | NCKIPSD | NCK interacting protein with SH3 domain | |
|
2 | 4 | ||||||
| MIRT523627 | FZD9 | frizzled class receptor 9 | |
|
2 | 4 | ||||||
| MIRT523734 | FBXW2 | F-box and WD repeat domain containing 2 | |
|
2 | 4 | ||||||
| MIRT523983 | DVL3 | dishevelled segment polarity protein 3 | |
|
2 | 2 | ||||||
| MIRT524115 | DNA2 | DNA replication helicase/nuclease 2 | |
|
2 | 2 | ||||||
| MIRT525728 | SOD2 | superoxide dismutase 2 | |
|
2 | 2 | ||||||
| MIRT527764 | RRAD | RRAD, Ras related glycolysis inhibitor and calcium channel regulator | |
|
2 | 2 | ||||||
| MIRT529728 | OPRL1 | opioid related nociceptin receptor 1 | |
|
2 | 2 | ||||||
| MIRT533189 | WASL | Wiskott-Aldrich syndrome like | |
|
2 | 6 | ||||||
| MIRT536379 | LEFTY1 | left-right determination factor 1 | |
|
2 | 2 | ||||||
| MIRT543786 | RBM12B | RNA binding motif protein 12B | |
|
2 | 4 | ||||||
| MIRT543869 | SLC16A9 | solute carrier family 16 member 9 | |
|
2 | 2 | ||||||
| MIRT545388 | PM20D2 | peptidase M20 domain containing 2 | |
|
2 | 2 | ||||||
| MIRT546329 | TGFBR3 | transforming growth factor beta receptor 3 | |
|
2 | 2 | ||||||
| MIRT547372 | MSI2 | musashi RNA binding protein 2 | |
|
2 | 2 | ||||||
| MIRT547573 | LRIG3 | leucine rich repeats and immunoglobulin like domains 3 | |
|
2 | 4 | ||||||
| MIRT548266 | FBXL20 | F-box and leucine rich repeat protein 20 | |
|
2 | 2 | ||||||
| MIRT548346 | EPHA4 | EPH receptor A4 | |
|
2 | 2 | ||||||
| MIRT548535 | DUSP1 | dual specificity phosphatase 1 | |
|
2 | 2 | ||||||
| MIRT548564 | DNAL1 | dynein axonemal light chain 1 | |
|
2 | 2 | ||||||
| MIRT548780 | COLEC12 | collectin subfamily member 12 | |
|
2 | 2 | ||||||
| MIRT548972 | CCNT2 | cyclin T2 | |
|
2 | 2 | ||||||
| MIRT549022 | CBX5 | chromobox 5 | |
|
2 | 2 | ||||||
| MIRT549207 | BEND4 | BEN domain containing 4 | |
|
2 | 4 | ||||||
| MIRT549764 | ZNF611 | zinc finger protein 611 | |
|
2 | 6 | ||||||
| MIRT549800 | KIAA0391 | KIAA0391 | |
|
2 | 2 | ||||||
| MIRT549848 | ECHDC1 | ethylmalonyl-CoA decarboxylase 1 | |
|
2 | 2 | ||||||
| MIRT550727 | PMPCA | peptidase, mitochondrial processing alpha subunit | |
|
2 | 4 | ||||||
| MIRT550899 | ACTA1 | actin, alpha 1, skeletal muscle | |
|
2 | 2 | ||||||
| MIRT551284 | MCF2L2 | MCF.2 cell line derived transforming sequence-like 2 | |
|
2 | 6 | ||||||
| MIRT551319 | GSG2 | histone H3 associated protein kinase | |
|
2 | 6 | ||||||
| MIRT552004 | RAD18 | RAD18, E3 ubiquitin protein ligase | |
|
2 | 2 | ||||||
| MIRT552411 | ZNF460 | zinc finger protein 460 | |
|
2 | 4 | ||||||
| MIRT553018 | USP38 | ubiquitin specific peptidase 38 | |
|
2 | 2 | ||||||
| MIRT555551 | PLEKHA3 | pleckstrin homology domain containing A3 | |
|
2 | 2 | ||||||
| MIRT555717 | PDZD8 | PDZ domain containing 8 | |
|
2 | 2 | ||||||
| MIRT557967 | FAM222B | family with sequence similarity 222 member B | |
|
2 | 2 | ||||||
| MIRT559088 | C19orf47 | chromosome 19 open reading frame 47 | |
|
2 | 4 | ||||||
| MIRT559498 | ARIH1 | ariadne RBR E3 ubiquitin protein ligase 1 | |
|
2 | 2 | ||||||
| MIRT561776 | PEG10 | paternally expressed 10 | |
|
2 | 2 | ||||||
| MIRT564403 | EMILIN2 | elastin microfibril interfacer 2 | |
|
2 | 4 | ||||||
| MIRT565450 | SURF4 | surfeit 4 | |
|
2 | 2 | ||||||
| MIRT566519 | PARP16 | poly(ADP-ribose) polymerase family member 16 | |
|
2 | 2 | ||||||
| MIRT567430 | GNG5 | G protein subunit gamma 5 | |
|
2 | 2 | ||||||
| MIRT567718 | E2F6 | E2F transcription factor 6 | |
|
2 | 2 | ||||||
| MIRT568649 | ABHD17C | abhydrolase domain containing 17C | |
|
2 | 2 | ||||||
| MIRT569499 | THYN1 | thymocyte nuclear protein 1 | |
|
2 | 2 | ||||||
| MIRT573821 | TGOLN2 | trans-golgi network protein 2 | |
|
2 | 2 | ||||||
