miRTarBase - #MIRT002336


—
pre-miRNA Information
pre-miRNA mmu-mir-200c   
Genomic Coordinates chr6: 124718322 - 124718390
Description Mus musculus miR-200c stem-loop
Comment Mouse mir-200c is predicted .
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-200c-3p
Sequence 45| UAAUACUGCCGGGUAAUGAUGGA |67
Evidence Experimental
Experiments Cloned
Putative Targets

Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B0Q8FA miR-200c Safety Biomarker (SAF) Clinical/Experimental Data Expression Higher Urine Quantitative polymerase chain reaction
Gene Information
Gene Symbol Zeb1   
Synonyms 3110032K11Rik, AREB6, BZP, MEB1, Nil2, TCF-8, Tcf18, Tcf8, Tw, ZEB, Zfhep, Zfhx1a, Zfx1a, Zfx1ha, [delta]EF1
Description zinc finger E-box binding homeobox 1
Transcript NM_011546   
Expression
Putative miRNA Targets on Zeb1
3'UTR of Zeb1
(miRNA target sites are highlighted)		 
>Zeb1|NM_011546|3'UTR
   1 GAGTTCTTCTAAAAGGAAATTCTACTTGGTAATGAAATTTGCTCTATATTACCCACGCTTTTCATGGAAACATGGCTCCA
  81 TGGCTCCTGTGCTATGGTTCCTGCTCACTACTGTGTAATGTCAGAACTGAAAAAAAAAAAATTCCGGGTGTGCCTGAACC
 161 TCAAACCTAGTAATTTTTCATGCAGTTTTCAAAGTTAGGAACAAATTTATAACATGAAGCAGCTTAGAAAACATTAATGA
 241 CTCAGAAAACAAAGGTTTCTCAGCAGGTTACAGGAGGCTGGATGGGCGTCCGGCATGGCTAGCAGTATTATCACTCTTAC
 321 GTTGGCTCATTCTTAAGCTCTACAATGGGAGAAATTTTATAATTTTTTTATTGGTAAACATATGCTAAATCCGCTTCAGT
 401 ATTTTATTATGTTTTTTAAAATGTGAGAACTTCTGCACTACAGAATTCCCTTCACAGAGCAGTAGAAAGCAGTTCAAACC
 481 GTGCTGGCTACCTGCTGCTACCCAGTCAGTCAGGAGATAGGACCTCTGACGTTAGATGCCGTGTTGCCATCTAACATGTA
 561 TTGCTAGCCTTAAGGAAGCAGCCAGAGAAGAGCTGGAGTTTCTTACTCGTGTGATTTTTAAATGGAGTTCAAAGGTTGTC
 641 GTTGAGTCCTGACTCCAGGGACGACCAGTGTTGATGTGGCAAGGCCGGCAGAGGCGGCAGAATCAGTGTTCGTGATTGTT
 721 TGCGTACGTTAGCAACCATGAAGGATCTATAGGAAGCAAGCGCTGTGTCCCTTTGGCCTTAAGCAAGACCTGTGCTCTAA
 801 GTGCCATTCTCAGTATTGCAAGGCTCTGACAGCCTTCCCGCAGTGTGGCCTATATTAACTAGCAGTTGTTGATTCGTTTG
 881 TTGTGTCAAAATTCCCAAACAAAACTCAAAACCACTGACTGTGAGAGAAGCTGAAGCACTGGGGCATCTCACACTTTTGT
 961 TCCTCAGTAGTCATTTCATGTTGATTGACTCTCAGAAGTCTCTACAGAAATAAAAGGGAAATTCTCCAAACTACTTAATC
1041 CATGTACTTGCGTGTCAGGCATGGATACGCTATTGGTTTTTGGTTCACAGCCGTTTTCCAAATGTTAGTTATTACGGACC
1121 CAGGTGATGAACAACAGCAGCTGATTTTTACCTACCAGTATTATTTTATTTCTTTTAGTTTATAGATCTGTGCAACATTT
1201 TTGTACTGTATGTCTTTAAGCCTGGCAGTATTAATACCCTTCTTACTGACACGTACTTTTAGTTTTAGAAAACTTTTATA
1281 TTTATGTGTCTTATTTTTATATTTCTTTATTTATTACACAGTGTAGTGTATAATACTGTAGTTTGTATTAATACAATAAT
1361 ATATTTTAGTATGAAATTTTGGAAAGTTGCTAAGATTTACAGTAGAGATGCAGTTGGTTCCCGTGCGTTGAGATTTGATT
1441 TAACAGTGTTCTGTTAACATTTATACTTGCCTCCGACTGTAGACCAGCCTTTAAATGGGAAGGTATTAGTTTTACAACTA
1521 CAATCAAGTCATTCTCCCTTTCCCCAGTTTTTAATAGGAAACTCTTACACTTTGACACTCACTGTGTGCGACTCATAGCA
1601 TGCCGCTCTGCAGTCTTCTGTTAAGAGTTGGCCCAGCCATAACTCATTCCCTTAGCAAGCCAAATTAGAATTGCCTTCTG
1681 TAAACAGTGTTGGGAACAATGTTTAACATGTGCCAATTTGTTCCTGTATCCATGTATGTAAGCTACCAATCTGACTCTTC
1761 CTTTTAAGTTCCTTGTTACACCATGGTCATTTTCTAGTTTTTTACCAGACTCCCCAGCTCACAATAAACGCATCAACAAA
1841 CCTGACCTGCTGTCGTTCTTTGGATCATCAAATTTCCTTTGGAAAATTGTCTATGAAGTGGGCATTACATCCTAGAGCTT
1921 CATTCATCTTGAGCTGAGTTTGTTGACACAAAGTATTTGAGACACTTAGCACAAAGAATGCCTTTTCCTGTGGGGGAAAT
2001 TCCCTGAGGAAGCCCTCTGCACAGGTTGTCCCTTCTTCCAAAACCCACAGAGCAAGAGCCTTCCCCTCAGGGAACATCAG
2081 GGCTGTGCAAGCTTAAGATGCTTTTTGCTTGTACTCTGCCACTCTTTGAACCCTTCTCATTCAGCTCAAGGACTGTCACT
