pre-miRNA Information
pre-miRNA hsa-mir-124-1   
Genomic Coordinates chr8: 9903388 - 9903472
Description Homo sapiens miR-124-1 stem-loop
Comment miR-124 was first identified by cloning studies in mouse . The 5' end of the miRNA may be offset with respect to previous annotations.
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-124-2   
Genomic Coordinates chr8: 64379149 - 64379257
Description Homo sapiens miR-124-2 stem-loop
Comment miR-124 was first identified by cloning studies in mouse . The 5' end of the miRNA may be offset with respect to previous annotations.
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-124-3   
Genomic Coordinates chr20: 63178500 - 63178586
Description Homo sapiens miR-124-3 stem-loop
Comment miR-124 was first identified by cloning studies in mouse . The 5' end of the miRNA may be offset with respect to previous annotations.
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-124-3p
Sequence 53| UAAGGCACGCGGUGAAUGCC |72
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 22 8 - 9903399 17604727 MiREDiBase
A-to-I 22 8 + 64379231 17604727 MiREDiBase
A-to-I 22 20 + 63178573 17604727 MiREDiBase
C-to-U 19 8 - 9903402 20591823 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs34059726 4 dbSNP
rs1287398108 8 dbSNP
rs1482188536 11 dbSNP
rs759034202 11 dbSNP
rs1364752547 12 dbSNP
rs764861083 13 dbSNP
rs749909250 18 dbSNP
rs759045572 19 dbSNP
rs753437646 20 dbSNP
rs1256263272 21 dbSNP
miRNA Oxidation Modification
Oxidation Position Sequence (5'-3') Target Gene Validation Method PMID
4 UAAGGCACGCGGUGAAUGCC MEOX2; EGFR; IGF2BP3; BCAT1 Luciferase reporter assay 37696949
4 UAAGGCACGCGGUGAAUGCC not mentioned qPCR 38912549
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B28CWB miR-124 Safety Biomarker (SAF); Monitoring Biomarker (MOI) Clinical/Experimental Data Expression Increase Plasma Polymerase chain reaction
B28CWB miR-124 Safety Biomarker (SAF); Monitoring Biomarker (MOI) Clinical/Experimental Data Expression Decrease Neuron Reverse transcription-polymerase chain reaction
B28CWB miR-124 Safety Biomarker (SAF); Monitoring Biomarker (MOI) Clinical/Experimental Data Expression Decrease Peripheral blood mononuclear cell Reverse transcription-polymerase chain reaction
Gene Information
Gene Symbol MAD2L2   
Synonyms FANCV, MAD2B, POLZ2, REV7
Description mitotic arrest deficient 2 like 2
Transcript NM_001127325   
Other Transcripts NM_006341   
Expression
Putative miRNA Targets on MAD2L2
3'UTR of MAD2L2
(miRNA target sites are highlighted)
>MAD2L2|NM_001127325|3'UTR
   1 GGGGGCACCTGCCACCCCACTGATGCCCAAACTGTCAGACTTTGGGGGATCCCCGCCTAGGGCAGTGCTGCATGGCTGCC
  81 CTGATTCCAAGTGCTCTTATCGCCTCTGTGTGTGGATCGCCCGCCCCAGCCCGGGGCCGCTCAGGTCTGCTTGGAGGATG
 161 CCTCCCCCAGGAGGGCAGTGAGGGATGCCGCAACCTCGACTTCTCAGCCTCCTGGGGTTCCGCCGGCCAACACTGTCTGT
 241 CTCAAATACTGTGCTGTGAGTTGTTTCAATAAAGGGGCCCCAAGGGCTGGGCTGAAAAAAAAAAAAAAAAAAAAAAAAAA
 321 AAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' ccgUAAGUGGCGCACG-GAAu 5'
             |||  ||  |||| ||| 
Target 5' ctgATT--CCAAGTGCTCTTa 3'
81 - 99 117.00 -10.00
2
miRNA  3' ccguaaguggcgcACGGAau 5'
                       |||||  
Target 5' tctgcttggaggaTGCCTcc 3'
146 - 165 100.00 -9.10
3
miRNA  3' ccGUAAGUGGCGCACGGAAu 5'
            ||  :||  :||||: | 
Target 5' ctCAAATAC--TGTGCTGTg 3'
241 - 258 98.00 -7.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30477240 7 COSMIC
COSN30108466 16 COSMIC
COSN30450326 17 COSMIC
COSN30453383 18 COSMIC
COSN31503486 31 COSMIC
COSN31487712 34 COSMIC
COSN30542019 54 COSMIC
COSN13458778 55 COSMIC
COSN28877421 71 COSMIC
COSN30501004 101 COSMIC
COSN7173569 103 COSMIC
COSN30161589 115 COSMIC
COSN30556013 122 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs918568518 5 dbSNP
rs749227342 8 dbSNP
rs761441432 11 dbSNP
rs1188356571 12 dbSNP
rs774088224 15 dbSNP
rs1300722360 16 dbSNP
rs1446788215 19 dbSNP
rs768284310 26 dbSNP
rs748766499 30 dbSNP
rs965844239 34 dbSNP
rs1178949035 38 dbSNP
rs1273627155 43 dbSNP
rs1197418917 46 dbSNP
rs1337385125 47 dbSNP
rs1250218250 48 dbSNP
rs1233402293 50 dbSNP
rs775589805 51 dbSNP
rs530026451 52 dbSNP
rs911763896 54 dbSNP
rs991278295 55 dbSNP
rs987271924 60 dbSNP
rs1424477690 65 dbSNP
rs1416001193 68 dbSNP
rs1483075267 70 dbSNP
rs1252771950 78 dbSNP
rs1207116750 94 dbSNP
rs1389187548 101 dbSNP
rs1273847501 104 dbSNP
rs556573965 106 dbSNP
rs1323034172 118 dbSNP
rs1309903928 119 dbSNP
rs538577512 122 dbSNP
rs567967378 123 dbSNP
rs1011002004 126 dbSNP
rs548181592 132 dbSNP
rs183103774 133 dbSNP
rs762149813 134 dbSNP
rs1298134415 139 dbSNP
rs565625878 139 dbSNP
rs1352098857 141 dbSNP
rs1455209734 142 dbSNP
rs1045457 147 dbSNP
rs999316266 149 dbSNP
rs1413052797 155 dbSNP
rs906257952 166 dbSNP
rs1046551322 168 dbSNP
rs1464726505 171 dbSNP
rs1012344025 172 dbSNP
rs895414134 183 dbSNP
rs1048667830 187 dbSNP
rs997111066 189 dbSNP
rs899964579 196 dbSNP
rs1329166488 197 dbSNP
rs931538246 198 dbSNP
rs1045462 203 dbSNP
rs918636849 217 dbSNP
rs1349039299 221 dbSNP
rs1301227628 222 dbSNP
rs191836762 224 dbSNP
rs532203952 225 dbSNP
rs1292277663 229 dbSNP
rs936071183 235 dbSNP
rs944146985 239 dbSNP
rs1389384498 245 dbSNP
rs1161691894 254 dbSNP
rs1455799165 268 dbSNP
rs1363420306 269 dbSNP
rs1199361757 276 dbSNP
rs1295668015 278 dbSNP
rs912612304 279 dbSNP
rs987321273 280 dbSNP
rs1434715348 286 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Lim LP; Lau NC; Garrett-Engele P; Grimson et al.
- Nature, 2005
MicroRNAs (miRNAs) are a class of noncoding RNAs that post-transcriptionally regulate gene expression in plants and animals. To investigate the influence of miRNAs on transcript levels, we transfected miRNAs into human cells and used microarrays to examine changes in the messenger RNA profile. Here we show that delivering miR-124 causes the expression profile to shift towards that of brain, the organ in which miR-124 is preferentially expressed, whereas delivering miR-1 shifts the profile towards that of muscle, where miR-1 is preferentially expressed. In each case, about 100 messages were downregulated after 12 h. The 3' untranslated regions of these messages had a significant propensity to pair to the 5' region of the miRNA, as expected if many of these messages are the direct targets of the miRNAs. Our results suggest that metazoan miRNAs can reduce the levels of many of their target transcripts, not just the amount of protein deriving from these transcripts. Moreover, miR-1 and miR-124, and presumably other tissue-specific miRNAs, seem to downregulate a far greater number of targets than previously appreciated, thereby helping to define tissue-specific gene expression in humans.
LinkOut: [PMID: 15685193]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Baek D; Villen J; Shin C; Camargo FD; Gygi et al.
- Nature, 2008
MicroRNAs are endogenous approximately 23-nucleotide RNAs that can pair to sites in the messenger RNAs of protein-coding genes to downregulate the expression from these messages. MicroRNAs are known to influence the evolution and stability of many mRNAs, but their global impact on protein output had not been examined. Here we use quantitative mass spectrometry to measure the response of thousands of proteins after introducing microRNAs into cultured cells and after deleting mir-223 in mouse neutrophils. The identities of the responsive proteins indicate that targeting is primarily through seed-matched sites located within favourable predicted contexts in 3' untranslated regions. Hundreds of genes were directly repressed, albeit each to a modest degree, by individual microRNAs. Although some targets were repressed without detectable changes in mRNA levels, those translationally repressed by more than a third also displayed detectable mRNA destabilization, and, for the more highly repressed targets, mRNA destabilization usually comprised the major component of repression. The impact of microRNAs on the proteome indicated that for most interactions microRNAs act as rheostats to make fine-scale adjustments to protein output.
LinkOut: [PMID: 18668037]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.627 6.8e-4 0.446 1.6e-2 23 Click to see details
GSE28544 Breast cancer 0.353 4.5e-2 0.472 9.9e-3 24 Click to see details
GSE21687 Ependynoma primary tumors -0.123 1.7e-1 0.053 3.4e-1 64 Click to see details
GSE17306 Multiple myeloma -0.136 1.8e-1 0.376 3.9e-3 49 Click to see details
GSE21849 B cell lymphoma 0.172 1.9e-1 0.340 3.6e-2 29 Click to see details
GSE19350 CNS germ cell tumors 0.154 3.2e-1 -0.070 4.1e-1 12 Click to see details
GSE14794 Lymphoblastoid cells -0.048 3.3e-1 -0.047 3.3e-1 90 Click to see details
GSE32688 Pancreatic cancer 0.082 3.3e-1 0.151 2.0e-1 32 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.336 3.3e-1 0.600 2.0e-1 4 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.078 3.6e-1 0.098 3.2e-1 25 Click to see details
GSE27834 Pluripotent stem cells 0.053 4.2e-1 0.256 1.7e-1 16 Click to see details
GSE26953 Aortic valvular endothelial cells 0.037 4.3e-1 -0.097 3.3e-1 24 Click to see details
GSE28260 Renal cortex and medulla 0.043 4.4e-1 0.188 2.7e-1 13 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.019 4.7e-1 0.394 4.3e-2 20 Click to see details
GSE38226 Liver fibrosis -0.005 4.9e-1 0.025 4.6e-1 21 Click to see details
GSE38226 Liver fibrosis -0.005 4.9e-1 0.025 4.6e-1 21 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRP 0.658 0.01 0.706 0.01 12 Click to see details
STAD -0.63 0.03 -0.633 0.03 9 Click to see details
PRAD 0.794 0.1 0.800 0.1 4 Click to see details
KICH -0.67 0.11 -0.700 0.09 5 Click to see details
KIRC 0.215 0.22 0.082 0.39 15 Click to see details
THCA 0.186 0.25 -0.032 0.45 15 Click to see details
HNSC 0.178 0.37 0.371 0.23 6 Click to see details
HNSC 0.178 0.37 0.371 0.23 6 Click to see details
HNSC 0.178 0.37 0.371 0.23 6 Click to see details
HNSC 0.178 0.37 0.371 0.23 6 Click to see details
HNSC 0.178 0.37 0.371 0.23 6 Click to see details
HNSC 0.178 0.37 0.371 0.23 6 Click to see details
HNSC 0.178 0.37 0.371 0.23 6 Click to see details
1468 hsa-miR-124-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000360 SOX9 SRY-box 9 5 5
MIRT000362 BDNF brain derived neurotrophic factor 2 2
MIRT000478 EFNB1 ephrin B1 4 1
MIRT001168 NR3C2 nuclear receptor subfamily 3 group C member 2 3 1
MIRT001825 BACE1 beta-secretase 1 2 1
MIRT001827 RAVER2 ribonucleoprotein, PTB binding 2 3 1
MIRT001828 MAGT1 magnesium transporter 1 3 1
MIRT001830 SUCLG2 succinate-CoA ligase GDP-forming beta subunit 3 1
MIRT001831 SURF4 surfeit 4 3 1
MIRT001832 ELOVL5 ELOVL fatty acid elongase 5 3 1
MIRT001833 ADIPOR2 adiponectin receptor 2 1 1
MIRT001834 MTPN myotrophin 1 1
MIRT002025 CEBPA CCAAT/enhancer binding protein alpha 4 3
MIRT002560 DFFB DNA fragmentation factor subunit beta 2 2
MIRT002561 TRIM29 tripartite motif containing 29 2 1
MIRT002563 CDC14B cell division cycle 14B 2 2
MIRT002564 RARG retinoic acid receptor gamma 2 1
MIRT002565 PARP16 poly(ADP-ribose) polymerase family member 16 4 4
MIRT002566 ARPC1B actin related protein 2/3 complex subunit 1B 2 2
MIRT002567 PTPN12 protein tyrosine phosphatase, non-receptor type 12 2 2
MIRT002568 EYA4 EYA transcriptional coactivator and phosphatase 4 2 1
MIRT002569 TARBP1 TAR (HIV-1) RNA binding protein 1 2 2
MIRT002570 MAD2L2 mitotic arrest deficient 2 like 2 2 2
MIRT002571 LMNB1 lamin B1 4 4
MIRT002572 G3BP1 G3BP stress granule assembly factor 1 4 4
MIRT002574 UHRF1 ubiquitin like with PHD and ring finger domains 1 2 1
MIRT002575 CPNE3 copine 3 2 1
MIRT002576 SLC17A5 solute carrier family 17 member 5 2 2
MIRT002577 DHCR24 24-dehydrocholesterol reductase 2 1
MIRT002578 ACTR8 ARP8 actin related protein 8 homolog 2 1
MIRT002579 MYH9 myosin heavy chain 9 5 2
MIRT002580 ELF4 E74 like ETS transcription factor 4 5 2
MIRT002581 MAPK1IP1L mitogen-activated protein kinase 1 interacting protein 1 like 2 2
MIRT002583 CDCA7 cell division cycle associated 7 2 2
MIRT002585 SLC15A4 solute carrier family 15 member 4 2 2
