pre-miRNA Information
pre-miRNA hsa-mir-210   
Genomic Coordinates chr11: 568089 - 568198
Synonyms MIRN210, mir-210, MIR210
Description Homo sapiens miR-210 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-210-3p
Sequence 66| CUGUGCGUGUGACAGCGGCUGA |87
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 12 11 - 568122 25582055 MiREDiBase
A-to-I 14 11 - 568120 26028588 MiREDiBase
C-to-U 1 11 - 568133 26209130 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs753825152 1 dbSNP
rs759616365 3 dbSNP
rs1247955373 6 dbSNP
rs558661304 9 dbSNP
rs1490451308 13 dbSNP
rs1344162213 14 dbSNP
rs745930382 15 dbSNP
rs1220183952 16 dbSNP
rs1355496181 17 dbSNP
rs1280245998 19 dbSNP
rs781628850 20 dbSNP
rs1241231800 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BX0CY6 miR-210 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Urine Quantitative real-time reverse transcription PCR
BX0CY6 miR-210 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Low Blood Reverse transcription-polymerase chain reaction
Gene Information
Gene Symbol EFNA3   
Synonyms EFL2, EPLG3, Ehk1-L, LERK3
Description ephrin A3
Transcript NM_004952   
Expression
Putative miRNA Targets on EFNA3
3'UTR of EFNA3
(miRNA target sites are highlighted)
>EFNA3|NM_004952|3'UTR
   1 CTCTGCCCCCTCCCCTGGGGGGGGAGAGATGGGGCGGGGCTTGGAAGGAGCAGGGAGCCTTTGGCCTCTCCAAGGGAAGC
  81 CTAGTGGGCCTAGACCCCTCCTCCCATGGCTAGAAGTGGGGCCTGCACCATACATCTGTGTCCGCCCCCTCTACCCCTTC
 161 CCCCCACGTAGGGCACTGTAGTGGACCAAGCACGGGGACAGCCATGGGTCCCGGGCGGCCTTGTGGCTCTGGTAATGTTT
 241 GGTACCAAACTTGGGGGCCAAAAAGGGCAGTGCTCAGGACTCCCTGGCCCCTGGTACCTTTCCCTGACTCCTGGTGCCCT
 321 CTCCCTTTGTCCCCCCAGAGAGACATATGCCCCCAGAGAGAGCAAATCGAAGCGTGGGAGGCACCCCCATTGCTCTCCTC
 401 CAGGGGCAGAACATGGGGAGGGGACTAGATGGGCAAGGGGCAGCACTGCCTGCTGCTTCCTTCCCCTGTTTACAGCAATA
 481 AGCACGTCCTCCTCCCCCACTCCCACTTCCAGGATTGTGGTTTGGATTGAAACCAAGTTTACAAGTAGACACCCCTGGGG
 561 GGGCGGGCAGTGGACAAGGATGGCAAGGGGTGGGCATTGGGGTGCCAGGCAGGCATGTACAGACTCTATATCTCTATATA
 641 TAATGTACAGACAGACAGAGTCCCTTCCCTCTTTAACCCCCTGACCTTTCTTGACTTCCCCTTCAGCTTCAGACCCCTTC
 721 CCCACCAGGCTAGGCCCCCCACACCTGGGGGACCCCCTGGCCCCTCTTTTGTCTTCTGTGAAGACAGGACCTATGCAACG
 801 CACAGACACTTTTGGAGACCGTAAAACAACAACGCCCCCTCCCTTCCAGCCCTGAGCCGGGAACCATCTCCCAGGACCTT
 881 GCCCTGCTCACCCTATGTGGTCCCACCTATCCTCCTGGGCCTTTTTCAAGTGCTTTGGCTGTGACTTTCATACTCTGCTC
 961 TTAGTCTAAAAAAAATAAACTGGAGATAAAAATAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' agucGGCGACAGUGUGCGUGUc 5'
              ||  || || ||||||| 
Target 5' aggaCCTATG-CA-ACGCACAg 3'
786 - 805 148.00 -16.00
2
miRNA  3' aguCGG--CGACAGUGUGCGUGUc 5'
             |||  || |  :||:|:||| 
Target 5' ggtGCCAGGCAG--GCATGTACAg 3'
601 - 622 121.00 -15.30
3
miRNA  3' agucGGCGACA-GUG-UGCGUGUc 5'
              :| || | :|: |:|:||| 
Target 5' tataTCTCTATATATAATGTACAg 3'
627 - 650 114.00 -10.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN16834769 4 COSMIC
COSN30474689 13 COSMIC
COSN26123649 17 COSMIC
COSN30184658 23 COSMIC
COSN30458256 24 COSMIC
COSN20095425 25 COSMIC
COSN23013930 25 COSMIC
COSN18725952 37 COSMIC
COSN30190614 54 COSMIC
COSN31559525 89 COSMIC
COSN31610477 103 COSMIC
COSN32064636 166 COSMIC
COSN15609131 254 COSMIC
COSN21287536 285 COSMIC
COSN1089913 487 COSMIC
COSN31532242 557 COSMIC
COSN31482893 705 COSMIC
COSN24297589 750 COSMIC
COSN26638300 779 COSMIC
COSN31520519 801 COSMIC
COSN26650391 862 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1387513279 1 dbSNP
rs1158637580 6 dbSNP
rs1317919613 7 dbSNP
rs1338808187 10 dbSNP
rs372362069 11 dbSNP
rs750205801 12 dbSNP
rs1334036654 13 dbSNP
rs757012229 16 dbSNP
rs931542858 16 dbSNP
rs11449003 17 dbSNP
rs780250397 17 dbSNP
rs538270136 18 dbSNP
rs769269146 18 dbSNP
rs777341003 19 dbSNP
rs780091277 19 dbSNP
rs1212787710 20 dbSNP
rs200136625 20 dbSNP
rs569176633 21 dbSNP
rs762228610 21 dbSNP
rs746221819 24 dbSNP
rs772344828 25 dbSNP
rs1204115836 26 dbSNP
rs899917248 33 dbSNP
rs1489099865 36 dbSNP
rs775933862 37 dbSNP
rs1427298413 39 dbSNP
rs1256240737 40 dbSNP
rs747516633 41 dbSNP
rs200132180 45 dbSNP
rs776115582 49 dbSNP
rs1458733944 52 dbSNP
rs1240843210 59 dbSNP
rs1202668131 73 dbSNP
rs1461361569 85 dbSNP
rs1257289681 90 dbSNP
rs1202353121 106 dbSNP
rs1306907389 107 dbSNP
rs763471468 108 dbSNP
rs893000719 125 dbSNP
rs1313125468 131 dbSNP
rs566650671 144 dbSNP
rs953177230 145 dbSNP
rs534338239 146 dbSNP
rs1436037863 150 dbSNP
rs986309872 153 dbSNP
rs1169822103 156 dbSNP
rs1020196569 157 dbSNP
rs1383833329 165 dbSNP
rs965888128 166 dbSNP
rs977267549 168 dbSNP
rs1193512829 169 dbSNP
rs1308493628 170 dbSNP
rs902839925 184 dbSNP
rs1207236415 187 dbSNP
rs1002957029 192 dbSNP
rs935304003 195 dbSNP
rs1035422871 202 dbSNP
rs1245510700 210 dbSNP
rs958713332 213 dbSNP
rs1341353974 214 dbSNP
rs796650265 217 dbSNP
rs558801204 218 dbSNP
rs1372730976 247 dbSNP
rs1309153455 253 dbSNP
rs1432218841 258 dbSNP
rs1364098689 262 dbSNP
rs1287126984 265 dbSNP
rs991266074 266 dbSNP
rs1163409895 267 dbSNP
rs1027140007 272 dbSNP
rs1320520169 275 dbSNP
rs1369771778 276 dbSNP
rs1221879717 279 dbSNP
rs577242414 281 dbSNP
rs1266805110 287 dbSNP
rs1417951709 306 dbSNP
rs1251968117 308 dbSNP
rs1470142477 315 dbSNP
rs544285385 317 dbSNP
rs1184215615 319 dbSNP
rs1489857704 325 dbSNP
rs757655156 326 dbSNP
rs919722007 330 dbSNP
rs1358247117 331 dbSNP
rs1045591380 332 dbSNP
rs1237222435 335 dbSNP
rs1316381967 336 dbSNP
rs1289141086 341 dbSNP
rs1344113332 345 dbSNP
rs1412208488 345 dbSNP
rs1179399519 351 dbSNP
