>EFNA3|NM_004952|3'UTR
   1 CTCTGCCCCCTCCCCTGGGGGGGGAGAGATGGGGCGGGGCTTGGAAGGAGCAGGGAGCCTTTGGCCTCTCCAAGGGAAGC
  81 CTAGTGGGCCTAGACCCCTCCTCCCATGGCTAGAAGTGGGGCCTGCACCATACATCTGTGTCCGCCCCCTCTACCCCTTC
 161 CCCCCACGTAGGGCACTGTAGTGGACCAAGCACGGGGACAGCCATGGGTCCCGGGCGGCCTTGTGGCTCTGGTAATGTTT
 241 GGTACCAAACTTGGGGGCCAAAAAGGGCAGTGCTCAGGACTCCCTGGCCCCTGGTACCTTTCCCTGACTCCTGGTGCCCT
 321 CTCCCTTTGTCCCCCCAGAGAGACATATGCCCCCAGAGAGAGCAAATCGAAGCGTGGGAGGCACCCCCATTGCTCTCCTC
 401 CAGGGGCAGAACATGGGGAGGGGACTAGATGGGCAAGGGGCAGCACTGCCTGCTGCTTCCTTCCCCTGTTTACAGCAATA
 481 AGCACGTCCTCCTCCCCCACTCCCACTTCCAGGATTGTGGTTTGGATTGAAACCAAGTTTACAAGTAGACACCCCTGGGG
 561 GGGCGGGCAGTGGACAAGGATGGCAAGGGGTGGGCATTGGGGTGCCAGGCAGGCATGTACAGACTCTATATCTCTATATA
 641 TAATGTACAGACAGACAGAGTCCCTTCCCTCTTTAACCCCCTGACCTTTCTTGACTTCCCCTTCAGCTTCAGACCCCTTC
 721 CCCACCAGGCTAGGCCCCCCACACCTGGGGGACCCCCTGGCCCCTCTTTTGTCTTCTGTGAAGACAGGACCTATGCAACG
 801 CACAGACACTTTTGGAGACCGTAAAACAACAACGCCCCCTCCCTTCCAGCCCTGAGCCGGGAACCATCTCCCAGGACCTT
 881 GCCCTGCTCACCCTATGTGGTCCCACCTATCCTCCTGGGCCTTTTTCAAGTGCTTTGGCTGTGACTTTCATACTCTGCTC
 961 TTAGTCTAAAAAAAATAAACTGGAGATAAAAATAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' agucGGCGACAGUGUGCGUGUc 5' || || || ||||||| Target 5' aggaCCTATG-CA-ACGCACAg 3'	786 - 805	148.00	-16.00
2	miRNA 3' aguCGG--CGACAGUGUGCGUGUc 5' ||| || | :||:|:||| Target 5' ggtGCCAGGCAG--GCATGTACAg 3'	601 - 622	121.00	-15.30
3	miRNA 3' agucGGCGACA-GUG-UGCGUGUc 5' :| || | :|: |:|:||| Target 5' tataTCTCTATATATAATGTACAg 3'	627 - 650	114.00	-10.00

