miRTarBase - #MIRT003117


—
pre-miRNA Information
pre-miRNA mmu-mir-122   
Genomic Coordinates chr18: 65248861 - 65248926
Synonyms Mirn122a, mmu-mir-122, Mir122a
Description Mus musculus miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-122-5p
Sequence 6| UGGAGUGUGACAAUGGUGUUUG |27
Evidence Experimental
Experiments Cloned
Putative Targets

Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BOL4H5 miR-122 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Plasma Microarrays; Real-time quantitative RT-PCR analysis
BOL4H5 miR-122 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Decrease Liver tissue Microarrays; Real-time quantitative RT-PCR analysis
BOL4H5 miR-122 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Decrease Liver tissue Quantitative real-time reverse transcription PCR
BOL4H5 miR-122 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Plasma Quantitative real-time reverse transcription PCR
BOL4H5 miR-122 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Plasma Quantitative reverse transcription PCR
BOL4H5 miR-122 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data expression Increase Serum Quantitative reverse transcription PCR
BOL4H5 miR-122 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression . Blood Polymerase chain reaction
BOL4H5 miR-122 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Serum Quantitative polymerase chain reaction
BOL4H5 miR-122 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Higher Blood Polymerase chain reaction
Gene Information
Gene Symbol Hist1h1c   
Synonyms 0610008C09Rik, H1.2, H1c, H1f2, H1var1, His1a
Description histone cluster 1, H1c
Transcript NM_015786   
Expression
Putative miRNA Targets on Hist1h1c
3'UTR of Hist1h1c
(miRNA target sites are highlighted)		 
>Hist1h1c|NM_015786|3'UTR
   1 GCTGCCTCCCCTAACAATCCAAAAGGCTCTTTTCAGAGCCACCA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' guuugugguaacAGUGUGAGGu 5'
                      | ||| ||| 
Target 5' -gctgcctccccTAACAATCCa 3'
 1 - 21 110.00 -7.92
2 
miRNA  3' guUUGUGGUAACAGUGU--GAGGu 5'
            || :|: || ||| |  | || 
Target 5' aaAAGGCTCTTTTCAGAGCCACCa 3'
 21 - 44 64.00 -11.50
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Gatfield D; Le Martelot G; Vejnar CE; et al.
- Genes & development, 2009
In liver, most metabolic pathways are under circadian control, and hundreds of protein-encoding genes are thus transcribed in a cyclic fashion. Here we show that rhythmic transcription extends to the locus specifying miR-122, a highly abundant, hepatocyte-specific microRNA. Genetic loss-of-function and gain-of-function experiments have identified the orphan nuclear receptor REV-ERBalpha as the major circadian regulator of mir-122 transcription. Although due to its long half-life mature miR-122 accumulates at nearly constant rates throughout the day, this miRNA is tightly associated with control mechanisms governing circadian gene expression. Thus, the knockdown of miR-122 expression via an antisense oligonucleotide (ASO) strategy resulted in the up- and down-regulation of hundreds of mRNAs, of which a disproportionately high fraction accumulates in a circadian fashion. miR-122 has previously been linked to the regulation of cholesterol and lipid metabolism. The transcripts associated with these pathways indeed show the strongest time point-specific changes upon miR-122 depletion. The identification of Pparbeta/delta and the peroxisome proliferator-activated receptor alpha (PPARalpha) coactivator Smarcd1/Baf60a as novel miR-122 targets suggests an involvement of the circadian metabolic regulators of the PPAR family in miR-122-mediated metabolic control.