2161 GATGTTCCTCCCCATGTCATGGTCATGCCTCATGTGCCCCCTGCCCATGAACTGCCTCTCAACAGACATTCATTGAATGA
2241 ACACAGAAACTGCACATTTGCAGAGCTTAGCTGTGCTCACTGTTTTGCCTCTAATCTGAAAGTTCATAAGGTAAATGATT
2321 CCCATAATGTGCCGGTGGTCTTGTTTGAGTCTTATAGGCACTTACCATAGGAGATGTAATAAATGACTGCCTTGGAAGCT
2401 GC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agGUAGUAAU--GGGCCGUCAUAAu 5'
            ::|| |||  ||:||||||||| 
Target 5' taTGTCTTTAAGCCTGGCAGTATTa 3'
 1209 - 1233 175.00 -20.90
2 
miRNA  3' aggUAGUAAUGGGCCGUCAUAAu 5'
             ||: |||||:  ||||||| 
Target 5' ctgATTTTTACCTACCAGTATTa 3'
 1141 - 1163 168.00 -13.50
3 
miRNA  3' agGUAGUAAUGGGCCGUCAUAAu 5'
            |: || |: |: |||||||| 
Target 5' tcCGGCA-TGGCTAGCAGTATTa 3'
 289 - 310 156.00 -18.30
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions 4TO7
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... "Co-transfection of the reporter plasmid with miR-200b and/or 200c in the 4TO7 cells significantly reduced luciferase expression ( ...

- Dykxhoorn DM; Wu Y; Xie H; Yu F; Lal A; et al., 2009, PloS one.

Article - Dykxhoorn DM; Wu Y; Xie H; Yu F; Lal A; et al.
- PloS one, 2009
BACKGROUND: The development of metastases involves the dissociation of cells from the primary tumor to penetrate the basement membrane, invade and then exit the vasculature to seed, and colonize distant tissues. The last step, establishment of macroscopic tumors at distant sites, is the least well understood. Four isogenic mouse breast cancer cell lines (67NR, 168FARN, 4TO7, and 4T1) that differ in their ability to metastasize when implanted into the mammary fat pad are used to model the steps of metastasis. Only 4T1 forms macroscopic lung and liver metastases. Because some miRNAs are dysregulated in cancer and affect cellular transformation, tumor formation, and metastasis, we examined whether changes in miRNA expression might explain the differences in metastasis of these cells. METHODOLOGY/PRINCIPAL FINDINGS: miRNA expression was analyzed by miRNA microarray and quantitative RT-PCR in isogenic mouse breast cancer cells with distinct metastatic capabilities. 4T1 cells that form macroscopic metastases had elevated expression of miR-200 family miRNAs compared to related cells that invade distant tissues, but are unable to colonize. Moreover, over-expressing miR-200 in 4TO7 cells enabled them to metastasize to lung and liver. These findings are surprising since the miR-200 family was previously shown to promote epithelial characteristics by inhibiting the transcriptional repressor Zeb2 and thereby enhancing E-cadherin expression. We confirmed these findings in these cells. The most metastatic 4T1 cells acquired epithelial properties (high expression of E-cadherin and cytokeratin-18) compared to the less metastatic cells. CONCLUSIONS/SIGNIFICANCE: Expression of miR-200, which promotes a mesenchymal to epithelial cell transition (MET) by inhibiting Zeb2 expression, unexpectedly enhances macroscopic metastases in mouse breast cancer cell lines. These results suggest that for some tumors, tumor colonization at metastatic sites might be enhanced by MET. Therefore the epithelial nature of a tumor does not predict metastatic outcome.
