miRTarBase - #MIRT002925


—
pre-miRNA Information
pre-miRNA hsa-mir-133a-1   
Genomic Coordinates chr18: 21825698 - 21825785
Synonyms MIRN133A1, MIR133A1
Description Homo sapiens miR-133a-1 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-133a-2   
Genomic Coordinates chr20: 62564912 - 62565013
Synonyms MIRN133A2, MIR133A2
Description Homo sapiens miR-133a-2 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-133a-3p
Sequence 53| UUUGGUCCCCUUCAACCAGCUG |74
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30104664 8 COSMIC
COSN30455205 8 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs369575411 9 dbSNP
rs746815210 11 dbSNP
rs1382873526 13 dbSNP
rs553267926 15 dbSNP
rs1172821195 16 dbSNP
rs182673735 19 dbSNP
rs781929120 20 dbSNP
rs1296628341 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B2TV7U miR-133a Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Plasma .
B2TV7U miR-133a Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Muscle Reverse transcription-polymerase chain reaction
B2TV7U miR-133a Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Plasma Real-time reverse transcription PCR
B2TV7U miR-133a Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Serum Real-time polymerase chain reaction
Gene Information
Gene Symbol KCNQ1   
Synonyms ATFB1, ATFB3, JLNS1, KCNA8, KCNA9, KVLQT1, Kv1.9, Kv7.1, LQT, LQT1, RWS, SQT2, WRS
Description potassium voltage-gated channel subfamily Q member 1
Transcript NM_000218   
Other Transcripts NM_181798   
Expression
Putative miRNA Targets on KCNQ1
3'UTR of KCNQ1
(miRNA target sites are highlighted)		 
>KCNQ1|NM_000218|3'UTR
   1 GGAGGGGATGGGGCTGGGGGATGGGCCTGAGTGAGAGGGGAGGCCAAGAGTGGCCCCACCTGGCCCTCTCTGAAGGAGGC
  81 CACCTCCTAAAAGGCCCAGAGAGAAGAGCCCCACTCTCAGAGGCCCCAATACCCCATGGACCATGCTGTCTGGCACAGCC
 161 TGCACTTGGGGGCTCAGCAAGGCCACCTCTTCCTGGCCGGTGTGGGGGCCCCGTCTCAGGTCTGAGTTGTTACCCCAAGC
 241 GCCCTGGCCCCCACATGGTGATGTTGACATCACTGGCATGGTGGTTGGGACCCAGTGGCAGGGCACAGGGCCTGGCCCAT
 321 GTATGGCCAGGAAGTAGCACAGGCTGAGTGCAGGCCCACCCTGCTTGGCCCAGGGGGCTTCCTGAGGGGAGACAGAGCAA
 401 CCCCTGGACCCCAGCCTCAAATCCAGGACCCTGCCAGGCACAGGCAGGGCAGGACCAGCCCACGCTGACTACAGGGCCGC
 481 CGGCAATAAAAGCCCAGGAGCCCATTTGGAGGGCCTGGGCCTGGCTCCCTCACTCTCAGGAAATGCTGACCCATGGGCAG
 561 GAGACTGTGGAGACTGCTCCTGAGCCCCCAGCTTCCAGCAGGAGGGACAGTCTCACCATTTCCCCAGGGCACGTGGTTGA
 641 GTGGGGGGAACGCCCACTTCCCTGGGTTAGACTGCCAGCTCTTCCTAGCTGGAGAGGAGCCCTGCCTCTCCGCCCCTGAG
 721 CCCACTGTGCGTGGGGCTCCCGCCTCCAACCCCTCGCCCAGTCCCAGCAGCCAGCCAAACACACAGAAGGGGACTGCCAC
 801 CTCCCCTTGCCAGCTGCTGAGCCGCAGAGAAGTGACGGTTCCTACACAGGACAGGGGTTCCTTCTGGGCATTACATCGCA
 881 TAGAAATCAATAATTTGTGGTGATTTGGATCTGTGTTTTAATGAGTTTCACAGTGTGATTTTGATTATTAATTGTGCAAG
 961 CTTTTCCTAATAAACGTGGAGAATCACAGGCTGGGCTGGGCACTGCTCTCACCTTGGTTCCTGGGGCATCCATGGGGTCT
1041 CTCACAGACAGGACCCCTGCAGTTCCCCTGGAAGCAGTGCCCAGGTGGCTGTGGAATAGGAACGCTAAAAAAAAAAAAAA
1121 AAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gucGACCAACU-UCCCCU--GGUUu 5'
             |||  ||| ||||||  |||| 
Target 5' ggcCTGAGTGAGAGGGGAGGCCAAg 3'
 24 - 48 131.00 -21.50
2 
miRNA  3' gucGACCAACUUCCCCUGGUUu 5'
             | ||  |::  ||||||: 
Target 5' gcaCAGGCAGGGCAGGACCAGc 3'
