miRTarBase - #MIRT002447


—
pre-miRNA Information
pre-miRNA hsa-mir-96   
Genomic Coordinates chr7: 129774692 - 129774769
Synonyms DFNA50, MIRN96, hsa-mir-96, miR-96, miRNA96, MIR96
Description Homo sapiens miR-96 stem-loop
Comment This sequence is localised to chromosome 7 and was named mir-96-7 in reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-96-5p
Sequence 9| UUUGGCACUAGCACAUUUUUGCU |31
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
865 5 ClinVar
866 6 ClinVar
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs587776522 5 dbSNP
rs587776523 6 dbSNP
rs776335197 10 dbSNP
rs1483018024 12 dbSNP
rs772409471 14 dbSNP
rs1333938704 17 dbSNP
rs957232317 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BS5P4Z miR-96 Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Plasma Quantitative reverse transcription PCR
Gene Information
Gene Symbol HTR1B   
Synonyms 5-HT-1B, 5-HT-1D-beta, 5-HT1B, 5-HT1DB, HTR1D2, HTR1DB, S12
Description 5-hydroxytryptamine receptor 1B
Transcript NM_000863   
Expression
Putative miRNA Targets on HTR1B
3'UTR of HTR1B
(miRNA target sites are highlighted)		 
>HTR1B|NM_000863|3'UTR
   1 CTTGCCGTTTGCAGTGGGGTCGCCTAAGCGACCTTTGGGGACCAAGTTGTGTCTGGTTCCACAGGTAGGTCGAATCTTCT
  81 TTCGCGGTTTCTGGGTCCCAGCGAGGCTCTCTCTCCTGGGCAAGGGCAATGGATCCTGAGAAGCCAGAATAGTCCTGAGA
 161 GAGAGCTCTGAAAGGAGAAGTGTTGAAACTAAATGTAGAGCTTCCCTGCCCAGGAGGAGGCTCACTTCCTCCCCTCAAGC
 241 CCCGGGCTCAGCACTGACCCTGCGGCAGCCAATCCCAAAGGGGGTTGCAACTTTTAAAAATTGATAATGGAAGGGAATCC
 321 CTGCCCTGCTTTGGTATCGTGGATAATGCCCACTAGAAGCAGTGTACTTGTAATTGTTGTCTGAAGCCTGTCTGAGACAG
 401 ATCTACATACAGCCTGGCAGTACTTGAACTAGACGCTTAATGCCCTGTGTTTTTGGGGGGAGAACTTTGTGTTACAGCTT
 481 AATTTAAGAACAGTTACTTTGGCATCATTCAGTCTTCACTTTTTGTCTATTTAAACTTGGTTGGAGAAACTTGTGGATTT
 561 GGTGCTTCAAACCCTATGTGTGGCTTGGATGGCGCAGAGAAACCTTGAAGAGTTAACAGCAAAATTCTGATGCTGAGATC
 641 TCTATTTTTATTATACTTGAAACTATATGGGGGTGGGTGGGTGGGAATGGGAGATGAGGAGTGTTAAACTGAGAATCAAC
 721 ACCTATGATTGTTTGTTTTCTGCAGATTTACAATTTTGTAATTCCTGTTTAGCGATTGTCAAGCCACAACTCTAACAAAC
 801 AAACCATTATGTGTGCTAGTGCCGAAGTCTGCAGACTGCTTTATTTTTTCTCTTAATTTCATGTACCTGTCACTTTACAC
 881 ATTTAAATCCCCATAAATGAAGGGTATGATGGGTGACTCAGCCCACACTGCTGCTATATTTCTTACTAATGCAATTGGTA
 961 AAACCGATTAGTATTGGAAATATACTGTTTCTTAACAAGAAAAGTGTCTTTATTTCTTATCCAATTTAGTGAGATGTGAA
1041 GGAGACTGATGACATGGGGATAGTTCTTACACAATTGAGGAATGGGGTGGGGGCAATAGGAGGATGTATATTTTGACTTG
1121 TAAAAAAATCTTAAAATGCATGAAACTTTTATCTGATAGTCATTTGCACTCTCCTTCCCATCTGTGATTCCTTGTGTGCT
1201 AACATATAAAGAAACCAAGAGAACTATCTTCCTTCTCCAGAAACCTTAAAAATACAGTTAAGGGCCCTAAAAACGATATT
1281 GAAAAGAAAATAAACTTGTTTCTTTTTTGTTGTTGTTGTTATTGAAGTTTGGGCAGGAGAAAAGATTGCTAGAAAATGAC
1361 ATATAAGAACTTTAGAAAAGCTT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ucguuUUUACACGAUCACGGUUu 5'
               | :||||||||||||:| 
Target 5' ccattATGTGTGCTAGTGCCGAa 3'
 804 - 826 162.00 -25.20
2 
miRNA  3' ucgUUUUUACACGAUCACGGUUu 5'
             ::|:||| |  ||||::|| 
Target 5' atgGGAGATGAG-GAGTGTTAAa 3'
 687 - 708 127.00 -11.60
3 
miRNA  3' ucguuuuuACAC----GA--UCACGGUUu 5'
                  ||||    ||   ||||:|| 
Target 5' ttcccatcTGTGATTCCTTGTGTGCTAAc 3'
 1175 - 1203 127.00 -7.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN14241105 11 COSMIC
COSN30671363 22 COSMIC
COSN20699663 29 COSMIC
COSN30667100 33 COSMIC
COSN8514769 63 COSMIC
COSN26438515 83 COSMIC
COSN18719106 84 COSMIC
COSN4958073 106 COSMIC
COSN1337121 157 COSMIC
COSN30245494 258 COSMIC
COSN23353059 355 COSMIC
COSN15411555 400 COSMIC
COSN20447776 459 COSMIC
rs6297 7 GWAS
rs13212041 824 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1338292911 1 dbSNP
rs1379989095 2 dbSNP
rs770905837 6 dbSNP
rs6297 7 dbSNP