LinkOut: [PMID: 19787069]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Oba S; Kumano S; Suzuki E; Nishimatsu H; et al.
- PloS one, 2010
Members of the miR-200 family of micro RNAs (miRNAs) have been shown to inhibit epithelial-mesenchymal transition (EMT). EMT of tubular epithelial cells is the mechanism by which renal fibroblasts are generated. Here we show that miR-200 family members inhibit transforming growth factor-beta (TGF-beta)-induced EMT of tubular cells. Unilateral ureter obstruction (UUO) is a common model of EMT of tubular cells and subsequent tubulointerstitial fibrosis. In order to examine the role of miR-200 family members in tubulointerstitial fibrosis, their expression was investigated in the kidneys of UUO mice. The expression of miR-200 family miRNAs was increased in a time-dependent manner, with induction of miR-200b most pronounced. To clarify the effect of miR-200b on tubulointerstitial fibrosis, we injected miR-200b precursor intravenously. A single injection of 0.5 nM miR-200b precursor was sufficient to inhibit the increase of collagen types I, III and fibronectin in obstructed kidneys, and amelioration of fibrosis was confirmed by observation of the kidneys with Azan staining. miR-200 family members have been previously shown to inhibit EMT by reducing the expression of ZEB-1 and ZEB-2 which are known repressors of E-cadherin. We demonstrated that expression of ZEB-1 and ZEB-2 was increased after ureter obstruction and that administration of the miR-200b precursor reversed this effect. In summary, these results indicate that miR-200 family is up-regulated after ureter obstruction, miR-200b being strongly induced, and that miR-200b ameliorates tubulointerstitial fibrosis in obstructed kidneys. We suggest that members of the miR-200 family, and miR-200b specifically, might constitute novel therapeutic targets in kidney disease.
LinkOut: [PMID: 21049046]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293T
Disease MIMAT0000657
Location of target site 3'UTR
Tools used in this research unspecified
Original Description (Extracted from the article) ... "Our results reveal roles for miR-200b and miR-429 ...

- Hasuwa H; Ueda J; Ikawa M; Okabe M, 2013, Science (New York, N.Y.).

Article - Hasuwa H; Ueda J; Ikawa M; Okabe M
- Science (New York, N.Y.), 2013
Ovulation in the mouse and other mammals is controlled by hormones secreted by the hypothalamo-pituitary-ovarian axis. We describe anovulation and infertility in female mice lacking the microRNAs miR-200b and miR-429. Both miRNAs are strongly expressed in the pituitary gland, where they suppress expression of the transcriptional repressor ZEB1. Eliminating these miRNAs, in turn, inhibits luteinizing hormone (LH) synthesis by repressing transcription of its beta-subunit gene, which leads to lowered serum LH concentration, an impaired LH surge, and failure to ovulate. Our results reveal roles for miR-200b and miR-429, and their target the Zeb1 gene, in the regulation of mammalian reproduction. Thus, the hypothalamo-pituitary-ovarian axis was shown to require miR-200b and miR-429 to support ovulation.
LinkOut: [PMID: 23765281]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions AML-12
Disease ischemia
Location of target site 3'UTR
Tools used in this research miRBase Target Database , TargetScan
Original Description (Extracted from the article) ... ZEB1 is found as a target gene of miR-200c and is involved in H2O2-induced apoptosis ...