 438 - 459 131.00 -13.10
3 
miRNA  3' guCG-ACCAACUUCCCCUGGUUu 5'
            || ||| ||:  |||||| | 
Target 5' tgGCATGG-TGGTTGGGACCCAg 3'
 274 - 295 127.00 -19.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
1171329 3 ClinVar
1193163 4 ClinVar
918270 5 ClinVar
919839 7 ClinVar
304232 27 ClinVar
304233 48 ClinVar
879081 67 ClinVar
880305 82 ClinVar
880306 126 ClinVar
304234 161 ClinVar
304235 172 ClinVar
304236 220 ClinVar
878544 241 ClinVar
304237 242 ClinVar
304238 265 ClinVar
304239 267 ClinVar
879136 291 ClinVar
304240 293 ClinVar
880340 296 ClinVar
304241 306 ClinVar
304242 351 ClinVar
304243 373 ClinVar
304244 392 ClinVar
304245 393 ClinVar
304246 399 ClinVar
304247 412 ClinVar
304248 465 ClinVar
304249 480 ClinVar
304250 483 ClinVar
304251 540 ClinVar
304252 555 ClinVar
304253 582 ClinVar
877624 633 ClinVar
304254 634 ClinVar
304255 653 ClinVar
304256 713 ClinVar
304257 718 ClinVar
880424 731 ClinVar
304258 732 ClinVar
304259 743 ClinVar
304260 807 ClinVar
304261 838 ClinVar
304262 876 ClinVar
304263 878 ClinVar
304264 886 ClinVar
304265 889 ClinVar
304266 898 ClinVar
304267 905 ClinVar
304268 933 ClinVar
304269 976 ClinVar
304270 1026 ClinVar
304271 1056 ClinVar
304272 1089 ClinVar
COSN30464440 7 COSMIC
COSN10084363 371 COSMIC
COSN15676195 607 COSMIC
COSN21131599 1078 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1164909238 2 dbSNP
rs977184677 3 dbSNP
rs1447346891 4 dbSNP
rs756899141 4 dbSNP
rs1157661362 5 dbSNP
rs1368226333 6 dbSNP
rs1349244002 7 dbSNP
rs922698302 8 dbSNP
rs780861422 14 dbSNP
rs1429017976 15 dbSNP
rs932699787 15 dbSNP
rs745362039 16 dbSNP
rs1356220578 17 dbSNP
rs1158334274 19 dbSNP
rs1445475972 20 dbSNP
rs376507265 23 dbSNP
rs772900793 24 dbSNP
rs1380136719 26 dbSNP
rs886048166 27 dbSNP
rs1295490906 32 dbSNP
rs1341470142 34 dbSNP
rs780217220 36 dbSNP
rs1275666342 37 dbSNP
rs1441226594 39 dbSNP
rs1209814769 40 dbSNP
rs753980784 43 dbSNP
rs1461477002 44 dbSNP
rs769209557 44 dbSNP
rs1185117576 45 dbSNP
rs1387942228 46 dbSNP
rs754931159 48 dbSNP
rs1168698237 51 dbSNP
rs778785848 54 dbSNP
rs1421520168 57 dbSNP
rs1036974472 58 dbSNP
rs534954431 60 dbSNP
rs1333248196 61 dbSNP
rs1003222334 62 dbSNP
rs1359597562 64 dbSNP
rs1454381536 65 dbSNP
rs1318724330 66 dbSNP
rs994976684 67 dbSNP
rs1435857509 71 dbSNP
rs1453214051 77 dbSNP
rs1272042851 79 dbSNP
rs771815387 82 dbSNP
rs1219214397 84 dbSNP
rs1279774135 94 dbSNP
rs1012040936 95 dbSNP
rs1207235256 96 dbSNP
rs774883155 101 dbSNP
rs546897048 104 dbSNP
rs1346305711 106 dbSNP
rs746594325 107 dbSNP
rs1243405735 112 dbSNP
rs770580299 115 dbSNP
rs1171864260 119 dbSNP
rs1429926996 130 dbSNP
rs1238139057 131 dbSNP
rs1470807439 132 dbSNP
rs1156727046 136 dbSNP
rs1242587537 137 dbSNP
rs568335780 140 dbSNP
rs1458008844 147 dbSNP
rs1320350488 154 dbSNP
rs1329482183 157 dbSNP
rs886048167 161 dbSNP
rs1435846825 163 dbSNP
rs745424600 165 dbSNP
rs1268904069 168 dbSNP
rs535458696 170 dbSNP
rs886048168 172 dbSNP
rs1226898536 173 dbSNP
rs530238663 183 dbSNP
rs774779414 195 dbSNP
rs549903300 199 dbSNP
rs762397028 200 dbSNP
rs1449317436 201 dbSNP
rs1324206379 202 dbSNP
rs978609005 205 dbSNP
rs1197580257 209 dbSNP