rs906699172 352 dbSNP
rs1387666687 353 dbSNP
rs200463404 358 dbSNP
rs547265679 370 dbSNP
rs1404785457 375 dbSNP
rs1156423766 379 dbSNP
rs983026144 385 dbSNP
rs556101207 387 dbSNP
rs898094066 388 dbSNP
rs994483778 391 dbSNP
rs908793144 394 dbSNP
rs781347906 395 dbSNP
rs944012808 396 dbSNP
rs977173232 407 dbSNP
rs1453096778 408 dbSNP
rs1259451869 414 dbSNP
rs375720526 421 dbSNP
rs921327045 424 dbSNP
rs1203613883 427 dbSNP
rs749121502 428 dbSNP
rs574837447 439 dbSNP
rs888811308 441 dbSNP
rs1230235028 456 dbSNP
rs1321549379 460 dbSNP
rs1234665614 467 dbSNP
rs1274727274 467 dbSNP
rs1463911947 468 dbSNP
rs1333157302 472 dbSNP
rs1007305215 479 dbSNP
rs1381287412 492 dbSNP
rs1401024144 497 dbSNP
rs1322138437 499 dbSNP
rs542112496 503 dbSNP
rs1428054557 514 dbSNP
rs756835937 528 dbSNP
rs1479007690 533 dbSNP
rs533271958 534 dbSNP
rs778531892 537 dbSNP
rs1053822545 544 dbSNP
rs1248838779 547 dbSNP
rs1210845783 552 dbSNP
rs34777922 552 dbSNP
rs368742119 553 dbSNP
rs957265557 555 dbSNP
rs201103086 557 dbSNP
rs1347815950 563 dbSNP
rs947255941 565 dbSNP
rs1041577825 566 dbSNP
rs756279988 567 dbSNP
rs1002515799 568 dbSNP
rs939472285 571 dbSNP
rs1035752708 576 dbSNP
rs894166971 582 dbSNP
rs1415696252 588 dbSNP
rs1394166449 592 dbSNP
rs1167295557 594 dbSNP
rs112133541 597 dbSNP
rs1391833603 602 dbSNP
rs1026772143 610 dbSNP
rs1207275799 616 dbSNP
rs1443080096 623 dbSNP
rs1049815388 624 dbSNP
rs930898856 624 dbSNP
rs1236185303 625 dbSNP
rs1271448803 629 dbSNP
rs888745785 629 dbSNP
rs1205141061 635 dbSNP
rs1343287924 638 dbSNP
rs1472530789 647 dbSNP
rs572720799 655 dbSNP
rs775006799 660 dbSNP
rs780160882 663 dbSNP
rs1004384713 664 dbSNP
rs1284431341 678 dbSNP
rs1015821084 680 dbSNP
rs1040093082 682 dbSNP
rs966026498 682 dbSNP
rs1400777848 696 dbSNP
rs977058851 711 dbSNP
rs901617645 716 dbSNP
rs998584852 718 dbSNP
rs143153278 721 dbSNP
rs1332160113 729 dbSNP
rs921244843 737 dbSNP
rs1413256823 740 dbSNP
rs954082946 742 dbSNP
rs957235761 749 dbSNP
rs989514762 750 dbSNP
rs1011489116 758 dbSNP
rs1304077203 758 dbSNP
rs1337683604 759 dbSNP
rs1254615922 762 dbSNP
rs1023307325 767 dbSNP
rs1278384715 772 dbSNP
rs2306123 788 dbSNP
rs947198783 800 dbSNP
rs1229725456 810 dbSNP
rs563747435 810 dbSNP
rs546342547 822 dbSNP
rs1410343740 823 dbSNP
rs2306124 833 dbSNP
rs1435440594 834 dbSNP
rs186168085 835 dbSNP
rs972153770 835 dbSNP
rs1057089817 838 dbSNP
rs1405871166 843 dbSNP
rs11554834 851 dbSNP
rs1487315949 856 dbSNP
rs930848158 859 dbSNP
rs568868065 860 dbSNP
rs910825579 862 dbSNP
rs1247695482 881 dbSNP
rs1476299432 881 dbSNP
rs943034016 884 dbSNP
rs1039994493 885 dbSNP
rs1228398313 886 dbSNP
rs1330641595 887 dbSNP
rs1281243311 888 dbSNP
rs527708452 891 dbSNP
rs1368039922 894 dbSNP
rs139174640 896 dbSNP
rs1358102762 900 dbSNP
rs1398811627 901 dbSNP
rs1298471339 902 dbSNP
rs1386648444 904 dbSNP
rs1320181432 905 dbSNP
rs1457794242 905 dbSNP
rs1390986431 909 dbSNP
rs1266590206 910 dbSNP
rs1174539938 912 dbSNP
rs1004353681 913 dbSNP
rs1426295194 915 dbSNP
rs1193229057 919 dbSNP
rs1052805486 930 dbSNP
rs1246983482 942 dbSNP
rs1465841226 949 dbSNP
rs1260748614 950 dbSNP
rs1209325630 959 dbSNP
rs1433396102 967 dbSNP
rs1312648487 968 dbSNP
rs548488696 976 dbSNP
rs1212547900 980 dbSNP
rs1011857646 981 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HUVEC , U2OS
Disease 1944.0;
Tools used in this research miRanda , TargetScan , PicTar , miRBase Target Database
Original Description (Extracted from the article) ... "miR-210 inhibits EFNA3 expression directly.//We determined that one relevant target of miR-210 in hypoxia was Ephrin-A3 since miR-210 was necessary and sufficient to down-modulate its expression. Moreover ...

- Fasanaro P; D'Alessandra Y; Di Stefano V; et al., 2008, The Journal of biological chemistry.

Article - Fasanaro P; D'Alessandra Y; Di Stefano V; et al.
- The Journal of biological chemistry, 2008
MicroRNAs (miRNAs) are small non-protein-coding RNAs that function as negative gene expression regulators. In the present study, we investigated miRNAs role in endothelial cell response to hypoxia. We found that the expression of miR-210 progressively increased upon exposure to hypoxia. miR-210 overexpression in normoxic endothelial cells stimulated the formation of capillary-like structures on Matrigel and vascular endothelial growth factor-driven cell migration. Conversely, miR-210 blockade via anti-miRNA transfection inhibited the formation of capillary-like structures stimulated by hypoxia and decreased cell migration in response to vascular endothelial growth factor. miR-210 overexpression did not affect endothelial cell growth in both normoxia and hypoxia. However, anti-miR-210 transfection inhibited cell growth and induced apoptosis, in both normoxia and hypoxia. We determined that one relevant target of miR-210 in hypoxia was Ephrin-A3 since miR-210 was necessary and sufficient to down-modulate its expression. Moreover, luciferase reporter assays showed that Ephrin-A3 was a direct target of miR-210. Ephrin-A3 modulation by miR-210 had significant functional consequences; indeed, the expression of an Ephrin-A3 allele that is not targeted by miR-210 prevented miR-210-mediated stimulation of both tubulogenesis and chemotaxis. We conclude that miR-210 up-regulation is a crucial element of endothelial cell response to hypoxia, affecting cell survival, migration, and differentiation.