rs549044555 8 dbSNP
rs1186882420 14 dbSNP
rs3827804 16 dbSNP
rs1283019706 18 dbSNP
rs201244159 19 dbSNP
rs781514771 20 dbSNP
rs199958336 21 dbSNP
rs1418326016 22 dbSNP
rs1301327058 26 dbSNP
rs1284594171 29 dbSNP
rs751157790 31 dbSNP
rs976107076 32 dbSNP
rs1283110317 33 dbSNP
rs879177240 34 dbSNP
rs1262234662 35 dbSNP
rs765998073 39 dbSNP
rs766405382 41 dbSNP
rs1359165972 44 dbSNP
rs1037180131 45 dbSNP
rs1447500052 46 dbSNP
rs1356534795 47 dbSNP
rs1296261503 49 dbSNP
rs1418929755 50 dbSNP
rs1360902383 51 dbSNP
rs1271556683 55 dbSNP
rs202034124 56 dbSNP
rs1453205958 68 dbSNP
rs964326100 71 dbSNP
rs201148078 72 dbSNP
rs552891807 80 dbSNP
rs1216679824 84 dbSNP
rs1408116668 85 dbSNP
rs949513998 86 dbSNP
rs1192887192 92 dbSNP
rs1258089694 94 dbSNP
rs1476088838 96 dbSNP
rs1185512160 100 dbSNP
rs1412706228 102 dbSNP
rs749695827 106 dbSNP
rs896601300 109 dbSNP
rs1055210550 110 dbSNP
rs1342945632 112 dbSNP
rs1399799676 113 dbSNP
rs1298158452 115 dbSNP
rs1376566043 116 dbSNP
rs1417076939 116 dbSNP
rs534264154 117 dbSNP
rs938035700 119 dbSNP
rs1385183254 127 dbSNP
rs1159895257 129 dbSNP
rs1282790186 138 dbSNP
rs1471537715 147 dbSNP
rs1224558858 151 dbSNP
rs1367322333 154 dbSNP
rs1184757470 156 dbSNP
rs574789017 157 dbSNP
rs1446960534 160 dbSNP
rs759713904 161 dbSNP
rs769934603 162 dbSNP
rs140792648 166 dbSNP
rs979096185 167 dbSNP
rs947294068 173 dbSNP
rs554770523 183 dbSNP
rs1208556199 189 dbSNP
rs913072691 190 dbSNP
rs1470360955 198 dbSNP
rs538031299 200 dbSNP
rs1178604879 210 dbSNP
rs1405304529 211 dbSNP
rs957235837 213 dbSNP
rs569071651 220 dbSNP
rs1208224342 227 dbSNP
rs1355731675 228 dbSNP
rs73469291 231 dbSNP
rs965167840 233 dbSNP
rs1358974329 236 dbSNP
rs1019356918 241 dbSNP
rs1443336102 242 dbSNP
rs867152458 244 dbSNP
rs1384884215 247 dbSNP
rs1295183449 249 dbSNP
rs555115312 256 dbSNP
rs985173686 259 dbSNP
rs953715390 260 dbSNP
rs1350067901 262 dbSNP
rs539073414 264 dbSNP
rs9361234 266 dbSNP
rs183156887 269 dbSNP
rs1016247381 275 dbSNP
rs1013608021 281 dbSNP
rs1457040844 284 dbSNP
rs530047898 285 dbSNP
rs1396379104 295 dbSNP
rs1451982276 300 dbSNP
rs144949072 303 dbSNP
rs896655395 304 dbSNP
rs550860050 306 dbSNP
rs1055220327 310 dbSNP
rs1427152982 315 dbSNP
rs938045569 324 dbSNP
rs755028939 326 dbSNP
rs1326768708 328 dbSNP
rs1373325959 333 dbSNP
rs76194807 333 dbSNP
rs116501140 337 dbSNP
rs913174486 338 dbSNP
rs1216174502 342 dbSNP
rs1255928500 348 dbSNP
rs1475952483 353 dbSNP
rs1244127370 354 dbSNP
rs1213956320 359 dbSNP
rs1254450473 364 dbSNP
rs1197104717 367 dbSNP
rs191457115 370 dbSNP
rs758386210 372 dbSNP
rs1451234816 373 dbSNP
rs943912796 388 dbSNP
rs1246697365 397 dbSNP
rs1476029519 398 dbSNP
rs1224782367 400 dbSNP
rs912355262 402 dbSNP
rs1170090283 412 dbSNP
rs73469290 429 dbSNP
rs1465393088 430 dbSNP
rs1165971234 435 dbSNP
rs1396929772 438 dbSNP
rs953774831 441 dbSNP
rs1322963503 453 dbSNP
rs1327034572 454 dbSNP
rs1272421426 455 dbSNP
rs1213863834 456 dbSNP
rs1491399235 460 dbSNP
rs559131611 460 dbSNP
rs58138557 461 dbSNP
rs796066904 461 dbSNP
rs945739798 462 dbSNP
rs542193930 464 dbSNP
rs912890279 465 dbSNP
rs1344442499 472 dbSNP
rs1303337827 488 dbSNP
rs1284361127 496 dbSNP
rs1406265861 501 dbSNP
rs919652114 506 dbSNP
rs973795065 511 dbSNP
rs1261614108 512 dbSNP
rs1477725231 525 dbSNP
rs1170363518 529 dbSNP
rs957119836 537 dbSNP
rs1471933899 539 dbSNP
rs1162833522 542 dbSNP
rs1385795372 546 dbSNP
rs1402487683 553 dbSNP
rs1296312216 558 dbSNP
rs1034479276 562 dbSNP
rs1415229889 563 dbSNP
rs961326343 567 dbSNP
rs1015890075 568 dbSNP
rs1411009226 576 dbSNP
rs1422162260 581 dbSNP
rs532960125 583 dbSNP
rs1171168088 593 dbSNP
rs564331700 594 dbSNP