- Wu Y; Gu C; Huang X, 2016, Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' agguaguaaUGGGC--CGUCAUAAu 5'
                   |:|||   ||||||| 
Target 5' --augcuaaAUCCGCUUCAGUAUUu 3'
 		1 - 23
Article - Wu Y; Gu C; Huang X
- Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 2016
This present study was aimed to investigate the molecular mechanisms involved in sevoflurane protection of hepatic ischemia-reperfusion (I/R) injury. Firstly, we investigated the protective effects of sevoflurane against hepatic I/R injury. Biochemical analysis results showed that sevoflurane preconditioning significantly protected against hepatic I/R injury by reducing liver enzymes and improving antioxidant defense markers. We also found that sevoflurane attenuates I/R-induced hepatic cell death, by TUNEL staining, DNA fragmentation ELISA and PARP activity determination. Next, In order to find the molecular mechanism of sevoflurane preconditioning in hepatic I/R injury, we poured our attention to microRNAs regulation. We focused on miR-200c, one of microRNAs which screened from the gene expression omnibus (GEO). Furthermore, a hydrogen peroxide (H2O2)-induced oxidative stress apoptosis model was also established to mimic hepatic I/R injury, the effects of MiR-200c was investigated. We observed that MiR-200c inhibition decreased the H2O2-induced apoptosis of hepatic AML-12 cells. And also, ZEB1 is found as a target gene of miR-200c and is involved in H2O2-induced apoptosis. On the other hand, the in vivo model was established to examine whether sevoflurane protect against hepatic IR injury by downregulating MiR-200c. Together with the biochemical tests and apoptosis detection, results showed that over-expression of miR-200c significantly inhibited the protect effect of sevoflurane in Hepatic IR injury. Summarizing, sevoflurane preconditioning seems to ameliorate hepatic I/R injury in mice, mediated by mechanisms that include microRNA 200c down regulation. However, further more studies need to be carried out to verify this point.
LinkOut: [PMID: 27780142]
33 mmu-miR-200c-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT002336 Zeb1 zinc finger E-box binding homeobox 1 4 3
MIRT002337 Zeb2 zinc finger E-box binding homeobox 2 3 4
MIRT005946 Flt1 FMS-like tyrosine kinase 1 1 1
MIRT006426 Mapk14 mitogen-activated protein kinase 14 2 1
MIRT009810 ZEB1 zinc finger E-box binding homeobox 1 1 1
MIRT009811 ZEB2 zinc finger E-box binding homeobox 2 1 1
MIRT053235 Sox2 SRY (sex determining region Y)-box 2 4 1
MIRT418784 Map2 microtubule-associated protein 2 1 1
MIRT438019 Bmi1 Bmi1 polycomb ring finger oncogene 2 1
MIRT438582 Zfpm2 zinc finger protein, multitype 2 2 1
MIRT438658 Nog noggin 5 1
MIRT577097 Fhod1 formin homology 2 domain containing 1 1 3
MIRT577625 St3gal2 ST3 beta-galactoside alpha-2,3-sialyltransferase 2 1 1
MIRT578593 Hist1h1d histone cluster 1, H1d 1 4
MIRT579059 Cradd CASP2 and RIPK1 domain containing adaptor with death domain 1 1
MIRT581140 Senp5 SUMO/sentrin specific peptidase 5 1 2
MIRT581298 Rnf166 ring finger protein 166 1 1
MIRT581364 Rdh10 retinol dehydrogenase 10 (all-trans) 1 1
MIRT581743 Plxnc1 plexin C1 1 1
MIRT581831 Pkib protein kinase inhibitor beta, cAMP dependent, testis specific 1 1
MIRT582081 Ogfod1 2-oxoglutarate and iron-dependent oxygenase domain containing 1 1 2
MIRT582414 Mphosph9 M-phase phosphoprotein 9 1 2
MIRT582457 Mgat3 mannoside acetylglucosaminyltransferase 3 1 1
MIRT582940 Ikzf5 IKAROS family zinc finger 5 1 1
MIRT583984 Ddx26b integrator complex subunit 6 like 1 1
MIRT595499 Mtf2 metal response element binding transcription factor 2 1 1
MIRT595530 Foxn3 forkhead box N3 1 1
MIRT596310 Rassf10 Ras association (RalGDS/AF-6) domain family (N-terminal) member 10 1 1
MIRT596609 Zfp459 zinc finger protein 459 1 1
MIRT601132 Bri3bp Bri3 binding protein 1 1
MIRT603385 Sh2d4a SH2 domain containing 4A 1 1
MIRT731202 Reln reelin 2 1