LinkOut: [PMID: 18417479]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions 293T
Disease MIMAT0000267
Location of target site 3'UTR
Tools used in this research miRanda , TargetScan , PicTar
Original Description (Extracted from the article) ... "Furthermore ...

- Pulkkinen K; Malm T; Turunen M; Koistinaho et al., 2008, FEBS letters.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' agucGGCGACAGUGUGCGUGUc 5'
              ||  || || ||||||| 
Target 5' aggaCCUAUG-CA-ACGCACAg 3'
4 - 23
Article - Pulkkinen K; Malm T; Turunen M; Koistinaho et al.
- FEBS letters, 2008
Shortage of oxygen is one of the prime stress conditions in tissues. In this study, we looked for microRNAs expressed during hypoxia and showed that miR-210 expression was upregulated in response to hypoxia in vitro and in vivo. An active form of the HIF-1alpha induced the expression of miR-210, showing the involvement of the HIF-1 signaling pathway in miR-210 gene transcription. Furthermore, miR-210 was shown to bind to the predicted target sites of ephrin-A3 or neuronal pentraxin 1, causing repression in luciferase reporter activity. Contrary to the microRNA-mediated repression hypothesis, ephrin-A3 was expressed at very high levels in post-ischemic mouse hippocampus in vivo. Thus, the regulatory effects of miR-210 on its targets in vivo need to be further characterized.
LinkOut: [PMID: 18539147]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions MCF7 , HEK293
Location of target site 3'UTR
Tools used in this research miRanda , PicTar , TargetScan
Original Description (Extracted from the article) ... Our results show the 3'UTR of EFNA3 is regulated by miR-210 and inhibition of miR-210 reduces EFNA3 pro- tein levels as well as clonogenic cell survival of MCF-7 cells.// ...

- Greither T; Grochola LF; Udelnow A; et al., 2010, International journal of cancer.

Article - Greither T; Grochola LF; Udelnow A; et al.
- International journal of cancer, 2010
Pancreatic cancer is the eighth most common cancer and has an overall 5-year survival rate lower than 10%. Because of their ability to regulate gene expression, microRNAs can act as oncogenes or tumor-suppressor genes and so have garnered interest as possible prognostic and therapeutic markers during the last decade. However, the prognostic value of microRNA expression in pancreatic cancer has not been thoroughly investigated. We measured the levels of miR-155, miR-203, miR-210, miR-216, miR-217 and miR-222 by quantitative RT-PCR in a cohort of 56 microdissected pancreatic ductal adenocarcinomas (PDAC). These microRNAs were chosen as they had previously been shown to be differentially expressed in pancreatic tumors compared to normal tissues. The possible association of microRNA expression and patients' survival was examined using multivariate Cox's regression hazard analyses. Interestingly, significant correlations between elevated microRNA expression and overall survival were observed for miR-155 (RR = 2.50; p = 0.005), miR-203 (RR = 2.21; p = 0.017), miR-210 (RR = 2.48; p = 0.005) and miR-222 (RR = 2.05; p = 0.035). Furthermore, tumors from patients demonstrating elevated expression levels of all 4 microRNAs possessed a 6.2-fold increased risk of tumor-related death compared to patients whose tumors showed a lower expression of these microRNAs. This study provides the first evidence for an oncogenic activity of miR-155, miR-203, miR-210 and miR-222 in the development of pancreatic cancer as has been reported for other tumor types. Furthermore, the putative target genes for these microRNAs suggest a complex signaling network that can affect PDAC tumorigenesis and tumor progression.
LinkOut: [PMID: 19551852]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293 , HUVEC , MCF7
Location of target site 3'UTR
Tools used in this research Literature survey
Original Description (Extracted from the article) ... "EFNA3 ...

- Fasanaro P; Greco S; Lorenzi M; Pescatori et al., 2009, The Journal of biological chemistry.

Article - Fasanaro P; Greco S; Lorenzi M; Pescatori et al.
- The Journal of biological chemistry, 2009
miR-210 is a key player of cell response to hypoxia, modulating cell survival, VEGF-driven endothelial cell migration, and the ability of endothelial cells to form capillary-like structures. A crucial step in understanding microRNA (miRNA) function is the identification of their targets. However, only few miR-210 targets have been identified to date. Here, we describe an integrated strategy for large-scale identification of new miR-210 targets by combining transcriptomics and proteomics with bioinformatic approaches. To experimentally validate candidate targets, the RNA-induced silencing complex (RISC) loaded with miR-210 was purified by immunoprecipitation along with its mRNA targets. The complex was significantly enriched in mRNAs of 31 candidate targets, such as BDNF, GPD1L, ISCU, NCAM, and the non-coding RNA Xist. A subset of the newly identified targets was further confirmed by 3'-untranslated region (UTR) reporter assays, and hypoxia induced down-modulation of their expression was rescued blocking miR-210, providing support for the approach validity. In the case of 9 targets, such as PTPN1 and P4HB, miR-210 seed-pairing sequences localized in the coding sequence or in the 5'-UTR, in line with recent data extending miRNA targeting beyond the "classic" 3'-UTR recognition. Finally, Gene Ontology analysis of the targets highlights known miR-210 impact on cell cycle regulation and differentiation, and predicts a new role of this miRNA in RNA processing, DNA binding, development, membrane trafficking, and amino acid catabolism. Given the complexity of miRNA actions, we view such a multiprong approach as useful to adequately describe the multiple pathways regulated by miR-210 during physiopathological processes.
LinkOut: [PMID: 19826008]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
Experimental Support 6 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HMEC1
Location of target site 3'UTR
Tools used in this research miRanda , PicTar , TargetScan
Original Description (Extracted from the article) ... WSS25 downregulated Dicer and miR-210 expression and upregulated the expression of the miR-210 target gene Ephrin-A3. Ephrin-A3 is a functional target of miR-210 in HMEC-1 cells ...

- Xiao F; Qiu H; Zhou L; Shen X; Yang L; Ding K, 2013, Glycobiology.

Article - Xiao F; Qiu H; Zhou L; Shen X; Yang L; Ding K
- Glycobiology, 2013
WSS25 is a sulfated polysaccharide that inhibits angiogenesis. However, the mechanism underlying the regulation of angiogenesis by WSS25 is not well understood. Using microRNA (miRNA) microarray analysis, a total of 25 miRNAs were found to be upregulated and 12 (including miR-210) downregulated by WSS25 in human microvascular endothelial cells (HMEC-1). Interestingly, Dicer, a key enzyme for miRNA biosynthesis, was downregulated by WSS25 in HMEC-1 cells. Further studies indicated that HMEC-1 cell tube formation and miR-210 expression were suppressed while Ephrin-A3 expression was enhanced by the silencing of Dicer. In contrast, HMEC-1 cell tube formation and miR-210 expression were induced while Ephrin-A3 expression was suppressed by Dicer overexpression. Moreover, miR-210 was downregulated while Ephrin-A3 was upregulated by WSS25 in HMEC-1 cells. HMEC-1 cell migration and tube formation were arrested, while Ephrin-A3 expression was augmented by anti-miR-210. In addition, HMEC-1 cell tube formation was significantly attenuated or augmented when Ephrin-A3 was overexpressed or silenced, respectively. Nevertheless, the tube formation blocked by WSS25 could be partially rescued by manipulation of Dicer, miR-210 and Ephrin-A3. These results suggest a new pathway whereby WSS25 inhibits angiogenesis via suppression of Dicer, leading to downregulation of miR-210 and upregulation of Ephrin-A3.