MIRT002586 STOM stomatin 2 2
MIRT002587 MTMR6 myotubularin related protein 6 2 2
MIRT002588 POLR3G RNA polymerase III subunit G 2 1
MIRT002589 ANXA8 annexin A8 2 1
MIRT002590 OSBPL8 oxysterol binding protein like 8 2 2
MIRT002592 BTG3 BTG anti-proliferation factor 3 2 2
MIRT002594 VAMP3 vesicle associated membrane protein 3 3 5
MIRT002595 USP48 ubiquitin specific peptidase 48 2 1
MIRT002596 PTTG1IP PTTG1 interacting protein 2 2
MIRT002597 PGM1 phosphoglucomutase 1 2 2
MIRT002598 CYP1B1 cytochrome P450 family 1 subfamily B member 1 2 2
MIRT002599 TOM1L1 target of myb1 like 1 membrane trafficking protein 2 1
MIRT002600 SMAD5 SMAD family member 5 2 1
MIRT002601 NFIC nuclear factor I C 2 2
MIRT002602 RYK receptor-like tyrosine kinase 2 1
MIRT002604 CTGF connective tissue growth factor 3 3
MIRT002605 CHSY1 chondroitin sulfate synthase 1 4 4
MIRT002606 GNG10 G protein subunit gamma 10 2 2
MIRT002607 GMCL1P1 germ cell-less, spermatogenesis associated 1 pseudogene 1 1 1
MIRT002610 MAPK14 mitogen-activated protein kinase 14 4 4
MIRT002611 NEK6 NIMA related kinase 6 2 1
MIRT002612 MAN2A1 mannosidase alpha class 2A member 1 2 2
MIRT002613 CTDSP2 CTD small phosphatase 2 2 2
MIRT002614 BLOC1S6 biogenesis of lysosomal organelles complex 1 subunit 6 2 2
MIRT002615 DEPDC1 DEP domain containing 1 2 2
MIRT002616 RELA RELA proto-oncogene, NF-kB subunit 3 1
MIRT002617 KATNA1 katanin catalytic subunit A1 2 2
MIRT002618 SLC22A5 solute carrier family 22 member 5 2 2
MIRT002619 RASSF5 Ras association domain family member 5 2 2
MIRT002620 TNFRSF21 TNF receptor superfamily member 21 2 2
MIRT002623 DCTD dCMP deaminase 2 2
MIRT002624 CD59 CD59 molecule (CD59 blood group) 2 2
MIRT002625 CDK4 cyclin dependent kinase 4 6 12
MIRT002630 HTATIP2 HIV-1 Tat interactive protein 2 2 2
MIRT002631 ALDH9A1 aldehyde dehydrogenase 9 family member A1 2 2
MIRT002633 SSFA2 sperm specific antigen 2 2 2
MIRT002635 NEK9 NIMA related kinase 9 4 4
MIRT002636 PAPSS2 3'-phosphoadenosine 5'-phosphosulfate synthase 2 2 2
MIRT002637 ANKRD27 ankyrin repeat domain 27 2 2
MIRT002638 APEX2 apurinic/apyrimidinic endodeoxyribonuclease 2 2 2
MIRT002639 GSN gelsolin 4 4
MIRT002641 SLC30A7 solute carrier family 30 member 7 2 1
MIRT002642 CDK6 cyclin dependent kinase 6 6 10
MIRT002643 HEBP2 heme binding protein 2 2 1
MIRT002644 AHRR aryl-hydrocarbon receptor repressor 2 2
MIRT002645 GINM1 glycoprotein integral membrane 1 2 2
MIRT002646 SERPINB6 serpin family B member 6 2 2
MIRT002647 PTBP1 polypyrimidine tract binding protein 1 7 8
MIRT002649 IFRD2 interferon related developmental regulator 2 4 4
MIRT002652 DVL2 dishevelled segment polarity protein 2 2 2
MIRT002653 AHR aryl hydrocarbon receptor 4 3
MIRT002655 PLP2 proteolipid protein 2 5 2
MIRT002657 PODXL podocalyxin like 2 2
MIRT002658 CTNND1 catenin delta 1 2 2
MIRT002659 RHOV ras homolog family member V 1 2
MIRT002660 SP1 Sp1 transcription factor 4 4
MIRT002662 ACAA2 acetyl-CoA acyltransferase 2 3 3
MIRT002663 NME4 NME/NM23 nucleoside diphosphate kinase 4 2 1
MIRT002665 SLC16A1 solute carrier family 16 member 1 7 10
MIRT002667 MDFIC MyoD family inhibitor domain containing 2 1
MIRT002668 ARFIP1 ADP ribosylation factor interacting protein 1 2 2
MIRT002670 DNM2 dynamin 2 2 2
MIRT002672 PGRMC2 progesterone receptor membrane component 2 2 2
MIRT002673 FAM35A family with sequence similarity 35 member A 2 1
MIRT002674 ZBED3 zinc finger BED-type containing 3 2 2
MIRT002675 B4GALT1 beta-1,4-galactosyltransferase 1 5 3
MIRT002676 MPHOSPH9 M-phase phosphoprotein 9 2 1
MIRT002677 GTPBP8 GTP binding protein 8 (putative) 2 1
MIRT002678 F11R F11 receptor 2 2
MIRT002679 GNAI3 G protein subunit alpha i3 2 1
MIRT002682 SLC25A30 solute carrier family 25 member 30 2 2
MIRT002684 SERP1 stress associated endoplasmic reticulum protein 1 3 3
MIRT002687 PHF19 PHD finger protein 19 2 2
MIRT002689 INO80C INO80 complex subunit C 2 2
MIRT002690 STX2 syntaxin 2 2 1
MIRT002692 TRIP11 thyroid hormone receptor interactor 11 2 1
MIRT002693 TLN1 talin 1 2 2
MIRT002694 SWAP70 SWAP switching B-cell complex subunit 70 2 1
MIRT002695 ARHGEF1 Rho guanine nucleotide exchange factor 1 2 2
MIRT002696 ELOVL1 ELOVL fatty acid elongase 1 2 2
MIRT002697 IQGAP1 IQ motif containing GTPase activating protein 1 5 4
MIRT002698 ABHD5 abhydrolase domain containing 5 2 2
MIRT002699 RNPEPL1 arginyl aminopeptidase like 1 2 2
MIRT002700 STX10 syntaxin 10 2 3
MIRT002701 TEAD1 TEA domain transcription factor 1 2 2
MIRT002702 FAM177A1 family with sequence similarity 177 member A1 2 2
MIRT002703 FCHO2 FCH domain only 2 2 2
MIRT002706 CREB3L2 cAMP responsive element binding protein 3 like 2 2 1
MIRT002707 AK2 adenylate kinase 2 2 1
MIRT002709 TTC7A tetratricopeptide repeat domain 7A 2 2
MIRT002711 HADHB hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit 2 2
MIRT002712 LRRC1 leucine rich repeat containing 1 4 4
MIRT002714 TWIST2 twist family bHLH transcription factor 2 2 1
MIRT002715 AP1M2 adaptor related protein complex 1 mu 2 subunit 2 2
MIRT002716 SNAI2 snail family transcriptional repressor 2 4 5
MIRT002717 SYNGR2 synaptogyrin 2 2 2
MIRT002718 TJP2 tight junction protein 2 2 2
MIRT002719 CAV1 caveolin 1 5 3
MIRT002720 LAMC1 laminin subunit gamma 1 4 4
MIRT002721 DNAJC1 DnaJ heat shock protein family (Hsp40) member C1 2 2
MIRT002722 CDCA7L cell division cycle associated 7 like 2 2
MIRT002723 PLOD3 procollagen-lysine,2-oxoglutarate 5-dioxygenase 3 2 2
MIRT002724 SHC3 SHC adaptor protein 3 1 1
MIRT002726 CERS2 ceramide synthase 2 2 2
MIRT002728 LITAF lipopolysaccharide induced TNF factor 2 2
MIRT002729 CTDSP1 CTD small phosphatase 1 5 6
MIRT002730 CD164 CD164 molecule 5 7
MIRT002731 ITGB1 integrin subunit beta 1 5 5
MIRT002901 JAKMIP1 janus kinase and microtubule interacting protein 1 1 1
MIRT002902 CHODL chondrolectin 1 1
MIRT002903 GAS2L1 growth arrest specific 2 like 1 3 2
MIRT002904 TSPAN15 tetraspanin 15 1 1
MIRT002905 RFFL ring finger and FYVE like domain containing E3 ubiquitin protein ligase 2 2
MIRT002906 ERH ERH, mRNA splicing and mitosis factor 1 1
MIRT002907 ZFP36L2 ZFP36 ring finger protein like 2 2 2
MIRT002908 FAM104A family with sequence similarity 104 member A 1 1
MIRT002909 PLSCR3 phospholipid scramblase 3 2 2
MIRT002910 CAPRIN2 caprin family member 2 2 2
MIRT002911 FA2H fatty acid 2-hydroxylase 1 1
MIRT002912 SENP8 SUMO/sentrin peptidase family member, NEDD8 specific 2 2
MIRT002913 PGF placental growth factor 1 1
MIRT002914 PDLIM7 PDZ and LIM domain 7 2 2
MIRT002915 MYO10 myosin X 3 3
MIRT002917 E2F5 E2F transcription factor 5 2 2
MIRT002918 NFATC1 nuclear factor of activated T-cells 1 5 3
MIRT002919 ARRDC1 arrestin domain containing 1 1 1
MIRT002920 MMADHC methylmalonic aciduria and homocystinuria, cblD type 1 1
MIRT002921 NID1 nidogen 1 2 2
MIRT002922 RHOG ras homolog family member G 5 3
MIRT002923 PRKD1 protein kinase D1 1 1
MIRT003051 RDH10 retinol dehydrogenase 10 3 2
MIRT003523 ELK3 ELK3, ETS transcription factor 3 2
MIRT003839 ATP6V0E1 ATPase H+ transporting V0 subunit e1 3 2
MIRT004039 TMBIM1 transmembrane BAX inhibitor motif containing 1 2 2
MIRT004042 PPP1R13L protein phosphatase 1 regulatory subunit 13 like 5 4
MIRT004075 ARHGAP29 Rho GTPase activating protein 29 2 1
MIRT004100 TSC22D4 TSC22 domain family member 4 4 6
MIRT004101 NAA15 N(alpha)-acetyltransferase 15, NatA auxiliary subunit 2 2
MIRT004119 SYPL1 synaptophysin like 1 4 4
MIRT004120 SEC11A SEC11 homolog A, signal peptidase complex subunit 2 2
MIRT004283 CDK2 cyclin dependent kinase 2 4 2
MIRT004284 CCL2 C-C motif chemokine ligand 2 4 2
MIRT004503 PEA15 phosphoprotein enriched in astrocytes 15 2 1
MIRT004546 NR3C1 nuclear receptor subfamily 3 group C member 1 7 3
MIRT004548 TSC22D3 TSC22 domain family member 3 2 1
MIRT004724 VIM vimentin 5 2
MIRT004725 SMYD3 SET and MYND domain containing 3 4 2
MIRT004726 E2F6 E2F transcription factor 6 4 1
MIRT004880 OAF out at first homolog 2 2
MIRT004883 TMEM109 transmembrane protein 109 2 2
MIRT004884 TUBB6 tubulin beta 6 class V 2 1
MIRT004885 C12orf23 transmembrane protein 263 2 2
MIRT004886 SLC50A1 solute carrier family 50 member 1 2 2
MIRT004890 UHMK1 U2AF homology motif kinase 1 2 2
MIRT004891 LIMCH1 LIM and calponin homology domains 1 2 2
MIRT004892 ENDOD1 endonuclease domain containing 1 2 2
MIRT004893 HADH hydroxyacyl-CoA dehydrogenase 2 2
MIRT004894 GCA grancalcin 2 1
MIRT004895 C11orf75 single-pass membrane protein with coiled-coil domains 4 2 2
MIRT004896 FAM83H family with sequence similarity 83 member H 2 2
MIRT004897 ASPRV1 aspartic peptidase retroviral like 1 2 1
MIRT004898 VPS37C VPS37C, ESCRT-I subunit 2 2
MIRT004899 SPDL1 spindle apparatus coiled-coil protein 1 2 2
MIRT004903 RBM47 RNA binding motif protein 47 2 2
MIRT004906 DRAM1 DNA damage regulated autophagy modulator 1 2 1
MIRT004907 NECAP2 NECAP endocytosis associated 2 2 2
MIRT004908 TSKU tsukushi, small leucine rich proteoglycan 2 2
MIRT004912 CHST14 carbohydrate sulfotransferase 14 2 1
MIRT004913 FAM57A family with sequence similarity 57 member A 2 2
MIRT004925 FAM129B family with sequence similarity 129 member B 2 1
MIRT004926 CLDND1 claudin domain containing 1 2 2
MIRT004927 ZCCHC24 zinc finger CCHC-type containing 24 2 2
MIRT004928 LDLRAP1 low density lipoprotein receptor adaptor protein 1 2 2
MIRT004929 ARAF A-Raf proto-oncogene, serine/threonine kinase 2 2
MIRT004930 KANK1 KN motif and ankyrin repeat domains 1 2 2
MIRT005083 NFKBIZ NFKB inhibitor zeta 4 1
MIRT005655 ECI2 enoyl-CoA delta isomerase 2 2 2
MIRT006451 AR androgen receptor 3 2
MIRT006478 ROCK2 Rho associated coiled-coil containing protein kinase 2 3 1
MIRT006479 EZH2 enhancer of zeste 2 polycomb repressive complex 2 subunit 7 6
MIRT006541 IL6R interleukin 6 receptor 4 1
MIRT006562 HMGA1 high mobility group AT-hook 1 4 1
MIRT006776 ROCK1 Rho associated coiled-coil containing protein kinase 1 3 3
MIRT006837 PIK3CA phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha 6 2
MIRT007235 FXN frataxin 1 1
MIRT007282 MECP2 methyl-CpG binding protein 2 1 1
MIRT022113 SPTA1 spectrin alpha, erythrocytic 1 1 1
MIRT022115 FOXF2 forkhead box F2 1 1
MIRT022116 LRRC4 leucine rich repeat containing 4 1 1
MIRT022117 SGK1 serum/glucocorticoid regulated kinase 1 1 1
MIRT022118 DEFB118 defensin beta 118 1 1
MIRT022119 RFT1 RFT1 homolog 1 1
MIRT022120 USH2A usherin 1 1
MIRT022121 ARMCX2 armadillo repeat containing, X-linked 2 1 1
MIRT022122 BAG5 BCL2 associated athanogene 5 1 1
MIRT022123 ARHGAP22 Rho GTPase activating protein 22 1 1
MIRT022124 VNN2 vanin 2 1 1
MIRT022125 YBX3 Y-box binding protein 3 1 1
MIRT022126 TRIM38 tripartite motif containing 38 1 1
MIRT022127 C9orf85 chromosome 9 open reading frame 85 1 1
MIRT022128 PLA2G4C phospholipase A2 group IVC 1 1
MIRT022129 MVP major vault protein 1 1
MIRT022130 SEC24D SEC24 homolog D, COPII coat complex component 1 1
MIRT022131 XRCC2 X-ray repair cross complementing 2 1 1
MIRT022132 HLA-A major histocompatibility complex, class I, A 1 1
MIRT022133 GMPR2 guanosine monophosphate reductase 2 1 1
MIRT022134 SNX18 sorting nexin 18 3 3
MIRT022135 TBXA2R thromboxane A2 receptor 1 1
MIRT022136 SH2D3A SH2 domain containing 3A 1 1
MIRT022137 MFAP4 microfibril associated protein 4 1 1
MIRT022138 MICAL2 microtubule associated monooxygenase, calponin and LIM domain containing 2 1 1
MIRT022139 EREG epiregulin 1 1
MIRT022140 LRRC2 leucine rich repeat containing 2 1 1
MIRT022141 BIRC2 baculoviral IAP repeat containing 2 1 1
MIRT022142 ADPRH ADP-ribosylarginine hydrolase 1 1
MIRT022143 XKRX XK related, X-linked 1 1
MIRT022144 LAMA4 laminin subunit alpha 4 1 1
MIRT022145 EFNA1 ephrin A1 1 1
MIRT022146 LSM10 LSM10, U7 small nuclear RNA associated 1 1
MIRT022147 ADCY6 adenylate cyclase 6 1 1
MIRT022148 WISP2 WNT1 inducible signaling pathway protein 2 1 1
MIRT022149 ADAM15 ADAM metallopeptidase domain 15 1 1
MIRT022150 DSEL dermatan sulfate epimerase-like 1 1
MIRT022151 EPB41L5 erythrocyte membrane protein band 4.1 like 5 1 1
MIRT022152 ZHX3 zinc fingers and homeoboxes 3 1 1