rs1279729532 596 dbSNP
rs960874172 597 dbSNP
rs1201803282 602 dbSNP
rs1482123956 604 dbSNP
rs1251089138 609 dbSNP
rs971613359 615 dbSNP
rs1284573506 616 dbSNP
rs1024247262 619 dbSNP
rs1258721445 619 dbSNP
rs1488246322 619 dbSNP
rs1004788258 624 dbSNP
rs1187150582 627 dbSNP
rs887143432 631 dbSNP
rs1203816053 632 dbSNP
rs1441678663 638 dbSNP
rs1156918155 644 dbSNP
rs1033820868 648 dbSNP
rs1435268030 664 dbSNP
rs113775592 666 dbSNP
rs554856313 667 dbSNP
rs544473565 668 dbSNP
rs1217295675 671 dbSNP
rs1399833778 671 dbSNP
rs1002111567 674 dbSNP
rs905147829 678 dbSNP
rs1406321362 679 dbSNP
rs1043391535 682 dbSNP
rs1297088694 683 dbSNP
rs1395205918 684 dbSNP
rs1443617961 685 dbSNP
rs1382395741 691 dbSNP
rs898590494 696 dbSNP
rs1307899419 699 dbSNP
rs773615500 719 dbSNP
rs1044184481 725 dbSNP
rs1009602297 726 dbSNP
rs1332730650 727 dbSNP
rs942901809 739 dbSNP
rs891271446 759 dbSNP
rs1251587912 767 dbSNP
rs892460373 768 dbSNP
rs865887910 773 dbSNP
rs1430350267 776 dbSNP
rs1459256061 777 dbSNP
rs1178860459 779 dbSNP
rs946392342 780 dbSNP
rs1386732588 781 dbSNP
rs1051321562 787 dbSNP
rs1052968519 788 dbSNP
rs946299012 789 dbSNP
rs1178191446 791 dbSNP
rs1375837315 794 dbSNP
rs913446572 804 dbSNP
rs550641100 805 dbSNP
rs935639290 816 dbSNP
rs13212041 824 dbSNP
rs1177820174 827 dbSNP
rs1330214584 828 dbSNP
rs559100296 838 dbSNP
rs1442432167 843 dbSNP
rs1481635180 856 dbSNP
rs756864198 860 dbSNP
rs200844239 861 dbSNP
rs186469534 863 dbSNP
rs1460707131 873 dbSNP
rs1252260201 881 dbSNP
rs1320380634 893 dbSNP
rs1263521337 899 dbSNP
rs1257627078 904 dbSNP
rs1225025292 911 dbSNP
rs566938421 912 dbSNP
rs1326609914 913 dbSNP
rs753468961 921 dbSNP
rs983408702 922 dbSNP
rs1265259517 924 dbSNP
rs1432525235 927 dbSNP
rs147248718 928 dbSNP
rs1425532447 931 dbSNP
rs919721300 936 dbSNP
rs1169573884 942 dbSNP
rs9448091 950 dbSNP
rs961077568 955 dbSNP
rs1459049103 962 dbSNP
rs908172549 965 dbSNP
rs992425596 972 dbSNP
rs963011645 983 dbSNP
rs1018383190 986 dbSNP
rs1407387678 990 dbSNP
rs960926255 994 dbSNP
rs1342819280 996 dbSNP
rs1007372969 997 dbSNP
rs1257730161 999 dbSNP
rs1033912209 1000 dbSNP
rs1002400822 1002 dbSNP
rs536661783 1003 dbSNP
rs1263770401 1007 dbSNP
rs1488168274 1009 dbSNP
rs748622064 1011 dbSNP
rs1051207518 1012 dbSNP
rs1265210755 1020 dbSNP
rs1010325712 1021 dbSNP
rs1192654610 1033 dbSNP
rs1455889146 1034 dbSNP
rs968612254 1042 dbSNP
rs892059353 1056 dbSNP
rs1022415997 1063 dbSNP
rs1160041233 1066 dbSNP
rs142832271 1070 dbSNP
rs1348819275 1072 dbSNP
rs892473008 1075 dbSNP
rs1411632288 1079 dbSNP
rs550898859 1081 dbSNP
rs1398612091 1083 dbSNP
rs1008836173 1087 dbSNP
rs1356430862 1093 dbSNP
rs1230259821 1100 dbSNP
rs935702225 1103 dbSNP
rs1321240107 1105 dbSNP
rs1239836870 1115 dbSNP
rs1288151302 1119 dbSNP
rs542294302 1121 dbSNP
rs1487267637 1127 dbSNP
rs1443913566 1128 dbSNP
rs539911887 1129 dbSNP
rs926936435 1129 dbSNP
rs1412588242 1131 dbSNP
rs1205291902 1132 dbSNP
rs56088227 1136 dbSNP
rs1259811399 1146 dbSNP
rs1215995753 1151 dbSNP
rs1377872055 1162 dbSNP
rs1318205991 1168 dbSNP
rs1312275030 1171 dbSNP
rs571391563 1180 dbSNP
rs1245964515 1182 dbSNP
rs148532865 1204 dbSNP
rs1301368072 1207 dbSNP
rs1378707006 1215 dbSNP
rs983293940 1217 dbSNP
rs950504139 1238 dbSNP
rs932540845 1253 dbSNP
rs898286009 1259 dbSNP
rs1317726073 1260 dbSNP
rs1433378949 1262 dbSNP
rs528202229 1275 dbSNP
rs1239367052 1277 dbSNP
rs1280910107 1293 dbSNP
rs182270109 1294 dbSNP
rs1455533591 1301 dbSNP
rs939738596 1303 dbSNP
rs908226415 1306 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Location of target site 3'UTR
Article - Jensen KP; Covault J; Conner TS; Tennen H; et al.