LinkOut: [PMID: 23322395]
Experimental Support 7 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions SMMC-7721 , 293
Tools used in this research unspecified
Original Description (Extracted from the article) ... "To investigate the mechanism underlying the knockdown of miR-210 mediated tumor growth delay ...

- Yang W; Wei J; Sun T; Liu F, 2013, Radiation oncology (London, England).

Article - Yang W; Wei J; Sun T; Liu F
- Radiation oncology (London, England), 2013
BACKGROUND: Solid tumors usually develop local hypoxia, which renders them resilient to radiotherapy. MiR-210 is the most consistently and robustly induced miRNA under hypoxia and functions as a micro-controller of a wide range of cellular responses to hypoxia. Hence, it is important to investigate the effect of knockdown of miR-210 in tumorigenesis and evaluate the efficacy of knockdown of miR-210 in combination with radiotherapy on human tumor xenograft in nude mice. MATERIALS AND METHODS: SMMC-7721 Cells with stable integration of the anti-sense miR-210 were generated through lentiviral-mediated gene transfer and were subcutaneously implanted into nude mice. Mice were monitored for tumor growth and survival after radiotherapy. MiR-210 expression in tumor tissues was assessed by real-time Reverse transcription-Polymerase Chain Reaction (RT-PCR). Protein expression of HIF-1alpha and miR-210 targeted genes in human hepatoma xenograft was assessed by Western blot. Tumors were analyzed for proliferation, apoptosis, and angiogenesis biomarkers by immunohistochemistry staining. RESULTS: Tumor growth was delayed in miR-210 downregulated xenograft. Knockdown of miR-210 increased protein expression of miR-210 targeted genes, but decreased HIF-1alpha protein in hepatoma xenograft. Knockdown of miR-210 in combination with radiotherapy is more effective than radiotherapy alone or miR-210 knockdown therapy alone in suppressing tumor growth and extending survival duration. Combined therapy decreased Ki-67-positive cells and CD31-positive cells and increased TUNEL-positive cells in tumor xenograft. CONCLUSIONS: Knockdown of miR-210 in combination with radiotherapy showed an enhanced anti-tumor effect on human hepatoma xenograft. Our experiments demonstrated specific inhibition of miR-210 expression might be a means to enhance the effectiveness of radiotherapy to human hepatoma.
LinkOut: [PMID: 23618526]
Experimental Support 8 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions bone marrow -derived mesenchymal stem cells
Disease MIMAT0000267
Location of target site 3'UTR
Original Description (Extracted from the article) ... "Moreover ...

- Qiu Y; Chen Y; Zeng T; Guo W; Zhou W; Yang X, 2016, Molecular biology reports.

Article - Qiu Y; Chen Y; Zeng T; Guo W; Zhou W; Yang X
- Molecular biology reports, 2016
The healing process of fractured bone is affected by the multiple factors regulating the growth and differentiation of osteoblasts and bone mesenchymal stem cells (MSCs), however, such markers and molecular events need to be orchestrated in details. This study investigated the effect of polyphenol(-)-epigallocatechin-3-gallate (EGCG) on the hypoxia-induced apoptosis and osteogenic differentiation of human bone marrow-derived MSCs, examined the miR-210 induction by EGCG, explored the target inhibition of the expression of receptor tyrosine kinase ligand ephrin-A3 (EFNA3) by miR-210, and then determined the association of the miR-210 promotion with the hypoxia-induced apoptosis and osteogenic differentiation. Results demonstrated that EGCG treatment significantly inhibited the hypoxia-induced apoptosis in MSCs and promoted the level of alkaline phosphatase (ALP), bone morphogenetic protein 2 (BMP-2), propeptide of type I procollagen I (PINP) and runt-related transcription factor 2 (RUNX2) in MSCs under either normoxia or hypoxia. Moreover, the EGCG treatment upregulated the miR-210 expression, in an association with EFNA3 downregulation; and the miR-210 upregulation significantly downregulated the expression of EFNA3 via the specific binding to the 3' UTR of EFNA3. In addition, the manipulated miR-210 upregulation exerted amelioration on the hypoxia-induced apoptosis and on the hypoxia-reduced expression of ALP, BMP-2, PINP and RUNX2 in MSCs. In summary, our study indicated the protective role of EGCG in response to hypoxia and promontory role to osteogenic differentiation in MSCs via upregulating miR-210 and downregulating the expression of miR-210-targeted EFNA3. Our study implies the protective role of EGCG in the hypoxia-induced impairment in MSCs.
LinkOut: [PMID: 26780211]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC 0.523 0 0.446 0 42 Click to see details
KIRC 0.415 0 0.463 0 68 Click to see details
KIRP 0.532 0 0.464 0 32 Click to see details
BLCA 0.669 0 0.717 0 18 Click to see details
BRCA 0.302 0 0.244 0.01 84 Click to see details
KICH 0.518 0 0.469 0.01 25 Click to see details
STAD 0.42 0.01 0.449 0 32 Click to see details
PRAD 0.301 0.02 0.213 0.07 50 Click to see details
ESCA 0.598 0.03 0.427 0.1 11 Click to see details
LUAD 0.391 0.1 0.392 0.1 12 Click to see details
CHOL 0.424 0.13 0.050 0.45 9 Click to see details
COAD 0.316 0.22 0.214 0.31 8 Click to see details
LIHC 0.098 0.25 0.039 0.4 49 Click to see details
UCEC -0.12 0.31 -0.177 0.23 19 Click to see details
PCPG -0.535 0.32 -1.000 0.5 3 Click to see details
THCA 0.052 0.35 -0.008 0.48 59 Click to see details
LUSC 0.063 0.35 -0.017 0.46 38 Click to see details
CESC -0.277 0.41 -0.500 0.33 3 Click to see details
PAAD 0.153 0.42 0.400 0.3 4 Click to see details
PAAD 0.153 0.42 0.400 0.3 4 Click to see details
PAAD 0.153 0.42 0.400 0.3 4 Click to see details
126 hsa-miR-210-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000149 HOXA9 homeobox A9 4 1
MIRT000150 TP53I11 tumor protein p53 inducible protein 11 2 1
MIRT000151 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 2 1
MIRT000152 HOXA1 homeobox A1 2 1
MIRT000153 FGFRL1 fibroblast growth factor receptor like 1 6 3
MIRT000156 RAD52 RAD52 homolog, DNA repair protein 5 3
MIRT001930 NPTX1 neuronal pentraxin 1 3 2
MIRT002024 EFNA3 ephrin A3 8 8
MIRT003153 BDNF brain derived neurotrophic factor 5 1