Mutant ID	Mutant Position	Mutant Source
COSN16834769	4	COSMIC
COSN30474689	13	COSMIC
COSN26123649	17	COSMIC
COSN30184658	23	COSMIC
COSN30458256	24	COSMIC
COSN20095425	25	COSMIC
COSN23013930	25	COSMIC
COSN18725952	37	COSMIC
COSN30190614	54	COSMIC
COSN31559525	89	COSMIC
COSN31610477	103	COSMIC
COSN32064636	166	COSMIC
COSN15609131	254	COSMIC
COSN21287536	285	COSMIC
COSN1089913	487	COSMIC
COSN31532242	557	COSMIC
COSN31482893	705	COSMIC
COSN24297589	750	COSMIC
COSN26638300	779	COSMIC
COSN31520519	801	COSMIC
COSN26650391	862	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1387513279	1	dbSNP
rs1158637580	6	dbSNP
rs1317919613	7	dbSNP
rs1338808187	10	dbSNP
rs372362069	11	dbSNP
rs750205801	12	dbSNP
rs1334036654	13	dbSNP
rs757012229	16	dbSNP
rs931542858	16	dbSNP
rs11449003	17	dbSNP
rs780250397	17	dbSNP
rs538270136	18	dbSNP
rs769269146	18	dbSNP
rs777341003	19	dbSNP
rs780091277	19	dbSNP
rs1212787710	20	dbSNP
rs200136625	20	dbSNP
rs569176633	21	dbSNP
rs762228610	21	dbSNP
rs746221819	24	dbSNP
rs772344828	25	dbSNP
rs1204115836	26	dbSNP
rs899917248	33	dbSNP
rs1489099865	36	dbSNP
rs775933862	37	dbSNP
rs1427298413	39	dbSNP
rs1256240737	40	dbSNP
rs747516633	41	dbSNP
rs200132180	45	dbSNP
rs776115582	49	dbSNP
rs1458733944	52	dbSNP
rs1240843210	59	dbSNP
rs1202668131	73	dbSNP
rs1461361569	85	dbSNP
rs1257289681	90	dbSNP
rs1202353121	106	dbSNP
rs1306907389	107	dbSNP
rs763471468	108	dbSNP
rs893000719	125	dbSNP
rs1313125468	131	dbSNP
rs566650671	144	dbSNP
rs953177230	145	dbSNP
rs534338239	146	dbSNP
rs1436037863	150	dbSNP
rs986309872	153	dbSNP
rs1169822103	156	dbSNP
rs1020196569	157	dbSNP
rs1383833329	165	dbSNP
rs965888128	166	dbSNP
rs977267549	168	dbSNP
rs1193512829	169	dbSNP
rs1308493628	170	dbSNP
rs902839925	184	dbSNP
rs1207236415	187	dbSNP
rs1002957029	192	dbSNP
rs935304003	195	dbSNP
rs1035422871	202	dbSNP
rs1245510700	210	dbSNP
rs958713332	213	dbSNP
rs1341353974	214	dbSNP
rs796650265	217	dbSNP
rs558801204	218	dbSNP
rs1372730976	247	dbSNP
rs1309153455	253	dbSNP
rs1432218841	258	dbSNP
rs1364098689	262	dbSNP
rs1287126984	265	dbSNP
rs991266074	266	dbSNP
rs1163409895	267	dbSNP
rs1027140007	272	dbSNP
rs1320520169	275	dbSNP
rs1369771778	276	dbSNP
rs1221879717	279	dbSNP
rs577242414	281	dbSNP
rs1266805110	287	dbSNP
rs1417951709	306	dbSNP
rs1251968117	308	dbSNP
rs1470142477	315	dbSNP
rs544285385	317	dbSNP
rs1184215615	319	dbSNP
rs1489857704	325	dbSNP
rs757655156	326	dbSNP
rs919722007	330	dbSNP
rs1358247117	331	dbSNP
rs1045591380	332	dbSNP
rs1237222435	335	dbSNP
rs1316381967	336	dbSNP
rs1289141086	341	dbSNP
rs1344113332	345	dbSNP
rs1412208488	345	dbSNP
rs1179399519	351	dbSNP
rs906699172	352	dbSNP
rs1387666687	353	dbSNP
rs200463404	358	dbSNP
rs547265679	370	dbSNP
rs1404785457	375	dbSNP
rs1156423766	379	dbSNP
rs983026144	385	dbSNP
rs556101207	387	dbSNP
rs898094066	388	dbSNP
rs994483778	391	dbSNP
rs908793144	394	dbSNP
rs781347906	395	dbSNP
rs944012808	396	dbSNP
rs977173232	407	dbSNP
rs1453096778	408	dbSNP
rs1259451869	414	dbSNP
rs375720526	421	dbSNP
rs921327045	424	dbSNP
rs1203613883	427	dbSNP
rs749121502	428	dbSNP
rs574837447	439	dbSNP
rs888811308	441	dbSNP
rs1230235028	456	dbSNP
rs1321549379	460	dbSNP
rs1234665614	467	dbSNP
rs1274727274	467	dbSNP
rs1463911947	468	dbSNP
rs1333157302	472	dbSNP
rs1007305215	479	dbSNP
rs1381287412	492	dbSNP
rs1401024144	497	dbSNP
rs1322138437	499	dbSNP
rs542112496	503	dbSNP
rs1428054557	514	dbSNP
rs756835937	528	dbSNP
rs1479007690	533	dbSNP
rs533271958	534	dbSNP
rs778531892	537	dbSNP
rs1053822545	544	dbSNP
rs1248838779	547	dbSNP
rs1210845783	552	dbSNP
rs34777922	552	dbSNP
rs368742119	553	dbSNP
rs957265557	555	dbSNP
rs201103086	557	dbSNP
rs1347815950	563	dbSNP
rs947255941	565	dbSNP
rs1041577825	566	dbSNP
rs756279988	567	dbSNP
rs1002515799	568	dbSNP
rs939472285	571	dbSNP
rs1035752708	576	dbSNP
rs894166971	582	dbSNP
rs1415696252	588	dbSNP
rs1394166449	592	dbSNP
rs1167295557	594	dbSNP
rs112133541	597	dbSNP
rs1391833603	602	dbSNP
rs1026772143	610	dbSNP
rs1207275799	616	dbSNP
rs1443080096	623	dbSNP
rs1049815388	624	dbSNP
rs930898856	624	dbSNP
rs1236185303	625	dbSNP
rs1271448803	629	dbSNP
rs888745785	629	dbSNP
rs1205141061	635	dbSNP
rs1343287924	638	dbSNP
rs1472530789	647	dbSNP
rs572720799	655	dbSNP
rs775006799	660	dbSNP
rs780160882	663	dbSNP
rs1004384713	664	dbSNP
rs1284431341	678	dbSNP
rs1015821084	680	dbSNP
rs1040093082	682	dbSNP
rs966026498	682	dbSNP
rs1400777848	696	dbSNP
rs977058851	711	dbSNP
rs901617645	716	dbSNP
rs998584852	718	dbSNP
rs143153278	721	dbSNP
rs1332160113	729	dbSNP
rs921244843	737	dbSNP
rs1413256823	740	dbSNP
rs954082946	742	dbSNP
rs957235761	749	dbSNP
rs989514762	750	dbSNP
rs1011489116	758	dbSNP
rs1304077203	758	dbSNP
rs1337683604	759	dbSNP
rs1254615922	762	dbSNP
rs1023307325	767	dbSNP
rs1278384715	772	dbSNP
rs2306123	788	dbSNP
rs947198783	800	dbSNP
rs1229725456	810	dbSNP
rs563747435	810	dbSNP
rs546342547	822	dbSNP
rs1410343740	823	dbSNP
rs2306124	833	dbSNP
rs1435440594	834	dbSNP
rs186168085	835	dbSNP
rs972153770	835	dbSNP
rs1057089817	838	dbSNP
rs1405871166	843	dbSNP
rs11554834	851	dbSNP
rs1487315949	856	dbSNP
rs930848158	859	dbSNP
rs568868065	860	dbSNP
rs910825579	862	dbSNP
rs1247695482	881	dbSNP
rs1476299432	881	dbSNP
rs943034016	884	dbSNP
rs1039994493	885	dbSNP
rs1228398313	886	dbSNP
rs1330641595	887	dbSNP
rs1281243311	888	dbSNP
rs527708452	891	dbSNP
rs1368039922	894	dbSNP
rs139174640	896	dbSNP
rs1358102762	900	dbSNP
rs1398811627	901	dbSNP
rs1298471339	902	dbSNP
rs1386648444	904	dbSNP
rs1320181432	905	dbSNP
rs1457794242	905	dbSNP
rs1390986431	909	dbSNP
rs1266590206	910	dbSNP
rs1174539938	912	dbSNP
rs1004353681	913	dbSNP
rs1426295194	915	dbSNP
rs1193229057	919	dbSNP
rs1052805486	930	dbSNP
rs1246983482	942	dbSNP
rs1465841226	949	dbSNP
rs1260748614	950	dbSNP
rs1209325630	959	dbSNP
rs1433396102	967	dbSNP
rs1312648487	968	dbSNP
rs548488696	976	dbSNP
rs1212547900	980	dbSNP
rs1011857646	981	dbSNP

