miRTarBase - #MIRT002940


—
pre-miRNA Information
pre-miRNA hsa-mir-196a-1   
Genomic Coordinates chr17: 48632490 - 48632559
Synonyms MIRN196-1, MIRN196A1, MIR196A1
Description Homo sapiens miR-196a-1 stem-loop
Comment Lagos-Quintana et al. .
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-196a-2   
Genomic Coordinates chr12: 53991738 - 53991847
Synonyms MIRN196-2, MIRN196A2, MIR196A2
Description Homo sapiens miR-196a-2 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-196a-5p
Sequence 25| UAGGUAGUUUCAUGUUGUUGGG |46
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 6 17 - 48632548 29233923 MiREDiBase
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30188818 11 COSMIC
COSN30130427 18 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1449318187 1 dbSNP
rs1167097656 4 dbSNP
rs767877229 4 dbSNP
rs750731061 10 dbSNP
rs756640169 12 dbSNP
rs931027203 13 dbSNP
rs185070757 13 dbSNP
rs569910454 16 dbSNP
rs190478598 17 dbSNP
rs755062780 17 dbSNP
rs751887895 18 dbSNP
rs1422312414 20 dbSNP
rs372978481 21 dbSNP
rs1289240119 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol HOXA7   
Synonyms ANTP, HOX1, HOX1.1, HOX1A
Description homeobox A7
Transcript NM_006896   
Expression
Putative miRNA Targets on HOXA7
3'UTR of HOXA7
(miRNA target sites are highlighted)		 
>HOXA7|NM_006896|3'UTR
   1 GGGGCCGATCCGGGGCCCTCTCTGCACCGGACAGTCGGAAAAGCGTCTTTAAGAGACTCACTGGTTTTACTTACAAAAAT
  81 GGGAAAAATAAAAGAAAATGTAAAAAACAAAAACAAAAACAAAAAAGCAACCCAGTCCCCAACCTGCACTCTACCCACCC
 161 CCATCACCTACTCCAGCTCCCAACTTTTGTGGACTGAGCGGCCGCAGAGACTGGGTCGCCTTGGATTCCCTCTGCCTCCG
 241 AGGACCCCAAAAGACACCCCCAACCCCAGGCCAGCCGGCCCTGCTCTGGCGCGTCCAAAATACTACCTAGCACAGGCCTC
 321 TGCTCGAGGCACCCCCAAACTACCTATGTATCCAGCCCCAGAGGGCCTCCATTCCCAGGAAGTCCCTATGTATCCCAACA
 401 CTGGCAGACACCCAGCACCACCCTCCCAGACCCGCAAGAAAGTGAATCTCACTACTACCTACTCCCCTAAAACTACCTAT
 481 TTTGTGCTGGCTGGCTTGCCTGCTACCTAGTGCCGACTGCTCCCAGGCAAGTCCCCTGCTGCTTACAGCCCGCAGCTTTT
 561 GGGGTCCCTGAGGCTGCCCTGAGAATGTGCTGAGGTCCAGGATCAGGGTATTGGCATCTATTTAAATCGAAAAATAATAT
 641 ATTTATTCCAAAAAGCATCCTAAGTGCTTGCACCCTAGAATCAATCCCTCCTTCTCTGGCTTGGCACCCACAGCTCAGGC
 721 CCATCAACCCCCACTTCTGGAGGGGAATGTTCCTGAGCTGGCTGCAGATCTGTGGGTTAGCTTCTGCTTAGCAGGACTGT
 801 GGAGATGCTTCCAGCTTCGCTGTCCTTTCCTCTGGCTCCTGTATCTTACTGTTCAGCTGTGTTAAATATGTACGCCCTGA
 881 TGTTTCCTATAATAGCAGATACTGTATATTTGAACAAGATTTTTTTTTATCATTTCTATAGTCTTGGAGTTCATTTGTAA
 961 GGCAGTGTCTTGACTTGGAAAGGATGTGTTAATGGGGTGACTTTGTAGCATGGTATGTTGTCTTGAGTTAACTGTAGTGG
1041 GTGGGGAGGTCCAATGCCCTCCGCAATGCCCTTCATCTCCTGTGTTGTCCTGTACCCTGCTCAGCTCCATCCTGGGGTTC
1121 AGGGAAGGCACACTTCCCAGCCCAGCTGTGTTTTATGTAACCGAAAATAAAGATGCGTGGTGACAAAGAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ggGUUGUUGUACUU-------UGAUGGAu 5'
            ||| || :||||       ||||||| 
Target 5' cgCAAGAAAGTGAATCTCACTACTACCTa 3'
 433 - 461 160.00 -14.31
2 
miRNA  3' gggUUGUUGUACUUUGAUGGAu 5'
             ::|| |   ||||||||| 
Target 5' cgaGGCACCCCCAAACTACCTa 3'
 325 - 346 155.00 -14.00
3 
miRNA  3' ggguuGUUGUACUUUGAUGGAu 5'
               ||| ||   ||||||| 
Target 5' gcgtcCAAAAT---ACTACCTa 3'
 291 - 309 150.00 -12.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30186559 2 COSMIC
COSN30530527 3 COSMIC
COSN30502830 5 COSMIC
COSN30150359 7 COSMIC
COSN30452182 11 COSMIC
COSN31507857 11 COSMIC
COSN30604265 20 COSMIC
COSN30105753 29 COSMIC
COSN31594271 29 COSMIC
COSN31592620 37 COSMIC
COSN31517329 63 COSMIC
COSN28824413 80 COSMIC
COSN31573871 85 COSMIC
COSN14282651 94 COSMIC
COSN5099661 99 COSMIC
COSN30537854 100 COSMIC
COSN31526191 105 COSMIC
COSN17076473 181 COSMIC
COSN22453653 232 COSMIC
COSN16129149 290 COSMIC
COSN26566790 303 COSMIC
COSN5655106 304 COSMIC
COSN31565704 325 COSMIC
COSN31545090 438 COSMIC
COSN31549090 449 COSMIC
COSN31577472 490 COSMIC
COSN31535072 583 COSMIC
COSN31561410 615 COSMIC
COSN22147651 682 COSMIC
COSN31569480 919 COSMIC
COSN8516350 1089 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs534858142 4 dbSNP
rs781557426 5 dbSNP
rs755368638 6 dbSNP
rs924558521 7 dbSNP
rs750085818 11 dbSNP
rs1265813218 12 dbSNP
rs1419419088 12 dbSNP
rs1365361149 13 dbSNP
rs757580952 14 dbSNP
rs977300205 15 dbSNP
rs767178708 18 dbSNP
rs773956048 20 dbSNP
rs764129277 22 dbSNP
rs1301290587 26 dbSNP
rs1334667498 27 dbSNP
rs762922018 28 dbSNP
rs775554939 29 dbSNP
rs1287702487 30 dbSNP
rs1235443329 31 dbSNP
rs1354020695 32 dbSNP
rs755689856 35 dbSNP
rs989979316 38 dbSNP
rs769777690 43 dbSNP
rs780308242 44 dbSNP
rs745643552 51 dbSNP
rs1177864304 55 dbSNP
rs1489719485 71 dbSNP
rs1468861243 73 dbSNP
rs185124386 82 dbSNP