MIRT022153 SMPD4 sphingomyelin phosphodiesterase 4 1 1
MIRT022154 MAML1 mastermind like transcriptional coactivator 1 1 1
MIRT022155 SLC46A3 solute carrier family 46 member 3 1 1
MIRT022156 RRAS RAS related 4 2
MIRT022157 NUDT19 nudix hydrolase 19 1 1
MIRT022158 FAM134B reticulophagy regulator 1 1 1
MIRT022159 SPRY2 sprouty RTK signaling antagonist 2 1 1
MIRT022160 MTHFSD methenyltetrahydrofolate synthetase domain containing 1 1
MIRT022161 JAG2 jagged 2 1 1
MIRT022162 STK36 serine/threonine kinase 36 1 1
MIRT022163 METAP2 methionyl aminopeptidase 2 1 1
MIRT022164 KDELR2 KDEL endoplasmic reticulum protein retention receptor 2 1 1
MIRT022165 ECE1 endothelin converting enzyme 1 1 1
MIRT022166 SBNO2 strawberry notch homolog 2 1 1
MIRT022167 PRRX1 paired related homeobox 1 4 2
MIRT022168 TOR3A torsin family 3 member A 1 1
MIRT022169 LHX2 LIM homeobox 2 1 1
MIRT022170 RAB34 RAB34, member RAS oncogene family 1 1
MIRT022171 ARHGAP28 Rho GTPase activating protein 28 1 1
MIRT022172 COL4A1 collagen type IV alpha 1 chain 1 1
MIRT022173 USP10 ubiquitin specific peptidase 10 2 1
MIRT022174 GPATCH4 G-patch domain containing 4 2 1
MIRT022175 DHX33 DEAH-box helicase 33 2 1
MIRT022176 LIN7C lin-7 homolog C, crumbs cell polarity complex component 2 1
MIRT022177 DDX51 DEAD-box helicase 51 2 1
MIRT022178 ZNF740 zinc finger protein 740 2 1
MIRT022179 GRSF1 G-rich RNA sequence binding factor 1 2 1
MIRT022180 COLGALT1 collagen beta(1-O)galactosyltransferase 1 2 1
MIRT022181 FAM35BP family with sequence similarity 35, member A pseudogene 2 2
MIRT022182 FAM171B family with sequence similarity 171 member B 1 1
MIRT022183 IL6 interleukin 6 1 1
MIRT022184 CAPN11 calpain 11 1 1
MIRT022185 DYNC2H1 dynein cytoplasmic 2 heavy chain 1 1 1
MIRT022186 CABP1 calcium binding protein 1 1 1
MIRT022187 METTL7A methyltransferase like 7A 1 1
MIRT022188 FGF1 fibroblast growth factor 1 1 1
MIRT022189 SERPINE1 serpin family E member 1 1 1
MIRT022190 RBMS1 RNA binding motif single stranded interacting protein 1 2 1
MIRT022191 SLC43A3 solute carrier family 43 member 3 1 1
MIRT022192 PUS1 pseudouridylate synthase 1 1 1
MIRT022193 CALCRL calcitonin receptor like receptor 1 1
MIRT022194 SAMD11 sterile alpha motif domain containing 11 1 1
MIRT022195 SOGA2 microtubule crosslinking factor 1 1 1
MIRT022196 AVEN apoptosis and caspase activation inhibitor 1 1
MIRT022197 ZNHIT6 zinc finger HIT-type containing 6 1 1
MIRT022198 CDRT4 CMT1A duplicated region transcript 4 1 1
MIRT022199 GPR161 G protein-coupled receptor 161 1 1
MIRT022200 EPGN epithelial mitogen 1 1
MIRT022201 FAM65B RHO family interacting cell polarization regulator 2 1 1
MIRT022202 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT022203 ERCC5 ERCC excision repair 5, endonuclease 1 1
MIRT022204 TAX1BP3 Tax1 binding protein 3 1 1
MIRT022205 CHRDL1 chordin like 1 1 1
MIRT022206 CCDC3 coiled-coil domain containing 3 1 1
MIRT022207 MVK mevalonate kinase 1 1
MIRT022208 INF2 inverted formin, FH2 and WH2 domain containing 1 1
MIRT022209 ZNF410 zinc finger protein 410 1 1
MIRT022210 PPP2R1B protein phosphatase 2 scaffold subunit Abeta 1 1
MIRT022211 CYBRD1 cytochrome b reductase 1 1 1
MIRT022212 LNX2 ligand of numb-protein X 2 1 1
MIRT022213 TMEM79 transmembrane protein 79 1 1
MIRT022214 MRPL49 mitochondrial ribosomal protein L49 3 3
MIRT022215 DNMBP dynamin binding protein 1 1
MIRT022216 OGFOD2 2-oxoglutarate and iron dependent oxygenase domain containing 2 1 1
MIRT022217 CPNE8 copine 8 1 1
MIRT022218 TRAIP TRAF interacting protein 1 1
MIRT022219 RAD51AP1 RAD51 associated protein 1 1 1
MIRT022220 CTSH cathepsin H 1 1
MIRT022221 GRB2 growth factor receptor bound protein 2 4 1
MIRT022222 ADCY9 adenylate cyclase 9 1 1
MIRT022223 SNX17 sorting nexin 17 1 1
MIRT022224 MSRB3 methionine sulfoxide reductase B3 1 1
MIRT022225 FAM129A family with sequence similarity 129 member A 1 1
MIRT022226 RNF141 ring finger protein 141 1 1
MIRT022227 LYSMD3 LysM domain containing 3 3 3
MIRT022228 UNC5D unc-5 netrin receptor D 1 1
MIRT022229 KLF6 Kruppel like factor 6 2 2
MIRT022230 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT022231 DCAF16 DDB1 and CUL4 associated factor 16 1 1
MIRT022232 PI4K2B phosphatidylinositol 4-kinase type 2 beta 3 7
MIRT022233 GATA6 GATA binding protein 6 1 1
MIRT022234 KLF4 Kruppel like factor 4 1 1
MIRT022235 SERTAD2 SERTA domain containing 2 1 1
MIRT022236 RAB27A RAB27A, member RAS oncogene family 4 1
MIRT022237 CD55 CD55 molecule (Cromer blood group) 2 1
MIRT022238 ATAD3A ATPase family, AAA domain containing 3A 2 1
MIRT022239 PLOD1 procollagen-lysine,2-oxoglutarate 5-dioxygenase 1 2 1
MIRT022240 RFC3 replication factor C subunit 3 2 1
MIRT022241 PPAN peter pan homolog (Drosophila) 2 1
MIRT022242 KRT17P2 keratin 17 pseudogene 2 2 1
MIRT022243 HELLS helicase, lymphoid specific 2 1
MIRT022244 LAS1L LAS1 like, ribosome biogenesis factor 2 1
MIRT022245 NGDN neuroguidin 2 1
MIRT022246 PIAS1 protein inhibitor of activated STAT 1 2 1
MIRT022247 JUP junction plakoglobin 2 1
MIRT022248 GNB4 G protein subunit beta 4 2 1
MIRT022249 TRIM25 tripartite motif containing 25 2 1
MIRT022250 RCC2 regulator of chromosome condensation 2 2 1
MIRT022251 SEPT9 septin 9 2 1
MIRT022252 ENAH ENAH, actin regulator 2 1
MIRT022253 DIS3 DIS3 homolog, exosome endoribonuclease and 3'-5' exoribonuclease 2 1
MIRT022254 LDLR low density lipoprotein receptor 2 2
MIRT022255 PDAP1 PDGFA associated protein 1 1 1
MIRT022256 CCDC102B coiled-coil domain containing 102B 1 1
MIRT022257 TSEN54 tRNA splicing endonuclease subunit 54 1 1
MIRT022258 ZNF483 zinc finger protein 483 1 1
MIRT022259 ADARB1 adenosine deaminase, RNA specific B1 1 1
MIRT022260 DHRS3 dehydrogenase/reductase 3 1 1
MIRT022261 SLC1A3 solute carrier family 1 member 3 1 1
MIRT022262 TMEM156 transmembrane protein 156 1 1
MIRT022263 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT022264 CKS2 CDC28 protein kinase regulatory subunit 2 1 1
MIRT022265 AFAP1L1 actin filament associated protein 1 like 1 1 1
MIRT022266 ID3 inhibitor of DNA binding 3, HLH protein 1 1
MIRT022267 EDN1 endothelin 1 1 1
MIRT022268 IGFBP1 insulin like growth factor binding protein 1 1 1
MIRT022269 CLIC3 chloride intracellular channel 3 1 1
MIRT022270 E2F4 E2F transcription factor 4 1 1
MIRT022271 SPHK1 sphingosine kinase 1 4 3
MIRT022272 OCA2 OCA2 melanosomal transmembrane protein 1 1
MIRT022273 SDCCAG8 serologically defined colon cancer antigen 8 1 1
MIRT022274 TMEM5 transmembrane protein 5 1 1
MIRT022275 PRKCB protein kinase C beta 1 1
MIRT022276 COL17A1 collagen type XVII alpha 1 chain 1 1
MIRT022277 HOXC4 homeobox C4 1 1
MIRT022278 ATOH8 atonal bHLH transcription factor 8 1 1
MIRT022279 SULT1E1 sulfotransferase family 1E member 1 1 1
MIRT022280 RILPL2 Rab interacting lysosomal protein like 2 1 1
MIRT022281 TMEM44 transmembrane protein 44 1 1
MIRT022282 RPS15 ribosomal protein S15 1 1
MIRT022283 RPS6KA4 ribosomal protein S6 kinase A4 1 1
MIRT022284 NSMAF neutral sphingomyelinase activation associated factor 1 1
MIRT022285 PTH2R parathyroid hormone 2 receptor 1 1
MIRT022286 NUB1 negative regulator of ubiquitin like proteins 1 1 1
MIRT022287 ROM1 retinal outer segment membrane protein 1 1 1
MIRT022288 ACADL acyl-CoA dehydrogenase, long chain 1 1
MIRT022289 NASP nuclear autoantigenic sperm protein 1 1
MIRT022290 RFWD3 ring finger and WD repeat domain 3 1 1
MIRT022291 FAM63B MINDY lysine 48 deubiquitinase 2 1 1
MIRT022292 HMGN4 high mobility group nucleosomal binding domain 4 1 1
MIRT022293 TSN translin 1 1
MIRT022294 SNX12 sorting nexin 12 1 1
MIRT022295 POLA1 DNA polymerase alpha 1, catalytic subunit 1 1
MIRT022296 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 1
MIRT022297 MALL mal, T-cell differentiation protein like 1 1
MIRT022298 MOBP myelin-associated oligodendrocyte basic protein 1 1
MIRT022299 KLHL24 kelch like family member 24 1 1
MIRT022300 FGFR1 fibroblast growth factor receptor 1 1 1
MIRT022301 TMEM128 transmembrane protein 128 1 1
MIRT022302 RIPK4 receptor interacting serine/threonine kinase 4 3 3
MIRT022303 BVES blood vessel epicardial substance 1 1
MIRT022304 HEATR5A HEAT repeat containing 5A 1 1
MIRT022305 C11orf82 DNA damage induced apoptosis suppressor 1 1
MIRT022306 CMTM7 CKLF like MARVEL transmembrane domain containing 7 1 1
MIRT022307 EMD emerin 1 1
MIRT022308 PTPRB protein tyrosine phosphatase, receptor type B 1 1
MIRT022309 GPM6B glycoprotein M6B 1 1
MIRT022310 RASSF1 Ras association domain family member 1 1 1
MIRT022311 TUB tubby bipartite transcription factor 1 1
MIRT022312 PALLD palladin, cytoskeletal associated protein 1 1
MIRT022313 PHF17 jade family PHD finger 1 1 1
MIRT022314 SIX4 SIX homeobox 4 1 1
MIRT022315 INA internexin neuronal intermediate filament protein alpha 2 1
MIRT022316 DNM3 dynamin 3 2 1
MIRT022317 NOL8 nucleolar protein 8 2 1
MIRT022318 EHD2 EH domain containing 2 2 1
MIRT022319 AURKB aurora kinase B 2 1
MIRT022320 SRSF3 serine and arginine rich splicing factor 3 2 1
MIRT022321 NOSIP nitric oxide synthase interacting protein 2 1
MIRT022322 SPIN1 spindlin 1 2 1
MIRT022323 PPIF peptidylprolyl isomerase F 2 1
MIRT022324 FRAS1 Fraser extracellular matrix complex subunit 1 2 1
MIRT022325 FLOT2 flotillin 2 2 1
MIRT022326 MVD mevalonate diphosphate decarboxylase 1 1
MIRT022327 LIN28A lin-28 homolog A 1 1
MIRT022328 TUBA3D tubulin alpha 3d 1 1
MIRT022329 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT022330 LIN7A lin-7 homolog A, crumbs cell polarity complex component 1 1
MIRT022331 AKAP4 A-kinase anchoring protein 4 1 1
MIRT022332 AGTR2 angiotensin II receptor type 2 1 1
MIRT022333 NCAPH2 non-SMC condensin II complex subunit H2 1 1
MIRT022334 DRG2 developmentally regulated GTP binding protein 2 1 1
MIRT022335 SLC13A2 solute carrier family 13 member 2 1 1
MIRT022336 MFAP5 microfibril associated protein 5 1 1
MIRT022337 CALR calreticulin 1 1
MIRT022338 WBSCR16 RCC1 like 1 1
MIRT022339 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT022340 GPR123 adhesion G protein-coupled receptor A1 1 1
MIRT022341 FAM109B family with sequence similarity 109 member B 1 1
MIRT022342 TNFRSF12A TNF receptor superfamily member 12A 1 1
MIRT022343 FBXO18 F-box protein, helicase, 18 1 1
MIRT022344 IKBKE inhibitor of nuclear factor kappa B kinase subunit epsilon 1 1
MIRT022345 CSPG4 chondroitin sulfate proteoglycan 4 1 1
MIRT022346 KIAA0930 KIAA0930 1 1
MIRT022347 ANXA6 annexin A6 1 1
MIRT022348 VKORC1 vitamin K epoxide reductase complex subunit 1 1 1
MIRT022349 DISP1 dispatched RND transporter family member 1 1 1
MIRT022350 SYNC syncoilin, intermediate filament protein 1 1
MIRT022351 KIAA1804 mitogen-activated protein kinase kinase kinase 21 1 1
MIRT022352 CDC42EP3 CDC42 effector protein 3 1 1
MIRT022353 SEC22C SEC22 homolog C, vesicle trafficking protein 1 1
MIRT022355 C14orf178 chromosome 14 open reading frame 178 1 1
MIRT022356 SDC4 syndecan 4 1 1
MIRT022357 ZNF440 zinc finger protein 440 1 1
MIRT022358 MYPN myopalladin 1 1
MIRT022359 TPP1 tripeptidyl peptidase 1 1 1
MIRT022360 ATP8B2 ATPase phospholipid transporting 8B2 1 1
MIRT022361 SLC31A2 solute carrier family 31 member 2 1 1
MIRT022362 GFPT2 glutamine-fructose-6-phosphate transaminase 2 1 1
MIRT022363 IGFBP3 insulin like growth factor binding protein 3 1 1
MIRT022364 TMEM45A transmembrane protein 45A 1 1
MIRT022365 CDCP1 CUB domain containing protein 1 1 1
MIRT022366 PUS3 pseudouridylate synthase 3 1 1
MIRT022367 MAP3K8 mitogen-activated protein kinase kinase kinase 8 1 1
MIRT022368 TPST2 tyrosylprotein sulfotransferase 2 4 1
MIRT022369 C8orf22 pancreatic progenitor cell differentiation and proliferation factor like 1 1
MIRT022370 NFIA nuclear factor I A 1 1
MIRT022371 GMCL1 germ cell-less, spermatogenesis associated 1 2 2
MIRT022372 SLC1A4 solute carrier family 1 member 4 1 1
MIRT022373 PPP1R3B protein phosphatase 1 regulatory subunit 3B 1 1
MIRT022374 ESYT2 extended synaptotagmin 2 1 1
MIRT022375 ANXA11 annexin A11 1 1
MIRT022376 GNB2L1 receptor for activated C kinase 1 2 1
MIRT022377 SEPT2 septin 2 2 1