LinkOut: [PMID: 19487572]
86 mmu-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003075 Tmem50b transmembrane protein 50B 1 1
MIRT003076 Lass6 ceramide synthase 6 1 1
MIRT003077 Gpx7 glutathione peroxidase 7 1 1
MIRT003113 Tgfbr1 transforming growth factor, beta receptor I 3 1
MIRT003114 Sbk1 SH3-binding kinase 1 3 1
MIRT003117 Hist1h1c histone cluster 1, H1c 3 1
MIRT003118 Ddc dopa decarboxylase 2 1
MIRT003120 Rell1 RELT-like 1 3 1
MIRT003121 Bach1 BTB and CNC homology 1, basic leucine zipper transcription factor 1 2 1
MIRT003122 Apob apolipoprotein B 2 1
MIRT003123 P4ha1 procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha 1 polypeptide 2 1
MIRT003124 Ccng1 cyclin G1 2 1
MIRT003125 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 3 3
MIRT003126 Gys1 glycogen synthase 1, muscle 2 2
MIRT003127 Slc35a4 solute carrier family 35, member A4 2 2
MIRT003128 Hfe2 hemochromatosis type 2 (juvenile) 3 3
MIRT003129 Tmed3 transmembrane p24 trafficking protein 3 2 2
MIRT003132 Bckdk branched chain ketoacid dehydrogenase kinase 4 1
MIRT003133 Aldoa aldolase A, fructose-bisphosphate 4 7
MIRT003134 Ndrg3 N-myc downstream regulated gene 3 4 2
MIRT003135 Cd320 CD320 antigen 4 1
MIRT003724 Smarcd1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 3 1
MIRT003725 Rcan1 regulator of calcineurin 1 2 1
MIRT003726 Gde1 glycerophosphodiester phosphodiesterase 1 2 1
MIRT004536 Ccrn4l nocturnin 4 1
MIRT005975 Klf6 Kruppel-like factor 6 4 1
MIRT005976 B2m beta-2 microglobulin 1 1
MIRT005977 Afp alpha fetoprotein 1 1
MIRT005978 Ccl2 chemokine (C-C motif) ligand 2 1 1
MIRT005979 Csf3r colony stimulating factor 3 receptor (granulocyte) 1 1
MIRT005980 Ctgf connective tissue growth factor 1 1
MIRT005981 Cxcl13 chemokine (C-X-C motif) ligand 13 1 1
MIRT005982 Cyp2b13 cytochrome P450, family 2, subfamily b, polypeptide 13 1 1
MIRT005983 Dbp D site albumin promoter binding protein 1 1
MIRT005984 Igf2 insulin-like growth factor 2 1 1
MIRT005985 Il1b interleukin 1 beta 1 1
MIRT005986 Jun jun proto-oncogene 1 1
MIRT005987 Per1 period circadian clock 1 1 1
MIRT005988 Alpl alkaline phosphatase, liver/bone/kidney 2 1
MIRT005989 Cs citrate synthase 2 1
MIRT005990 Prom1 prominin 1 3 1
MIRT005991 Sox4 SRY (sex determining region Y)-box 4 3 1
MIRT013527 Uros uroporphyrinogen III synthase 1 1
MIRT013528 Ppox protoporphyrinogen oxidase 1 1
MIRT013529 Urod uroporphyrinogen decarboxylase 1 1
MIRT013530 Cpox coproporphyrinogen oxidase 1 1
MIRT013531 Fech ferrochelatase 1 1
MIRT013532 Hamp hepcidin antimicrobial peptide 1 1
MIRT013533 Tfr2 transferrin receptor 2 1 1
MIRT013534 Smad4 SMAD family member 4 1 1
MIRT013535 Smad7 SMAD family member 7 1 1
MIRT013536 Bmpr1a bone morphogenetic protein receptor, type 1A 1 1
MIRT013537 Hba-a1 hemoglobin alpha, adult chain 1 2 1
MIRT013538 Hmbs hydroxymethylbilane synthase 2 1
MIRT013539 Mir17 microRNA 17 2 1
MIRT013540 Alas2 aminolevulinic acid synthase 2, erythroid 2 1
MIRT013541 Mir451 microRNA 451a 2 1
MIRT013542 Tfrc transferrin receptor 2 1
MIRT013543 Socs2 suppressor of cytokine signaling 2 1 1
MIRT013544 Slc35g1 solute carrier family 35, member G1 1 1
MIRT013545 Camk2b calcium/calmodulin-dependent protein kinase II, beta 1 1
MIRT013546 Irf6 interferon regulatory factor 6 1 1
MIRT013547 Rbl2 RB transcriptional corepressor like 2 1 1
MIRT013548 Hfe hemochromatosis 2 1
MIRT013549 Ccnd1 cyclin D1 2 1
MIRT054338 Pkm pyruvate kinase, muscle 3 1
MIRT054339 Tfdp2 transcription factor Dp 2 3 1
MIRT054340 E2f1 E2F transcription factor 1 3 1
MIRT579817 Zfp113 zinc finger protein 113 1 1