- The Journal of biological chemistry, 2008

MicroRNAs (miRNAs) are small non-protein-coding RNAs that function as negative gene expression regulators. In the present study, we investigated miRNAs role in endothelial cell response to hypoxia. We found that the expression of miR-210 progressively increased upon exposure to hypoxia. miR-210 overexpression in normoxic endothelial cells stimulated the formation of capillary-like structures on Matrigel and vascular endothelial growth factor-driven cell migration. Conversely, miR-210 blockade via anti-miRNA transfection inhibited the formation of capillary-like structures stimulated by hypoxia and decreased cell migration in response to vascular endothelial growth factor. miR-210 overexpression did not affect endothelial cell growth in both normoxia and hypoxia. However, anti-miR-210 transfection inhibited cell growth and induced apoptosis, in both normoxia and hypoxia. We determined that one relevant target of miR-210 in hypoxia was Ephrin-A3 since miR-210 was necessary and sufficient to down-modulate its expression. Moreover, luciferase reporter assays showed that Ephrin-A3 was a direct target of miR-210. Ephrin-A3 modulation by miR-210 had significant functional consequences; indeed, the expression of an Ephrin-A3 allele that is not targeted by miR-210 prevented miR-210-mediated stimulation of both tubulogenesis and chemotaxis. We conclude that miR-210 up-regulation is a crucial element of endothelial cell response to hypoxia, affecting cell survival, migration, and differentiation.