rs760109009 87 dbSNP
rs1250517653 88 dbSNP
rs1028514581 94 dbSNP
rs1180647783 96 dbSNP
rs543002504 99 dbSNP
rs965525016 112 dbSNP
rs1450063802 119 dbSNP
rs1163752472 121 dbSNP
rs1347917090 123 dbSNP
rs73071599 125 dbSNP
rs1294039481 126 dbSNP
rs549455922 126 dbSNP
rs753874592 126 dbSNP
rs977301187 126 dbSNP
rs550235866 127 dbSNP
rs192273659 135 dbSNP
rs1310854177 137 dbSNP
rs1015889146 140 dbSNP
rs746086038 142 dbSNP
rs1251080644 143 dbSNP
rs968929329 158 dbSNP
rs561505249 168 dbSNP
rs1251218565 169 dbSNP
rs1456858946 184 dbSNP
rs866018066 190 dbSNP
rs1356022586 194 dbSNP
rs1307196847 199 dbSNP
rs888115085 202 dbSNP
rs894223758 203 dbSNP
rs1425321957 211 dbSNP
rs17472084 214 dbSNP
rs1002480428 217 dbSNP
rs1013097038 222 dbSNP
rs887383603 225 dbSNP
rs1332724119 228 dbSNP
rs527948425 229 dbSNP
rs1348934422 230 dbSNP
rs1318628448 234 dbSNP
rs144408283 235 dbSNP
rs1056794252 236 dbSNP
rs1157557264 239 dbSNP
rs1047737371 248 dbSNP
rs1454619883 253 dbSNP
rs545744158 257 dbSNP
rs199953368 258 dbSNP
rs1295356429 260 dbSNP
rs931511707 271 dbSNP
rs938550877 273 dbSNP
rs1477614987 276 dbSNP
rs779074997 277 dbSNP
rs1208181336 281 dbSNP
rs376410549 285 dbSNP
rs576756642 290 dbSNP
rs1483718873 291 dbSNP
rs1216698173 292 dbSNP
rs947290705 293 dbSNP
rs1172723125 298 dbSNP
rs1424316084 305 dbSNP
rs1283922506 309 dbSNP
rs757394202 310 dbSNP
rs1173388481 313 dbSNP
rs1216015066 318 dbSNP
rs1448336748 322 dbSNP
rs1349192965 324 dbSNP
rs915241115 325 dbSNP
rs1304137558 329 dbSNP
rs1051121214 330 dbSNP
rs563151618 332 dbSNP
rs543475604 335 dbSNP
rs989473077 342 dbSNP
rs1280853355 347 dbSNP
rs1228412396 355 dbSNP
rs1312932772 362 dbSNP
rs932626717 365 dbSNP
rs921379590 369 dbSNP
rs1215336342 370 dbSNP
rs1217818135 374 dbSNP
rs1261382491 374 dbSNP
rs1367270457 381 dbSNP
rs1271138703 382 dbSNP
rs968581981 384 dbSNP
rs914426824 387 dbSNP
rs976826713 388 dbSNP
rs1188902855 390 dbSNP
rs186915437 402 dbSNP
rs965577053 404 dbSNP
rs1337989724 413 dbSNP
rs1358299101 416 dbSNP
rs1421883545 422 dbSNP
rs1299234726 423 dbSNP
rs17500932 432 dbSNP
rs139545701 433 dbSNP
rs1002511391 434 dbSNP
rs1239585796 438 dbSNP
rs1377197167 439 dbSNP
rs951022279 444 dbSNP
rs182650118 454 dbSNP
rs1027629691 462 dbSNP
rs1284725308 465 dbSNP
rs756052907 469 dbSNP
rs1219290616 476 dbSNP
rs1478063032 486 dbSNP
rs894136928 491 dbSNP
rs571953685 494 dbSNP
rs1441198404 497 dbSNP
rs1159566117 499 dbSNP
rs1390471328 503 dbSNP
rs1035405913 507 dbSNP
rs1002575394 509 dbSNP
rs1188084882 510 dbSNP
rs1326092052 513 dbSNP
rs1007047553 514 dbSNP
rs1307210768 515 dbSNP
rs903058643 516 dbSNP
rs1041539006 517 dbSNP
rs947315521 518 dbSNP
rs116178882 533 dbSNP
rs1051154160 551 dbSNP
rs538592804 552 dbSNP
rs117115548 565 dbSNP
rs1291913338 584 dbSNP
rs1468892462 586 dbSNP
rs1197414111 598 dbSNP
rs752485900 601 dbSNP
rs189579948 605 dbSNP
rs1178859583 608 dbSNP
rs1043728865 611 dbSNP
rs1472000132 614 dbSNP
rs75542492 620 dbSNP
rs1312152143 628 dbSNP
rs187665400 629 dbSNP
rs183865524 635 dbSNP
rs1402557974 640 dbSNP
rs565207584 642 dbSNP
rs1333741635 645 dbSNP
rs991305884 655 dbSNP
rs1338977047 656 dbSNP
rs1242300707 659 dbSNP
rs56698762 660 dbSNP
rs1315654316 664 dbSNP
rs982990804 665 dbSNP
rs958508979 666 dbSNP
rs1217940478 677 dbSNP
rs1256152766 681 dbSNP
rs527865012 688 dbSNP
rs191997658 690 dbSNP
rs539244656 691 dbSNP
rs41305930 692 dbSNP
rs1255005813 699 dbSNP
rs1300573194 704 dbSNP
rs1440363513 712 dbSNP
rs552068260 719 dbSNP
rs951161448 720 dbSNP
rs1355063820 736 dbSNP
rs958405494 737 dbSNP
rs531933347 745 dbSNP
rs1258676430 755 dbSNP
rs1035310536 762 dbSNP
rs1426488017 764 dbSNP
rs563246280 768 dbSNP
rs1340813941 791 dbSNP
rs118016485 796 dbSNP
rs1020429771 798 dbSNP
rs1011420691 799 dbSNP
rs556629939 811 dbSNP
rs529731632 814 dbSNP
rs1475659973 815 dbSNP
rs891267719 816 dbSNP
rs1051186332 818 dbSNP
rs1050365389 819 dbSNP
rs996089984 824 dbSNP
rs560644548 829 dbSNP
rs899866326 831 dbSNP
rs1342361431 834 dbSNP
rs540758394 835 dbSNP
rs1041051144 843 dbSNP
rs1427730225 844 dbSNP
rs1280689160 845 dbSNP
rs946719766 847 dbSNP
rs1234004643 849 dbSNP
rs1200913287 855 dbSNP
rs1265937371 857 dbSNP
rs1429663248 868 dbSNP
rs151012022 873 dbSNP
rs1467707000 874 dbSNP
rs1174484167 875 dbSNP
rs1360184820 877 dbSNP
rs187649677 882 dbSNP
rs757398915 886 dbSNP
rs1233450921 887 dbSNP
rs1047558466 893 dbSNP
rs1342239605 895 dbSNP
rs931503542 898 dbSNP
rs1299907572 899 dbSNP
rs552711590 900 dbSNP
rs1234859293 902 dbSNP
rs1303665406 906 dbSNP
rs1214855482 915 dbSNP
rs920087113 920 dbSNP
rs929744209 920 dbSNP