rs1277590057 211 dbSNP
rs925803833 213 dbSNP
rs1269469051 214 dbSNP
rs45477500 220 dbSNP
rs422976 223 dbSNP
rs1179726585 234 dbSNP
rs1411030571 237 dbSNP
rs1357716386 240 dbSNP
rs773743391 241 dbSNP
rs142023323 242 dbSNP
rs909951778 243 dbSNP
rs1388860786 244 dbSNP
rs558109815 247 dbSNP
rs1169310670 248 dbSNP
rs1404788863 251 dbSNP
rs911538668 253 dbSNP
rs766755883 255 dbSNP
rs1425313213 263 dbSNP
rs1186816461 264 dbSNP
rs45579540 265 dbSNP
rs113029000 267 dbSNP
rs1288112560 269 dbSNP
rs897572417 285 dbSNP
rs1241642971 290 dbSNP
rs765204255 291 dbSNP
rs1216860647 292 dbSNP
rs886048169 293 dbSNP
rs752515823 294 dbSNP
rs1208698179 295 dbSNP
rs1296388392 296 dbSNP
rs1291936810 298 dbSNP
rs939224456 300 dbSNP
rs1049209010 301 dbSNP
rs1398089641 304 dbSNP
rs1203016172 305 dbSNP
rs45570140 306 dbSNP
rs1419388138 307 dbSNP
rs1183750306 311 dbSNP
rs867662993 312 dbSNP
rs1002429002 315 dbSNP
rs1366896921 317 dbSNP
rs1472614251 321 dbSNP
rs894844737 322 dbSNP
rs1374159416 328 dbSNP
rs1355709187 331 dbSNP
rs1164267882 335 dbSNP
rs1225608901 338 dbSNP
rs1035697142 344 dbSNP
rs960657182 347 dbSNP
rs1427912007 349 dbSNP
rs1483794489 350 dbSNP
rs114877430 351 dbSNP
rs1397864614 357 dbSNP
rs746858364 358 dbSNP
rs1332658985 361 dbSNP
rs756874937 370 dbSNP
rs780891889 372 dbSNP
rs1265506594 373 dbSNP
rs762386874 373 dbSNP
rs772427083 373 dbSNP
rs1315129204 374 dbSNP
rs1360886456 375 dbSNP
rs1225555869 377 dbSNP
rs376876993 378 dbSNP
rs1480936068 383 dbSNP
rs968122131 390 dbSNP
rs774059974 392 dbSNP
rs868129989 393 dbSNP
rs953352978 394 dbSNP
rs886048170 399 dbSNP
rs1017032365 401 dbSNP
rs985403091 401 dbSNP
rs963083609 402 dbSNP
rs1447680907 406 dbSNP
rs1168072539 411 dbSNP
rs45460605 412 dbSNP
rs1165155951 413 dbSNP
rs1464025648 416 dbSNP
rs1384565902 417 dbSNP
rs1379390676 419 dbSNP
rs1176565097 421 dbSNP
rs1441422937 425 dbSNP
rs1251203261 428 dbSNP
rs1402022739 431 dbSNP
rs1223421616 432 dbSNP
rs1453839999 432 dbSNP
rs1336910855 434 dbSNP
rs1384568470 435 dbSNP
rs1190274165 436 dbSNP
rs775070916 442 dbSNP
rs1294279888 443 dbSNP
rs1307981140 444 dbSNP
rs944660985 449 dbSNP
rs1229595695 450 dbSNP
rs1336839279 456 dbSNP
rs1254181380 460 dbSNP
rs748563398 462 dbSNP
rs533308153 463 dbSNP
rs1204085942 464 dbSNP
rs141960532 465 dbSNP
rs1463747954 470 dbSNP
rs1187984974 471 dbSNP
rs1262592669 474 dbSNP
rs1386386078 477 dbSNP
rs564155427 479 dbSNP
rs2519184 480 dbSNP
rs754424379 482 dbSNP
rs45510192 483 dbSNP
rs938180265 487 dbSNP
rs1407805703 494 dbSNP
rs777048548 495 dbSNP
rs1331485407 501 dbSNP
rs568373701 503 dbSNP
rs759814198 506 dbSNP
rs1383429461 510 dbSNP
rs1299046034 511 dbSNP
rs1344840118 515 dbSNP
rs1223864983 516 dbSNP
rs765160471 520 dbSNP
rs1327327095 525 dbSNP
rs1208420435 530 dbSNP
rs1261530725 532 dbSNP
rs1486854696 536 dbSNP
rs886048171 540 dbSNP
rs1189564574 544 dbSNP
rs1267220325 547 dbSNP
rs1219222009 554 dbSNP
rs886048172 555 dbSNP
rs1202012215 556 dbSNP
rs1410284676 558 dbSNP
rs752849482 559 dbSNP
rs529154789 562 dbSNP
rs373266174 564 dbSNP
rs1454857611 566 dbSNP
rs1314488068 568 dbSNP
rs1291329387 580 dbSNP
rs765566577 582 dbSNP
rs764061286 587 dbSNP
rs1223634154 590 dbSNP