MIRT003154 PTPN1 protein tyrosine phosphatase, non-receptor type 1 5 1
MIRT003155 P4HB prolyl 4-hydroxylase subunit beta 6 2
MIRT003156 UBQLN1 ubiquilin 1 3 1
MIRT003157 SERTAD2 SERTA domain containing 2 3 1
MIRT003158 SEH1L SEH1 like nucleoporin 3 1
MIRT003159 NCAM1 neural cell adhesion molecule 1 4 1
MIRT003160 MID1IP1 MID1 interacting protein 1 3 1
MIRT003161 MDGA1 MAM domain containing glycosylphosphatidylinositol anchor 1 3 1
MIRT003162 KIAA1161 myogenesis regulating glycosidase (putative) 3 1
MIRT003163 ISCU iron-sulfur cluster assembly enzyme 6 7
MIRT003164 HOXA3 homeobox A3 3 1
MIRT003165 GPD1L glycerol-3-phosphate dehydrogenase 1 like 7 2
MIRT003166 DENND6A DENN domain containing 6A 3 1
MIRT003167 CPEB2 cytoplasmic polyadenylation element binding protein 2 5 1
MIRT003168 CDK10 cyclin dependent kinase 10 3 1
MIRT003169 ABCB9 ATP binding cassette subfamily B member 9 3 1
MIRT003170 CBX1 chromobox 1 3 1
MIRT003171 XIST X inactive specific transcript (non-protein coding) 4 1
MIRT003172 TNPO1 transportin 1 3 1
MIRT003173 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 3 1
MIRT003174 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 3 1
MIRT003175 NIPBL NIPBL, cohesin loading factor 3 1
MIRT003176 MIB1 mindbomb E3 ubiquitin protein ligase 1 3 1
MIRT003177 HECTD1 HECT domain E3 ubiquitin protein ligase 1 3 1
MIRT003178 ELK3 ELK3, ETS transcription factor 3 1
MIRT003179 DDAH1 dimethylarginine dimethylaminohydrolase 1 4 1
MIRT003180 CLASP2 cytoplasmic linker associated protein 2 3 1
MIRT003181 CHD9 chromodomain helicase DNA binding protein 9 3 1
MIRT003182 ATP11C ATPase phospholipid transporting 11C 3 1
MIRT003183 APC APC, WNT signaling pathway regulator 3 1
MIRT003184 E2F3 E2F transcription factor 3 7 5
MIRT003185 ACVR1B activin A receptor type 1B 2 1
MIRT003916 MRE11A MRE11 homolog, double strand break repair nuclease 2 1
MIRT003917 XPA XPA, DNA damage recognition and repair factor 2 1
MIRT004672 MNT MAX network transcriptional repressor 4 2
MIRT006326 AIFM3 apoptosis inducing factor, mitochondria associated 3 3 2
MIRT006519 CASP8AP2 caspase 8 associated protein 2 4 1
MIRT006663 VMP1 vacuole membrane protein 1 3 2
MIRT006830 TFRC transferrin receptor 3 2
MIRT047002 PFDN2 prefoldin subunit 2 1 1
MIRT047003 U2AF2 U2 small nuclear RNA auxiliary factor 2 1 1
MIRT047004 UBA1 ubiquitin like modifier activating enzyme 1 1 1
MIRT047005 ESPL1 extra spindle pole bodies like 1, separase 1 1
MIRT047006 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT047007 SCN1B sodium voltage-gated channel beta subunit 1 1 1
MIRT047008 RCC2 regulator of chromosome condensation 2 1 1
MIRT053179 HSD17B1 hydroxysteroid 17-beta dehydrogenase 1 2 1
MIRT054098 NDUFA4 NDUFA4, mitochondrial complex associated 4 2
MIRT054099 SDHD succinate dehydrogenase complex subunit D 6 4
MIRT054141 STMN1 stathmin 1 3 1
MIRT054142 DIMT1L DIM1 dimethyladenosine transferase 1 homolog 4 2
MIRT054186 ROD1 polypyrimidine tract binding protein 3 3 1
MIRT054203 ALDH5A1 aldehyde dehydrogenase 5 family member A1 4 1
MIRT054204 FOXN3 forkhead box N3 5 2
MIRT054205 MCM3 minichromosome maintenance complex component 3 4 1
MIRT054206 IGFBP3 insulin like growth factor binding protein 3 6 2
MIRT054207 COL4A2 collagen type IV alpha 2 chain 6 2
MIRT054208 INPP5A inositol polyphosphate-5-phosphatase A 4 1
MIRT054209 EHD2 EH domain containing 2 4 1
MIRT054210 SH3BGRL SH3 domain binding glutamate rich protein like 5 2
MIRT054248 PTPN2 protein tyrosine phosphatase, non-receptor type 2 3 1
MIRT054321 LDHA lactate dehydrogenase A 2 1
MIRT054324 LDHB lactate dehydrogenase B 2 1
MIRT054349 HIF1A hypoxia inducible factor 1 alpha subunit 5 2
MIRT054714 FOXP3 forkhead box P3 3 1
MIRT054794 HIF3A hypoxia inducible factor 3 alpha subunit 3 1
MIRT115688 MGRN1 mahogunin ring finger 1 2 3
MIRT170674 INSIG1 insulin induced gene 1 1 1
MIRT437785 BNIP3 BCL2 interacting protein 3 5 2
MIRT438739 KCMF1 potassium channel modulatory factor 1 1 1
MIRT439407 TNPO3 transportin 3 1 1
MIRT439629 SIPA1L3 signal induced proliferation associated 1 like 3 1 1
MIRT439632 SIN3A SIN3 transcription regulator family member A 1 1
MIRT439740 RPL22 ribosomal protein L22 1 1
MIRT439886 PSAP prosaposin 1 1
MIRT439918 PPP1R2 protein phosphatase 1 regulatory inhibitor subunit 2 1 1
MIRT439928 POU2AF1 POU class 2 associating factor 1 1 1
MIRT440033 ICMT isoprenylcysteine carboxyl methyltransferase 2 3
MIRT440255 MEF2D myocyte enhancer factor 2D 1 1
MIRT440491 HMGCS1 3-hydroxy-3-methylglutaryl-CoA synthase 1 2 3
MIRT440570 GIT2 GIT ArfGAP 2 1 1
MIRT440647 FCHSD2 FCH and double SH3 domains 2 1 1
MIRT440830 DEAF1 DEAF1, transcription factor 1 1
MIRT440866 CSNK1E casein kinase 1 epsilon 1 1
MIRT472232 NFIC nuclear factor I C 2 2
MIRT473190 MITF melanogenesis associated transcription factor 2 2
MIRT477856 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 2 2
MIRT497528 ZNF607 zinc finger protein 607 2 2
MIRT509770 SERTM1 serine rich and transmembrane domain containing 1 2 6
MIRT524407 CNTNAP5 contactin associated protein like 5 2 4
MIRT535209 PKIA cAMP-dependent protein kinase inhibitor alpha 2 4
MIRT554511 RUNX1T1 RUNX1 translocation partner 1 2 4
MIRT558069 ESCO2 establishment of sister chromatid cohesion N-acetyltransferase 2 2 2
MIRT572273 KCNJ6 potassium voltage-gated channel subfamily J member 6 2 2
MIRT574255 DOCK7 dedicator of cytokinesis 7 2 4
MIRT575621 Foxn3 forkhead box N3 2 2
MIRT575742 Zfp618 zinc finger protein 618 1 1
MIRT609050 VAMP4 vesicle associated membrane protein 4 2 2
MIRT611143 TNRC6B trinucleotide repeat containing 6B 2 4
MIRT699226 SLCO3A1 solute carrier organic anion transporter family member 3A1 2 2
MIRT703060 GTDC1 glycosyltransferase like domain containing 1 2 2
MIRT716005 ASB11 ankyrin repeat and SOCS box containing 11 2 2
MIRT731682 BTK Bruton tyrosine kinase 3 1
MIRT733090 DLEU2L deleted in lymphocytic leukemia 2-like 3 0
MIRT733091 BRCA2 BRCA2, DNA repair associated 3 0
MIRT733156 ITGA5 integrin subunit alpha 5 1 0
MIRT733501 GATA1 GATA binding protein 1 3 0
MIRT733503 SMAD2 SMAD family member 2 3 0
MIRT733525 MIR210HG MIR210 host gene 2 0
MIRT733615 TGFBI transforming growth factor beta induced 2 0
MIRT734175 KRAS KRAS proto-oncogene, GTPase 2 0