- FEBS letters, 2008

Shortage of oxygen is one of the prime stress conditions in tissues. In this study, we looked for microRNAs expressed during hypoxia and showed that miR-210 expression was upregulated in response to hypoxia in vitro and in vivo. An active form of the HIF-1alpha induced the expression of miR-210, showing the involvement of the HIF-1 signaling pathway in miR-210 gene transcription. Furthermore, miR-210 was shown to bind to the predicted target sites of ephrin-A3 or neuronal pentraxin 1, causing repression in luciferase reporter activity. Contrary to the microRNA-mediated repression hypothesis, ephrin-A3 was expressed at very high levels in post-ischemic mouse hippocampus in vivo. Thus, the regulatory effects of miR-210 on its targets in vivo need to be further characterized.

- International journal of cancer, 2010

Pancreatic cancer is the eighth most common cancer and has an overall 5-year survival rate lower than 10%. Because of their ability to regulate gene expression, microRNAs can act as oncogenes or tumor-suppressor genes and so have garnered interest as possible prognostic and therapeutic markers during the last decade. However, the prognostic value of microRNA expression in pancreatic cancer has not been thoroughly investigated. We measured the levels of miR-155, miR-203, miR-210, miR-216, miR-217 and miR-222 by quantitative RT-PCR in a cohort of 56 microdissected pancreatic ductal adenocarcinomas (PDAC). These microRNAs were chosen as they had previously been shown to be differentially expressed in pancreatic tumors compared to normal tissues. The possible association of microRNA expression and patients' survival was examined using multivariate Cox's regression hazard analyses. Interestingly, significant correlations between elevated microRNA expression and overall survival were observed for miR-155 (RR = 2.50; p = 0.005), miR-203 (RR = 2.21; p = 0.017), miR-210 (RR = 2.48; p = 0.005) and miR-222 (RR = 2.05; p = 0.035). Furthermore, tumors from patients demonstrating elevated expression levels of all 4 microRNAs possessed a 6.2-fold increased risk of tumor-related death compared to patients whose tumors showed a lower expression of these microRNAs. This study provides the first evidence for an oncogenic activity of miR-155, miR-203, miR-210 and miR-222 in the development of pancreatic cancer as has been reported for other tumor types. Furthermore, the putative target genes for these microRNAs suggest a complex signaling network that can affect PDAC tumorigenesis and tumor progression.

- The Journal of biological chemistry, 2009

miR-210 is a key player of cell response to hypoxia, modulating cell survival, VEGF-driven endothelial cell migration, and the ability of endothelial cells to form capillary-like structures. A crucial step in understanding microRNA (miRNA) function is the identification of their targets. However, only few miR-210 targets have been identified to date. Here, we describe an integrated strategy for large-scale identification of new miR-210 targets by combining transcriptomics and proteomics with bioinformatic approaches. To experimentally validate candidate targets, the RNA-induced silencing complex (RISC) loaded with miR-210 was purified by immunoprecipitation along with its mRNA targets. The complex was significantly enriched in mRNAs of 31 candidate targets, such as BDNF, GPD1L, ISCU, NCAM, and the non-coding RNA Xist. A subset of the newly identified targets was further confirmed by 3'-untranslated region (UTR) reporter assays, and hypoxia induced down-modulation of their expression was rescued blocking miR-210, providing support for the approach validity. In the case of 9 targets, such as PTPN1 and P4HB, miR-210 seed-pairing sequences localized in the coding sequence or in the 5'-UTR, in line with recent data extending miRNA targeting beyond the "classic" 3'-UTR recognition. Finally, Gene Ontology analysis of the targets highlights known miR-210 impact on cell cycle regulation and differentiation, and predicts a new role of this miRNA in RNA processing, DNA binding, development, membrane trafficking, and amino acid catabolism. Given the complexity of miRNA actions, we view such a multiprong approach as useful to adequately describe the multiple pathways regulated by miR-210 during physiopathological processes.

- The EMBO journal, 2012

Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.