rs1486447180 922 dbSNP
rs1057512 925 dbSNP
rs974166802 927 dbSNP
rs17500925 928 dbSNP
rs1018546431 929 dbSNP
rs550176855 929 dbSNP
rs958934190 929 dbSNP
rs955604338 930 dbSNP
rs1454183495 935 dbSNP
rs1373928346 936 dbSNP
rs751726644 937 dbSNP
rs1292860093 938 dbSNP
rs1333351130 939 dbSNP
rs1387980985 942 dbSNP
rs1029869054 948 dbSNP
rs1375634138 953 dbSNP
rs181591017 953 dbSNP
rs1311835903 962 dbSNP
rs1399188504 965 dbSNP
rs981090569 970 dbSNP
rs556482394 974 dbSNP
rs41304930 977 dbSNP
rs1244575961 1001 dbSNP
rs999684286 1004 dbSNP
rs1489771947 1008 dbSNP
rs966986612 1020 dbSNP
rs1370465609 1030 dbSNP
rs764389620 1030 dbSNP
rs1456557812 1032 dbSNP
rs772760261 1033 dbSNP
rs1162728898 1035 dbSNP
rs1011701878 1036 dbSNP
rs1180737126 1037 dbSNP
rs1409065433 1046 dbSNP
rs957264309 1048 dbSNP
rs17500918 1050 dbSNP
rs1423390582 1055 dbSNP
rs902618746 1057 dbSNP
rs1022355504 1062 dbSNP
rs373259624 1063 dbSNP
rs1444010186 1069 dbSNP
rs777765835 1070 dbSNP
rs536241937 1074 dbSNP
rs1180292050 1084 dbSNP
rs764616299 1099 dbSNP
rs895112554 1106 dbSNP
rs1214731607 1108 dbSNP
rs1234440815 1111 dbSNP
rs190750155 1115 dbSNP
rs937294170 1125 dbSNP
rs1200660536 1135 dbSNP
rs775860691 1142 dbSNP
rs1040288225 1148 dbSNP
rs554291478 1162 dbSNP
rs1008241500 1163 dbSNP
rs534304376 1176 dbSNP
rs1047185036 1177 dbSNP
rs1171941314 1179 dbSNP
rs1354702060 1186 dbSNP
rs918346625 1192 dbSNP
rs973816400 1194 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HeLa
Location of target site 3'UTR
Original Description (Extracted from the article) ... "miR-196 delimits or dampens the expression of HOXB8 and probably also HOXC8 ...

- Yekta S; Shih IH; Bartel DP, 2004, Science (New York, N.Y.).

Article - Yekta S; Shih IH; Bartel DP
- Science (New York, N.Y.), 2004
MicroRNAs (miRNAs) are endogenous approximately 22-nucleotide RNAs, some of which are known to play important regulatory roles in animals by targeting the messages of protein-coding genes for translational repression. We find that miR-196, a miRNA encoded at three paralogous locations in the A, B, and C mammalian HOX clusters, has extensive, evolutionarily conserved complementarity to messages of HOXB8, HOXC8, and HOXD8. RNA fragments diagnostic of miR-196-directed cleavage of HOXB8 were detected in mouse embryos. Cell culture experiments demonstrated down-regulation of HOXB8, HOXC8, HOXD8, and HOXA7 and supported the cleavage mechanism for miR-196-directed repression of HOXB8. These results point to a miRNA-mediated mechanism for the posttranscriptional restriction of HOX gene expression during vertebrate development and demonstrate that metazoan miRNAs can repress expression of their natural targets through mRNA cleavage in addition to inhibiting productive translation.
LinkOut: [PMID: 15105502]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions SW480
Disease MIMAT0000226;
Tools used in this research Literature survey
Original Description (Extracted from the article) ... "significant differences in target restriction were observed. While low miR-196a concentrations (20 nmol/L) sufficiently restricted HoxB8 mRNA ...

- Schimanski CC; Frerichs K; Rahman F; Berger et al., 2009, World journal of gastroenterology.

Article - Schimanski CC; Frerichs K; Rahman F; Berger et al.
- World journal of gastroenterology, 2009
AIM: To analyze the relevance of the microRNA miR-196a for colorectal oncogenesis. METHODS: The impact of miR-196a on the restriction targets HoxA7, HoxB8, HoxC8 and HoxD8 was analyzed by reverse transcription polymerase chain reaction (RT-PCR) after transient transfection of SW480 cancer cells. The miR-196a transcription profile in colorectal cancer samples, mucosa samples and diverse cancer cell lines was quantified by RT-PCR. Transiently miR-196a-transfected colorectal cancer cells were used for diverse functional assays in vitro and for a xenograft lung metastasis model in vivo. RESULTS: HoxA7, HoxB8, HoxC8 and HoxD8 were restricted by miR-196a in a dose-dependent and gene-specific manner. High levels of miR-196a activated the AKT signaling pathway as indicated by increased phosphorylation of AKT. In addition, high levels of miR-196a promoted cancer cell detachment, migration, invasion and chemosensitivity towards platin derivatives but did not impact on proliferation or apoptosis. Furthermore, miR-196a increased the development of lung metastases in mice after tail vein injection. CONCLUSION: miR-196a exerts a pro-oncogenic influence in colorectal cancer.