| MIRT574364 | ZBTB37 | zinc finger and BTB domain containing 37 | |
|
2 | 2 | ||||||
| MIRT574749 | GOLGA4 | golgin A4 | |
|
2 | 2 | ||||||
| MIRT576088 | Poteg | POTE ankyrin domain family, member G | |
|
2 | 2 | ||||||
| MIRT576807 | Thbs1 | thrombospondin 1 | |
|
2 | 3 | ||||||
| MIRT616371 | RWDD1 | RWD domain containing 1 | |
|
2 | 2 | ||||||
| MIRT617852 | FMO4 | flavin containing monooxygenase 4 | |
|
2 | 2 | ||||||
| MIRT642395 | ZNF556 | zinc finger protein 556 | |
|
2 | 2 | ||||||
| MIRT680520 | PRIM2 | DNA primase subunit 2 | |
|
2 | 2 | ||||||
| MIRT680548 | ZNF584 | zinc finger protein 584 | |
|
2 | 2 | ||||||
| MIRT680801 | ZNF578 | zinc finger protein 578 | |
|
2 | 2 | ||||||
| MIRT680839 | ARL8B | ADP ribosylation factor like GTPase 8B | |
|
2 | 2 | ||||||
| MIRT681142 | INTS7 | integrator complex subunit 7 | |
|
2 | 2 | ||||||
| MIRT681272 | RFC2 | replication factor C subunit 2 | |
|
2 | 2 | ||||||
| MIRT681324 | ZFAND4 | zinc finger AN1-type containing 4 | |
|
2 | 4 | ||||||
| MIRT681360 | BRI3BP | BRI3 binding protein | |
|
2 | 2 | ||||||
| MIRT681507 | STAT2 | signal transducer and activator of transcription 2 | |
|
2 | 2 | ||||||
| MIRT681537 | ZNF738 | zinc finger protein 738 | |
|
2 | 2 | ||||||
| MIRT681659 | DTX3L | deltex E3 ubiquitin ligase 3L | |
|
2 | 2 | ||||||
| MIRT681739 | RAB19 | RAB19, member RAS oncogene family | |
|
2 | 4 | ||||||
| MIRT681761 | CDKAL1 | CDK5 regulatory subunit associated protein 1 like 1 | |
|
2 | 2 | ||||||
| MIRT681798 | EIF4A3 | eukaryotic translation initiation factor 4A3 | |
|
2 | 2 | ||||||
| MIRT681870 | DNAH9 | dynein axonemal heavy chain 9 | |
|
2 | 2 | ||||||
| MIRT681942 | SLC19A3 | solute carrier family 19 member 3 | |
|
2 | 2 | ||||||
| MIRT682103 | ITGA3 | integrin subunit alpha 3 | |
|
2 | 4 | ||||||
| MIRT682182 | SLC38A7 | solute carrier family 38 member 7 | |
|
2 | 2 | ||||||
| MIRT682239 | SAR1A | secretion associated Ras related GTPase 1A | |
|
2 | 2 | ||||||
| MIRT682385 | PHACTR4 | phosphatase and actin regulator 4 | |
|
2 | 2 | ||||||
| MIRT682445 | MTX3 | metaxin 3 | |
|
2 | 2 | ||||||
| MIRT682605 | CPA4 | carboxypeptidase A4 | |
|
2 | 2 | ||||||
| MIRT682641 | COX6B1 | cytochrome c oxidase subunit 6B1 | |
|
2 | 2 | ||||||
| MIRT689328 | FPR1 | formyl peptide receptor 1 | |
|
2 | 2 | ||||||
| MIRT689731 | ATXN2 | ataxin 2 | |
|
2 | 2 | ||||||
| MIRT691037 | ZNF799 | zinc finger protein 799 | |
|
2 | 2 | ||||||
| MIRT691936 | DNAJC28 | DnaJ heat shock protein family (Hsp40) member C28 | |
|
2 | 2 | ||||||
| MIRT694885 | ZNF417 | zinc finger protein 417 | |
|
2 | 2 | ||||||
| MIRT695256 | ZNF443 | zinc finger protein 443 | |
|
2 | 2 | ||||||
| MIRT695414 | ADH5 | alcohol dehydrogenase 5 (class III), chi polypeptide | |
|
2 | 2 | ||||||
| MIRT700588 | PRSS22 | protease, serine 22 | |
|
2 | 2 | ||||||
| MIRT701425 | NHLRC2 | NHL repeat containing 2 | |
|
2 | 2 | ||||||
| MIRT702485 | KIAA1328 | KIAA1328 | |
|
2 | 2 | ||||||
| MIRT702714 | IPO9 | importin 9 | |
|
2 | 2 | ||||||
| MIRT704030 | EDEM3 | ER degradation enhancing alpha-mannosidase like protein 3 | |
|
2 | 2 | ||||||
| MIRT704422 | CTPS1 | CTP synthase 1 | |
|
2 | 2 | ||||||
| MIRT705751 | AMD1 | adenosylmethionine decarboxylase 1 | |
|
2 | 2 | ||||||
| MIRT712372 | NAP1L1 | nucleosome assembly protein 1 like 1 | |
|
2 | 2 | ||||||
| MIRT713521 | PAFAH2 | platelet activating factor acetylhydrolase 2 | |
|
2 | 2 | ||||||
| MIRT734116 | Olr1 | oxidized low density lipoprotein (lectin-like) receptor 1 | |
|
|
3 | 0 | |||||
| MIRT734252 | OPRM1 | opioid receptor mu 1 | |
|
|
3 | 0 | |||||
| MIRT735524 | CD274 | CD274 molecule | |
|
|
3 | 0 | |||||
| miRNA-Drug Associations | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|