MIRT022378 BEND3 BEN domain containing 3 2 1
MIRT022379 MBNL1 muscleblind like splicing regulator 1 2 1
MIRT022380 CUX2 cut like homeobox 2 2 1
MIRT022381 MCAM melanoma cell adhesion molecule 2 1
MIRT022382 EIF2S2 eukaryotic translation initiation factor 2 subunit beta 2 1
MIRT022383 SNRPB small nuclear ribonucleoprotein polypeptides B and B1 2 1
MIRT022384 CDC27 cell division cycle 27 2 1
MIRT022385 PGM5 phosphoglucomutase 5 2 1
MIRT022386 NOL10 nucleolar protein 10 2 1
MIRT022387 NOC3L NOC3 like DNA replication regulator 2 1
MIRT022388 WTAP WT1 associated protein 2 1
MIRT022389 EIF3M eukaryotic translation initiation factor 3 subunit M 2 1
MIRT022390 MED20 mediator complex subunit 20 2 1
MIRT022391 AURKA aurora kinase A 2 1
MIRT022392 GNAI2 G protein subunit alpha i2 2 1
MIRT022393 NMNAT1 nicotinamide nucleotide adenylyltransferase 1 2 1
MIRT022394 LMNA lamin A/C 2 1
MIRT022395 ACAT2 acetyl-CoA acetyltransferase 2 1 1
MIRT022396 RBPMS RNA binding protein with multiple splicing 1 1
MIRT022397 GBP1 guanylate binding protein 1 1 1
MIRT022398 TAF1A TATA-box binding protein associated factor, RNA polymerase I subunit A 1 1
MIRT022399 PYCARD PYD and CARD domain containing 1 1
MIRT022400 SQRDL sulfide quinone oxidoreductase 1 1
MIRT022401 PSG3 pregnancy specific beta-1-glycoprotein 3 1 1
MIRT022402 TMEFF2 transmembrane protein with EGF like and two follistatin like domains 2 1 1
MIRT022403 DENND2D DENN domain containing 2D 1 1
MIRT022404 PTGES prostaglandin E synthase 1 1
MIRT022405 SAMD10 sterile alpha motif domain containing 10 1 1
MIRT022406 ANO1 anoctamin 1 1 1
MIRT022407 PDGFC platelet derived growth factor C 1 1
MIRT022408 TMEM121 transmembrane protein 121 1 1
MIRT022409 FNDC4 fibronectin type III domain containing 4 1 1
MIRT022410 ANKRD36B ankyrin repeat domain 36B 1 1
MIRT022411 PLEKHB1 pleckstrin homology domain containing B1 1 1
MIRT022412 Hes1 hairy and enhancer of split 1 (Drosophila) 1 1
MIRT022413 LOXL1 lysyl oxidase like 1 1 1
MIRT022414 TPRA1 transmembrane protein adipocyte associated 1 1 1
MIRT022415 IPCEF1 interaction protein for cytohesin exchange factors 1 1 1
MIRT022416 CLN5 CLN5, intracellular trafficking protein 1 1
MIRT022417 AMIGO2 adhesion molecule with Ig like domain 2 1 1
MIRT022418 CTAGE5 melanoma inhibitory activity 2 1 1
MIRT022419 ICAM5 intercellular adhesion molecule 5 1 1
MIRT022420 ATP8B3 ATPase phospholipid transporting 8B3 1 1
MIRT022421 GSTK1 glutathione S-transferase kappa 1 1 1
MIRT022422 PLA2G7 phospholipase A2 group VII 1 1
MIRT022423 DDX19A DEAD-box helicase 19A 1 1
MIRT022424 CPOX coproporphyrinogen oxidase 1 1
MIRT022425 DPH5 diphthamide biosynthesis 5 1 1
MIRT022426 NEDD4 neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase 1 1
MIRT022427 LAMP2 lysosomal associated membrane protein 2 1 1
MIRT022428 MEPE matrix extracellular phosphoglycoprotein 1 1
MIRT022429 RAB3IL1 RAB3A interacting protein like 1 1 1
MIRT022430 CAST calpastatin 1 1
MIRT022431 ZNF451 zinc finger protein 451 1 1
MIRT022432 AKT3 AKT serine/threonine kinase 3 6 3
MIRT022433 ANGPTL7 angiopoietin like 7 1 1
MIRT022434 UNC5B unc-5 netrin receptor B 1 1
MIRT022435 FAXDC2 fatty acid hydroxylase domain containing 2 1 1
MIRT022436 KIF26A kinesin family member 26A 1 1
MIRT022437 GK5 glycerol kinase 5 (putative) 1 1
MIRT022438 BMPR1A bone morphogenetic protein receptor type 1A 1 1
MIRT022439 ARMC1 armadillo repeat containing 1 1 1
MIRT022440 MDK midkine 1 1
MIRT022441 PLSCR4 phospholipid scramblase 4 1 1
MIRT022442 SLC44A1 solute carrier family 44 member 1 1 1
MIRT022443 CNN3 calponin 3 1 1
MIRT022444 PTPRZ1 protein tyrosine phosphatase, receptor type Z1 1 1
MIRT022445 TWSG1 twisted gastrulation BMP signaling modulator 1 1 1
MIRT022446 ASCC2 activating signal cointegrator 1 complex subunit 2 1 1
MIRT022447 SHE Src homology 2 domain containing E 1 1
MIRT022448 IL11 interleukin 11 1 1
MIRT022449 TCTA T-cell leukemia translocation altered 1 1
MIRT022450 YBX1 Y-box binding protein 1 2 1
MIRT022451 ANAPC5 anaphase promoting complex subunit 5 2 1
MIRT022452 ILF2 interleukin enhancer binding factor 2 2 1
MIRT022453 BRE BRISC and BRCA1 A complex member 2 2 1
MIRT022454 TFB2M transcription factor B2, mitochondrial 2 1
MIRT022455 BCCIP BRCA2 and CDKN1A interacting protein 2 1
MIRT022456 SCAF11 SR-related CTD associated factor 11 2 1
MIRT022457 CKAP4 cytoskeleton associated protein 4 2 1
MIRT022458 G3BP2 G3BP stress granule assembly factor 2 2 1
MIRT022459 NFIB nuclear factor I B 2 1
MIRT022460 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT022461 ASCC3 activating signal cointegrator 1 complex subunit 3 1 1
MIRT022462 DNAJC25 DnaJ heat shock protein family (Hsp40) member C25 1 1
MIRT022463 TNFRSF25 TNF receptor superfamily member 25 1 1
MIRT022464 FLG filaggrin 1 1
MIRT022465 STC2 stanniocalcin 2 1 1
MIRT022466 PSG9 pregnancy specific beta-1-glycoprotein 9 1 1
MIRT022467 MESDC2 mesoderm development LRP chaperone 1 1
MIRT022468 KRT33A keratin 33A 1 1
MIRT022469 ADAMTS1 ADAM metallopeptidase with thrombospondin type 1 motif 1 1 1
MIRT022470 FHDC1 FH2 domain containing 1 1 1
MIRT022471 SS18L2 SS18 like 2 1 1
MIRT022472 GAS6 growth arrest specific 6 1 1
MIRT022473 NUP50 nucleoporin 50 1 1
MIRT022474 DRD4 dopamine receptor D4 1 1
MIRT022475 AIF1L allograft inflammatory factor 1 like 1 1
MIRT022476 USP49 ubiquitin specific peptidase 49 1 1
MIRT022477 TMEM54 transmembrane protein 54 1 1
MIRT022478 KCNC4 potassium voltage-gated channel subfamily C member 4 1 1
MIRT022479 KDSR 3-ketodihydrosphingosine reductase 1 1
MIRT022480 KCNK1 potassium two pore domain channel subfamily K member 1 1 1
MIRT022481 TRIM4 tripartite motif containing 4 1 1
MIRT022482 MALSU1 mitochondrial assembly of ribosomal large subunit 1 1 1
MIRT022483 FAM171A1 family with sequence similarity 171 member A1 1 1
MIRT022484 NEU4 neuraminidase 4 1 1
MIRT022485 FGF5 fibroblast growth factor 5 1 1
MIRT022486 SLC16A6 solute carrier family 16 member 6 1 1
MIRT022487 HFM1 HFM1, ATP dependent DNA helicase homolog 1 1
MIRT022488 HKDC1 hexokinase domain containing 1 1 1
MIRT022489 CCDC71 coiled-coil domain containing 71 1 1
MIRT022490 C6orf89 chromosome 6 open reading frame 89 1 1
MIRT022491 SLC2A4RG SLC2A4 regulator 1 1
MIRT022492 PHF21B PHD finger protein 21B 1 1
MIRT022493 EOGT EGF domain specific O-linked N-acetylglucosamine transferase 1 1
MIRT022494 FRMD3 FERM domain containing 3 1 1
MIRT022495 ROR1 receptor tyrosine kinase like orphan receptor 1 1 1
MIRT022496 STX18 syntaxin 18 1 1
MIRT022497 FAM76A family with sequence similarity 76 member A 1 1
MIRT022498 DZIP1 DAZ interacting zinc finger protein 1 1 1
MIRT022499 PTP4A1 protein tyrosine phosphatase type IVA, member 1 1 1
MIRT022500 ABCC3 ATP binding cassette subfamily C member 3 1 1
MIRT022501 KIAA1704 GPALPP motifs containing 1 1 1
MIRT022502 FXR1 FMR1 autosomal homolog 1 1 1
MIRT022503 NKAP NFKB activating protein 1 1
MIRT022504 BTC betacellulin 1 1
MIRT022505 FMOD fibromodulin 1 1
MIRT022506 NRG1 neuregulin 1 1 1
MIRT022507 BCL6 B-cell CLL/lymphoma 6 1 1
MIRT022508 PQLC3 PQ loop repeat containing 3 1 1
MIRT022509 SHPK sedoheptulokinase 1 1
MIRT022510 C3orf58 chromosome 3 open reading frame 58 1 1
MIRT022511 TOMM34 translocase of outer mitochondrial membrane 34 1 1
MIRT022512 IQCE IQ motif containing E 1 1
MIRT022513 SLC26A2 solute carrier family 26 member 2 1 1
MIRT022514 FAM199X family with sequence similarity 199, X-linked 1 1
MIRT022515 THAP2 THAP domain containing 2 1 1
MIRT022516 SERTAD4 SERTA domain containing 4 1 1
MIRT022517 RYR3 ryanodine receptor 3 1 1
MIRT022518 PIK3C2A phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha 1 1
MIRT022519 TCOF1 treacle ribosome biogenesis factor 1 2 1
MIRT022520 CHRAC1 chromatin accessibility complex 1 2 1
MIRT022521 NPM3 nucleophosmin/nucleoplasmin 3 2 1
MIRT022522 CD2BP2 CD2 cytoplasmic tail binding protein 2 2 1
MIRT022523 TOPBP1 DNA topoisomerase II binding protein 1 2 1
MIRT022524 TTLL3 tubulin tyrosine ligase like 3 2 1
MIRT022525 SYNE1 spectrin repeat containing nuclear envelope protein 1 2 1
MIRT022526 DSG2 desmoglein 2 2 1
MIRT022527 RBPJ recombination signal binding protein for immunoglobulin kappa J region 2 1
MIRT022528 TLR3 toll like receptor 3 1 1
MIRT022529 AARS alanyl-tRNA synthetase 1 1
MIRT022530 RAET1E retinoic acid early transcript 1E 1 1
MIRT022531 HMOX1 heme oxygenase 1 1 1
MIRT022532 KAT2A lysine acetyltransferase 2A 1 1
MIRT022533 SECTM1 secreted and transmembrane 1 1 1
MIRT022534 KIAA1199 cell migration inducing hyaluronan binding protein 1 1
MIRT022535 C8orf33 chromosome 8 open reading frame 33 1 1
MIRT022536 MAPK11 mitogen-activated protein kinase 11 1 1
MIRT022537 TIMP3 TIMP metallopeptidase inhibitor 3 1 1
MIRT022538 RIBC2 RIB43A domain with coiled-coils 2 1 1
MIRT022539 PRB2 proline rich protein BstNI subfamily 2 1 1
MIRT022540 HSD17B2 hydroxysteroid 17-beta dehydrogenase 2 1 1
MIRT022541 TUBE1 tubulin epsilon 1 1 1
MIRT022542 PTGS2 prostaglandin-endoperoxide synthase 2 1 1
MIRT022543 LOXL4 lysyl oxidase like 4 1 1
MIRT022544 POP5 POP5 homolog, ribonuclease P/MRP subunit 1 1
MIRT022545 SSNA1 SS nuclear autoantigen 1 1 1
MIRT022546 ID1 inhibitor of DNA binding 1, HLH protein 1 1
MIRT022547 MYH7B myosin heavy chain 7B 1 1
MIRT022548 RHBDL2 rhomboid like 2 1 1
MIRT022550 YKT6 YKT6 v-SNARE homolog 1 1
MIRT022551 PLA2G4A phospholipase A2 group IVA 1 1
MIRT022552 FBXL18 F-box and leucine rich repeat protein 18 1 1
MIRT022553 NT5C1B 5'-nucleotidase, cytosolic IB 1 1
MIRT022554 TBX2 T-box 2 1 1
MIRT022555 MBD6 methyl-CpG binding domain protein 6 1 1
MIRT022556 SLC38A2 solute carrier family 38 member 2 1 1
MIRT022557 CSGALNACT1 chondroitin sulfate N-acetylgalactosaminyltransferase 1 1 1
MIRT022558 CD86 CD86 molecule 1 1
MIRT022559 HAUS6 HAUS augmin like complex subunit 6 1 1
MIRT022560 LDLRAD4 low density lipoprotein receptor class A domain containing 4 1 1
MIRT022561 TSPAN6 tetraspanin 6 1 1
MIRT022562 COL4A4 collagen type IV alpha 4 chain 1 1
MIRT022563 CNKSR3 CNKSR family member 3 1 1
MIRT022564 SLC25A36 solute carrier family 25 member 36 1 1
MIRT022565 TGOLN2 trans-golgi network protein 2 1 1
MIRT022566 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT022567 RAB11FIP5 RAB11 family interacting protein 5 1 1
MIRT022568 LRRC8C leucine rich repeat containing 8 VRAC subunit C 1 1
MIRT022569 ACADVL acyl-CoA dehydrogenase, very long chain 1 1
MIRT022570 BCAP29 B-cell receptor associated protein 29 1 1
MIRT022571 FRMD6 FERM domain containing 6 1 1
MIRT022572 NXN nucleoredoxin 1 1
MIRT022573 PTPN11 protein tyrosine phosphatase, non-receptor type 11 1 1
MIRT022574 FBXO17 F-box protein 17 1 1
MIRT022575 SNTA1 syntrophin alpha 1 1 1
MIRT022576 ZMPSTE24 zinc metallopeptidase STE24 1 1
MIRT022577 SLC9A9 solute carrier family 9 member A9 1 1
MIRT022578 NRP1 neuropilin 1 3 1
MIRT022579 SNX16 sorting nexin 16 1 1
MIRT022580 AK3 adenylate kinase 3 1 1
MIRT022581 ANKS6 ankyrin repeat and sterile alpha motif domain containing 6 1 1
MIRT022582 RRP15 ribosomal RNA processing 15 homolog 1 1
MIRT022583 WASF2 WAS protein family member 2 1 1
MIRT022584 DENND6A DENN domain containing 6A 1 1
MIRT022585 RBM24 RNA binding motif protein 24 1 1
MIRT022586 RNFT1 ring finger protein, transmembrane 1 1 1
MIRT022587 COL1A1 collagen type I alpha 1 chain 2 1
MIRT022588 MOGS mannosyl-oligosaccharide glucosidase 2 1
MIRT022589 KANK2 KN motif and ankyrin repeat domains 2 2 1
MIRT022590 SNRPF small nuclear ribonucleoprotein polypeptide F 2 1
MIRT022591 PARN poly(A)-specific ribonuclease 2 1
MIRT022592 TIMM13 translocase of inner mitochondrial membrane 13 2 1
MIRT022593 MUC1 mucin 1, cell surface associated 2 1
MIRT022594 PRPH peripherin 2 1
MIRT022595 CDKN2AIP CDKN2A interacting protein 2 1
MIRT022596 PHC2 polyhomeotic homolog 2 2 1
MIRT022597 DCUN1D5 defective in cullin neddylation 1 domain containing 5 2 1
MIRT022598 ANAPC7 anaphase promoting complex subunit 7 2 1
MIRT022599 FAM175B abraxas 2, BRISC complex subunit 1 1