LinkOut: [PMID: 19418581]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE38226 Liver fibrosis -0.569 3.6e-3 -0.379 4.5e-2 21 Click to see details
GSE17306 Multiple myeloma 0.362 5.3e-3 0.355 6.2e-3 49 Click to see details
GSE32688 Pancreatic cancer 0.444 5.5e-3 0.421 8.2e-3 32 Click to see details
GSE28544 Breast cancer 0.478 9.1e-3 0.390 3.0e-2 24 Click to see details
GSE14794 Lymphoblastoid cells -0.205 2.6e-2 0.031 3.9e-1 90 Click to see details
GSE21032 Prostate cancer -0.205 3.2e-2 -0.129 1.2e-1 83 Click to see details
GSE19350 CNS germ cell tumors 0.436 7.8e-2 0.385 1.1e-1 12 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.292 7.8e-2 -0.230 1.3e-1 25 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.479 9.6e-2 0.400 1.4e-1 9 Click to see details
GSE27834 Pluripotent stem cells 0.222 2.0e-1 0.341 9.8e-2 16 Click to see details
GSE28260 Renal cortex and medulla -0.238 2.2e-1 -0.181 2.8e-1 13 Click to see details
GSE26953 Aortic valvular endothelial cells -0.166 2.2e-1 -0.178 2.0e-1 24 Click to see details
GSE17498 Multiple myeloma -0.115 2.4e-1 -0.143 1.9e-1 40 Click to see details
GSE19783 ER+ ER+ breast cancer -0.138 2.8e-1 -0.123 3.0e-1 20 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.107 3.3e-1 0.359 6.0e-2 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.091 3.3e-1 0.115 2.9e-1 25 Click to see details
GSE19536 Breast cancer -0.039 3.5e-1 0.064 2.6e-1 100 Click to see details
GSE19783 ER- ER- breast cancer 0.028 4.0e-1 0.172 6.5e-2 79 Click to see details
GSE21849 B cell lymphoma -0.016 4.7e-1 0.200 1.5e-1 29 Click to see details
GSE21687 Ependynoma primary tumors 0.008 4.7e-1 0.098 2.2e-1 64 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
CHOL 0.861 0 0.548 0.08 8 Click to see details
PRAD 0.36 0.01 0.295 0.02 50 Click to see details
THCA 0.332 0.01 0.301 0.02 47 Click to see details
HNSC 0.281 0.04 0.276 0.04 42 Click to see details
STAD -0.3 0.05 -0.327 0.04 31 Click to see details
LIHC -0.259 0.06 -0.364 0.01 37 Click to see details
ESCA 0.468 0.07 0.382 0.12 11 Click to see details
KIRC 0.166 0.09 0.029 0.41 68 Click to see details
BRCA -0.146 0.09 -0.096 0.19 84 Click to see details
BLCA 0.306 0.11 0.189 0.23 18 Click to see details
KIRP 0.207 0.13 0.106 0.28 32 Click to see details
LUSC 0.187 0.13 0.196 0.12 38 Click to see details
COAD 0.348 0.2 0.500 0.1 8 Click to see details
UCEC -0.162 0.25 -0.126 0.3 19 Click to see details
CESC 0.616 0.29 1.000 0.5 3 Click to see details
LUAD 0.167 0.31 0.027 0.47 11 Click to see details
KICH 0.081 0.35 0.116 0.29 25 Click to see details
PAAD 0.266 0.37 0.000 0.5 4 Click to see details
PCPG 0.226 0.43 -0.500 0.33 3 Click to see details
PCPG 0.226 0.43 -0.500 0.33 3 Click to see details
PCPG 0.226 0.43 -0.500 0.33 3 Click to see details
301 hsa-miR-196a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000218 BMP4 bone morphogenetic protein 4 1 1
MIRT000219 SPRR2C small proline rich protein 2C (pseudogene) 3 2
MIRT000220 S100A9 S100 calcium binding protein A9 3 2
MIRT000221 KRT5 keratin 5 3 2
MIRT000709 ANXA1 annexin A1 4 2
MIRT002266 HOXB8 homeobox B8 5 7
MIRT002940 HOXA7 homeobox A7 4 5
MIRT002941 HOXD8 homeobox D8 3 3
MIRT002942 HOXC8 homeobox C8 6 15
MIRT004244 HOXB7 homeobox B7 4 1
MIRT004718 BACH1 BTB domain and CNC homolog 1 6 3
MIRT004719 HMOX1 heme oxygenase 1 4 1
MIRT005065 CDKN1B cyclin dependent kinase inhibitor 1B 6 7
MIRT006802 HMGA1 high mobility group AT-hook 1 5 5
MIRT006803 HMGA2 high mobility group AT-hook 2 5 7
MIRT006906 HOXA5 homeobox A5 5 3
MIRT026026 IKBKB inhibitor of nuclear factor kappa B kinase subunit beta 1 1
MIRT026027 PDCD4 programmed cell death 4 1 1
MIRT026028 SRRT serrate, RNA effector molecule 2 9
MIRT026029 DIEXF digestive organ expansion factor homolog (zebrafish) 1 1
MIRT026030 ZBTB24 zinc finger and BTB domain containing 24 1 1
MIRT026031 NR4A1 nuclear receptor subfamily 4 group A member 1 1 1
MIRT026032 ABT1 activator of basal transcription 1 1 1
MIRT026033 SPATA2 spermatogenesis associated 2 1 1
MIRT026034 NHLRC3 NHL repeat containing 3 1 1
MIRT026035 RPUSD2 RNA pseudouridylate synthase domain containing 2 1 1
MIRT026036 CEP120 centrosomal protein 120 1 1
MIRT026037 PHC3 polyhomeotic homolog 3 1 1
MIRT026038 ZBTB6 zinc finger and BTB domain containing 6 1 1
MIRT026039 C9orf41 carnosine N-methyltransferase 1 1 1
MIRT026040 PNP purine nucleoside phosphorylase 1 1
MIRT026041 COPS3 COP9 signalosome subunit 3 1 1
MIRT026042 NUP50 nucleoporin 50 1 1
MIRT026043 ZNF763 zinc finger protein 763 1 1
MIRT026044 FOXJ3 forkhead box J3 1 1
MIRT026045 BIN3 bridging integrator 3 1 1
MIRT026046 C12orf4 chromosome 12 open reading frame 4 1 1
MIRT026047 RAD9A RAD9 checkpoint clamp component A 1 1
MIRT026048 PCGF3 polycomb group ring finger 3 1 1
MIRT026049 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT026050 SLC10A7 solute carrier family 10 member 7 1 1
MIRT026051 LBR lamin B receptor 1 1
MIRT026052 BCL11A B-cell CLL/lymphoma 11A 1 1
MIRT026053 GLMN glomulin, FKBP associated protein 1 1
MIRT026054 STK40 serine/threonine kinase 40 1 1
MIRT026055 TMEM135 transmembrane protein 135 1 1
MIRT026056 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 2 3
MIRT026057 POLR2D RNA polymerase II subunit D 2 5
MIRT026058 LGR4 leucine rich repeat containing G protein-coupled receptor 4 1 1
MIRT026059 IGF2BP3 insulin like growth factor 2 mRNA binding protein 3 2 4
MIRT026060 ESPL1 extra spindle pole bodies like 1, separase 1 1
MIRT026061 RFX5 regulatory factor X5 1 1
MIRT026062 SYT9 synaptotagmin 9 1 1