- Molecular psychiatry, 2009
Non-coding regulatory elements can transduce the human genome's response to environmental stimuli. Thus, there is a possibility that variation in non-coding regulatory elements may underlie some of the diversity in human behavior. However, this idea has remained largely untested due to the difficulty in accurately identifying regulatory elements in the 98% of the human genome that does not encode protein. The recent recognition that small trans-acting RNAs anneal to mRNA and regulate gene expression provides a means to identify and test such variants. Here, we show that microRNA-directed silencing of mRNA can be attenuated by a common human polymorphism. We have identified an element (A-element) within serotonin receptor 1B (HTR1B) mRNA that confers repression by miR-96. The repressive activity of this element is attenuated by a common human variant (G-element) that disrupts a nucleotide critical for its interaction with miR-96. Because deletion of the HTR1B gene leads to an aggressive phenotype in mice, we hypothesized an association between the A/G polymorphism and aggressive phenotypes in a sample of 359 college students. As predicted, individuals homozygous for the ancestral A-element reported more conduct-disorder behaviors than individuals with the G-element. Our studies suggest that such functional variants may be common and may help to refine the search for genes involved in complex behavioral disorders.
LinkOut: [PMID: 18283276]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28260 Renal cortex and medulla 0.758 1.3e-3 0.896 1.7e-5 13 Click to see details
GSE38226 Liver fibrosis 0.309 8.6e-2 0.019 4.7e-1 21 Click to see details
GSE21032 Prostate cancer -0.144 9.7e-2 -0.083 2.3e-1 83 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.276 1.2e-1 -0.283 1.1e-1 20 Click to see details
GSE19536 Breast cancer 0.11 1.4e-1 0.091 1.8e-1 100 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.217 1.5e-1 0.236 1.3e-1 25 Click to see details
GSE14794 Lymphoblastoid cells -0.111 1.5e-1 -0.080 2.3e-1 90 Click to see details
GSE19783 ER- ER- breast cancer 0.112 1.6e-1 0.083 2.3e-1 79 Click to see details
GSE19350 CNS germ cell tumors 0.269 2.0e-1 0.355 1.3e-1 12 Click to see details
GSE28544 Breast cancer 0.168 2.2e-1 0.268 1.0e-1 24 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.349 2.2e-1 -0.821 1.2e-2 7 Click to see details
GSE21849 B cell lymphoma -0.127 2.6e-1 -0.127 2.6e-1 29 Click to see details
GSE17306 Multiple myeloma -0.094 2.6e-1 0.248 4.3e-2 49 Click to see details
GSE32688 Pancreatic cancer 0.068 3.6e-1 0.123 2.5e-1 32 Click to see details
GSE26953 Aortic valvular endothelial cells -0.071 3.7e-1 -0.009 4.8e-1 24 Click to see details
GSE17498 Multiple myeloma -0.035 4.2e-1 0.023 4.4e-1 40 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.023 4.6e-1 0.120 2.8e-1 25 Click to see details
GSE19783 ER+ ER+ breast cancer 0.026 4.6e-1 0.162 2.5e-1 20 Click to see details
GSE27834 Pluripotent stem cells -0.021 4.7e-1 -0.124 3.2e-1 16 Click to see details
GSE21687 Ependynoma primary tumors 0.008 4.7e-1 -0.111 1.9e-1 64 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA -0.331 0 -0.311 0 83 Click to see details
PRAD -0.362 0 -0.410 0 50 Click to see details
LUSC -0.263 0.06 -0.336 0.02 38 Click to see details
ESCA -0.416 0.12 -0.430 0.11 10 Click to see details
KIRC 0.149 0.12 0.161 0.1 65 Click to see details
BLCA -0.273 0.14 -0.480 0.03 17 Click to see details
KICH -0.194 0.18 -0.343 0.05 25 Click to see details
STAD 0.152 0.22 0.099 0.31 28 Click to see details
LUAD -0.199 0.27 0.028 0.47 12 Click to see details
HNSC -0.087 0.29 -0.139 0.19 42 Click to see details
THCA 0.063 0.32 0.095 0.24 59 Click to see details
CHOL 0.151 0.36 0.143 0.37 8 Click to see details
UCEC -0.068 0.39 -0.036 0.44 19 Click to see details
PAAD -0.185 0.41 -0.400 0.3 4 Click to see details
LIHC 0.027 0.43 0.071 0.33 43 Click to see details
KIRP -0.019 0.46 -0.021 0.45 32 Click to see details
PCPG 0.03 0.49 0.500 0.33 3 Click to see details
PCPG 0.03 0.49 0.500 0.33 3 Click to see details
PCPG 0.03 0.49 0.500 0.33 3 Click to see details
PCPG 0.03 0.49 0.500 0.33 3 Click to see details
PCPG 0.03 0.49 0.500 0.33 3 Click to see details
202 hsa-miR-96-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001087 FOXO1 forkhead box O1 7 6
MIRT001989 MITF melanogenesis associated transcription factor 2 1
MIRT001991 ADCY6 adenylate cyclase 6 3 2
MIRT002447 HTR1B 5-hydroxytryptamine receptor 1B 2 1
MIRT003144 Mitf melanogenesis associated transcription factor 3 1
MIRT003414 CDKN1A cyclin dependent kinase inhibitor 1A 5 1