MIRT734293 PTEN phosphatase and tensin homolog 1 0
MIRT734568 STAT6 signal transducer and activator of transcription 6 1 0
MIRT734966 ADAMTS6 ADAM metallopeptidase with thrombospondin type 1 motif 6 1 0
MIRT736294 ID2 inhibitor of DNA binding 2, HLH protein 1 0
MIRT737104 FABP4 fatty acid binding protein 4, adipocyte 3 0
MIRT756028 NTN4 netrin 4 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-210 Vincristine approved 5978 Quantitative real-time PCR Hep-2 cells 23780424 2013 up-regualted
miR-210 Lenalidomide approved 216326 Quantitative real-time PCR peripheral blood CD14+ monocytes 25287904 2014 down-regulated
miR-210 Arsenic trioxide approved 14888 Microarray lymphoblast cell line TK-6 17108120 2006 down-regulated
miR-210 5-Fluorouracil approved 3385 Quantitative real-time PCR colon cancer cells 17702597 2007 down-regulated
miR-210 Arsenic trioxide approved 14888 Microarray HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-210 Arsenic trioxide approved 14888 Quantitative real-time PCR HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-210 Arsenic trioxide approved 14888 Quantitative real-time PCR HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-210 Ginsenoside Rh2 NULL 119307 Microarray human glioma cells U251 21372826 2011 down-regulated
miR-210 Aidi injection NULL NULL Microarray human breast cancer cells 21563499 2011 down-regulated
miR-210 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer HB2 22076154 2011 down-regulated
miR-210 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer MDA-MB231 22076154 2011 down-regulated
miR-210 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer SKBR3 22076154 2011 down-regulated
miR-210 Trastuzumab approved NULL Microarray HER2-positive breast cancer 22384020 2012 down-regulated
miR-210 Trastuzumab approved NULL Quantitative real-time PCR HER2-positive breast cancer 22384020 2012 down-regulated
miR-210 Trastuzumab approved NULL Microarray BT474 cells 22384020 2012 down-regulated
miR-210 Curcumin NULL 969516 Quantitative real-time PCR Y79 RB cells. 22510010 2012 down-regulated
miR-210 Bicalutamide approved 2375 Microarray prostate 22674191 2012 down-regulated
miR-210 Goserelin approved 47725 Microarray prostate 22674191 2012 down-regulated
miR-210 Olea europaea leaf extract NULL NULL Quantitative real-time PCR glioblastoma cells. 22722712 2012 up-regulated
miR-210 Temozolomide approved 5394 Quantitative real-time PCR glioblastoma cells. 22722712 2012 up-regulated
miR-210 Nicotine approved 89594 Microarray Rat adrenal pheochromocytoma PC12 cell 18845019 2009 down-regulated
miR-210 Comfrey NULL 6440495 Microarray rat liver 21370286 2011 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-210 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-mir-210 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-210 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-210 Paclitaxel 36314 NSC125973 approved resistant cell line (W1)
hsa-mir-210 Androstenedione 6128 NSC9563 sensitive cell line (MCF-7)
hsa-mir-210 Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-210 Tamoxifen 2733525 NSC180973 approved resistant tissue (ER-positive breast cancer)
hsa-mir-210 Fluorouracil 3385 NSC19893 approved sensitive cell line (OE19)
hsa-mir-210 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-mir-210 Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)
hsa-miR-210-3p (E)-1-[3,5-bis[(dimethylamino)methyl]-4-hydroxyphenyl]-3-phenylprop-2-en-1-one 6374691 NSC677784 resistant
hsa-miR-210-3p (e)-3-chloro-3-(4-methoxyphenyl)-2-(4-nitrophenyl)prop-2-enal 5387396 NSC623175 resistant
hsa-miR-210-3p [(E)-(1-chloro-2-methylpropylidene)amino] N-anilinocarbamate 5494354 NSC682841 resistant
hsa-miR-210-3p [(E)-1-chloropropylideneamino] N-[2-(trifluoromethoxy)phenyl]carbamate 5466266 NSC682836 resistant
hsa-miR-210-3p [2-[(e)-(carbamothioylhydrazono)methyl]-6-methoxy-phenoxy]-hydroxy-copper; 2-(2-pyridyl)pyridine 135484845 NSC638302 resistant
hsa-miR-210-3p 1-(4-ethoxyphenyl)-3-(2-methyl-5-propan-2-ylphenyl)urea 240168 NSC46213 sensitive
hsa-miR-210-3p 1-(4-nitrophenyl)-3-(2-pyridyl)thiourea 3005383 NSC695329 sensitive
hsa-miR-210-3p 1-(naphthalen-1-ylmethyl)-4-[1-(naphthalen-1-ylmethyl)piperidin-4-yl]piperidine 364095 NSC669995 resistant
hsa-miR-210-3p 1-[2-(4-nitrophenyl)-2-oxoethyl]-4-pentylpyridin-1-ium bromide 24181037 NSC4290 resistant
hsa-miR-210-3p 11-(3-methoxyphenyl)-2,12,15-triazapentacyclo[11.7.1.03,8.09,21.014,19]henicosa-1,3,5,7,9,11,13(21),14(19),15,17-decaen-20-one 54608964 NSC697747 resistant
hsa-miR-210-3p 17-acetyl-9,14-dihydroxy-16-methyl-15-(4-methylphenyl)-15-azatetracyclo[8.7.0.01,14.03,8]heptadeca-3,5,7,9,12,16-hexaene-2,11-dione 405612 NSC722982 resistant
hsa-miR-210-3p 1h-benz[g]indol-5-ol, 2-phenyl 371327 NSC645431 resistant
hsa-miR-210-3p 2-[[4-anilino-5-[8-[4-anilino-5-[(1-hydroxynaphthalen-2-yl)oxymethyl]-1,2,4-triazol-3-yl]octyl]-1,2,4-triazol-3-yl]methoxy]naphthalen-1-ol 394049 NSC697167 resistant
hsa-miR-210-3p 2-[9-[(7-oxocyclohepta-1,3,5-trien-1-yl)amino]nonylamino]cyclohepta-2,4,6-trien-1-one 358331 NSC618296 resistant
hsa-miR-210-3p 2-amino-5,8-dihydroxy-1,4-naphthoquinone 377209 NSC658441 resistant
hsa-miR-210-3p 2-bromo-4-(5-fluoro-1,3-benzothiazol-2-yl)aniline 399248 NSC709925 sensitive
hsa-miR-210-3p 2-hydroxy-5-({(e)-[(10-hydroxyacridin-9(10h)-ylidene)methyl]diazenyl}sulfonyl)benzoic acid 363212 NSC627890 resistant
hsa-miR-210-3p 3'-chloro-3-nitro-o-salicylotoluidide 332278 NSC328477 resistant
hsa-miR-210-3p 3-((4-(methylthio)phenoxy)methyl)-2-oxiranol 366923 NSC636087 resistant
hsa-miR-210-3p 4-(2-phenylethylamino)naphthalene-1,2-dione 367789 NSC637731 resistant
hsa-miR-210-3p 4-[(E)-2-piperidin-1-ylethenyl]benzo[g]quinoline-5,10-dione 5781544 NSC642968 resistant
hsa-miR-210-3p 4-[(r)-[(2s,5r)-2,5-dimethyl-4-prop-2-enylpiperazin-1-yl]-(3-methoxyphenyl)methyl]-n-pentan-3-ylbenzamide;hydrochloride 5471112 NSC708822 resistant
hsa-miR-210-3p 4-[2-(methylamino)-1-methylsulfanylethyl]benzene-1,2-diol 412349 NSC39215 resistant
hsa-miR-210-3p 4-[4-(4-sulfinobutyldisulfanyl)butyldisulfanyl]butane-1-sulfinic acid 361262 NSC624205 resistant
hsa-miR-210-3p 4-acetamido-n-[(e)-(2,4-dichlorophenyl)methylideneamino]-2-methoxybenzamide 9572428 NSC716142 sensitive