MIRT026063 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT026064 IGF1R insulin like growth factor 1 receptor 1 1
MIRT026065 SMCR7L mitochondrial elongation factor 1 1 4
MIRT026066 SLC30A6 solute carrier family 30 member 6 2 3
MIRT026067 RAB31 RAB31, member RAS oncogene family 1 1
MIRT026068 KPNA5 karyopherin subunit alpha 5 1 1
MIRT026069 SLC20A1 solute carrier family 20 member 1 1 1
MIRT026070 TIMM23 translocase of inner mitochondrial membrane 23 1 1
MIRT026071 IGDCC4 immunoglobulin superfamily DCC subclass member 4 2 6
MIRT026072 SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 1 1
MIRT026073 CCNT2 cyclin T2 1 1
MIRT026074 CCND2 cyclin D2 1 1
MIRT026075 USP24 ubiquitin specific peptidase 24 1 1
MIRT026076 TRPC3 transient receptor potential cation channel subfamily C member 3 2 4
MIRT026077 SMC3 structural maintenance of chromosomes 3 1 1
MIRT026078 TMEM2 transmembrane protein 2 1 1
MIRT026079 RDH10 retinol dehydrogenase 10 1 1
MIRT026080 C11orf57 chromosome 11 open reading frame 57 2 5
MIRT026081 FAM127A retrotransposon Gag like 8C 2 4
MIRT026082 PRUNE2 prune homolog 2 2 3
MIRT026083 SPRYD4 SPRY domain containing 4 1 1
MIRT026084 TMEM161B transmembrane protein 161B 1 1
MIRT026085 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 1
MIRT026086 FAM104A family with sequence similarity 104 member A 2 2
MIRT026087 RAB7L1 RAB29, member RAS oncogene family 1 1
MIRT026088 ITGAV integrin subunit alpha V 1 1
MIRT026089 CPD carboxypeptidase D 1 1
MIRT026090 ZNF354B zinc finger protein 354B 1 1
MIRT026091 TMEM194A nuclear envelope integral membrane protein 1 1 1
MIRT026092 EPHA7 EPH receptor A7 1 1
MIRT026093 KIAA1804 mitogen-activated protein kinase kinase kinase 21 1 1
MIRT026094 DFFA DNA fragmentation factor subunit alpha 2 2
MIRT026095 TSPAN12 tetraspanin 12 1 1
MIRT026096 LIN28B lin-28 homolog B 1 1
MIRT026097 ARHGAP28 Rho GTPase activating protein 28 1 1
MIRT026098 IGF2BP1 insulin like growth factor 2 mRNA binding protein 1 1 1
MIRT026099 CCDC47 coiled-coil domain containing 47 1 1
MIRT026100 HAND1 heart and neural crest derivatives expressed 1 4 2
MIRT026101 LLGL1 LLGL1, scribble cell polarity complex component 1 1
MIRT048150 PGAM1 phosphoglycerate mutase 1 1 1
MIRT048151 PSMC3 proteasome 26S subunit, ATPase 3 1 1
MIRT048152 TMX2 thioredoxin related transmembrane protein 2 1 1
MIRT048153 KLHL7 kelch like family member 7 1 1
MIRT048154 RFC2 replication factor C subunit 2 1 1
MIRT048155 GLUL glutamate-ammonia ligase 1 1
MIRT048156 NRXN1 neurexin 1 1 1
MIRT048157 GSTK1 glutathione S-transferase kappa 1 1 1
MIRT048158 HIST2H4B histone cluster 2 H4 family member b 1 1
MIRT048159 SPEN spen family transcriptional repressor 1 1
MIRT048160 TAF15 TATA-box binding protein associated factor 15 1 1
MIRT048161 SAP18 Sin3A associated protein 18 1 1
MIRT048162 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 1 1
MIRT048163 MSL3 MSL complex subunit 3 1 1
MIRT048164 TSKU tsukushi, small leucine rich proteoglycan 1 1
MIRT048165 KMT2C lysine methyltransferase 2C 1 1
MIRT048166 LYRM2 LYR motif containing 2 1 1
MIRT048167 UBE2Z ubiquitin conjugating enzyme E2 Z 1 1
MIRT048168 C19orf55 proline and serine rich 3 1 1
MIRT048169 LRP2 LDL receptor related protein 2 1 1
MIRT048170 ND4L NADH dehydrogenase, subunit 4L (complex I) 1 1
MIRT048171 NKX6-1 NK6 homeobox 1 1 1
MIRT048172 BRMS1L breast cancer metastasis-suppressor 1 like 1 1
MIRT048173 RPS2 ribosomal protein S2 1 1
MIRT048174 RBMX RNA binding motif protein, X-linked 1 1
MIRT048175 ZFP64 ZFP64 zinc finger protein 1 1
MIRT048176 REEP2 receptor accessory protein 2 1 1
MIRT048177 MED13 mediator complex subunit 13 1 1
MIRT048178 MYCBP2 MYC binding protein 2, E3 ubiquitin protein ligase 1 1
MIRT048179 TRAPPC9 trafficking protein particle complex 9 1 1
MIRT048180 DNTTIP2 deoxynucleotidyltransferase terminal interacting protein 2 1 1
MIRT048181 VDAC3 voltage dependent anion channel 3 1 1
MIRT048182 ZNF529 zinc finger protein 529 1 1
MIRT048183 EWSR1 EWS RNA binding protein 1 1 1
MIRT048184 ATP6V1B2 ATPase H+ transporting V1 subunit B2 1 1
MIRT048185 RDH11 retinol dehydrogenase 11 (all-trans/9-cis/11-cis) 1 1
MIRT048186 APP amyloid beta precursor protein 1 1
MIRT048187 PROSER1 proline and serine rich 1 1 1
MIRT048188 HIST1H2BB histone cluster 1 H2B family member b 1 1
MIRT048189 TAB2 TGF-beta activated kinase 1/MAP3K7 binding protein 2 1 1
MIRT048190 TUBA1B tubulin alpha 1b 1 1
MIRT048191 USP19 ubiquitin specific peptidase 19 1 1
MIRT048192 COX3 cytochrome c oxidase III 1 1
MIRT048193 PSMD8 proteasome 26S subunit, non-ATPase 8 1 1
MIRT048194 TRA2B transformer 2 beta homolog 1 1
MIRT048195 MRPL35 mitochondrial ribosomal protein L35 1 1
MIRT048196 KCTD1 potassium channel tetramerization domain containing 1 1 1
MIRT048197 UBE2C ubiquitin conjugating enzyme E2 C 1 1
MIRT048198 ZNF581 zinc finger protein 581 1 1
MIRT048199 CNOT11 CCR4-NOT transcription complex subunit 11 1 1
MIRT048200 POTEG POTE ankyrin domain family member G 1 1
MIRT048201 MTRF1L mitochondrial translational release factor 1 like 1 1
MIRT048202 SRP9 signal recognition particle 9 2 5
MIRT048203 BCORL1 BCL6 corepressor like 1 1 1
MIRT048204 NRBP1 nuclear receptor binding protein 1 1 1
MIRT048205 LRRC41 leucine rich repeat containing 41 1 1
MIRT048206 ATP6 ATP synthase F0 subunit 6 1 1
MIRT048207 FKTN fukutin 1 1
MIRT048208 RANBP9 RAN binding protein 9 1 1
MIRT048209 SYVN1 synoviolin 1 1 1
MIRT048210 NR2F6 nuclear receptor subfamily 2 group F member 6 1 1
MIRT048211 ATG16L1 autophagy related 16 like 1 1 1