MIRT004352 PRMT5 protein arginine methyltransferase 5 4 2
MIRT005450 FOXO3 forkhead box O3 4 1
MIRT005553 KRAS KRAS proto-oncogene, GTPase 5 4
MIRT006779 REV1 REV1, DNA directed polymerase 3 1
MIRT006780 RAD51 RAD51 recombinase 3 1
MIRT027869 CELSR2 cadherin EGF LAG seven-pass G-type receptor 2 1 1
MIRT027870 ODF2 outer dense fiber of sperm tails 2 1 1
MIRT027871 IRS1 insulin receptor substrate 1 1 1
MIRT027872 MYRIP myosin VIIA and Rab interacting protein 2 1
MIRT027873 RYK receptor-like tyrosine kinase 1 1
MIRT027874 CAMTA1 calmodulin binding transcription activator 1 1 1
MIRT027875 CDON cell adhesion associated, oncogene regulated 1 1
MIRT027876 MGST1 microsomal glutathione S-transferase 1 1 1
MIRT027877 SRXN1 sulfiredoxin 1 1 1
MIRT027878 SUPT4H1 SPT4 homolog, DSIF elongation factor subunit 1 1
MIRT027879 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 1
MIRT027880 ZC3H15 zinc finger CCCH-type containing 15 1 1
MIRT027881 ZYX zyxin 1 1
MIRT027882 ZMIZ1 zinc finger MIZ-type containing 1 1 1
MIRT027883 JAZF1 JAZF zinc finger 1 1 1
MIRT027884 TRIM4 tripartite motif containing 4 1 1
MIRT027885 B4GALT3 beta-1,4-galactosyltransferase 3 1 1
MIRT027886 POMP proteasome maturation protein 1 1
MIRT027887 GTF2A1 general transcription factor IIA subunit 1 1 1
MIRT027888 RELA RELA proto-oncogene, NF-kB subunit 1 1
MIRT027889 SLAIN1 SLAIN motif family member 1 1 1
MIRT027890 RPS29 ribosomal protein S29 1 1
MIRT027891 PON2 paraoxonase 2 1 1
MIRT027892 HMGCS1 3-hydroxy-3-methylglutaryl-CoA synthase 1 1 1
MIRT027893 SLC25A46 solute carrier family 25 member 46 1 1
MIRT027894 APPL1 adaptor protein, phosphotyrosine interacting with PH domain and leucine zipper 1 1 1
MIRT027895 BAG4 BCL2 associated athanogene 4 1 1
MIRT027896 TSPAN14 tetraspanin 14 1 1
MIRT027897 CHML CHM like, Rab escort protein 2 1 1
MIRT027898 REEP3 receptor accessory protein 3 1 1
MIRT027899 TWISTNB TWIST neighbor 1 1
MIRT027900 ECT2 epithelial cell transforming 2 1 1
MIRT027901 XIAP X-linked inhibitor of apoptosis 1 1
MIRT027902 NKIRAS2 NFKB inhibitor interacting Ras like 2 1 1
MIRT027903 DDIT3 DNA damage inducible transcript 3 1 1
MIRT027904 RLF rearranged L-myc fusion 1 1
MIRT027905 MTHFD2L methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2 like 1 1
MIRT027906 SYNGR2 synaptogyrin 2 2 2
MIRT027907 ADSS adenylosuccinate synthase 1 1
MIRT027908 PHF19 PHD finger protein 19 1 1
MIRT027909 SGK3 serum/glucocorticoid regulated kinase family member 3 1 1
MIRT027910 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT027911 UBE2N ubiquitin conjugating enzyme E2 N 1 1
MIRT027912 CNOT6 CCR4-NOT transcription complex subunit 6 1 1
MIRT027913 FBXO21 F-box protein 21 1 1
MIRT027914 ARHGEF2 Rho/Rac guanine nucleotide exchange factor 2 1 1
MIRT027915 SPIN4 spindlin family member 4 2 2
MIRT027916 CGGBP1 CGG triplet repeat binding protein 1 1 1
MIRT027917 PPP1R12A protein phosphatase 1 regulatory subunit 12A 2 3
MIRT027918 RAB5B RAB5B, member RAS oncogene family 1 1
MIRT027919 TAOK1 TAO kinase 1 1 1
MIRT027920 EFNB2 ephrin B2 1 1
MIRT027921 NIPA1 non imprinted in Prader-Willi/Angelman syndrome 1 1 1
MIRT027922 YWHAG tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein gamma 1 1
MIRT027923 NHLRC3 NHL repeat containing 3 1 1
MIRT027924 SNX16 sorting nexin 16 1 1
MIRT027925 EVI5 ecotropic viral integration site 5 2 3
MIRT027926 PRDM16 PR/SET domain 16 1 1
MIRT027927 HOXA9 homeobox A9 2 3
MIRT027928 PROSC pyridoxal phosphate binding protein 1 1
MIRT027929 BCL2 BCL2, apoptosis regulator 1 1
MIRT027930 EIF4G1 eukaryotic translation initiation factor 4 gamma 1 1 1
MIRT027931 FAM171A1 family with sequence similarity 171 member A1 1 1
MIRT027932 MED1 mediator complex subunit 1 1 1
MIRT027933 CNNM3 cyclin and CBS domain divalent metal cation transport mediator 3 1 1
MIRT027934 PROK2 prokineticin 2 1 1
MIRT027935 ATXN1 ataxin 1 1 1
MIRT027936 FRS2 fibroblast growth factor receptor substrate 2 1 1
MIRT027937 PRKCE protein kinase C epsilon 1 1
MIRT027938 SLC39A1 solute carrier family 39 member 1 1 1
MIRT035550 SCARB1 scavenger receptor class B member 1 3 2
MIRT048714 FAM105B OTU deubiquitinase with linear linkage specificity 1 1
MIRT048715 SNX7 sorting nexin 7 1 1
MIRT048716 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT048717 PAPD5 poly(A) RNA polymerase D5, non-canonical 1 1
MIRT048718 GAPDH glyceraldehyde-3-phosphate dehydrogenase 1 1
MIRT048719 THAP9 THAP domain containing 9 1 1
MIRT048720 MOXD1 monooxygenase DBH like 1 1 1
MIRT048721 ITPR3 inositol 1,4,5-trisphosphate receptor type 3 1 1
MIRT048722 ALKBH5 alkB homolog 5, RNA demethylase 1 1
MIRT048723 ADNP2 ADNP homeobox 2 1 1
MIRT048724 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT048725 PGAM1 phosphoglycerate mutase 1 1 1