MIRT022600 SGSM3 small G protein signaling modulator 3 1 1
MIRT022601 SPATA9 spermatogenesis associated 9 1 1
MIRT022602 PPAP2B phospholipid phosphatase 3 1 1
MIRT022603 MFSD10 major facilitator superfamily domain containing 10 1 1
MIRT022604 IFI44L interferon induced protein 44 like 1 1
MIRT022605 COL6A2 collagen type VI alpha 2 chain 1 1
MIRT022606 LAMC1 laminin subunit gamma 1 1 1
MIRT022607 PRKAG1 protein kinase AMP-activated non-catalytic subunit gamma 1 1 1
MIRT022608 Mapk14 mitogen-activated protein kinase 14 1 1
MIRT022609 SLC39A11 solute carrier family 39 member 11 1 1
MIRT022610 MTCH1 mitochondrial carrier 1 1 1
MIRT022611 HOXA3 homeobox A3 1 1
MIRT022612 CHST6 carbohydrate sulfotransferase 6 1 1
MIRT022613 RAB32 RAB32, member RAS oncogene family 4 1
MIRT022614 ZNF549 zinc finger protein 549 1 1
MIRT022615 ANKRD42 ankyrin repeat domain 42 1 1
MIRT022616 DOK7 docking protein 7 1 1
MIRT022617 TGM1 transglutaminase 1 1 1
MIRT022618 MMP26 matrix metallopeptidase 26 1 1
MIRT022619 CABLES1 Cdk5 and Abl enzyme substrate 1 1 1
MIRT022620 FAM83D family with sequence similarity 83 member D 1 1
MIRT022621 PTP4A2 protein tyrosine phosphatase type IVA, member 2 1 1
MIRT022622 ETNPPL ethanolamine-phosphate phospho-lyase 1 1
MIRT022623 MAPKAPK3 mitogen-activated protein kinase-activated protein kinase 3 1 1
MIRT022624 CPM carboxypeptidase M 1 1
MIRT022625 PEMT phosphatidylethanolamine N-methyltransferase 1 1
MIRT022626 SKIL SKI like proto-oncogene 1 1
MIRT022627 DAPK1 death associated protein kinase 1 1 1
MIRT022628 MXD4 MAX dimerization protein 4 1 1
MIRT022629 DBNL drebrin like 1 1
MIRT022630 ABHD4 abhydrolase domain containing 4 1 1
MIRT022631 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT022632 TMED10 transmembrane p24 trafficking protein 10 1 1
MIRT022633 ANKS1B ankyrin repeat and sterile alpha motif domain containing 1B 1 1
MIRT022634 NARG2 interactor of little elongation complex ELL subunit 2 1 1
MIRT022635 HSPB7 heat shock protein family B (small) member 7 1 1
MIRT022636 SLC25A39 solute carrier family 25 member 39 1 1
MIRT022637 SNX7 sorting nexin 7 1 1
MIRT022638 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 1
MIRT022639 MKLN1 muskelin 1 1 1
MIRT022640 ATRIP ATR interacting protein 1 1
MIRT022641 MVB12A multivesicular body subunit 12A 1 1
MIRT022642 IMPACT impact RWD domain protein 1 1
MIRT022643 FAM133A family with sequence similarity 133 member A 1 1
MIRT022644 NR4A3 nuclear receptor subfamily 4 group A member 3 1 1
MIRT022645 CYP2U1 cytochrome P450 family 2 subfamily U member 1 1 1
MIRT022646 DHRS1 dehydrogenase/reductase 1 1 1
MIRT022647 MSRA methionine sulfoxide reductase A 1 1
MIRT022648 POC1B POC1 centriolar protein B 1 1
MIRT022649 UMPS uridine monophosphate synthetase 1 1
MIRT022650 GRM1 glutamate metabotropic receptor 1 1 1
MIRT022651 GIT2 GIT ArfGAP 2 1 1
MIRT022652 TP53INP1 tumor protein p53 inducible nuclear protein 1 1 1
MIRT022653 EGR2 early growth response 2 1 1
MIRT022654 KRI1 KRI1 homolog 2 1
MIRT022655 MISP mitotic spindle positioning 2 1
MIRT022656 ALDOB aldolase, fructose-bisphosphate B 2 1
MIRT022657 IFI16 interferon gamma inducible protein 16 2 1
MIRT022658 RAVER1 ribonucleoprotein, PTB binding 1 2 1
MIRT022659 DCTN3 dynactin subunit 3 2 1
MIRT022660 QKI QKI, KH domain containing RNA binding 2 1
MIRT022661 DDIT4 DNA damage inducible transcript 4 1 1
MIRT022662 TGFB1I1 transforming growth factor beta 1 induced transcript 1 1 1
MIRT022663 FAM206A family with sequence similarity 206 member A 1 1
MIRT022664 ZNF655 zinc finger protein 655 1 1
MIRT022665 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT022666 NTF4 neurotrophin 4 1 1
MIRT022667 CCDC142 coiled-coil domain containing 142 1 1
MIRT022668 DCC DCC netrin 1 receptor 1 1
MIRT022669 ZNF395 zinc finger protein 395 1 1
MIRT022670 EVI2A ecotropic viral integration site 2A 1 1
MIRT022671 QSER1 glutamine and serine rich 1 1 1
MIRT022672 PDSS1 decaprenyl diphosphate synthase subunit 1 1 1
MIRT022673 NSUN7 NOP2/Sun RNA methyltransferase family member 7 1 1
MIRT022674 FAM105A family with sequence similarity 105 member A 1 1
MIRT022675 PGGT1B protein geranylgeranyltransferase type I subunit beta 1 1
MIRT022676 RSAD1 radical S-adenosyl methionine domain containing 1 1 1
MIRT022677 BABAM1 BRISC and BRCA1 A complex member 1 1 1
MIRT022678 ABCG8 ATP binding cassette subfamily G member 8 1 1
MIRT022679 COL8A2 collagen type VIII alpha 2 chain 1 1
MIRT022680 TSR2 TSR2, ribosome maturation factor 1 1
MIRT022681 TRIM65 tripartite motif containing 65 1 1
MIRT022682 CTHRC1 collagen triple helix repeat containing 1 1 1
MIRT022683 C1orf85 glycosylated lysosomal membrane protein 1 1
MIRT022684 OASL 2'-5'-oligoadenylate synthetase like 1 1
MIRT022685 ITGB1 integrin subunit beta 1 1 1
MIRT022686 USP5 ubiquitin specific peptidase 5 1 1
MIRT022687 IFIT3 interferon induced protein with tetratricopeptide repeats 3 1 1
MIRT022688 ITPRIP inositol 1,4,5-trisphosphate receptor interacting protein 1 1
MIRT022689 VIT vitrin 1 1
MIRT022690 TUBB2B tubulin beta 2B class IIb 1 1
MIRT022691 IGFBP4 insulin like growth factor binding protein 4 1 1
MIRT022692 C1orf198 chromosome 1 open reading frame 198 1 1
MIRT022693 CDV3 CDV3 homolog 1 1
MIRT022694 FAM19A2 family with sequence similarity 19 member A2, C-C motif chemokine like 1 1
MIRT022695 FECH ferrochelatase 1 1
MIRT022696 VAMP8 vesicle associated membrane protein 8 1 1
MIRT022697 FNDC3B fibronectin type III domain containing 3B 1 1
MIRT022698 KCNS3 potassium voltage-gated channel modifier subfamily S member 3 1 1
MIRT022699 MAP3K7CL MAP3K7 C-terminal like 1 1
MIRT022700 FMNL2 formin like 2 1 1
MIRT022701 FAM89A family with sequence similarity 89 member A 1 1
MIRT022702 ICMT isoprenylcysteine carboxyl methyltransferase 3 5
MIRT022703 GPC1 glypican 1 1 1
MIRT022704 PRDM13 PR/SET domain 13 1 1
MIRT022705 PNP purine nucleoside phosphorylase 1 1
MIRT022706 ACOT11 acyl-CoA thioesterase 11 1 1
MIRT022707 SLC35F3 solute carrier family 35 member F3 1 1
MIRT022708 RPP25L ribonuclease P/MRP subunit p25 like 1 1
MIRT022709 RHBDF1 rhomboid 5 homolog 1 1 1
MIRT022710 TXLNA taxilin alpha 1 1
MIRT022711 MST4 serine/threonine kinase 26 1 1
MIRT022712 NUFIP2 NUFIP2, FMR1 interacting protein 2 3 3
MIRT022713 TMED1 transmembrane p24 trafficking protein 1 1 1
MIRT022714 GGA2 golgi associated, gamma adaptin ear containing, ARF binding protein 2 1 1
MIRT022715 PPARA peroxisome proliferator activated receptor alpha 1 1
MIRT022716 TPD52L2 tumor protein D52 like 2 1 1
MIRT022717 LRRC58 leucine rich repeat containing 58 4 4
MIRT022718 ANAPC4 anaphase promoting complex subunit 4 2 1
MIRT022719 IGFBP7 insulin like growth factor binding protein 7 2 1
MIRT022720 CCT3 chaperonin containing TCP1 subunit 3 2 1
MIRT022721 NONO non-POU domain containing octamer binding 2 1
MIRT022722 THOC6 THO complex 6 2 1
MIRT022723 CTNNB1 catenin beta 1 2 1
MIRT022724 CLTA clathrin light chain A 2 1
MIRT022725 TFAP4 transcription factor AP-4 5 1
MIRT022726 ACTR3 ARP3 actin related protein 3 homolog 2 1
MIRT022727 CHMP2B charged multivesicular body protein 2B 1 1
MIRT022728 EIF4E eukaryotic translation initiation factor 4E 2 1
MIRT022729 PTBP3 polypyrimidine tract binding protein 3 4 3
MIRT022730 RPL23 ribosomal protein L23 1 1
MIRT022731 BCL6B B-cell CLL/lymphoma 6B 1 1
MIRT022732 S100A2 S100 calcium binding protein A2 1 1
MIRT022733 LINC00174 long intergenic non-protein coding RNA 174 1 1
MIRT022734 DNAH5 dynein axonemal heavy chain 5 1 1
MIRT022735 CARD14 caspase recruitment domain family member 14 1 1
MIRT022736 ANO6 anoctamin 6 1 1
MIRT022737 GREM1 gremlin 1, DAN family BMP antagonist 1 1
MIRT022738 TRPV3 transient receptor potential cation channel subfamily V member 3 1 1
MIRT022739 NPR1 natriuretic peptide receptor 1 1 1
MIRT022740 ANGPTL4 angiopoietin like 4 1 1
MIRT022741 HTRA3 HtrA serine peptidase 3 1 1
MIRT022742 WRAP53 WD repeat containing antisense to TP53 1 1
MIRT022743 NTHL1 nth like DNA glycosylase 1 1 1
MIRT022744 DPYD dihydropyrimidine dehydrogenase 1 1
MIRT022745 GABBR2 gamma-aminobutyric acid type B receptor subunit 2 1 1
MIRT022746 DNAJC25-GNG10 DNAJC25-GNG10 readthrough 1 1
MIRT022747 IL27RA interleukin 27 receptor subunit alpha 1 1
MIRT022748 GNRHR gonadotropin releasing hormone receptor 1 1
MIRT022749 TTC8 tetratricopeptide repeat domain 8 1 1
MIRT022750 STK38L serine/threonine kinase 38 like 1 1
MIRT022751 TUBB4A tubulin beta 4A class IVa 1 1
MIRT022752 IFIT2 interferon induced protein with tetratricopeptide repeats 2 1 1
MIRT022754 NRF1 nuclear respiratory factor 1 1 1
MIRT022755 EIF2AK2 eukaryotic translation initiation factor 2 alpha kinase 2 1 1
MIRT022756 NID2 nidogen 2 1 1
MIRT022757 MARCH11 membrane associated ring-CH-type finger 11 1 1
MIRT022758 ADAMTSL5 ADAMTS like 5 1 1
MIRT022759 SCN3A sodium voltage-gated channel alpha subunit 3 1 1
MIRT022760 NDE1 nudE neurodevelopment protein 1 1 1
MIRT022761 BEX1 brain expressed X-linked 1 1 1
MIRT022762 GDA guanine deaminase 1 1
MIRT022763 PDE3B phosphodiesterase 3B 1 1
MIRT022764 RECK reversion inducing cysteine rich protein with kazal motifs 1 1
MIRT022765 CTNS cystinosin, lysosomal cystine transporter 1 1
MIRT022766 MKX mohawk homeobox 1 1
MIRT022767 SGMS1 sphingomyelin synthase 1 1 1
MIRT022768 AKT2 AKT serine/threonine kinase 2 1 1
MIRT022769 LAPTM4A lysosomal protein transmembrane 4 alpha 1 1
MIRT022770 SLC7A1 solute carrier family 7 member 1 1 1
MIRT022771 ZNF548 zinc finger protein 548 1 1
MIRT022772 NLRX1 NLR family member X1 1 1
MIRT022773 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT022774 SDF2L1 stromal cell derived factor 2 like 1 1 1
MIRT022775 DACT1 dishevelled binding antagonist of beta catenin 1 1 1
MIRT022776 POGLUT1 protein O-glucosyltransferase 1 1 1
MIRT022777 AMMECR1 Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 1 1
MIRT022778 VPS4B vacuolar protein sorting 4 homolog B 1 1
MIRT022779 TRIP12 thyroid hormone receptor interactor 12 1 1
MIRT022780 TMEM184B transmembrane protein 184B 1 1
MIRT022781 C9orf41 carnosine N-methyltransferase 1 3 3
MIRT022782 KIF16B kinesin family member 16B 1 1
MIRT022783 ITSN2 intersectin 2 1 1
MIRT022784 FAM122B family with sequence similarity 122B 1 1
MIRT022785 CCDC68 coiled-coil domain containing 68 1 1
MIRT022786 AKT1S1 AKT1 substrate 1 1 1
MIRT022787 PHF6 PHD finger protein 6 1 1
MIRT022788 MBD3 methyl-CpG binding domain protein 3 2 1
MIRT022789 FLII FLII, actin remodeling protein 2 1
MIRT022790 CSRP1 cysteine and glycine rich protein 1 2 1
MIRT022791 GOLGA7 golgin A7 2 1
MIRT022792 DPF2 double PHD fingers 2 2 1
MIRT022793 MLLT4 afadin, adherens junction formation factor 2 1
MIRT022794 RHOC ras homolog family member C 2 1
MIRT022795 ABCF2 ATP binding cassette subfamily F member 2 2 1
MIRT022796 DKC1 dyskerin pseudouridine synthase 1 2 1
MIRT022797 CCDC86 coiled-coil domain containing 86 2 1
MIRT022798 LARP1 La ribonucleoprotein domain family member 1 2 1
MIRT022799 HADHA hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit 2 1
MIRT022800 EFHD2 EF-hand domain family member D2 2 1
MIRT022801 ANXA5 annexin A5 2 1
MIRT022802 SPOCD1 SPOC domain containing 1 1 1
MIRT022803 GPX7 glutathione peroxidase 7 1 1
MIRT022804 EPDR1 ependymin related 1 1 1
MIRT022805 KIAA1217 KIAA1217 1 1
MIRT022806 CNNM2 cyclin and CBS domain divalent metal cation transport mediator 2 1 1
MIRT022807 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT022808 GCSAML germinal center associated signaling and motility like 1 1
MIRT022809 SLC38A5 solute carrier family 38 member 5 1 1
MIRT022810 DSCAML1 DS cell adhesion molecule like 1 1 1
MIRT022811 CCM2L CCM2 like scaffolding protein 1 1
MIRT022812 BARX1 BARX homeobox 1 1 1
MIRT022813 THPO thrombopoietin 1 1
MIRT022814 ATG4A autophagy related 4A cysteine peptidase 1 1
MIRT022815 SLC35A2 solute carrier family 35 member A2 1 1
MIRT022816 VASN vasorin 1 1
MIRT022817 F3 coagulation factor III, tissue factor 1 1
MIRT022818 AAMDC adipogenesis associated Mth938 domain containing 1 1