rs750656168 598 dbSNP
rs1348326236 600 dbSNP
rs879399215 605 dbSNP
rs1307913161 612 dbSNP
rs1318984076 624 dbSNP
rs751354814 625 dbSNP
rs1291190960 631 dbSNP
rs568824453 633 dbSNP
rs886048173 634 dbSNP
rs539193205 637 dbSNP
rs1177204953 638 dbSNP
rs1308739934 643 dbSNP
rs1482905726 643 dbSNP
rs1028828683 644 dbSNP
rs1408227207 646 dbSNP
rs1420556514 648 dbSNP
rs780272542 649 dbSNP
rs1384142648 652 dbSNP
rs886048174 653 dbSNP
rs1304814315 656 dbSNP
rs986363892 659 dbSNP
rs1199124632 664 dbSNP
rs1463019641 667 dbSNP
rs747029163 672 dbSNP
rs1298573543 673 dbSNP
rs1375770823 680 dbSNP
rs1226876980 682 dbSNP
rs1201147787 686 dbSNP
rs1018774191 689 dbSNP
rs1275764735 692 dbSNP
rs1006853251 693 dbSNP
rs371578548 696 dbSNP
rs1248291497 698 dbSNP
rs1273060597 700 dbSNP
rs962738295 701 dbSNP
rs973260634 706 dbSNP
rs755082727 712 dbSNP
rs745447199 713 dbSNP
rs1481410004 715 dbSNP
rs189162344 718 dbSNP
rs1373959043 719 dbSNP
rs1242163309 721 dbSNP
rs1444658487 722 dbSNP
rs1421627149 724 dbSNP
rs1398129449 726 dbSNP
rs930321240 731 dbSNP
rs146324627 732 dbSNP
rs1409350276 734 dbSNP
rs979372434 735 dbSNP
rs748877199 742 dbSNP
rs114844136 743 dbSNP
rs1445547161 748 dbSNP
rs555497849 751 dbSNP
rs1383841214 754 dbSNP
rs1056641840 756 dbSNP
rs573995364 757 dbSNP
rs1339291078 758 dbSNP
rs747362141 760 dbSNP
rs1275730777 765 dbSNP
rs935000910 768 dbSNP
rs1203453024 769 dbSNP
rs376794105 771 dbSNP
rs1264543277 772 dbSNP
rs1461520198 779 dbSNP
rs544883023 784 dbSNP
rs1184877138 785 dbSNP
rs1242326002 793 dbSNP
rs1384809970 799 dbSNP
rs1239918935 801 dbSNP
rs1475040100 802 dbSNP
rs1186967364 804 dbSNP
rs1315484981 805 dbSNP
rs539398869 807 dbSNP
rs1412503336 817 dbSNP
rs1175492374 818 dbSNP
rs1364751390 821 dbSNP
rs1407087384 822 dbSNP
rs903817572 824 dbSNP
rs577950799 825 dbSNP
rs1325864190 826 dbSNP
rs1410648374 827 dbSNP
rs1431593592 830 dbSNP
rs1272387132 833 dbSNP
rs371292977 837 dbSNP
rs139633955 838 dbSNP
rs527747262 842 dbSNP
rs772946233 845 dbSNP
rs1323785482 846 dbSNP
rs748954997 847 dbSNP
rs1224241650 852 dbSNP
rs1281701902 856 dbSNP
rs181022556 858 dbSNP
rs1178438660 863 dbSNP
rs1211682317 864 dbSNP
rs1215910726 868 dbSNP
rs1243746330 869 dbSNP
rs1479444015 870 dbSNP
rs1018718202 875 dbSNP
rs8234 876 dbSNP
rs1446191321 877 dbSNP
rs763163556 878 dbSNP
rs142546141 879 dbSNP
rs1219724056 882 dbSNP
rs394656 884 dbSNP
rs1384559309 885 dbSNP
rs1401321078 886 dbSNP
rs886048175 886 dbSNP
rs546360517 889 dbSNP
rs886048176 889 dbSNP
rs1348621884 897 dbSNP
rs371580920 897 dbSNP
rs561861522 898 dbSNP
rs1026189552 899 dbSNP
rs1347699169 900 dbSNP
rs186055804 905 dbSNP
rs1277358870 908 dbSNP
rs1383143392 914 dbSNP
rs1349555922 915 dbSNP
rs1223832716 922 dbSNP
rs984855368 923 dbSNP
rs751442870 930 dbSNP
rs80148517 932 dbSNP
rs10798 933 dbSNP
rs1406945515 936 dbSNP
rs1347328728 937 dbSNP
rs1269540549 938 dbSNP
rs1158389994 954 dbSNP
rs1490766349 958 dbSNP
rs568787689 971 dbSNP
rs74048340 976 dbSNP
rs191331870 977 dbSNP
rs1363403452 980 dbSNP
rs1477991608 981 dbSNP
rs994161262 982 dbSNP
rs1160356048 983 dbSNP
rs1383538296 990 dbSNP
rs1269213282 993 dbSNP
rs779794829 994 dbSNP
rs1026164720 996 dbSNP