MIRT048212 EIF2S3 eukaryotic translation initiation factor 2 subunit gamma 1 1
MIRT048213 ECHDC1 ethylmalonyl-CoA decarboxylase 1 1 1
MIRT048214 HAUS6 HAUS augmin like complex subunit 6 1 1
MIRT048215 CKAP2L cytoskeleton associated protein 2 like 1 1
MIRT048216 IFNGR1 interferon gamma receptor 1 1 1
MIRT048217 ANXA7 annexin A7 1 1
MIRT048218 ENAH ENAH, actin regulator 1 1
MIRT048219 FOXO1 forkhead box O1 9 3
MIRT048220 NDFIP1 Nedd4 family interacting protein 1 1 1
MIRT048221 LSM14A LSM14A, mRNA processing body assembly factor 1 1
MIRT048222 ATP1A1 ATPase Na+/K+ transporting subunit alpha 1 1 1
MIRT048223 SLC25A17 solute carrier family 25 member 17 1 1
MIRT048224 ZNF398 zinc finger protein 398 1 1
MIRT048225 RASSF7 Ras association domain family member 7 1 1
MIRT048226 SBF1 SET binding factor 1 1 1
MIRT048227 TP53RK TP53 regulating kinase 1 1
MIRT048228 MED12 mediator complex subunit 12 1 1
MIRT048229 FLNA filamin A 1 1
MIRT048230 CCNE2 cyclin E2 1 1
MIRT048231 CANX calnexin 1 1
MIRT048232 PRPF8 pre-mRNA processing factor 8 1 1
MIRT048233 FRS2 fibroblast growth factor receptor substrate 2 1 1
MIRT048234 KIF18B kinesin family member 18B 1 1
MIRT048235 U2AF2 U2 small nuclear RNA auxiliary factor 2 1 1
MIRT048236 SH3GL3 SH3 domain containing GRB2 like 3, endophilin A3 1 1
MIRT048237 VCP valosin containing protein 1 1
MIRT048238 ETV3 ETS variant 3 1 1
MIRT048239 BCS1L BCS1 homolog, ubiquinol-cytochrome c reductase complex chaperone 1 1
MIRT048240 ND5 NADH dehydrogenase, subunit 5 (complex I) 1 1
MIRT048241 ZCCHC11 zinc finger CCHC-type containing 11 1 1
MIRT048242 RALGPS2 Ral GEF with PH domain and SH3 binding motif 2 1 1
MIRT048243 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 1 1
MIRT048244 ACTB actin beta 1 1
MIRT048245 UQCRC2 ubiquinol-cytochrome c reductase core protein II 1 1
MIRT048246 EIF2B4 eukaryotic translation initiation factor 2B subunit delta 1 1
MIRT048247 GMFB glia maturation factor beta 1 1
MIRT048248 PALLD palladin, cytoskeletal associated protein 1 1
MIRT048249 CASP3 caspase 3 1 1
MIRT048250 VCL vinculin 1 1
MIRT048251 IPO5 importin 5 1 1
MIRT048252 PATL1 PAT1 homolog 1, processing body mRNA decay factor 1 1
MIRT048253 NAP1L4 nucleosome assembly protein 1 like 4 1 1
MIRT048254 RUFY2 RUN and FYVE domain containing 2 2 1
MIRT048255 TUBB tubulin beta class I 1 1
MIRT048256 CCND1 cyclin D1 1 1
MIRT048257 GID8 GID complex subunit 8 homolog 1 1
MIRT048258 VDAC2 voltage dependent anion channel 2 1 1
MIRT048259 SLC6A8 solute carrier family 6 member 8 1 1
MIRT048260 FXR2 FMR1 autosomal homolog 2 1 1
MIRT048261 SCN11A sodium voltage-gated channel alpha subunit 11 1 1
MIRT048262 AHSA1 activator of HSP90 ATPase activity 1 1 1
MIRT048263 ATG9A autophagy related 9A 1 1
MIRT048264 NOTCH2 notch 2 1 1
MIRT048265 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 1 1
MIRT048266 ND4 NADH dehydrogenase, subunit 4 (complex I) 2 1
MIRT048267 OAT ornithine aminotransferase 1 1
MIRT048268 TRAP1 TNF receptor associated protein 1 1 1
MIRT048269 SKI SKI proto-oncogene 1 1
MIRT048270 GLTP glycolipid transfer protein 1 1
MIRT048271 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT048272 LSM3 LSM3 homolog, U6 small nuclear RNA and mRNA degradation associated 1 1
MIRT048273 GRIK4 glutamate ionotropic receptor kainate type subunit 4 1 1
MIRT048274 PDE6D phosphodiesterase 6D 1 1
MIRT048275 MPP2 membrane palmitoylated protein 2 1 1
MIRT048276 SAR1B secretion associated Ras related GTPase 1B 2 3
MIRT048277 MAP4 microtubule associated protein 4 1 1
MIRT048278 RAB21 RAB21, member RAS oncogene family 1 1
MIRT048279 BUB1 BUB1 mitotic checkpoint serine/threonine kinase 1 1
MIRT048280 OGFRL1 opioid growth factor receptor like 1 1 1
MIRT048281 GOT2 glutamic-oxaloacetic transaminase 2 1 1
MIRT048282 NRDE2 NRDE-2, necessary for RNA interference, domain containing 1 1
MIRT048283 SBNO1 strawberry notch homolog 1 1 1
MIRT053067 NTN4 netrin 4 2 1
MIRT054025 RDX radixin 5 5
MIRT056750 ARID5B AT-rich interaction domain 5B 2 2
MIRT057645 LCOR ligand dependent nuclear receptor corepressor 2 4
MIRT076226 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 2 6
MIRT083303 ZCCHC3 zinc finger CCHC-type containing 3 2 2
MIRT095769 GRPEL2 GrpE like 2, mitochondrial 2 10
MIRT187720 SUOX sulfite oxidase 2 2
MIRT191923 CALM1 calmodulin 1 2 2
MIRT205504 SP100 SP100 nuclear antigen 2 2
MIRT209857 ACVR2B activin A receptor type 2B 2 2
MIRT229841 YIPF6 Yip1 domain family member 6 2 2
MIRT230833 TBRG1 transforming growth factor beta regulator 1 2 2
MIRT235376 CALM3 calmodulin 3 2 2
MIRT251626 KCNJ2 potassium voltage-gated channel subfamily J member 2 2 2
MIRT252333 SALL3 spalt like transcription factor 3 2 2
MIRT255317 CDV3 CDV3 homolog 2 2
MIRT324734 ACER2 alkaline ceramidase 2 4 3
MIRT386075 ZNF609 zinc finger protein 609 2 2
MIRT402060 ATP6V1F ATPase H+ transporting V1 subunit F 2 4
MIRT437422 NFKBIA NFKB inhibitor alpha 4 2
MIRT437980 TYMS thymidylate synthetase 1 1
MIRT437981 NRP2 neuropilin 2 1 1
MIRT437982 LSP1 lymphocyte-specific protein 1 1 1
MIRT439104 MYC MYC proto-oncogene, bHLH transcription factor 0 1
MIRT447143 KIF27 kinesin family member 27 2 2
MIRT447559 C14orf37 chromosome 14 open reading frame 37 2 2
MIRT449961 FMNL3 formin like 3 2 2
MIRT465087 TSPAN3 tetraspanin 3 2 2
MIRT470426 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 2
MIRT472726 MTUS1 microtubule associated scaffold protein 1 2 6
MIRT473801 MAP3K2 mitogen-activated protein kinase kinase kinase 2 2 2
MIRT474507 KLHDC8B kelch domain containing 8B 2 2