hsa-miR-210-3p 4-aminodithiolane-4-carboxylic acid 269217 NSC109825 resistant
hsa-miR-210-3p 4-hydroxy-3-[1-(1-hydroxy-3,4-dioxonaphthalen-2-yl)-3-phenylpropyl]naphthalene-1,2-dione 272651 NSC117274 resistant
hsa-miR-210-3p 4,4-dimethylspiro[1,3,2-oxazaphospholidin-2-ium-2,2'-3h-1,3,2-benzoxazaphosphol-2-ium]-5-one 6330525 NSC351866 resistant
hsa-miR-210-3p 4b-hydroxy-10,10-dimethoxy-9ah-indeno[1,2-a]inden-9-one 363252 NSC628000 resistant
hsa-miR-210-3p 4h,7h-furo[2',3',4':4,5]naphth[2,1-e][1,3]oxazin-4-one, 8-(4-chlorophenyl)-8,9-dihydro- 373969 NSC651001 resistant
hsa-miR-210-3p 5,6,7-trimethoxy-N-(4H-pyrazolo[1,5-a]indol-2-yl)-1H-indole-2-carboxamide 404173 NSC720326 resistant
hsa-miR-210-3p 6-(3-chloropropyl)-3-nitroindeno[1,2-c]isoquinoline-5,11-dione 17755848 NSC731154 resistant
hsa-miR-210-3p 6-benzyloxyhexanal 389877 NSC686505 resistant
hsa-miR-210-3p 7-[(E)-2-(1,6-dimethylquinolin-1-ium-2-yl)ethenyl]-5-methylquinolin-8-ol 135483953 NSC86371 resistant
hsa-miR-210-3p 7-[(naphthalen-1-ylamino)(phenyl)methyl]quinolin-8-ol 256754 NSC84092 resistant
hsa-miR-210-3p 7-chloro-6-n-(2-fluoroethylamino)-5,8-quinolinedione 379079 NSC663286 resistant
hsa-miR-210-3p 7-o,8-o-isopropylidene iriomoteolide 3a 24808220 NSC753164 resistant
hsa-miR-210-3p 9h-quino[4,3,2-de][1,10]phenanthrolin-9-one, 2-phenyl- 4567749 NSC686553 resistant
hsa-miR-210-3p Acetyltrophanthidin 261075 NSC92954 resistant
hsa-miR-210-3p Adenosine, 2-bromo-2'-deoxy- 334838 NSC341936 resistant
hsa-miR-210-3p Asimicinone 393461 NSC695394 resistant
hsa-miR-210-3p Benzo[b]naphtho[2,3-d]furan-6,11-dione, 4-chloro-3-hydroxy 371025 NSC644902 resistant
hsa-miR-210-3p Benzo[g]pteridine-2,4(3h,10h)-dione, 10-(2,4-dimethylphenyl)-3-methyl- 363228 NSC627974 resistant
hsa-miR-210-3p Benzo[g]pteridine-2,4(3h,10h)-dione, 10-(4-chlorophenyl)-3,7,8-trimethyl- 363246 NSC627992 resistant
hsa-miR-210-3p Benzo[g]pteridine-2,4(3h,10h)-dione, 3-methyl-10-[3-(methylthio)phenyl]- 363242 NSC627988 resistant
hsa-miR-210-3p Benzo[g]quinoxaline-5,10-dione, 5,10-dihydro-2,3-dimethyl- 353644 NSC602617 resistant
hsa-miR-210-3p Celcot rm 67277 NSC37168 resistant
hsa-miR-210-3p Cytarabine 6253 NSC287459 approved resistant
hsa-miR-210-3p Destruxin a 122810 NSC361126 resistant
hsa-miR-210-3p Di-p-tolyliodinium bromide 54601177 NSC8985 resistant
hsa-miR-210-3p Diethoxybis(1,4-naphthochinone-2-olato)titanium(iv) 368297 NSC638842 resistant
hsa-miR-210-3p Dihydrorotenone 243725 NSC53866 resistant
hsa-miR-210-3p Diisopropoxybis(1,4-naphthochinone-2-olato)titanium(iv) 368058 NSC638383 resistant
hsa-miR-210-3p Discorhabdin i 135409047 NSC656206 resistant
hsa-miR-210-3p Dpbq 364074 NSC629713 resistant
hsa-miR-210-3p Ethyl 6-chloro-4-phenyl-2-(piperazin-1-ylmethyl)quinoline-3-carboxylate 369623 NSC641536 resistant
hsa-miR-210-3p Ethyl 6-hydroxy-4-(4-methoxyphenyl)-6-methyl-3-oxo-2-phenyl-1,4,5,7-tetrahydroindazole-5-carboxylate 392845 NSC693857 resistant
hsa-miR-210-3p Gnmlngdfmleynr-uhfffaoysa-n 402862 NSC717147 sensitive
hsa-miR-210-3p Gw612286x 9822610 NSC756278 sensitive
hsa-miR-210-3p Gw811761x 6539382 NSC756375 sensitive
hsa-miR-210-3p Herbimycin 6436247 NSC305978 resistant
hsa-miR-210-3p Hypothemycin 5458809 NSC354462 resistant
hsa-miR-210-3p Indole-2,3-dione, 5-methyl-, 3-[(o-nitrophenyl)hydrazone] 3632950 NSC117915 sensitive
hsa-miR-210-3p J3.572.907k 396709 NSC703318 resistant
hsa-miR-210-3p Methyl 10-acetyl-3-(4-methylphenyl)sulfonyl-9-(2-methylprop-1-enyl)-3,10-diazatricyclo[6.4.1.04,13]trideca-1,4,6,8(13),11-pentaene-11-carboxylate NSC621968 resistant
hsa-miR-210-3p Methyl 8-[(4-chlorophenyl)carbamoyl]naphthalene-1-carboxylate 364289 NSC630307 resistant
hsa-miR-210-3p N-(2-morpholin-4-ylethyl)-5-nitroquinolin-4-amine;hydrochloride 372042 NSC646859 resistant
hsa-miR-210-3p N-(3-chloro-1,4-dioxonaphthalen-2-yl)-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1H-2-benzofuran-1-yl)butanamide 369463 NSC641233 resistant
hsa-miR-210-3p N-(3,5-dicyano-2-(4-methylphenyl)-6-oxo-4-phenyl-1(6h)-pyridinyl)-4-methylbenzenesulfonamide 390286 NSC687578 resistant
hsa-miR-210-3p N-[(1E)-1-(1-hydroxypyridin-2-ylidene)ethyl]iminoazepane-1-carbothioamide 5369124 NSC351075 resistant
hsa-miR-210-3p N-[1,1,1,3,3,3-hexafluoro-2-(4-fluoroanilino)propan-2-yl]butanamide 389152 NSC684836 resistant
hsa-miR-210-3p Naphtho[2,3-d]-1,3-dioxepin-6,11-dione, 4-methyl- NSC626868 resistant
hsa-miR-210-3p Naphtho[2,3-d]oxazole-4,9-dione, 2-(1,1-dimethylethyl)- 370622 NSC643915 resistant
hsa-miR-210-3p Niosh/br9826000 359483 NSC620462 resistant
hsa-miR-210-3p NSC619321 NSC619321 sensitive
hsa-miR-210-3p NSC621321 NSC621321 resistant
hsa-miR-210-3p NSC631451 NSC631451 resistant
hsa-miR-210-3p NSC634766 NSC634766 resistant
hsa-miR-210-3p NSC635414 NSC635414 resistant
hsa-miR-210-3p Pentyl 6-(chloromethyl)-2-oxo-2h-chromene-3-carboxylate 402498 NSC716524 resistant
hsa-miR-210-3p Pmp (van) 72508 NSC1906 resistant
hsa-miR-210-3p Scillirosidin, glycoside 222160 NSC7534 resistant
hsa-miR-210-3p Sesbanimide 163490 NSC355461 resistant
hsa-miR-210-3p Snc 80 123924 NSC707484 resistant
hsa-miR-210-3p Streptovaricin b 135443622 NSC156215 resistant
hsa-miR-210-3p Tetratert-butyl 8,11-dimethoxytricyclo[4.3.3.01,6]dodeca-7,10-diene-7,9,10,12-tetracarboxylate 362411 NSC626176 resistant
hsa-miR-210-3p Tolonium chloride 7083 NSC36758 resistant
hsa-miR-210-3p Z48861686 4784054 NSC745813 resistant
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Temozolomide 5394 NSC362856 approved resistant High Glioblastoma cell line (U251MG, U251R, U87MG, M059K, M059J)
hsa-miR-210-3p Imatinib 5291 NSC743414 approved resistant High Myelogenous Leukemia cell line (MYL)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colon Cancer cell line (HT-29)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colon Cancer cell line (HT-29)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant High Ehrlich Ascites Tumor cell line (EHR2,P6, P12, P36, P72, EHR2/1.3)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant High Ehrlich Ascites Tumor cell line (EHR2,P6, P12, P36, P72, EHR2/1.3)