rs960749277 998 dbSNP
rs1304220094 1000 dbSNP
rs753280723 1001 dbSNP
rs1408344420 1002 dbSNP
rs1328661082 1005 dbSNP
rs1334793706 1007 dbSNP
rs1224211361 1008 dbSNP
rs1442574414 1009 dbSNP
rs754590297 1014 dbSNP
rs1205376840 1017 dbSNP
rs1356573092 1018 dbSNP
rs778576517 1019 dbSNP
rs945531020 1020 dbSNP
rs1042629125 1023 dbSNP
rs181226788 1026 dbSNP
rs1249622963 1028 dbSNP
rs1297883212 1028 dbSNP
rs34368109 1030 dbSNP
rs533592455 1035 dbSNP
rs1050174772 1036 dbSNP
rs1241545211 1038 dbSNP
rs1347252699 1040 dbSNP
rs1444030905 1044 dbSNP
rs1164330115 1045 dbSNP
rs1387606595 1046 dbSNP
rs1460969850 1050 dbSNP
rs1167696844 1053 dbSNP
rs771593461 1054 dbSNP
rs1393517809 1055 dbSNP
rs375155898 1056 dbSNP
rs1041128182 1059 dbSNP
rs777252957 1060 dbSNP
rs762263484 1067 dbSNP
rs979788388 1068 dbSNP
rs1173605168 1077 dbSNP
rs1451245877 1080 dbSNP
rs886048177 1089 dbSNP
rs925205254 1090 dbSNP
rs993297008 1092 dbSNP
rs956591515 1094 dbSNP
rs1315195015 1100 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... 3' untranslated regions (3' UTRs) of the genes and experimentally established KCNQ1 and KCNE1 as targets for repression by muscle specifeid microRNAs miR-133 and miR-1 ...

- Luo X; Xiao J; Lin H; Li B; Lu Y; Yang B; Wang Z, 2007, Journal of cellular physiology.

Article - Luo X; Xiao J; Lin H; Li B; Lu Y; Yang B; Wang Z
- Journal of cellular physiology, 2007
In cardiac cells, KCNQ1 assembles with KCNE1 and forms a channel complex constituting the slow delayed rectifier current I(Ks). Expression of KCNQ1 and KCNE1 are regionally heterogeneous and changes with pathological states of the heart. The aims of this study were to decipher the molecular mechanisms for transcriptional and post-transcriptional regulation expression of KCNQ1 and KCNE1 genes and to shed light on the molecular mechanisms for their spatial heterogeneity of distribution. We cloned the 5'-flanking region and identified the transcription start sites of the KCNQ1 gene. We characterized the core promoters of KCNQ1 and KCNE1 and revealed the stimulating protein (Sp1) as a common transactivator of KCNQ1 and KCNE1 by interacting with the Sp1 cis-acting elements in the core promoter regions of these genes. We also characterized the 3' untranslated regions (3'UTRs) of the genes and experimentally established KCNQ1 and KCNE1 as targets for repression by the muscle-specific microRNAs miR-133 and miR-1, respectively. We demonstrated spatial heterogeneity of KCNQ1 and KCNE1 distributions at three axes (interventricular, transmural and apical-basal) and disparity between mRNA and protein expressions of these genes. We also found characteristic regional differences of expressions of Sp1 and miR-1/miR-133 in the heart. Our study unraveled a novel aspect of the cellular function of miRNAs and suggests that the I(Ks)-encoding genes KCNQ1 and KCNE1 expressions are dynamically balanced by transcription factor regulation and miRNA repression. The heterogeneities of Sp1 and miR-1/miR-133 offer an explanation for the well-recognized regional differences and disparity between mRNA and protein expressions of KCNQ1 and KCNE1.