MIRT756395 Cd274 CD274 antigen 1 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-200c All-trans-retinoic acid (ATRA) approved 444796 Quantitative real-time PCR breast cancer cells 23904188 2013 up-regualted
miR-200c Glucose NULL 5793 Microarray endothelial cells 24394957 2014 up-regulated
miR-200c Hydroxamic acid HDACi LAQ824 NULL NULL Microarray breast cancer cell line SKBr3 16452179 2006 up-regulated
miR-200c Trichostatin A (TSA) NULL 444732 Microarray human pancreatic cancer cell line BxPC-3 19112422 2009 up-regulated
miR-200c Trichostatin A (TSA) NULL 444732 Northern blot human pancreatic cancer cell line BxPC-3 19112422 2009 up-regulated
miR-200c 17beta-estradiol (E2) approved 5757 Microarray MCF-7 breast cancer cells 19528081 2009 up-regulated
miR-200c Activin A NULL 229455 Quantitative real-time PCR Human embryonic stem (hES) cells 19885849 2010 up-regulated
miR-200c 5-Fluorouracil approved 3385 Microarray HCT-8 colon cancer cell line 19956872 2010 down-regulated
miR-200c CDF(analogues of curcumin) NULL NULL Quantitative real-time PCR pancreatic cancer (gemcitabine-sensitive) BxPC-3 cells and gemcitabine-resistant MIAPaCa-E (relatively resistant to gemcitabine) and MIAPaCa-M (highly resistant to gemcitabine) 20388782 2010 up-regulated
miR-200c CDF(analogues of curcumin) + gemcitabine NULL NULL Quantitative real-time PCR pancreatic cancer (gemcitabine-sensitive) BxPC-3 cells and gemcitabine-resistant MIAPaCa-E (relatively resistant to gemcitabine) and MIAPaCa-M (highly resistant to gemcitabine) 20388782 2010 up-regulated
miR-200c 5-Fluorouracil approved 3385 Microarray MCF-7 breast cancer cells 21506117 2011 up-regulated
miR-200c 1,3-bis(2 chloroethyl)-1-nitrosourea (BCNU) NULL 2578 Quantitative real-time PCR Human umbilical vein endothelial cells 21527937 2011 up-regulated
miR-200c Hydrogen peroxide (H2O2) NULL 784 Quantitative real-time PCR Human umbilical vein endothelial cells 21527937 2011 up-regulated
miR-200c DNA methyltransferases (DNMTs) + 5-azacytidine (5-AzaC) NULL NULL Quantitative real-time PCR umbilical cord blood-derived multipotent stem cells(hUCB-MSCs) 21572997 2011 up-regulated
miR-200c Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-200c Metformin approved 4091 Quantitative real-time PCR pancreatic cancer cells 22086681 2012 up-regulated
miR-200c Metformin approved 4091 Quantitative real-time PCR pancreatic cancer cells 22086681 2012 up-regulated
miR-200c CDF(analogues of curcumin) NULL NULL Quantitative real-time PCR pancreatic cancer cells 22108826 2012 up-regulated
miR-200c Marine fungal metabolite 1386A NULL NULL Microarray MCF-7 breast cancer cells. 22159329 2012 up-regulated
miR-200c Paclitaxel + Cyclopamine NULL NULL Quantitative real-time PCR prostate cancer cell 22768203 2012 up-regulated
miR-200c Catechin approved 9064 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-200c Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 down-regulated
miR-200c Tert-butyl hydroperoxide (t-BHP) NULL 6410 Microarray mouse auditory cells 20510889 2010 up-regulated
miR-200c Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 up-regulated
miR-200c Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 down-regulated
miR-200c Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-200c Curcumin NULL 969516 Quantitative real-time PCR Y79 RB cells. 22510010 2012 up-regulated
miR-200c Furan NULL 8029 Quantitative real-time PCR liver 22079235 2011 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
mmu-miR-200c-3p Paclitaxel 36314 NSC125973 approved sensitive Low Ovarian Cancer tissue and cell line (HeyTGL)
mmu-miR-200c-3p Docetaxel 148124 NSC628503 approved sensitive Low Gastric Cancer tissue and cell line (BGC-823)
mmu-miR-200c-3p Erlotinib 176870 NSC718781 approved resistant Low Non-Small Cell Lung Cancer tissue and cell line (PC-9, ErlR)
mmu-miR-200c-3p Trastuzumab sensitive Low Breast Cancer tissue and cell line (SKBR3)

Error report submission