MIRT474917 KCTD21 potassium channel tetramerization domain containing 21 2 2
MIRT486549 DCTN4 dynactin subunit 4 2 2
MIRT492430 RGL2 ral guanine nucleotide dissociation stimulator like 2 2 2
MIRT493925 FAM127B retrotransposon Gag like 8A 2 4
MIRT500972 SPTSSA serine palmitoyltransferase small subunit A 2 2
MIRT501431 RAB11FIP4 RAB11 family interacting protein 4 2 2
MIRT502410 GATA6 GATA binding protein 6 2 8
MIRT506368 NUP155 nucleoporin 155 2 6
MIRT507497 E2F7 E2F transcription factor 7 2 6
MIRT520041 YOD1 YOD1 deubiquitinase 2 6
MIRT522366 NAP1L1 nucleosome assembly protein 1 like 1 2 4
MIRT531281 SLC7A7 solute carrier family 7 member 7 2 2
MIRT543674 FAM135A family with sequence similarity 135 member A 2 2
MIRT545199 HIST1H2BD histone cluster 1 H2B family member d 2 2
MIRT546336 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT546452 SLC9A7 solute carrier family 9 member A7 2 2
MIRT546787 RCC2 regulator of chromosome condensation 2 2 4
MIRT547253 NXPE3 neurexophilin and PC-esterase domain family member 3 2 2
MIRT547454 MBD4 methyl-CpG binding domain 4, DNA glycosylase 2 2
MIRT547581 LRIG3 leucine rich repeats and immunoglobulin like domains 3 2 4
MIRT547902 HOXA9 homeobox A9 2 4
MIRT549503 ABHD2 abhydrolase domain containing 2 2 2
MIRT549583 ZNF850 zinc finger protein 850 2 2
MIRT551888 MMS22L MMS22 like, DNA repair protein 2 2
MIRT552125 MED10 mediator complex subunit 10 2 2
MIRT554188 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT555552 PLEKHA3 pleckstrin homology domain containing A3 2 2
MIRT556285 MAPK1 mitogen-activated protein kinase 1 2 2
MIRT556980 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT559183 BRAP BRCA1 associated protein 2 2
MIRT561215 ZSWIM1 zinc finger SWIM-type containing 1 2 2
MIRT562352 EXOC8 exocyst complex component 8 2 2
MIRT565603 SLC35G1 solute carrier family 35 member G1 2 2
MIRT575599 Gnl1 guanine nucleotide binding protein-like 1 2 3
MIRT610363 GNL1 G protein nucleolar 1 (putative) 2 3
MIRT617860 FMO4 flavin containing monooxygenase 4 2 2
MIRT698193 TMEM66 store-operated calcium entry associated regulatory factor 1 1
MIRT704411 CTPS1 CTP synthase 1 2 2
MIRT732864 NARS asparaginyl-tRNA synthetase 3 0
MIRT732867 AJAP1 adherens junctions associated protein 1 3 0
MIRT732868 COL24A1 collagen type XXIV alpha 1 chain 3 0
MIRT735738 RASSF4 Ras association domain family member 4 3 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-196a Curcumin NULL 969516 Microarray BxPC-3 human pancreatic carcinoma cell line 18347134 2008 down-regulated
miR-196a Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 down-regulated
miR-196a Polylysine NULL 162282 Quantitative real-time PCR 293T(FLAG AGO2) cells 20529860 2010 down-regulated
miR-196a Trypaflavine NULL NULL Quantitative real-time PCR 293T(FLAG AGO2) cells 20529860 2010 down-regulated
miR-196a Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-196a 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-196a Curcumin NULL 969516 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-196a Narangin NULL 442428 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-196a Proanthocyanin NULL 108065 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-196a (S)-3,5-dihydroxyphenylglycine (DHPG) NULL 443586 Quantitative real-time PCR mouse brain 22309833 2012 up-regulated
miR-196a (S)-3,5-dihydroxyphenylglycine (DHPG) NULL 443586 Quantitative real-time PCR mouse brain 22309833 2012 up-regulated
miR-196a 17beta-estradiol (E2) approved 5757 Microarray rat breast 17700064 2007 down-regulated
miR-196a (S)-3,5-dihydroxyphenylglycine (DHPG) NULL 443586 Quantitative real-time PCR mouse brain 22309833 2012 up-regulated
miR-196a Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-196a-5p (e)-2-methyl-1-[2-(2-methyl-1h-indol-3-yl)indolin-1-yl]but-2-en-1-one 5388204 NSC633484 resistant
hsa-miR-196a-5p (E)-3-[2-(4-methoxyphenyl)imidazo[1,2-a]pyridin-3-yl]-1-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 54613570 NSC750335 sensitive
hsa-miR-196a-5p 1-[4-(5,6-diphenyl-1,2,4-triazin-3-yl)piperazin-1-yl]-2-[4-(4-methoxyphenyl)piperazin-1-yl]ethanone 54612996 NSC749161 sensitive
hsa-miR-196a-5p 2-[(e)-[6-(4-chloro-3-nitrophenyl)-2,3-dihydroimidazo[2,1-b][1,3]thiazol-5-yl]methylideneamino]guanidine;hydrochloride 16099315 NSC728901 resistant
hsa-miR-196a-5p 2-amino-6-(benzylamino)-4-(2-chlorophenyl)pyridine-3,5-dicarbonitrile 24205132 NSC734396 resistant
hsa-miR-196a-5p 7-[(3,4-dimethoxyphenyl)methyl]-6-phenyl-4,5-dihydropyrrolo[3,4-g][1,2]benzoxazole 60148271 NSC754077 sensitive
hsa-miR-196a-5p Bisarylpurine 45028308 NSC742146 resistant
hsa-miR-196a-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-196a-5p Dimethylarsinothious acid, 2,4-pyrimidinediyl ester 294741 NSC163664 resistant
hsa-miR-196a-5p Ethyl 5-(2,4-dichlorobenzoyl)oxy-4-oxo-1,3-diphenyl-2-thioxo-thieno[2,3-d]pyrimidine-6-carboxylate 383097 NSC671141 resistant
hsa-miR-196a-5p Gw620972x 766949 NSC756282 sensitive
hsa-miR-196a-5p Methyl 11h-pyrido[2,3-a]carbazole-5-carboxylate 13776879 NSC740203 sensitive
hsa-miR-196a-5p Methyl 6-[2-(diethylamino)ethoxy]-7-[(E)-3-(4-methoxyphenyl)prop-2-enoyl]-3-methyl-1-benzofuran-2-carboxylate;hydrochloride 24204523 NSC732112 resistant
hsa-miR-196a-5p N'-[2-(1,3-benzoxazol-2-ylamino)-6-methylpyrimidin-4-yl]-2-hydroxybenzohydrazide 24205702 NSC736401 resistant
hsa-miR-196a-5p N-(1,3-benzothiazol-2-yl)-2-[4-[(Z)-(3-oxo-1-benzofuran-2-ylidene)methyl]phenoxy]acetamide 45028625 NSC743506 resistant
hsa-miR-196a-5p N,n'-bis[(z)-(2-hydroxyphenyl)methylideneamino]decanediamide 135408549 NSC49488 resistant