LinkOut: [PMID: 17443681]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC 0.384 0 0.450 0 49 Click to see details
STAD -0.415 0.01 -0.494 0 32 Click to see details
COAD -0.743 0.02 -0.714 0.02 8 Click to see details
KICH -0.413 0.02 -0.277 0.1 24 Click to see details
BRCA -0.209 0.03 -0.090 0.22 77 Click to see details
UCEC 0.423 0.04 0.411 0.04 19 Click to see details
CHOL -0.47 0.1 -0.300 0.22 9 Click to see details
THCA 0.16 0.11 0.160 0.11 59 Click to see details
KIRC 0.143 0.12 0.159 0.1 67 Click to see details
PAAD -0.75 0.13 -0.800 0.1 4 Click to see details
PCPG -0.886 0.15 -0.500 0.33 3 Click to see details
KIRP -0.118 0.27 -0.037 0.42 30 Click to see details
LUSC 0.092 0.29 0.125 0.23 38 Click to see details
CESC 0.57 0.31 0.500 0.33 3 Click to see details
ESCA 0.154 0.33 0.064 0.43 11 Click to see details
HNSC -0.06 0.35 -0.168 0.14 42 Click to see details
PRAD -0.046 0.38 -0.251 0.04 50 Click to see details
LUAD 0.068 0.42 0.063 0.42 12 Click to see details
BLCA 0.041 0.44 0.119 0.32 18 Click to see details
BLCA 0.041 0.44 0.119 0.32 18 Click to see details
BLCA 0.041 0.44 0.119 0.32 18 Click to see details
122 hsa-miR-133a-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000325 RHOA ras homolog family member A 1 2
MIRT000327 CDC42 cell division cycle 42 4 2
MIRT000328 ERG ERG, ETS transcription factor 1 1
MIRT000329 HCN4 hyperpolarization activated cyclic nucleotide gated potassium channel 4 2 1
MIRT000330 UCP2 uncoupling protein 2 2 2
MIRT000331 KRT7 keratin 7 2 2
MIRT001203 CACNA1C calcium voltage-gated channel subunit alpha1 C 3 1
MIRT001204 HCN2 hyperpolarization activated cyclic nucleotide gated potassium and sodium channel 2 4 2
MIRT001816 PKM pyruvate kinase, muscle 1 1
MIRT001986 CASP9 caspase 9 3 3
MIRT002925 KCNQ1 potassium voltage-gated channel subfamily Q member 1 4 1
MIRT003542 FSCN1 fascin actin-bundling protein 1 5 4
MIRT004831 KCNH2 potassium voltage-gated channel subfamily H member 2 4 1
MIRT005604 TAGLN2 transgelin 2 5 4
MIRT005813 LASP1 LIM and SH3 protein 1 3 2
MIRT006571 PNP purine nucleoside phosphorylase 4 2
MIRT006680 MSN moesin 2 1
MIRT007032 EGFR epidermal growth factor receptor 3 5
MIRT007088 VKORC1 vitamin K epoxide reductase complex subunit 1 1 1
MIRT007383 PRDM16 PR/SET domain 16 1 2
MIRT021693 TPM1 tropomyosin 1 1 1
MIRT021695 FBN1 fibrillin 1 1 1
MIRT021696 FAM120C family with sequence similarity 120C 1 1
MIRT021697 BCAN brevican 1 1
MIRT021698 TCTEX1D2 Tctex1 domain containing 2 1 1
MIRT021699 ARL6IP1 ADP ribosylation factor like GTPase 6 interacting protein 1 1 1
MIRT021700 RFT1 RFT1 homolog 1 1
MIRT021701 SENP1 SUMO1/sentrin specific peptidase 1 1 1
MIRT021702 SMIM14 small integral membrane protein 14 1 1
MIRT021703 PRELID1 PRELI domain containing 1 1 1
MIRT021704 CNN2 calponin 2 3 3
MIRT021705 ARPC5 actin related protein 2/3 complex subunit 5 4 2
MIRT021706 FTL ferritin light chain 2 2
MIRT021707 CERS2 ceramide synthase 2 1 1
MIRT021708 SEC61B Sec61 translocon beta subunit 1 1
MIRT021709 PLEKHA3 pleckstrin homology domain containing A3 1 1
MIRT021710 EGFL7 EGF like domain multiple 7 1 1
MIRT021711 VEGFA vascular endothelial growth factor A 1 1
MIRT021712 PIK3R2 phosphoinositide-3-kinase regulatory subunit 2 1 1
MIRT021713 RGS3 regulator of G protein signaling 3 1 1
MIRT021714 COL1A1 collagen type I alpha 1 chain 4 1
MIRT021715 GSTP1 glutathione S-transferase pi 1 2 1
MIRT035537 SP1 Sp1 transcription factor 2 2
MIRT035579 KLF15 Kruppel like factor 15 1 1
MIRT045837 NR4A2 nuclear receptor subfamily 4 group A member 2 1 1
MIRT052647 BCL2L1 BCL2 like 1 4 2
MIRT052648 MCL1 MCL1, BCL2 family apoptosis regulator 4 2
MIRT053333 RFFL ring finger and FYVE like domain containing E3 ubiquitin protein ligase 4 1
MIRT054310 IGF1R insulin like growth factor 1 receptor 3 2
MIRT055599 FAM160B1 family with sequence similarity 160 member B1 2 2
MIRT081957 UBA2 ubiquitin like modifier activating enzyme 2 4 1
MIRT437400 MMP14 matrix metallopeptidase 14 3 1
MIRT437953 ANXA2 annexin A2 4 1
MIRT437954 SNX30 sorting nexin family member 30 4 1
MIRT437955 SGMS2 sphingomyelin synthase 2 4 1
MIRT438719 PDLIM5 PDZ and LIM domain 5 3 1
MIRT452802 PACS2 phosphofurin acidic cluster sorting protein 2 2 2