MIRT022819 NUPR1 nuclear protein 1, transcriptional regulator 1 1
MIRT022820 LRRC42 leucine rich repeat containing 42 1 1
MIRT022821 MTUS2 microtubule associated scaffold protein 2 1 1
MIRT022822 ROBO3 roundabout guidance receptor 3 1 1
MIRT022823 CCNA1 cyclin A1 1 1
MIRT022824 C4BPB complement component 4 binding protein beta 1 1
MIRT022825 FAR1 fatty acyl-CoA reductase 1 1 1
MIRT022826 CBR3 carbonyl reductase 3 1 1
MIRT022827 TRPC6 transient receptor potential cation channel subfamily C member 6 1 1
MIRT022828 RASSF2 Ras association domain family member 2 1 1
MIRT022829 FAM65C RIPOR family member 3 1 1
MIRT022830 PREB prolactin regulatory element binding 1 1
MIRT022831 SMPDL3A sphingomyelin phosphodiesterase acid like 3A 1 1
MIRT022832 FGFBP1 fibroblast growth factor binding protein 1 1 1
MIRT022833 LRRC15 leucine rich repeat containing 15 1 1
MIRT022834 CCDC121 coiled-coil domain containing 121 1 1
MIRT022835 TMEM104 transmembrane protein 104 3 3
MIRT022836 HRH1 histamine receptor H1 1 1
MIRT022837 LIMD1 LIM domains containing 1 1 1
MIRT022838 LRRFIP2 LRR binding FLII interacting protein 2 1 1
MIRT022839 RAB31 RAB31, member RAS oncogene family 1 1
MIRT022840 PLEKHG4 pleckstrin homology and RhoGEF domain containing G4 1 1
MIRT022841 PARP9 poly(ADP-ribose) polymerase family member 9 1 1
MIRT022842 GCH1 GTP cyclohydrolase 1 1 1
MIRT022843 SPTY2D1 SPT2 chromatin protein domain containing 1 1 1
MIRT022844 GXYLT1 glucoside xylosyltransferase 1 3 7
MIRT022845 ZBTB6 zinc finger and BTB domain containing 6 1 1
MIRT022846 FSTL1 follistatin like 1 4 1
MIRT022847 RPIA ribose 5-phosphate isomerase A 1 1
MIRT022848 LPP LIM domain containing preferred translocation partner in lipoma 1 1
MIRT022849 SHMT2 serine hydroxymethyltransferase 2 2 1
MIRT022850 TUBA1A tubulin alpha 1a 1 1
MIRT022851 PES1 pescadillo ribosomal biogenesis factor 1 2 1
MIRT022852 ALDH3B2 aldehyde dehydrogenase 3 family member B2 2 1
MIRT022853 MCM7 minichromosome maintenance complex component 7 2 1
MIRT022854 POLR2J RNA polymerase II subunit J 2 1
MIRT022855 KIAA0101 PCNA clamp associated factor 2 1
MIRT022856 CAPRIN1 cell cycle associated protein 1 2 1
MIRT022857 CNP 2',3'-cyclic nucleotide 3' phosphodiesterase 2 1
MIRT022858 PACSIN3 protein kinase C and casein kinase substrate in neurons 3 2 1
MIRT022859 ADD3 adducin 3 2 1
MIRT022860 FOXRED2 FAD dependent oxidoreductase domain containing 2 2 1
MIRT022861 RRAS2 RAS related 2 2 1
MIRT022862 MSN moesin 2 1
MIRT022863 DDX3X DEAD-box helicase 3, X-linked 2 1
MIRT022864 TP63 tumor protein p63 1 1
MIRT022865 CCDC41 centrosomal protein 83 1 1
MIRT022866 SH2D1B SH2 domain containing 1B 1 1
MIRT022867 ELP2 elongator acetyltransferase complex subunit 2 1 1
MIRT022868 P4HA3 prolyl 4-hydroxylase subunit alpha 3 1 1
MIRT022869 CLMP CXADR like membrane protein 1 1
MIRT022870 RASIP1 Ras interacting protein 1 1 1
MIRT022871 GOLT1B golgi transport 1B 1 1
MIRT022872 IVD isovaleryl-CoA dehydrogenase 1 1
MIRT022873 NAT6 N-acetyltransferase 6 1 1
MIRT022874 ANKS3 ankyrin repeat and sterile alpha motif domain containing 3 1 1
MIRT022875 CSTF3 cleavage stimulation factor subunit 3 1 1
MIRT022876 EIF4EBP1 eukaryotic translation initiation factor 4E binding protein 1 1 1
MIRT022877 MRPS11 mitochondrial ribosomal protein S11 1 1
MIRT022878 ID4 inhibitor of DNA binding 4, HLH protein 1 1
MIRT022879 CXXC1 CXXC finger protein 1 1 1
MIRT022880 XBP1 X-box binding protein 1 1 1
MIRT022881 NTMT1 N-terminal Xaa-Pro-Lys N-methyltransferase 1 1 1
MIRT022882 SNAI1 snail family transcriptional repressor 1 1 1
MIRT022883 RHOA ras homolog family member A 1 1
MIRT022884 NCF2 neutrophil cytosolic factor 2 1 1
MIRT022885 CDO1 cysteine dioxygenase type 1 1 1
MIRT022886 WNT5B Wnt family member 5B 1 1
MIRT022887 TMEM179B transmembrane protein 179B 1 1
MIRT022888 USP47 ubiquitin specific peptidase 47 1 1
MIRT022889 LCA5L LCA5L, lebercilin like 1 1
MIRT022890 CRB1 crumbs 1, cell polarity complex component 1 1
MIRT022891 CD2AP CD2 associated protein 1 1
MIRT022892 HN1L Jupiter microtubule associated homolog 2 1 1
MIRT022893 MAP3K4 mitogen-activated protein kinase kinase kinase 4 1 1
MIRT022894 GRAMD3 GRAM domain containing 2B 1 1
MIRT022895 AIM1 crystallin beta-gamma domain containing 1 1 1
MIRT022896 LRIG1 leucine rich repeats and immunoglobulin like domains 1 1 1
MIRT022897 CENPQ centromere protein Q 1 1
MIRT022898 RUNX2 runt related transcription factor 2 1 1
MIRT022899 SMCR7L mitochondrial elongation factor 1 1 1
MIRT022900 QSOX1 quiescin sulfhydryl oxidase 1 1 1
MIRT022901 RAB38 RAB38, member RAS oncogene family 1 1
MIRT022902 CCBL2 kynurenine aminotransferase 3 1 1
MIRT022903 H6PD hexose-6-phosphate dehydrogenase/glucose 1-dehydrogenase 3 3
MIRT022904 PARP14 poly(ADP-ribose) polymerase family member 14 1 1
MIRT022905 RAB2A RAB2A, member RAS oncogene family 1 1
MIRT022906 KIF13A kinesin family member 13A 1 1
MIRT022907 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT022908 PRPS1 phosphoribosyl pyrophosphate synthetase 1 1 1
MIRT022909 ERF ETS2 repressor factor 1 1
MIRT022910 CTDSPL CTD small phosphatase like 1 1
MIRT022911 MLLT3 MLLT3, super elongation complex subunit 1 1
MIRT022912 PSKH1 protein serine kinase H1 1 1
MIRT022913 SLITRK4 SLIT and NTRK like family member 4 1 1
MIRT022914 EVI5 ecotropic viral integration site 5 1 1
MIRT022915 TBX22 T-box 22 1 1
MIRT022916 KCNK2 potassium two pore domain channel subfamily K member 2 1 1
MIRT022917 WIPF1 WAS/WASL interacting protein family member 1 1 1
MIRT022918 HIPK3 homeodomain interacting protein kinase 3 1 1
MIRT022919 BMP6 bone morphogenetic protein 6 1 1
MIRT022920 STT3A STT3A, catalytic subunit of the oligosaccharyltransferase complex 1 1
MIRT022921 SNX9 sorting nexin 9 2 1
MIRT022922 RPRD1B regulation of nuclear pre-mRNA domain containing 1B 2 1
MIRT022923 GLIPR2 GLI pathogenesis related 2 2 1
MIRT022924 GAR1 GAR1 ribonucleoprotein 2 1
MIRT022925 POLR2L RNA polymerase II subunit L 2 1
MIRT022926 PABPC4 poly(A) binding protein cytoplasmic 4 2 1
MIRT022927 SERPINH1 serpin family H member 1 2 1
MIRT022928 KDM2A lysine demethylase 2A 2 1
MIRT022929 HNRNPCL1 heterogeneous nuclear ribonucleoprotein C-like 1 2 1
MIRT022930 ALDH18A1 aldehyde dehydrogenase 18 family member A1 2 1
MIRT022931 CDKN2A cyclin dependent kinase inhibitor 2A 2 1
MIRT022932 EIF3B eukaryotic translation initiation factor 3 subunit B 2 1
MIRT022933 SP3 Sp3 transcription factor 2 1
MIRT022934 DDX6 DEAD-box helicase 6 2 1
MIRT022935 GAB3 GRB2 associated binding protein 3 1 1
MIRT022936 SAMSN1 SAM domain, SH3 domain and nuclear localization signals 1 1 1
MIRT022937 CCDC11 cilia and flagella associated protein 53 1 1
MIRT022938 GUK1 guanylate kinase 1 1 1
MIRT022939 TRIM7 tripartite motif containing 7 1 1
MIRT022940 MRPS12 mitochondrial ribosomal protein S12 1 1
MIRT022941 CC2D2A coiled-coil and C2 domain containing 2A 1 1
MIRT022942 CHSY3 chondroitin sulfate synthase 3 1 1
MIRT022943 MLEC malectin 1 1
MIRT022944 TREX2 three prime repair exonuclease 2 1 1
MIRT022945 CPA6 carboxypeptidase A6 1 1
MIRT022946 SYNJ2BP synaptojanin 2 binding protein 1 1
MIRT022947 SULT1B1 sulfotransferase family 1B member 1 1 1
MIRT022948 PEX16 peroxisomal biogenesis factor 16 1 1
MIRT022949 NRTN neurturin 1 1
MIRT022950 PPRC1 peroxisome proliferator-activated receptor gamma, coactivator-related 1 1 1
MIRT022951 APPL2 adaptor protein, phosphotyrosine interacting with PH domain and leucine zipper 2 1 1
MIRT022952 TMEM43 transmembrane protein 43 1 1
MIRT022953 UGT1A10 UDP glucuronosyltransferase family 1 member A10 1 1
MIRT022954 LAMA1 laminin subunit alpha 1 1 1
MIRT022955 PRSS50 protease, serine 50 1 1
MIRT022956 LSMEM2 leucine rich single-pass membrane protein 2 1 1
MIRT022957 SEC14L3 SEC14 like lipid binding 3 1 1
MIRT022958 CEBPE CCAAT/enhancer binding protein epsilon 1 1
MIRT022959 NNMT nicotinamide N-methyltransferase 1 1
MIRT022960 MAP2K3 mitogen-activated protein kinase kinase 3 1 1
MIRT022961 RNF144B ring finger protein 144B 1 1
MIRT022962 CABP7 calcium binding protein 7 1 1
MIRT022963 FTSJ1 FtsJ RNA methyltransferase homolog 1 1 1
MIRT022964 RUFY3 RUN and FYVE domain containing 3 1 1
MIRT022965 SULF1 sulfatase 1 1 1
MIRT022966 TPST1 tyrosylprotein sulfotransferase 1 1 1
MIRT022967 SLC22A3 solute carrier family 22 member 3 1 1
MIRT022968 TPCN2 two pore segment channel 2 1 1
MIRT022969 SLC25A16 solute carrier family 25 member 16 1 1
MIRT022970 CA12 carbonic anhydrase 12 1 1
MIRT022971 ZFYVE26 zinc finger FYVE-type containing 26 1 1
MIRT022972 KLF9 Kruppel like factor 9 1 1
MIRT022973 ADCY3 adenylate cyclase 3 1 1
MIRT022974 CCT5 chaperonin containing TCP1 subunit 5 1 1
MIRT022975 HS2ST1 heparan sulfate 2-O-sulfotransferase 1 1 1
MIRT022976 CD151 CD151 molecule (Raph blood group) 4 2
MIRT022977 CDH11 cadherin 11 1 1
MIRT022978 IL7 interleukin 7 1 1
MIRT022979 ITGA3 integrin subunit alpha 3 3 3
MIRT022980 FBLIM1 filamin binding LIM protein 1 1 1
MIRT022981 ARPP21 cAMP regulated phosphoprotein 21 1 1
MIRT022982 CCDC28A coiled-coil domain containing 28A 1 1
MIRT022983 DCAF5 DDB1 and CUL4 associated factor 5 1 1
MIRT022984 TRPS1 transcriptional repressor GATA binding 1 1 1
MIRT022985 PGM2 phosphoglucomutase 2 1 1
MIRT022986 PLEKHF2 pleckstrin homology and FYVE domain containing 2 1 1
MIRT022987 ZWINT ZW10 interacting kinetochore protein 3 3
MIRT022988 RANBP10 RAN binding protein 10 1 1
MIRT022989 TMEM41A transmembrane protein 41A 3 3
MIRT022990 ANPEP alanyl aminopeptidase, membrane 2 1
MIRT022991 PSME3 proteasome activator subunit 3 2 1
MIRT022992 PBX1 PBX homeobox 1 2 1
MIRT022993 AHNAK2 AHNAK nucleoprotein 2 2 1
MIRT022994 AATF apoptosis antagonizing transcription factor 2 1
MIRT022995 HSD17B10 hydroxysteroid 17-beta dehydrogenase 10 2 1
MIRT022996 NT5E 5'-nucleotidase ecto 2 1
MIRT022997 NSUN2 NOP2/Sun RNA methyltransferase family member 2 2 1
MIRT022998 RFX1 regulatory factor X1 2 1
MIRT022999 TRIM37 tripartite motif containing 37 1 1
MIRT023000 F13B coagulation factor XIII B chain 1 1
MIRT023001 NPLOC4 NPL4 homolog, ubiquitin recognition factor 1 1
MIRT023002 KIF20A kinesin family member 20A 1 1
MIRT023003 MYO19 myosin XIX 1 1
MIRT023004 GNPDA1 glucosamine-6-phosphate deaminase 1 1 1
MIRT023005 RBBP9 RB binding protein 9, serine hydrolase 1 1
MIRT023006 L3HYPDH trans-L-3-hydroxyproline dehydratase 1 1
MIRT023007 ASPN asporin 1 1
MIRT023008 S1PR5 sphingosine-1-phosphate receptor 5 1 1
MIRT023009 UNC79 unc-79 homolog, NALCN channel complex subunit 1 1
MIRT023010 TNS4 tensin 4 1 1
MIRT023011 TMEM161A transmembrane protein 161A 1 1
MIRT023012 CEPT1 choline/ethanolamine phosphotransferase 1 1 1
MIRT023013 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT023014 S100G S100 calcium binding protein G 1 1
MIRT023015 FLI1 Fli-1 proto-oncogene, ETS transcription factor 1 1
MIRT023016 PLEKHA4 pleckstrin homology domain containing A4 1 1
MIRT023017 TYK2 tyrosine kinase 2 1 1
MIRT023018 CDH12 cadherin 12 1 1
MIRT023019 DBT dihydrolipoamide branched chain transacylase E2 1 1
MIRT023020 PTGS1 prostaglandin-endoperoxide synthase 1 1 1
MIRT023021 SERPINB2 serpin family B member 2 1 1
MIRT023022 TMEM248 transmembrane protein 248 2 2
MIRT023023 SGPL1 sphingosine-1-phosphate lyase 1 1 1
MIRT023024 KLHL14 kelch like family member 14 1 1
MIRT023025 TM9SF3 transmembrane 9 superfamily member 3 1 1
MIRT023026 LGR5 leucine rich repeat containing G protein-coupled receptor 5 1 1
MIRT023027 PIWIL4 piwi like RNA-mediated gene silencing 4 1 1
MIRT023028 KLF2 Kruppel like factor 2 1 1
MIRT023029 FKBP14 FK506 binding protein 14 1 1
MIRT023030 PXN paxillin 1 1
MIRT023031 RAD51 RAD51 recombinase 1 1
MIRT023032 B4GALT5 beta-1,4-galactosyltransferase 5 1 1
MIRT023033 PRKCDBP caveolae associated protein 3 1 1
MIRT023034 PORCN porcupine O-acyltransferase 1 1
MIRT023035 SHC1 SHC adaptor protein 1 1 1
MIRT023036 KANSL2 KAT8 regulatory NSL complex subunit 2 1 1
MIRT023037 NLGN4Y neuroligin 4, Y-linked 1 1
MIRT023038 CA5B carbonic anhydrase 5B 1 1
MIRT023039 CAPNS1 calpain small subunit 1 3 2