MIRT580378 Tmem206 transmembrane protein 206 1 2
MIRT581166 Sec23ip Sec23 interacting protein 1 1
MIRT582514 March5 membrane-associated ring finger (C3HC4) 5 1 2
MIRT586941 H2-T24 histocompatibility 2, T region locus 24 1 2
MIRT591859 Iffo2 intermediate filament family orphan 2 1 1
MIRT592160 Paxip1 PAX interacting (with transcription-activation domain) protein 1 1 1
MIRT592189 Nanog Nanog homeobox 1 2
MIRT592792 Cdh12 cadherin 12 1 1
MIRT597026 Thap1 THAP domain containing, apoptosis associated protein 1 1 1
MIRT597210 Snhg11 small nucleolar RNA host gene 11 1 1
MIRT601300 Zfp949 zinc finger protein 949 1 1
MIRT602608 Chrna1 cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle) 1 1
MIRT602960 Xpo7 exportin 7 1 1
MIRT603391 Sgol2 shugoshin 2A 1 1
MIRT604008 Ggps1 geranylgeranyl diphosphate synthase 1 1 1
MIRT605553 Ppp1r16b protein phosphatase 1, regulatory (inhibitor) subunit 16B 1 1
MIRT606204 Sfxn4 sideroflexin 4 1 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-122 Quercetin NULL 5280343 Quantitative real-time PCR liver 22402395 2012 up-regulated
miR-122 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) NULL 15625 Quantitative real-time PCR thymus 23024791 2012 up-regulated
miR-122 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-122 Streptozotocin (STZ) NULL 29327 Microarray streptozotocin (STZ)-induced type 1 diabetic mice 19372595 2009 down-regulated
miR-122 Streptozotocin (STZ) NULL 29327 Quantitative real-time PCR streptozotocin (STZ)-induced type 1 diabetic mice 19372595 2009 down-regulated
miR-122 Tert-butyl hydroperoxide (t-BHP) NULL 6410 Microarray mouse auditory cells 20510889 2010 down-regulated
miR-122 Benzo(a)pyrene NULL 2336 Microarray Adult male B6C3F1 mice 21569818 2011 down-regulated
miR-122 Glucose NULL 5793 Microarray endothelial cells 24394957 2014 up-regulated
miR-122 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-122 Bortezomib approved 387447 Quantitative real-time PCR SeAx and MyLa2000 cells 22235305 2012 up-regulated
miR-122 Doxorubicin approved 31703 Quantitative real-time PCR SeAx and MyLa2000 cells 22235305 2012 up-regulated
miR-122 MG132 NULL 462382 Quantitative real-time PCR SeAx and MyLa2000 cells 22235305 2012 up-regulated
miR-122 Microcystin-LR (MC-LR) NULL 445434 Quantitative real-time PCR WRL-68 Cells 22265967 2012 down-regulated
miR-122 Furan NULL 8029 Quantitative real-time PCR liver 22079235 2011 down-regulated
miR-122 Proanthocyanidins approved 108065 Quantitative real-time PCR liver cells 23922812 2013 down-regualted
miR-122 Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 down-regulated
miR-122 Dexamethasone approved 5743 Quantitative real-time PCR adrenals and granulosa cells 24205079 2014 down-regulated
miR-122 Proanthocyanidins approved 108065 Quantitative real-time PCR postprandial lipemia and liver 24445039 2014 down-regulated
miR-122 Aristolochic acid NULL 2236 Microarray kidney 25106556 2014 down-regualted
miR-122 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-122 Enoxacin approved 3229 Quantitative real-time PCR HCT-116 and RKO colon cancer cell lines 21368194 2011 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
mmu-miR-122-5p Cisplatin 5460033 NSC119875 approved sensitive Low Hepatocellular Carcinoma tissue and cell line
mmu-miR-122-5p Doxorubicin 31703 NSC123127 approved sensitive Low Hepatocellular Carcinoma tissue and cell line
mmu-miR-122-5p Fluorouracil 3385 NSC19893 approved sensitive Low Colon Cancer tissue and cell line (HCT-116, HCT-29)

Error report submission