MIRT462823 BCL3 B-cell CLL/lymphoma 3 2 2
MIRT468494 SESN2 sestrin 2 2 2
MIRT477714 EFHD2 EF-hand domain family member D2 2 2
MIRT483852 EMID1 EMI domain containing 1 2 2
MIRT490039 PRRT2 proline rich transmembrane protein 2 2 2
MIRT491349 CDKN1A cyclin dependent kinase inhibitor 1A 2 4
MIRT504443 MC2R melanocortin 2 receptor 2 2
MIRT505701 SESN3 sestrin 3 2 2
MIRT513521 RHOQ ras homolog family member Q 2 4
MIRT517423 HIST2H2AC histone cluster 2 H2A family member c 2 2
MIRT526599 DCAKD dephospho-CoA kinase domain containing 2 2
MIRT528904 THBS2 thrombospondin 2 2 2
MIRT533060 ZBTB37 zinc finger and BTB domain containing 37 2 2
MIRT534126 SNX33 sorting nexin 33 2 2
MIRT534700 RNF103-CHMP3 RNF103-CHMP3 readthrough 2 4
MIRT535732 MYPN myopalladin 2 2
MIRT538529 CHMP3 charged multivesicular body protein 3 2 4
MIRT550878 IBA57 IBA57 homolog, iron-sulfur cluster assembly 2 2
MIRT551260 PSMG1 proteasome assembly chaperone 1 2 2
MIRT551981 UGT2B10 UDP glucuronosyltransferase family 2 member B10 2 2
MIRT553866 SYAP1 synapse associated protein 1 2 2
MIRT558810 CDK5R1 cyclin dependent kinase 5 regulatory subunit 1 2 2
MIRT559367 ATP13A3 ATPase 13A3 2 2
MIRT560941 ZFP28 ZFP28 zinc finger protein 2 2
MIRT565461 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 2 2
MIRT566234 PTMA prothymosin, alpha 2 2
MIRT568217 C11orf24 chromosome 11 open reading frame 24 2 2
MIRT608912 NCDN neurochondrin 2 6
MIRT613229 CCDC39 coiled-coil domain containing 39 2 2
MIRT623563 ITPKB inositol-trisphosphate 3-kinase B 2 2
MIRT637224 TMEM59 transmembrane protein 59 2 2
MIRT641669 CCNI cyclin I 2 2
MIRT644440 ALDOC aldolase, fructose-bisphosphate C 2 2
MIRT644755 TXNRD3NB thioredoxin reductase 3 neighbor 2 2
MIRT646711 PDE1A phosphodiesterase 1A 2 2
MIRT647577 RBMXL1 RNA binding motif protein, X-linked like 1 2 2
MIRT647760 RNF168 ring finger protein 168 2 2
MIRT649267 C17orf64 chromosome 17 open reading frame 64 2 2
MIRT651238 ZMAT4 zinc finger matrin-type 4 2 2
MIRT652146 TRIM71 tripartite motif containing 71 2 2
MIRT657168 IP6K1 inositol hexakisphosphate kinase 1 2 2
MIRT668302 FOSL2 FOS like 2, AP-1 transcription factor subunit 2 2
MIRT687546 MLEC malectin 2 2
MIRT690857 PLEKHG2 pleckstrin homology and RhoGEF domain containing G2 2 2
MIRT697060 PSMC4 proteasome 26S subunit, ATPase 4 2 2
MIRT699725 SERPINH1 serpin family H member 1 2 2
MIRT700858 PER2 period circadian clock 2 2 2
MIRT705068 C4orf29 abhydrolase domain containing 18 2 2
MIRT709496 ANGPT4 angiopoietin 4 2 2
MIRT713925 PIGR polymeric immunoglobulin receptor 2 2
MIRT716058 SFTPB surfactant protein B 2 2
MIRT716724 APOL6 apolipoprotein L6 2 2
MIRT721677 CMTM4 CKLF like MARVEL transmembrane domain containing 4 2 2
MIRT723379 NFAM1 NFAT activating protein with ITAM motif 1 2 2
MIRT731340 IGF1 insulin like growth factor 1 1 1
MIRT731591 ZEB1 zinc finger E-box binding homeobox 1 1 1
MIRT732526 PTBP1 polypyrimidine tract binding protein 1 2 0
MIRT732527 KDM5C lysine demethylase 5C 2 0
MIRT732589 BCL2 BCL2, apoptosis regulator 2 0
MIRT732590 CASP3 caspase 3 2 0
MIRT733594 PPP2CA protein phosphatase 2 catalytic subunit alpha 3 0
MIRT735355 MB myoglobin 1 0
MIRT735744 CDCA8 cell division cycle associated 8 3 0
MIRT736984 SET SET nuclear proto-oncogene 1 0
MIRT737550 TGFB1 transforming growth factor beta 1 4 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-133a Catechin approved 9064 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-133a Proanthocyanin NULL 108065 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-133a Sulfonyl-hydrazone-1 (SHZ) NULL NULL Quantitative real-time PCR Murine broblast-derived Induced pluripotent stem cells 21445862 2011 up-regulated
miR-133a Atorvastatin approved 60823 Quantitative real-time PCR Cardiomyocyte 23860036 2013 down-regualted
miR-133a Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 down-regulated
miR-133a Glucose NULL 5793 Microarray endothelial cells 24394957 2014 up-regulated
miR-133a Benzene NULL 241 MiRNA PCR array white blood cell 24780745 2014 down-regulated
miR-133a Benzene NULL 241 MiRNA PCR array blood mononuclear cells 24780745 2014 down-regulated
miR-133a Ibandronate approved 60852 Quantitative real-time PCR Periodontal ligament stem cells (PDLSCs) 21108928 2011 down-regulated