hsa-miR-196a-5p NSC617562 NSC617562 resistant
hsa-miR-196a-5p NSC756998 NSC756998 sensitive
hsa-miR-196a-5p Tellurium, trichloro[1,2-hexanedioato(2-)-o,o']-, ammonium 498945 NSC641009 resistant
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (SKOV3, 2008, OVCAR10, OVCAR3, HeLa, MCF7, MDA-MB-468)
hsa-miR-196a-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-196a-5p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-196a-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (HepG2, Hep-394, Hep-SWX, Huh-7)
hsa-miR-196a-5p Imatinib 5291 NSC743414 approved resistant High Myelogenous Leukemia cell line (MYL)
hsa-miR-196a-5p 10-Hydroxycamptothecin 97226 NSC107124 sensitive High Gastric Cancer cell line (BGC823, SGC-7901, MGC-803, HGC-27, NCI-N87, AGS)
hsa-miR-196a-5p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7, LY2)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780)
hsa-miR-196a-5p Fulvestrant 17756771 NSC719276 approved resistant Low Breast Cancer cell line (MCF-7)
hsa-miR-196a-5p Tamoxifen 2733525 NSC180973 approved resistant Low Breast Cancer cell line (MCF-7)
hsa-miR-196a-5p Doxorubicin 31703 NSC123127 approved resistant High Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-196a-5p Docetaxel 148124 NSC628503 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-196a-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-196a-5p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (RKO)
hsa-miR-196a-5p Docetaxel 148124 NSC628503 approved resistant Low Breast Cancer tissue and cell line (MCF-7)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-196a-5p Tamoxifen 2733525 NSC180973 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-196a-5p Doxorubicin 31703 NSC123127 approved sensitive High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-196a-5p Tamoxifen 2733525 NSC180973 approved sensitive Low Breast Cancer cell line (TAMR1, TAMR4, TAMR8)
hsa-miR-196a-5p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-196a-5p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-196a-5p Cytoxan + Doxorubicin + Fluorouracil resistant High Breast Cancer tissue
hsa-miR-196a-5p Cytoxan + Epirubicin + Fluorouracil resistant High Breast Cancer tissue
hsa-miR-196a-5p Cytoxan + Pirarubicin + Fluorouracil resistant High Breast Cancer tissue
hsa-miR-196a-5p Doxorubicin + Taxol resistant High Breast Cancer tissue
hsa-miR-196a-5p Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-196a-5p Gefitinib 123631 NSC715055 approved resistant High Non-Small Cell Lung Cancer cell line (PC-9)
hsa-miR-196a-5p Yuanhuadine 6440572 resistant High Non-Small Cell Lung Cancer cell line (PC-9)
hsa-miR-196a-5p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (DU-145R)
hsa-miR-196a-5p Paclitaxel + Cisplatin sensitive Low Esophageal Squamous Cell Carcinoma tissue
hsa-miR-196a-5p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (WM266) (2uM)
hsa-miR-196a-5p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (WM266) (1uM)
hsa-miR-196a-5p Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (WM266) (2uM)
hsa-miR-196a-5p Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (WM266) (1uM)
hsa-miR-196a-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-196a-5p Paclitaxel 36314 NSC125973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-196a-5p Trastuzumab resistant High Breast Cancer cell line (MDA‐MB‐231, SKBR3, HEK‐293T)
hsa-miR-196a-5p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CIS)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant High Epithelial Ovarian Cancer cell line (SKOV3)
hsa-miR-196a-5p Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-196a-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-196a-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-196a-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (cytosolic RNA)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (total RNA)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-196a-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-196a-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-196a-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-196a-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-196a-5p Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-196a-5p Tamoxifen 2733525 NSC180973 approved resistant cell line (LCC2)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-196a-5p Testosterone+Exemestane sensitive cell line (MCF-7)
hsa-miR-196a-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-196a-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (MGC-803)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (RPMI2650)
hsa-miR-196a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-196a-5p Tamoxifen 2733525 NSC180973 approved sensitive cell line (TamR8)
hsa-miR-196a-5p Tamoxifen 2733525 NSC180973 approved sensitive cell line (TamR1)
hsa-miR-196a-5p Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (IGROV-1)
hsa-miR-196a-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR70)
hsa-miR-196a-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR200)
hsa-miR-196a-5p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-196a-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR3)
hsa-miR-196a-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)
hsa-miR-196a-5p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (H460)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (OVCAR3)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (TOV-112D)

Error report submission