MIRT023040 ZDHHC14 zinc finger DHHC-type containing 14 1 1
MIRT023041 ELF3 E74 like ETS transcription factor 3 1 1
MIRT023042 STK38 serine/threonine kinase 38 1 1
MIRT023043 CYB5A cytochrome b5 type A 1 1
MIRT023044 FCHSD2 FCH and double SH3 domains 2 3 3
MIRT023045 SLC35G1 solute carrier family 35 member G1 1 1
MIRT023046 VANGL1 VANGL planar cell polarity protein 1 1 1
MIRT023047 PECR peroxisomal trans-2-enoyl-CoA reductase 1 1
MIRT023048 TFEB transcription factor EB 1 1
MIRT023049 MORC4 MORC family CW-type zinc finger 4 1 1
MIRT023050 EEA1 early endosome antigen 1 1 1
MIRT023051 ALG2 ALG2, alpha-1,3/1,6-mannosyltransferase 1 1
MIRT023052 PHACTR2 phosphatase and actin regulator 2 1 1
MIRT023053 PTPN9 protein tyrosine phosphatase, non-receptor type 9 1 1
MIRT023054 PTRF caveolae associated protein 1 2 1
MIRT023055 MPHOSPH10 M-phase phosphoprotein 10 2 1
MIRT023056 RBM28 RNA binding motif protein 28 2 1
MIRT023057 TRPC1 transient receptor potential cation channel subfamily C member 1 2 1
MIRT023058 KIF2C kinesin family member 2C 2 1
MIRT023059 SLU7 SLU7 homolog, splicing factor 2 1
MIRT023060 MAZ MYC associated zinc finger protein 2 1
MIRT023061 MINA ribosomal oxygenase 2 2 1
MIRT023062 TIMM8B translocase of inner mitochondrial membrane 8 homolog B 2 1
MIRT023063 SMARCA2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 2 1
MIRT023064 ORC1 origin recognition complex subunit 1 2 1
MIRT023065 KRT14 keratin 14 2 1
MIRT023066 NIP7 NIP7, nucleolar pre-rRNA processing protein 2 1
MIRT023067 SRSF5 serine and arginine rich splicing factor 5 2 1
MIRT023068 CORO2A coronin 2A 2 1
MIRT023069 SIRT1 sirtuin 1 1 1
MIRT023070 COL12A1 collagen type XII alpha 1 chain 4 3
MIRT023071 RIN1 Ras and Rab interactor 1 1 1
MIRT023072 HOXC9 homeobox C9 1 1
MIRT023073 PCSK9 proprotein convertase subtilisin/kexin type 9 1 1
MIRT023074 LYVE1 lymphatic vessel endothelial hyaluronan receptor 1 1 1
MIRT023075 GNA12 G protein subunit alpha 12 1 1
MIRT023076 L1CAM L1 cell adhesion molecule 1 1
MIRT023077 ZNF790 zinc finger protein 790 1 1
MIRT023078 CCDC39 coiled-coil domain containing 39 1 1
MIRT023079 IL8 C-X-C motif chemokine ligand 8 1 1
MIRT023080 IKBIP IKBKB interacting protein 1 1
MIRT023081 IGFN1 immunoglobulin-like and fibronectin type III domain containing 1 1 1
MIRT023082 STAT5A signal transducer and activator of transcription 5A 1 1
MIRT023083 CHP1 calcineurin like EF-hand protein 1 1 1
MIRT023084 CXCL1 C-X-C motif chemokine ligand 1 1 1
MIRT023085 CAMP cathelicidin antimicrobial peptide 1 1
MIRT023086 SMIM12 small integral membrane protein 12 1 1
MIRT023087 CMTM3 CKLF like MARVEL transmembrane domain containing 3 1 1
MIRT023088 PLEKHM2 pleckstrin homology and RUN domain containing M2 1 1
MIRT023089 TMEM102 transmembrane protein 102 1 1
MIRT023090 IL18R1 interleukin 18 receptor 1 1 1
MIRT023091 HCN2 hyperpolarization activated cyclic nucleotide gated potassium and sodium channel 2 1 1
MIRT023092 LAMB3 laminin subunit beta 3 1 1
MIRT023093 DUSP2 dual specificity phosphatase 2 1 1
MIRT023094 MPRIP myosin phosphatase Rho interacting protein 1 1
MIRT023095 WASF4P WAS protein family member 4, pseudogene 1 1
MIRT023096 DGKA diacylglycerol kinase alpha 1 1
MIRT023097 SLC26A4 solute carrier family 26 member 4 1 1
MIRT023098 DUS4L dihydrouridine synthase 4 like 1 1
MIRT023099 CYR61 cysteine rich angiogenic inducer 61 1 1
MIRT023100 EYS eyes shut homolog (Drosophila) 1 1
MIRT023101 ECE2 endothelin converting enzyme 2 1 1
MIRT023102 C12orf40 chromosome 12 open reading frame 40 1 1
MIRT023103 KIF7 kinesin family member 7 1 1
MIRT023104 MICAL1 microtubule associated monooxygenase, calponin and LIM domain containing 1 1 1
MIRT023105 SC5D sterol-C5-desaturase 1 1
MIRT023106 KIF1B kinesin family member 1B 1 1
MIRT023107 AGTR1 angiotensin II receptor type 1 1 1
MIRT023108 PLEKHA7 pleckstrin homology domain containing A7 1 1
MIRT023109 FCF1 FCF1, rRNA-processing protein 1 1
MIRT023110 NR4A1 nuclear receptor subfamily 4 group A member 1 1 1
MIRT023111 ABT1 activator of basal transcription 1 3 3
MIRT023112 THEM6 thioesterase superfamily member 6 1 1
MIRT023113 MAP3K3 mitogen-activated protein kinase kinase kinase 3 1 1
MIRT023114 EML1 echinoderm microtubule associated protein like 1 1 1
MIRT023115 IL1R1 interleukin 1 receptor type 1 1 1
MIRT023116 RCAN1 regulator of calcineurin 1 4 1
MIRT023117 DISC1 disrupted in schizophrenia 1 1 1
MIRT023118 RFX2 regulatory factor X2 1 1
MIRT023119 USP38 ubiquitin specific peptidase 38 1 1
MIRT023120 LIMD2 LIM domain containing 2 1 1
MIRT023121 CBX2 chromobox 2 1 1
MIRT023122 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT023123 LTA4H leukotriene A4 hydrolase 1 1
MIRT023124 FPGS folylpolyglutamate synthase 1 1
MIRT023125 SH3PXD2A SH3 and PX domains 2A 1 1
MIRT023126 SOS2 SOS Ras/Rho guanine nucleotide exchange factor 2 1 1
MIRT023127 LMAN2L lectin, mannose binding 2 like 1 1
MIRT023128 SH2B3 SH2B adaptor protein 3 1 1
MIRT023129 IRAK3 interleukin 1 receptor associated kinase 3 1 1
MIRT023130 FRMD8 FERM domain containing 8 1 1
MIRT023131 MED10 mediator complex subunit 10 2 1
MIRT023132 DDX50 DExD-box helicase 50 2 1
MIRT023133 SRBD1 S1 RNA binding domain 1 2 1
MIRT023134 DIEXF digestive organ expansion factor homolog (zebrafish) 2 1
MIRT023135 TPM1 tropomyosin 1 2 1
MIRT023136 ATXN2L ataxin 2 like 2 1
MIRT023137 SPIN3 spindlin family member 3 2 1
MIRT023138 ZBTB2 zinc finger and BTB domain containing 2 2 1
MIRT023139 LLPH LLP homolog, long-term synaptic facilitation 2 1
MIRT023140 GTF3C5 general transcription factor IIIC subunit 5 2 1
MIRT023141 NRAS NRAS proto-oncogene, GTPase 2 1
MIRT023142 PLEC plectin 5 1
MIRT023143 MFSD12 major facilitator superfamily domain containing 12 1 1
MIRT023144 KIRREL2 kirre like nephrin family adhesion molecule 2 1 1
MIRT023145 LRRN1 leucine rich repeat neuronal 1 1 1
MIRT023146 CHIC2 cysteine rich hydrophobic domain 2 1 1
MIRT023147 IQCK IQ motif containing K 1 1
MIRT023148 EIF3L eukaryotic translation initiation factor 3 subunit L 1 1
MIRT023149 PTK7 protein tyrosine kinase 7 (inactive) 1 1
MIRT023150 SLC39A3 solute carrier family 39 member 3 1 1
MIRT023151 GDF10 growth differentiation factor 10 1 1
MIRT023152 LRP10 LDL receptor related protein 10 1 1
MIRT023153 RAB8A RAB8A, member RAS oncogene family 1 1
MIRT023154 LCLAT1 lysocardiolipin acyltransferase 1 1 1
MIRT023155 FAM120A family with sequence similarity 120A 1 1
MIRT023156 MOV10 Mov10 RISC complex RNA helicase 1 1
MIRT023157 TMED9 transmembrane p24 trafficking protein 9 1 1
MIRT023158 ESYT1 extended synaptotagmin 1 1 1
MIRT023159 CRLF1 cytokine receptor like factor 1 1 1
MIRT023160 KCNK18 potassium two pore domain channel subfamily K member 18 1 1
MIRT023161 PSD4 pleckstrin and Sec7 domain containing 4 1 1
MIRT023162 PHF7 PHD finger protein 7 1 1
MIRT023163 CHCHD7 coiled-coil-helix-coiled-coil-helix domain containing 7 1 1
MIRT023164 NBL1 neuroblastoma 1, DAN family BMP antagonist 1 1
MIRT023165 PRRX2 paired related homeobox 2 1 1
MIRT023166 MMP19 matrix metallopeptidase 19 1 1
MIRT023167 FAM167A family with sequence similarity 167 member A 1 1
MIRT023168 TMTC2 transmembrane and tetratricopeptide repeat containing 2 1 1
MIRT023169 EMP1 epithelial membrane protein 1 1 1
MIRT023170 BDKRB1 bradykinin receptor B1 1 1
MIRT023171 RXFP1 relaxin/insulin like family peptide receptor 1 1 1
MIRT023172 ARPC5L actin related protein 2/3 complex subunit 5 like 1 1
MIRT023173 UBE2R2 ubiquitin conjugating enzyme E2 R2 1 1
MIRT023174 PDPR pyruvate dehydrogenase phosphatase regulatory subunit 1 1
MIRT023175 ZNF420 zinc finger protein 420 1 1
MIRT023176 PLXNA2 plexin A2 1 1
MIRT023177 ID2 inhibitor of DNA binding 2, HLH protein 1 1
MIRT023178 MFSD1 major facilitator superfamily domain containing 1 1 1
MIRT023179 ERBB2 erb-b2 receptor tyrosine kinase 2 1 1
MIRT023180 HSD17B6 hydroxysteroid 17-beta dehydrogenase 6 1 1
MIRT023181 TNPO1 transportin 1 1 1
MIRT023182 SLC44A2 solute carrier family 44 member 2 1 1
MIRT023183 RAPGEF3 Rap guanine nucleotide exchange factor 3 1 1
MIRT023184 ACSL5 acyl-CoA synthetase long chain family member 5 1 1
MIRT023185 GALNT7 polypeptide N-acetylgalactosaminyltransferase 7 1 1
MIRT023186 CNOT11 CCR4-NOT transcription complex subunit 11 1 1
MIRT023187 PAQR3 progestin and adipoQ receptor family member 3 1 1
MIRT023188 HS1BP3 HCLS1 binding protein 3 1 1
MIRT023189 TGDS TDP-glucose 4,6-dehydratase 1 1
MIRT023190 CALU calumenin 1 1
MIRT023191 BICD2 BICD cargo adaptor 2 1 1
MIRT023192 EGR1 early growth response 1 3 2
MIRT023193 RBCK1 RANBP2-type and C3HC4-type zinc finger containing 1 1 1
MIRT023194 FSTL3 follistatin like 3 3 3
MIRT023195 TCF3 transcription factor 3 1 1
MIRT023196 PLXNB2 plexin B2 1 1
MIRT023197 CDH2 cadherin 2 1 1
MIRT023198 TRIB3 tribbles pseudokinase 3 6 6
MIRT023199 CRTC3 CREB regulated transcription coactivator 3 1 1
MIRT023200 FARP1 FERM, ARH/RhoGEF and pleckstrin domain protein 1 1 1
MIRT023201 CDON cell adhesion associated, oncogene regulated 1 1
MIRT023202 TNFRSF11B TNF receptor superfamily member 11b 1 1
MIRT023203 SCAMP2 secretory carrier membrane protein 2 1 1
MIRT023204 PNPLA2 patatin like phospholipase domain containing 2 1 1
MIRT023205 OSBP oxysterol binding protein 1 1
MIRT023206 SNAP23 synaptosome associated protein 23 2 1
MIRT023207 POLR2B RNA polymerase II subunit B 2 1
MIRT023208 TERF2 telomeric repeat binding factor 2 2 1
MIRT023209 PICALM phosphatidylinositol binding clathrin assembly protein 2 1
MIRT023210 PCNA proliferating cell nuclear antigen 3 1
MIRT023211 SNRPD3 small nuclear ribonucleoprotein D3 polypeptide 2 1
MIRT023212 KIAA1967 cell cycle and apoptosis regulator 2 2 1
MIRT023213 RCC1 regulator of chromosome condensation 1 2 1
MIRT023214 FHL2 four and a half LIM domains 2 2 1
MIRT023215 CPSF4 cleavage and polyadenylation specific factor 4 2 1
MIRT023216 NFIX nuclear factor I X 4 3
MIRT046106 HMGB3 high mobility group box 3 1 1
MIRT046107 GPX4 glutathione peroxidase 4 1 1
MIRT052931 STAT3 signal transducer and activator of transcription 3 3 8
MIRT053025 RAC1 Rac family small GTPase 1 2 1
MIRT053288 JAG1 jagged 1 3 2
MIRT053290 CAMTA1 calmodulin binding transcription activator 1 3 1
MIRT053356 CLOCK clock circadian regulator 3 1
MIRT054241 SYCP1 synaptonemal complex protein 1 3 2
MIRT054395 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 3 1
MIRT054694 REST RE1 silencing transcription factor 2 1
MIRT054758 Rab38 RAB38, member RAS oncogene family 3 1
MIRT054900 RGS4 regulator of G protein signaling 4 1 1
MIRT054918 CCND2 cyclin D2 2 1
MIRT061247 AMOTL1 angiomotin like 1 5 9
MIRT119038 SFT2D3 SFT2 domain containing 3 2 2
MIRT168868 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT185783 ZNF678 zinc finger protein 678 2 2
MIRT230381 OTUD1 OTU deubiquitinase 1 2 2
MIRT238056 TADA2B transcriptional adaptor 2B 2 2
MIRT343833 SNTB2 syntrophin beta 2 2 2
MIRT347225 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT364372 SLC31A1 solute carrier family 31 member 1 2 2
MIRT384397 KLHL42 kelch like family member 42 2 2
MIRT404495 ARL5B ADP ribosylation factor like GTPase 5B 2 2
MIRT408338 CREBRF CREB3 regulatory factor 2 2
MIRT437343 GRIA2 glutamate ionotropic receptor AMPA type subunit 2 2 2
MIRT437344 GRIA3 glutamate ionotropic receptor AMPA type subunit 3 2 2
MIRT437439 SOS1 SOS Ras/Rac guanine nucleotide exchange factor 1 3 1
MIRT437901 GRIA1 glutamate ionotropic receptor AMPA type subunit 1 2 1
MIRT438114 ITGB3 integrin subunit beta 3 1 1
MIRT438151 XRCC6 X-ray repair cross complementing 6 1 1
MIRT438215 FLOT1 flotillin 1 2 1
MIRT438360 HOTAIR HOX transcript antisense RNA 3 1
MIRT438398 CD274 CD274 molecule 3 1
MIRT441826 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT442711 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT443869 HDLBP high density lipoprotein binding protein 2 2
MIRT447651 RAB3GAP1 RAB3 GTPase activating protein catalytic subunit 1 2 2
MIRT452563 ZFP69B ZFP69 zinc finger protein B 2 2