miR-133a 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-133a Temozolomide approved 5394 Quantitative real-time PCR glioblastoma cells. 22722712 2012 up-regulated
miR-133a Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 down-regulated
miR-133a Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 up-regulated
miR-133a Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 down-regulated
miR-133a 5-Fluorouracil approved 3385 Quantitative real-time PCR colon cancer cells 17702597 2007 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-133a-3p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-133a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-133a-3p Doxorubicin 31703 NSC123127 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-133a-3p Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (H358, H1993)
hsa-miR-133a-3p Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (H1155, H358, H1993)
hsa-miR-133a-3p Sunitinib 5329102 NSC750690 approved resistant High Metastatic Renal Cell Carcinoma tissue and cell line (Caki-2)
hsa-miR-133a-3p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-miR-133a-3p Paclitaxel 36314 NSC125973 approved resistant Low Esophageal Squamous Cell Carcinoma tissue
hsa-miR-133a-3p Doxorubicin 31703 NSC123127 approved sensitive Low Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-133a-3p Doxorubicin 31703 NSC123127 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-133a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-133a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-133a-3p Fluorouracil 3385 NSC19893 approved sensitive Low Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-133a-3p Fluorouracil 3385 NSC19893 approved sensitive Low Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-133a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Head And Neck Squamous Cell Carcinoma cell line (Hep-2, NP69)
hsa-miR-133a-3p Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer tissue
hsa-miR-133a-3p Doxorubicin 31703 NSC123127 approved sensitive High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-133a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Urothelial Bladder Cancer cell line (T24)
hsa-miR-133a-3p Gemcitabine 60750 NSC613327 approved sensitive Low Urothelial Bladder Cancer cell line (T24)
hsa-miR-133a-3p Paclitaxel 36314 NSC125973 approved resistant Low Prostate Cancer cell line (PC-3-R)
hsa-miR-133a-3p Fluorouracil 3385 NSC19893 approved sensitive Low Nasopharyngeal Cancer cell line (HONE1, SUNE1)
hsa-miR-133a-3p Fluorouracil 3385 NSC19893 approved resistant High Gastric Cancer cell line (MGC-803)
hsa-miR-133a-3p Bromocriptine 31101 NSC169774 approved resistant Low Prolactinoma tissue
hsa-miR-133a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-133a-3p Gefitinib 123631 NSC715055 approved sensitive Low Non-Small Cell Lung Cancer cell line (PC-9)
hsa-miR-133a-3p Doxorubicin 31703 NSC123127 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-miR-133a-3p Paclitaxel 36314 NSC125973 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-miR-133a-3p Etoposide 36462 NSC141540 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-miR-133a-3p Vinorelbine 44424639 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-miR-133a-3p Vincristine 5978 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-miR-133a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer cell line (SKOV3, A2780)
hsa-miR-133a-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-133a-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-133a-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-133a-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-133a-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-133a-3p Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-miR-133a-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-133a-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-133a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-133a-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-133a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-133a-3p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine sensitive cell line (Bats-72)

Error report submission