- Glycobiology, 2013

WSS25 is a sulfated polysaccharide that inhibits angiogenesis. However, the mechanism underlying the regulation of angiogenesis by WSS25 is not well understood. Using microRNA (miRNA) microarray analysis, a total of 25 miRNAs were found to be upregulated and 12 (including miR-210) downregulated by WSS25 in human microvascular endothelial cells (HMEC-1). Interestingly, Dicer, a key enzyme for miRNA biosynthesis, was downregulated by WSS25 in HMEC-1 cells. Further studies indicated that HMEC-1 cell tube formation and miR-210 expression were suppressed while Ephrin-A3 expression was enhanced by the silencing of Dicer. In contrast, HMEC-1 cell tube formation and miR-210 expression were induced while Ephrin-A3 expression was suppressed by Dicer overexpression. Moreover, miR-210 was downregulated while Ephrin-A3 was upregulated by WSS25 in HMEC-1 cells. HMEC-1 cell migration and tube formation were arrested, while Ephrin-A3 expression was augmented by anti-miR-210. In addition, HMEC-1 cell tube formation was significantly attenuated or augmented when Ephrin-A3 was overexpressed or silenced, respectively. Nevertheless, the tube formation blocked by WSS25 could be partially rescued by manipulation of Dicer, miR-210 and Ephrin-A3. These results suggest a new pathway whereby WSS25 inhibits angiogenesis via suppression of Dicer, leading to downregulation of miR-210 and upregulation of Ephrin-A3.

- Radiation oncology (London, England), 2013

BACKGROUND: Solid tumors usually develop local hypoxia, which renders them resilient to radiotherapy. MiR-210 is the most consistently and robustly induced miRNA under hypoxia and functions as a micro-controller of a wide range of cellular responses to hypoxia. Hence, it is important to investigate the effect of knockdown of miR-210 in tumorigenesis and evaluate the efficacy of knockdown of miR-210 in combination with radiotherapy on human tumor xenograft in nude mice. MATERIALS AND METHODS: SMMC-7721 Cells with stable integration of the anti-sense miR-210 were generated through lentiviral-mediated gene transfer and were subcutaneously implanted into nude mice. Mice were monitored for tumor growth and survival after radiotherapy. MiR-210 expression in tumor tissues was assessed by real-time Reverse transcription-Polymerase Chain Reaction (RT-PCR). Protein expression of HIF-1alpha and miR-210 targeted genes in human hepatoma xenograft was assessed by Western blot. Tumors were analyzed for proliferation, apoptosis, and angiogenesis biomarkers by immunohistochemistry staining. RESULTS: Tumor growth was delayed in miR-210 downregulated xenograft. Knockdown of miR-210 increased protein expression of miR-210 targeted genes, but decreased HIF-1alpha protein in hepatoma xenograft. Knockdown of miR-210 in combination with radiotherapy is more effective than radiotherapy alone or miR-210 knockdown therapy alone in suppressing tumor growth and extending survival duration. Combined therapy decreased Ki-67-positive cells and CD31-positive cells and increased TUNEL-positive cells in tumor xenograft. CONCLUSIONS: Knockdown of miR-210 in combination with radiotherapy showed an enhanced anti-tumor effect on human hepatoma xenograft. Our experiments demonstrated specific inhibition of miR-210 expression might be a means to enhance the effectiveness of radiotherapy to human hepatoma.

- Molecular biology reports, 2016

The healing process of fractured bone is affected by the multiple factors regulating the growth and differentiation of osteoblasts and bone mesenchymal stem cells (MSCs), however, such markers and molecular events need to be orchestrated in details. This study investigated the effect of polyphenol(-)-epigallocatechin-3-gallate (EGCG) on the hypoxia-induced apoptosis and osteogenic differentiation of human bone marrow-derived MSCs, examined the miR-210 induction by EGCG, explored the target inhibition of the expression of receptor tyrosine kinase ligand ephrin-A3 (EFNA3) by miR-210, and then determined the association of the miR-210 promotion with the hypoxia-induced apoptosis and osteogenic differentiation. Results demonstrated that EGCG treatment significantly inhibited the hypoxia-induced apoptosis in MSCs and promoted the level of alkaline phosphatase (ALP), bone morphogenetic protein 2 (BMP-2), propeptide of type I procollagen I (PINP) and runt-related transcription factor 2 (RUNX2) in MSCs under either normoxia or hypoxia. Moreover, the EGCG treatment upregulated the miR-210 expression, in an association with EFNA3 downregulation; and the miR-210 upregulation significantly downregulated the expression of EFNA3 via the specific binding to the 3' UTR of EFNA3. In addition, the manipulated miR-210 upregulation exerted amelioration on the hypoxia-induced apoptosis and on the hypoxia-reduced expression of ALP, BMP-2, PINP and RUNX2 in MSCs. In summary, our study indicated the protective role of EGCG in response to hypoxia and promontory role to osteogenic differentiation in MSCs via upregulating miR-210 and downregulating the expression of miR-210-targeted EFNA3. Our study implies the protective role of EGCG in the hypoxia-induced impairment in MSCs.