MIRT048726 FLII FLII, actin remodeling protein 1 1
MIRT048727 PMS2 PMS1 homolog 2, mismatch repair system component 1 1
MIRT048728 TMPO thymopoietin 1 1
MIRT048729 KLHL15 kelch like family member 15 1 1
MIRT048730 SMIM12 small integral membrane protein 12 1 1
MIRT048731 EDEM1 ER degradation enhancing alpha-mannosidase like protein 1 1 1
MIRT048732 DEK DEK proto-oncogene 1 1
MIRT048733 PRKAR1A protein kinase cAMP-dependent type I regulatory subunit alpha 1 1
MIRT048734 YTHDC2 YTH domain containing 2 1 1
MIRT048735 ACTN4 actinin alpha 4 1 1
MIRT048736 TERF2 telomeric repeat binding factor 2 1 1
MIRT048737 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT048738 PAQR4 progestin and adipoQ receptor family member 4 1 1
MIRT053181 ALK ALK receptor tyrosine kinase 3 1
MIRT053390 CCNG1 cyclin G1 1 1
MIRT053391 RAB35 RAB35, member RAS oncogene family 1 1
MIRT053392 CASP2 caspase 2 1 1
MIRT053393 SOX5 SRY-box 5 1 1
MIRT053394 ABCD1 ATP binding cassette subfamily D member 1 1 1
MIRT053395 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT053396 ATG7 autophagy related 7 1 1
MIRT053397 RASA1 RAS p21 protein activator 1 1 1
MIRT053398 CCND2 cyclin D2 1 1
MIRT053783 GSK3B glycogen synthase kinase 3 beta 4 1
MIRT054654 ZEB1 zinc finger E-box binding homeobox 1 3 1
MIRT054656 SNAI2 snail family transcriptional repressor 2 3 1
MIRT054678 SLC1A1 solute carrier family 1 member 1 2 1
MIRT054679 SLC6A6 solute carrier family 6 member 6 4 2
MIRT078464 MAP3K3 mitogen-activated protein kinase kinase kinase 3 2 2
MIRT079298 NPTX1 neuronal pentraxin 1 2 2
MIRT203592 BRWD1 bromodomain and WD repeat domain containing 1 2 2
MIRT257150 TMEM170B transmembrane protein 170B 2 2
MIRT282640 IGF1R insulin like growth factor 1 receptor 2 2
MIRT291999 SIN3B SIN3 transcription regulator family member B 2 2
MIRT437837 IARS isoleucyl-tRNA synthetase 1 1
MIRT438045 RECK reversion inducing cysteine rich protein with kazal motifs 5 3
MIRT438129 TRIB3 tribbles pseudokinase 3 2 1
MIRT438804 SYCP1 synaptonemal complex protein 1 1 1
MIRT452671 GPR156 G protein-coupled receptor 156 2 2
MIRT453461 PITPNM3 PITPNM family member 3 2 2
MIRT454765 STOML3 stomatin like 3 2 2
MIRT462316 CWC25 CWC25 spliceosome associated protein homolog 2 2
MIRT467855 SLC25A25 solute carrier family 25 member 25 2 2
MIRT468527 SERPINH1 serpin family H member 1 2 2
MIRT470490 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 2 2
MIRT477660 EFHD2 EF-hand domain family member D2 2 2
MIRT479790 CCND1 cyclin D1 4 2
MIRT481283 ATXN1L ataxin 1 like 2 2
MIRT491594 CCL22 C-C motif chemokine ligand 22 2 2
MIRT500672 TSKU tsukushi, small leucine rich proteoglycan 2 2
MIRT501010 SPPL2A signal peptide peptidase like 2A 2 4
MIRT501681 PFN1 profilin 1 2 8
MIRT501919 MBD4 methyl-CpG binding domain 4, DNA glycosylase 2 4
MIRT502390 GATSL2 cytosolic arginine sensor for mTORC1 subunit 2 2 2
MIRT503221 ACER2 alkaline ceramidase 2 2 2
MIRT503540 RPL7L1 ribosomal protein L7 like 1 2 6
MIRT505703 SESN2 sestrin 2 2 2
MIRT509888 RPS23 ribosomal protein S23 2 4
MIRT525372 SYNM synemin 2 2
MIRT529420 MALT1 MALT1 paracaspase 2 2
MIRT533377 UBE2D4 ubiquitin conjugating enzyme E2 D4 (putative) 2 4
MIRT533469 TRIM71 tripartite motif containing 71 2 2
MIRT533595 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT535082 PODXL podocalyxin like 2 2
MIRT541183 MORF4L1 mortality factor 4 like 1 2 2
MIRT544139 PGK1 phosphoglycerate kinase 1 2 2
MIRT547915 HOXA5 homeobox A5 2 2
MIRT555926 NUP43 nucleoporin 43 2 2
MIRT557240 CRAMP1L cramped chromatin regulator homolog 1 2 2
MIRT557939 FAM73A mitoguardin 1 2 2
MIRT558455 DDAH1 dimethylarginine dimethylaminohydrolase 1 2 2
MIRT561177 TNFRSF10A TNF receptor superfamily member 10a 2 2
MIRT562310 GINM1 glycoprotein integral membrane 1 2 2
MIRT566586 NUP50 nucleoporin 50 2 2
MIRT573341 TUBD1 tubulin delta 1 2 2
MIRT576270 Cd59a CD59a antigen 1 1
MIRT612971 GID4 GID complex subunit 4 homolog 2 6
MIRT614998 GABRB1 gamma-aminobutyric acid type A receptor beta1 subunit 2 2
MIRT622020 STK17B serine/threonine kinase 17b 2 2
MIRT640562 CPE carboxypeptidase E 2 2
MIRT642241 PAK4 p21 (RAC1) activated kinase 4 2 2
MIRT646584 ANKRD36 ankyrin repeat domain 36 2 2
MIRT648861 ABCA6 ATP binding cassette subfamily A member 6 2 2
MIRT652226 TRAPPC3L trafficking protein particle complex 3 like 2 2
MIRT655805 NOTCH2 notch 2 2 2
MIRT656982 KDM5A lysine demethylase 5A 2 2
MIRT658778 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 2 2
MIRT660466 ASH1L ASH1 like histone lysine methyltransferase 2 2
MIRT668470 EXOSC2 exosome component 2 2 2
MIRT689954 ZNF185 zinc finger protein 185 with LIM domain 2 2