hsa-miR-210-3p Trastuzumab resistant Low Breast Cancer tissue and cell line (BT-474, BTR65)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Vincristine 5978 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant Low Cervical Cancer tissue and cell line (SiHa, Cask)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant High Laryngeal Cancer cell line (Hep2)
hsa-miR-210-3p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-210-3p Docetaxel 148124 NSC628503 approved resistant High Prostate Cancer cell line (DU-145)
hsa-miR-210-3p Asparaginate 5460875 sensitive Low Pediatric Acute Lymphoblastic Leukemia Reh cells
hsa-miR-210-3p Dexamethasone 5743 NSC34521 approved sensitive Low Pediatric Acute Lymphoblastic Leukemia Reh cells
hsa-miR-210-3p Daunorubicin 30323 NSC82151 approved sensitive Low Pediatric Acute Lymphoblastic Leukemia Reh cells
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved sensitive High Esophageal Adenocarcinoma cell line (OE19)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant High Hepatocellular Carcinoma tissue and cell line (HepG2)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (SW1990)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (SW1990)
hsa-miR-210-3p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR20)
hsa-miR-210-3p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR70)
hsa-miR-210-3p Dexamethasone 5743 NSC34521 approved sensitive High Myeloma cell line (MM1R, MM1S)
hsa-miR-210-3p Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-210-3p Daunorubicin 30323 NSC82151 approved sensitive High Acute Myeloid Leukemia cell line (U-937, KG-1)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Ductal Adenocarcinoma cell line (MIA-PaCa-2)
hsa-miR-210-3p Trametinib 11707110 NSC758246 approved sensitive Low Melanoma cell line (MML-1)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-miR-210-3p Tamoxifen 2733525 NSC180973 approved resistant Low Breast Cancer cell line (TAMR4, TAMR8)
hsa-miR-210-3p Aromatase Inhibitor sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Epirubicin 41867 NSC256942 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-210-3p Docetaxel 148124 NSC628503 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-210-3p Vinorelbine 44424639 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-210-3p 1'-Acetoxychavicol acetate 119104 NSC711510 resistant Low Cervical Cancer cell line (Ca Ski, SiHa)
hsa-miR-210-3p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-210-3p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive Low Renal Cell Cancer cell line (Caki-2)
hsa-miR-210-3p Vinblastine 442111 NSC90636 approved sensitive Low Renal Cell Cancer cell line (Caki-2)
hsa-miR-210-3p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colorectal Cancer cell line (LS174T)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Cholangiocarcinoma cell line (KKU-213, KKU-055, KKU-100)
hsa-miR-210-3p Docetaxel 148124 NSC628503 approved resistant Low Breast Cancer tissue
hsa-miR-210-3p Palbociclib 5330286 NSC758247 approved sensitive High Breast Cancer cell line (T47D)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive High Ovarian Cancer cell line (SKOV3)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer cell line (SKOV3)
hsa-miR-210-3p Cetuximab + Folfox(Fluorouracil + Leucovorin + Oxaliplatin) sensitive High Metastatic Colorectal Cancer tissue
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved sensitive Low Colorectal Cancer cell line (HT-29)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Cancer cell line (BXPC-3)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colorectal Adenocarcinoma cell line (HT-29)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Cancer cell line (PANC-1)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant Low Oral Cancer cell line (SAS, HSC-3, HSC-4)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive High Endometrial Serous Carcinoma cell line (USPC1)
hsa-miR-210-3p Imatinib 5291 NSC743414 approved sensitive Low Chronic Myelogenous Leukemia tissue
hsa-miR-210-3p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375)
hsa-miR-210-3p Sunitinib 5329102 NSC750690 approved resistant Low Renal Cell Cancer tissue
hsa-miR-210-3p Temozolomide 5394 NSC362856 approved resistant Low Glioma cell line (U87)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-210-3p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (PLC/PRF5-R1, PLC/PRF5-R2, PLC/PRF5)
hsa-miR-210-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (A375)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (total RNA)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (mitochondrial RNA)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (HeyA8)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM11)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM43)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant cell line (BAS)
hsa-miR-210-3p Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-210-3p Exemestane 60198 NSC713563 approved resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone 6013 NSC9700 approved resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Exemestane resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Letrozole resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Anastrozole resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Tamoxifen resistant cell line (MCF-7)
hsa-miR-210-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-210-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-210-3p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-210-3p Tamoxifen 2733525 NSC180973 approved resistant cell line (TamR4)
hsa-miR-210-3p Tamoxifen 2733525 NSC180973 approved resistant cell line (TamR8)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR20)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR200)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR70)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-210-3p Bortezomib 387447 NSC681239 approved sensitive cell line (CCRF-CEM) (100 nM)
hsa-miR-210-3p Bortezomib 387447 NSC681239 approved sensitive cell line (CCRF-CEM) (200 nM)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (Panc1-GR1)
hsa-miR-210-3p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line (H23)
hsa-miR-210-3p Cetuximab sensitive tissue (colorectal carcinoma)

Error report submission