MIRT453923 COMMD5 COMM domain containing 5 2 4
MIRT454444 QRFPR pyroglutamylated RFamide peptide receptor 2 14
MIRT456520 SRP9 signal recognition particle 9 2 4
MIRT461196 TIPIN TIMELESS interacting protein 2 2
MIRT462882 ZXDB zinc finger, X-linked, duplicated B 2 6
MIRT463237 ZNF131 zinc finger protein 131 2 2
MIRT469001 RNF41 ring finger protein 41 2 2
MIRT470256 PRR14L proline rich 14 like 2 2
MIRT470909 PLIN3 perilipin 3 2 2
MIRT471639 PANK2 pantothenate kinase 2 2 2
MIRT472902 MTDH metadherin 2 8
MIRT473871 MANBAL mannosidase beta like 2 2
MIRT475680 HIATL1 major facilitator superfamily domain containing 14B 2 4
MIRT477338 EPHA2 EPH receptor A2 2 2
MIRT478222 DDX52 DExD-box helicase 52 2 2
MIRT493807 GAN gigaxonin 2 6
MIRT494147 CTC1 CST telomere replication complex component 1 2 10
MIRT494728 ARHGAP1 Rho GTPase activating protein 1 2 6
MIRT497412 LRRC40 leucine rich repeat containing 40 2 2
MIRT498453 HIAT1 major facilitator superfamily domain containing 14A 2 2
MIRT512333 ACTB actin beta 2 4
MIRT519655 ZNF772 zinc finger protein 772 2 4
MIRT522386 MYLIP myosin regulatory light chain interacting protein 2 4
MIRT528864 PKP1 plakophilin 1 2 2
MIRT531173 ZNF626 zinc finger protein 626 2 2
MIRT533394 TYRP1 tyrosinase related protein 1 2 4
MIRT536900 HEPHL1 hephaestin like 1 2 2
MIRT544418 ZNF460 zinc finger protein 460 2 4
MIRT547849 IFNAR2 interferon alpha and beta receptor subunit 2 2 4
MIRT552390 ZNF507 zinc finger protein 507 2 2
MIRT557091 HOXB3 homeobox B3 2 2
MIRT557915 FBXO28 F-box protein 28 2 2
MIRT558229 EFCAB14 EF-hand calcium binding domain 14 2 4
MIRT559514 ARHGEF26 Rho guanine nucleotide exchange factor 26 2 2
MIRT561548 SNX13 sorting nexin 13 2 2
MIRT563045 NBPF12 NBPF member 12 2 2
MIRT564143 GTF2E1 general transcription factor IIE subunit 1 2 2
MIRT564218 SDE2 SDE2 telomere maintenance homolog 2 2
MIRT564579 ZXDA zinc finger, X-linked, duplicated A 2 2
MIRT564769 ZFP36L1 ZFP36 ring finger protein like 1 2 2
MIRT565199 TSHZ1 teashirt zinc finger homeobox 1 2 2
MIRT565220 TROVE2 TROVE domain family member 2 2 2
MIRT565342 TMED5 transmembrane p24 trafficking protein 5 2 2
MIRT565490 SPRTN SprT-like N-terminal domain 2 2
MIRT565752 SERTAD3 SERTA domain containing 3 2 2
MIRT566183 PTPN14 protein tyrosine phosphatase, non-receptor type 14 2 2
MIRT566374 POC1B-GALNT4 POC1B-GALNT4 readthrough 2 2
MIRT566490 PCCB propionyl-CoA carboxylase beta subunit 2 2
MIRT567005 KLHL28 kelch like family member 28 2 2
MIRT567097 KAT7 lysine acetyltransferase 7 2 2
MIRT567153 INO80D INO80 complex subunit D 2 2
MIRT567407 GPATCH8 G-patch domain containing 8 2 2
MIRT567471 GALNT4 polypeptide N-acetylgalactosaminyltransferase 4 2 2
MIRT567789 DGAT2 diacylglycerol O-acyltransferase 2 2 2
MIRT567816 DDI2 DNA damage inducible 1 homolog 2 2 2
MIRT568100 CHEK2 checkpoint kinase 2 2 2
MIRT568529 ANP32E acidic nuclear phosphoprotein 32 family member E 2 2
MIRT568589 AGO2 argonaute 2, RISC catalytic component 4 2
MIRT572690 NCMAP non-compact myelin associated protein 2 2
MIRT574291 RPL19 ribosomal protein L19 2 2
MIRT574646 LPCAT3 lysophosphatidylcholine acyltransferase 3 2 2
MIRT610938 ADRB3 adrenoceptor beta 3 2 4
MIRT616976 GJD2 gap junction protein delta 2 2 2
MIRT621642 UBXN2B UBX domain protein 2B 2 2
MIRT632743 MED28 mediator complex subunit 28 2 2
MIRT646054 CD1D CD1d molecule 2 2
MIRT651522 WNT4 Wnt family member 4 2 2
MIRT654670 PSMB5 proteasome subunit beta 5 2 2
MIRT655479 PAK3 p21 (RAC1) activated kinase 3 2 2
MIRT660277 BLOC1S5 biogenesis of lysosomal organelles complex 1 subunit 5 2 2
MIRT665316 ZBTB3 zinc finger and BTB domain containing 3 2 2
MIRT665787 TMEM181 transmembrane protein 181 2 2
MIRT686788 AZF1 azoospermia factor 1 2 2
MIRT687772 KIAA0355 KIAA0355 2 2
MIRT695653 MAN2B2 mannosidase alpha class 2B member 2 2 2
MIRT696824 PLLP plasmolipin 2 2
MIRT703793 FAM102B family with sequence similarity 102 member B 2 2
MIRT705273 BAHD1 bromo adjacent homology domain containing 1 2 2
MIRT706674 COL13A1 collagen type XIII alpha 1 chain 2 2
MIRT714427 SNED1 sushi, nidogen and EGF like domains 1 2 2
MIRT717140 DLEU1 deleted in lymphocytic leukemia 1 (non-protein coding) 2 2
MIRT720109 SAMD4A sterile alpha motif domain containing 4A 2 2
MIRT722051 HLA-E major histocompatibility complex, class I, E 2 2
MIRT725651 B4GALNT3 beta-1,4-N-acetyl-galactosaminyltransferase 3 2 2
MIRT731694 CBL Cbl proto-oncogene 3 1
MIRT731903 NEAT1 nuclear paraspeckle assembly transcript 1 (non-protein coding) 1 1
MIRT732467 PARP1 poly(ADP-ribose) polymerase 1 4 1
MIRT733004 NOS3 nitric oxide synthase 3 1 0
MIRT733005 APLN apelin 1 0
MIRT733006 ETS1 ETS proto-oncogene 1, transcription factor 1 0
MIRT733666 ELAVL3 ELAV like RNA binding protein 3 1 0
MIRT733759 SNHG14 small nucleolar RNA host gene 14 2 0
MIRT734450 OGFRP1 opioid growth factor receptor pseudogene 1 2 0
MIRT734451 SARM1 sterile alpha and TIR motif containing 1 2 0
MIRT734562 CPT1A carnitine palmitoyltransferase 1A 2 0
MIRT734738 PRKAA2 protein kinase AMP-activated catalytic subunit alpha 2 2 0
MIRT735107 MYD88 myeloid differentiation primary response 88 1 0
MIRT735196 ATF4 activating transcription factor 4 2 0
MIRT735213 LINC00240 long intergenic non-protein coding RNA 240 3 0
MIRT735953 ACTN4 actinin alpha 4 3 0
MIRT736741 MYL2 myosin light chain 2 1 0
MIRT736767 S1PR1 sphingosine-1-phosphate receptor 1 1 0
MIRT736954 ABCC4 ATP binding cassette subfamily C member 4 3 0
MIRT737275 CRKL CRK like proto-oncogene, adaptor protein 4 0
MIRT737400 ZEB2 zinc finger E-box binding homeobox 2 3 0
MIRT755586 NACC1 nucleus accumbens associated 1 3 1
MIRT755647 TNF tumor necrosis factor 3 1
MIRT755648 IL1B interleukin 1 beta 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-124 5-aminoimidazole-4-carboxamide-1-β-d-ribofuranoside (AICAR) NULL 16078949 Microarray hepatocytes 23107762 2013 up-regulated
miR-124 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-124 Vorinostat (SAHA) approved 5311 Microarray A549 human non-small cell lung cancer cells 19513533 2009 up-regulated
miR-124 Cocaine NULL 446220 Quantitative real-time PCR HEK293 cells or rat brain parts 19703567 2009 down-regulated
miR-124 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-124 Chaihu Shugan San NULL NULL Microarray hippocampus 23947143 2013 up-regualted
miR-124 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-124 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) NULL 15625 Microarray embryos 22921993 2012 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-124-3p Paroxetine 43815 approved resistant High Normal lymphoblastoid cell line
hsa-miR-124-3p Doxorubicin 31703 NSC123127 approved sensitive High Hepatocellular Carcinoma tissue and cell line (HepG2)
hsa-miR-124-3p Doxorubicin 31703 NSC123127 approved sensitive Low Renal Cell Cancer cell line (Caki-2)
hsa-miR-124-3p Vinblastine 442111 NSC90636 approved sensitive Low Renal Cell Cancer cell line (Caki-2)
hsa-miR-124-3p Camptothecin 24360 NSC94600 sensitive Low Osteosarcoma cell line (U-2 OS)
hsa-miR-124-3p Camptothecin 24360 NSC94600 sensitive Low Breast Cancer cell line (MDA-MB-231)
hsa-miR-124-3p Camptothecin 24360 NSC94600 sensitive Low Osteosarcoma cell line (U-2-OS)
hsa-miR-124-3p Camptothecin 24360 NSC94600 sensitive Low Breast Cancer cell line (MDA-MB-231)
hsa-miR-124-3p Doxorubicin 31703 NSC123127 approved sensitive Low Breast Cancer cell line (MDA-MB-231)
hsa-miR-124-3p Doxorubicin 31703 NSC123127 approved sensitive Low Osteosarcoma cell line (U-2-OS)
hsa-miR-124-3p Doxorubicin 31703 NSC123127 approved sensitive Low Osteosarcoma cell line (U-2 OS)
hsa-miR-124-3p Doxorubicin 31703 NSC123127 approved sensitive Low Breast Cancer cell line (MDA-MB-231)
hsa-miR-124-3p Etoposide 36462 NSC141540 approved sensitive Low Breast Cancer cell line (MDA-MB-231)
hsa-miR-124-3p Etoposide 36462 NSC141540 approved sensitive Low Breast Cancer cell line (MDA-MB-231)
hsa-miR-124-3p Etoposide 36462 NSC141540 approved sensitive Low Osteosarcoma cell line (U-2 OS)
hsa-miR-124-3p Fluorouracil 3385 NSC19893 approved sensitive Low Breast Cancer cell line (MDA-MB-231)
hsa-miR-124-3p Temozolomide 5394 NSC362856 approved sensitive Low Breast Cancer cell line (MDA-MB-231)
hsa-miR-124-3p Etoposide 36462 NSC141540 approved sensitive Low Osteosarcoma cell line (U-2-OS)
hsa-miR-124-3p Cisplatin 5460033 NSC119875 approved sensitive Low Colorectal Cancer cell line (SW620, SW480)
hsa-miR-124-3p Enzalutamide 15951529 NSC755605 approved sensitive Low Prostate Cancer cell line (22Rv1)
hsa-miR-124-3p Gefitinib 123631 NSC715055 approved sensitive Low Non-Small Cell Lung Cancer cell line
hsa-miR-124-3p Temozolomide 5394 NSC362856 approved sensitive Low Glioblastoma cell line (LN-229)
hsa-miR-124-3p Prednisone 5865 NSC10023 approved resistant Low Acute Lymphoblastic Leukemia cell line (CEM/C1, Jurkat)
hsa-miR-124-3p Cisplatin 5460033 NSC119875 approved sensitive Low Urothelial Bladder Cancer cell line (T24)
hsa-miR-124-3p Gemcitabine 60750 NSC613327 approved sensitive Low Urothelial Bladder Cancer cell line (T24)
hsa-miR-124-3p Gefitinib 123631 NSC715055 approved resistant Low Non-Small Cell Lung Cancer cell line (SPC-A1, NCI-H1650)
hsa-miR-124-3p Erlotinib 176870 NSC718781 approved sensitive Low Pancreatic Cancer cell line (Capan-1, BXPC-3)
hsa-miR-124-3p Doxorubicin 31703 NSC123127 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-124-3p Cisplatin 5460033 NSC119875 approved sensitive Low Hepatocellular Carcinoma cell line (HepG2, Huh-7)
hsa-miR-124-3p Doxorubicin 31703 NSC123127 approved resistant Low Breast Cancer cell line (MCF-7)
hsa-miR-124-3p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-124-3p Cisplatin 5460033 NSC119875 approved sensitive Low Tongue Squamous Cell Carcinoma cell line (CAL-27, SCC-9)
hsa-miR-124-3p Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (MGC803)
hsa-miR-124-3p Carboplatin 38904 NSC241240 approved sensitive Low Ovarian Cancer cell line (SKOV3, A2780)
hsa-miR-124-3p Sorafenib 216239 NSC747971 approved sensitive Low Hepatocellular Carcinoma cell line (Huh-7, HepG2, Hep3B, HCCLM3, 97H, CSQR-2)
hsa-miR-124-3p Etoposide 36462 NSC141540 approved sensitive Low Neuroblastoma cell line (Kelly, SK-N-AS)
hsa-miR-124-3p Cisplatin 5460033 NSC119875 approved sensitive Low Neuroblastoma cell line (Kelly, SK-N-AS)
hsa-miR-124-3p Cisplatin 5460033 NSC119875 approved sensitive Low Gastric Cancer cell line (MGC-803)
hsa-miR-124-3p Docetaxel 148124 NSC628503 approved resistant High Breast Cancer cell line (MDA-MB-231, MCF-7)
hsa-miR-124-3p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549, PC-9)
hsa-miR-124-3p Sorafenib 216239 NSC747971 approved sensitive High Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-124-3p Cisplatin 5460033 NSC119875 approved resistant Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-124-3p Cisplatin 5460033 NSC119875 approved resistant Low Renal Cell Cancer cell line (Caki-1, 786-O)
hsa-miR-124-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-124-3p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-124-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-124-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-124-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-124-3p Cisplatin 5460033 NSC119875 approved resistant tissue
hsa-miR-124-3p Exemestane 60198 NSC713563 approved sensitive cell line (MCF-7)
hsa-miR-124-3p Testosterone+Tamoxifen sensitive cell line (MCF-7)
hsa-miR-124-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-miR-124-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-124-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (RPMI2650)
hsa-miR-124-3p Gemcitabine 60750 NSC613327 approved resistant cell line (HuH28)
hsa-miR-124-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-124-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (H23)
hsa-miR-124-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (H460)
hsa-miR-124-3p Cetuximab resistant tissue (colorectal carcinoma)