MIRT690112 ZFAND1 zinc finger AN1-type containing 1 2 2
MIRT697755 USP5 ubiquitin specific peptidase 5 2 2
MIRT705941 ACY1 aminoacylase 1 2 2
MIRT705981 ABHD14A-ACY1 ABHD14A-ACY1 readthrough 2 2
MIRT723429 MIPOL1 mirror-image polydactyly 1 2 2
MIRT723490 WDR33 WD repeat domain 33 2 2
MIRT725556 CTSB cathepsin B 2 2
MIRT731565 PTPN9 protein tyrosine phosphatase, non-receptor type 9 3 1
MIRT732322 MTSS1 MTSS1, I-BAR domain containing 3 1
MIRT732695 HBEGF heparin binding EGF like growth factor 3 0
MIRT734622 GDNF glial cell derived neurotrophic factor 1 0
MIRT735085 PAX6 paired box 6 2 0
MIRT735992 FHL1 four and a half LIM domains 1 5 1
MIRT736590 ZDHHC5 zinc finger DHHC-type containing 5 3 0
MIRT736666 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 3 0
MIRT755968 DTL denticleless E3 ubiquitin protein ligase homolog 3 1
MIRT756106 PTEN phosphatase and tensin homolog 3 1
MIRT756475 ARHGAP6 Rho GTPase activating protein 6 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-96 Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miR-96 Enoxacin approved 3229 Quantitative real-time PCR HEK293 cells 18641635 2008 up-regulated
miR-96 Vorinostat (SAHA) approved 5311 Microarray A549 human non-small cell lung cancer cells 19513533 2009 up-regulated
miR-96 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-96 ACTH approved 16132265 Microarray adrenal gland 22128032 2012 down-regulated
miR-96 (S)-3,5-dihydroxyphenylglycine (DHPG) NULL 443586 Quantitative real-time PCR mouse brain 22309833 2012 up-regulated
miR-96 Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 up-regulated
miR-96 ACTH approved 16132265 Quantitative real-time PCR adrenals and granulosa cells 24205079 2014 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-96 Cisplatin 5460033 NSC119875 approved resistant cell line (W1)
hsa-miR-96-5p 2-(ethoxymethyl)-4,7-dimethoxy-6-[6-(4-methylpiperazin-1-yl)-1h-benzimidazol-2-yl]-1h-benzimidazole 398957 NSC709341 resistant
hsa-miR-96-5p 4-n-(7-chloro-3-phenylquinolin-4-yl)-1-n,1-n-diethylpentane-1,4-diamine;hydroiodide 24182056 NSC13477 resistant
hsa-miR-96-5p Destruxin e 107863 NSC361127 resistant
hsa-miR-96-5p Methyl 2-[33,34,35,36-tetrahydroxy-11,19,27-tris(2-methoxy-2-oxoethyl)-7,15,23,31-tetramethyl-3,11,19,27-tetrazapentacyclo[27.3.1.15,9.113,17.121,25]hexatriaconta-1(32),5,7,9(36),13,15,17(35),21(34),2 395595 NSC700325 resistant
hsa-miR-96-5p N,N-diethyl-2-[(E)-(3-methoxy-13-methyl-7,8,9,11,12,14,15,16-octahydro-6H-cyclopenta[a]phenanthren-17-ylidene)amino]oxyethanamine 6065911 NSC680094 resistant
hsa-miR-96-5p Trail sensitive High Non-Small Cell Lung Cancer cell line (CALU-1, A459, H460)
hsa-miR-96-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-96-5p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-96-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-96-5p Imatinib 5291 NSC743414 approved sensitive High Myelogenous Leukemia cell line (MYL)
hsa-miR-96-5p Cisplatin 5460033 NSC119875 approved resistant High Ehrlich Ascites Tumor cell line (EHR2,P6, P12, P36, P72, EHR2/1.3)
hsa-miR-96-5p Doxorubicin 31703 NSC123127 approved resistant High Ehrlich Ascites Tumor cell line (EHR2,P6, P12, P36, P72, EHR2/1.3)
hsa-miR-96-5p Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7, LY2)
hsa-miR-96-5p Fluorouracil 3385 NSC19893 approved resistant High Colon Cancer cell line (KM12C)
hsa-miR-96-5p Cisplatin 5460033 NSC119875 approved sensitive Low Osteosarcoma cell line (U-2-OS)
hsa-miR-96-5p Cisplatin 5460033 NSC119875 approved sensitive Low Breast Cancer cell line (HCC1937)
hsa-miR-96-5p Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer cell line (PEO1)
hsa-miR-96-5p Cisplatin 5460033 NSC119875 approved sensitive High Esophageal Squamous Cell Carcinoma tissue and cell line (TE1, TE5, TE8, TE9, TE10, TE11, TE13)
hsa-miR-96-5p Docetaxel 148124 NSC628503 approved sensitive High Prostate Cancer cell line (DU-145)
hsa-miR-96-5p Chemotherapy sensitive High Epithelial Ovarian Cancer tissue
hsa-miR-96-5p Fluorouracil 3385 NSC19893 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-96-5p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-96-5p Cisplatin 5460033 NSC119875 approved resistant Low Esophageal Cancer cell line (TE-1, ECa-109, EC-9706)
hsa-miR-96-5p Fluorouracil 3385 NSC19893 approved sensitive Low Colorectal Cancer cell line (HT-29, DLD-1, HCT-116)
hsa-miR-96-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (COC1)
hsa-miR-96-5p Taxane 9548828 resistant High Prostate Cancer cell line (PC-3, PR20)
hsa-miR-96-5p Paclitaxel 36314 NSC125973 approved resistant High Lung Adenocarcinoma cell line (A549)
hsa-miR-96-5p Paclitaxel 36314 NSC125973 approved resistant High Lung Adenocarcinoma cell line (A549)
hsa-miR-96-5p Plx-4720 24180719 NSC757438 resistant Low Thyroid Cancer cell line (8505c, BCPAP)
hsa-miR-96-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-96-5p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-96-5p Oxaliplatin 6857599 NSC266046 approved resistant Low Colon Cancer cell line (HCT-15, SW480)
hsa-miR-96-5p Fluorouracil 3385 NSC19893 approved sensitive High Colorectal Cancer cell line (DLD-1)
hsa-miR-96-5p Cisplatin 5460033 NSC119875 approved resistant Low Urothelial Bladder Cancer cell line (T24)
hsa-miR-96-5p Gemcitabine 60750 NSC613327 approved resistant Low Urothelial Bladder Cancer cell line (T24)
hsa-miR-96-5p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-96-5p Doxorubicin 31703 NSC123127 approved resistant Low Hepatocellular Carcinoma cell line (SNU387, HLF)
hsa-miR-96-5p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (DU-145R)
hsa-miR-96-5p Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (500nM)
hsa-miR-96-5p Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (2uM)
hsa-miR-96-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (500nM)
hsa-miR-96-5p Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-miR-96-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-miR-96-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (2uM)
hsa-miR-96-5p Cisplatin 5460033 NSC119875 approved resistant Low Head And Neck Squamous Cell Carcinoma cell line (Cal 27, FaDu)
hsa-miR-96-5p Cytarabine 6253 NSC287459 approved sensitive Low Acute Myeloid Leukemia cell line (HL60, THP-1)
hsa-miR-96-5p Fluorouracil 3385 NSC19893 approved resistant Low Colorectal Cancer cell line (HCT-116, HCT-8)
hsa-miR-96-5p Oxaliplatin 6857599 NSC266046 approved resistant Low Colorectal Cancer cell line (HCT-116, HCT-8)
hsa-miR-96-5p Fluorouracil 3385 NSC19893 approved sensitive High Colorectal Cancer cell line (HT-29)
hsa-miR-96-5p Imatinib 5291 NSC743414 approved sensitive Low Chronic Myelogenous Leukemia cell line (K562, MEG01)
hsa-miR-96-5p Gefitinib 123631 NSC715055 approved sensitive High Non-Small Cell Lung Cancer cell line (HCC827)
hsa-miR-96-5p Sorafenib 216239 NSC747971 approved resistant Low Hepatocellular Carcinoma tissue
hsa-miR-96-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-96-5p Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-96-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-96-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-96-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM43)
hsa-miR-96-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM47)
hsa-miR-96-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-96-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-96-5p Exemestane 60198 NSC713563 approved resistant cell line (MCF-7)
hsa-miR-96-5p Testosterone 6013 NSC9700 approved resistant cell line (MCF-7)
hsa-miR-96-5p Testosterone+Anastrozole resistant cell line (MCF-7)
hsa-miR-96-5p Testosterone+Exemestane resistant cell line (MCF-7)
hsa-miR-96-5p Testosterone+Letrozole resistant cell line (MCF-7)
hsa-miR-96-5p Testosterone+Tamoxifen resistant cell line (MCF-7)
hsa-miR-96-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-96-5p Sunitinib 5329102 NSC750690 approved resistant tissue (clear cell renal cell carcinoma)
hsa-miR-96-5p Fluorouracil 3385 NSC19893 approved sensitive cell line (HCT15)
hsa-miR-96-5p Cisplatin 5460033 NSC119875 approved resistant cell line (MGC-803)
hsa-miR-96-5p Ethanol+Tamoxifen sensitive cell line (LY2)
hsa-miR-96-5p Sunitinib 5329102 NSC750690 approved sensitive tissue (CardA)
hsa-miR-96-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-96-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (HuH28)
hsa-miR-96-5p Tamoxifen 2733525 NSC180973 approved sensitive cell line (TamR8)
hsa-miR-96-5p Tamoxifen 2733525 NSC180973 approved sensitive cell line (TamR4)
hsa-miR-96-5p Paclitaxel 36314 NSC125973 approved resistant cell line (PC3PR20)
hsa-miR-96-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-96-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-96-5p Bortezomib 387447 NSC681239 approved resistant cell line (CCRF-CEM) (200 nM)
hsa-miR-96-5p Bortezomib 387447 NSC681239 approved resistant cell line (CCRF-CEM) (100 nM)
hsa-miR-96-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)
hsa-miR-96-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-96-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (MDAH-2774)
hsa-miR-96-5p Cisplatin 5460033 NSC119875 approved resistant cell line (TOV-112D)
hsa-miR-96-5p Cisplatin 5460033 NSC119875 approved resistant cell line (OVSAHO)

Error report submission