miRTarBase - #MIRT003144


—
pre-miRNA Information
pre-miRNA hsa-mir-96   
Genomic Coordinates chr7: 129774692 - 129774769
Synonyms DFNA50, MIRN96, hsa-mir-96, miR-96, miRNA96, MIR96
Description Homo sapiens miR-96 stem-loop
Comment This sequence is localised to chromosome 7 and was named mir-96-7 in reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-96-5p
Sequence 9| UUUGGCACUAGCACAUUUUUGCU |31
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
865 5 ClinVar
866 6 ClinVar
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs587776522 5 dbSNP
rs587776523 6 dbSNP
rs776335197 10 dbSNP
rs1483018024 12 dbSNP
rs772409471 14 dbSNP
rs1333938704 17 dbSNP
rs957232317 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BS5P4Z miR-96 Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Plasma Quantitative reverse transcription PCR
Gene Information
Gene Symbol Mitf
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions rat liver
Original Description (Extracted from the article) ... "The livers of 2-AAF-exposed rats were characterized by the substantial deregulation of expression of miR-18 ...

- Pogribny IP; Muskhelishvili L; Tryndyak VP; et al., 2009, Toxicology and applied pharmacology.

Article - Pogribny IP; Muskhelishvili L; Tryndyak VP; et al.
- Toxicology and applied pharmacology, 2009
The aromatic amine 2-acetylaminofluore (2-AAF) is a powerful complete genotoxic rat liver carcinogen that induces tumors without any additional interventions. While the tumor-initiating genotoxic activity of 2-AAF is well established, its tumor-promotion activity is far less understood. It is believed that the tumor-promoting property of 2-AAF is associated with selective enhancement of cell replication and sustained suppression of apoptosis in initiated cells. In the present study, we investigated the underlying mechanisms of tumor-promoting events induced by 2-AAF-exposure. Male Sprague-Dawley rats were fed NIH-31 diet containing 0.02% of 2-AAF for 12 and 24 weeks, and the expression pattern of genes associated with the p53-signaling pathway and microRNA genes was determined in the livers of control and 2-AAF-fed rats. The results indicate that the tumor-promoting property of 2-AAF during hepatocarcinogenesis is associated predominantly with the up-regulation of anti-apoptotic growth-related genes and down-regulation of expression of pro-apoptotic genes. This disrupts the balance between cell proliferation and apoptosis, which leads to consequential unrestricted cell proliferation, especially of initiated cells. Also, the long-term-administration of 2-AAF resulted in disruption of regulatory miR-34a-p53 feed-back loop that mediates apoptosis. This was evidenced by an increased expression of miR-34a in response to genotoxic effects of 2-AAF in the absence of p53 up-regulation, and loss of regulatory control of mir-34a on SIRT1 function. Additionally, the livers of 2-AAF-exposed rats were characterized by the substantial deregulation of expression of miR-18, miR-21, miR-182, and miR-200 family, microRNAs involved in control of apoptosis/cell proliferation and cell-cell contact pathways, two major pathways disrupted during the promotion stage of hepatocarcinogenesis.
LinkOut: [PMID: 19167416]
202 hsa-miR-96-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001087 FOXO1 forkhead box O1 7 6
MIRT001989 MITF melanogenesis associated transcription factor 2 1
MIRT001991 ADCY6 adenylate cyclase 6 3 2
MIRT002447 HTR1B 5-hydroxytryptamine receptor 1B 2 1
MIRT003144 Mitf melanogenesis associated transcription factor 3 1
MIRT003414 CDKN1A cyclin dependent kinase inhibitor 1A 5 1
MIRT004352 PRMT5 protein arginine methyltransferase 5 4 2
MIRT005450 FOXO3 forkhead box O3 4 1
MIRT005553 KRAS KRAS proto-oncogene, GTPase 5 4
MIRT006779 REV1 REV1, DNA directed polymerase 3 1
MIRT006780 RAD51 RAD51 recombinase 3 1
MIRT027869 CELSR2 cadherin EGF LAG seven-pass G-type receptor 2 1 1
MIRT027870 ODF2 outer dense fiber of sperm tails 2 1 1
MIRT027871 IRS1 insulin receptor substrate 1 1 1
MIRT027872 MYRIP myosin VIIA and Rab interacting protein 2 1
MIRT027873 RYK receptor-like tyrosine kinase 1 1
MIRT027874 CAMTA1 calmodulin binding transcription activator 1 1 1
MIRT027875 CDON cell adhesion associated, oncogene regulated 1 1
MIRT027876 MGST1 microsomal glutathione S-transferase 1 1 1
MIRT027877 SRXN1 sulfiredoxin 1 1 1
MIRT027878 SUPT4H1 SPT4 homolog, DSIF elongation factor subunit 1 1
MIRT027879 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 1
MIRT027880 ZC3H15 zinc finger CCCH-type containing 15 1 1
MIRT027881 ZYX zyxin 1 1
MIRT027882 ZMIZ1 zinc finger MIZ-type containing 1 1 1
MIRT027883 JAZF1 JAZF zinc finger 1 1 1
MIRT027884 TRIM4 tripartite motif containing 4 1 1
MIRT027885 B4GALT3 beta-1,4-galactosyltransferase 3 1 1
MIRT027886 POMP proteasome maturation protein 1 1
MIRT027887 GTF2A1 general transcription factor IIA subunit 1 1 1
MIRT027888 RELA RELA proto-oncogene, NF-kB subunit 1 1
MIRT027889 SLAIN1 SLAIN motif family member 1 1 1
MIRT027890 RPS29 ribosomal protein S29 1 1
MIRT027891 PON2 paraoxonase 2 1 1
MIRT027892 HMGCS1 3-hydroxy-3-methylglutaryl-CoA synthase 1 1 1
MIRT027893 SLC25A46 solute carrier family 25 member 46 1 1
MIRT027894 APPL1 adaptor protein, phosphotyrosine interacting with PH domain and leucine zipper 1 1 1
MIRT027895 BAG4 BCL2 associated athanogene 4 1 1
MIRT027896 TSPAN14 tetraspanin 14 1 1
MIRT027897 CHML CHM like, Rab escort protein 2 1 1
MIRT027898 REEP3 receptor accessory protein 3 1 1
MIRT027899 TWISTNB TWIST neighbor 1 1
MIRT027900 ECT2 epithelial cell transforming 2 1 1
MIRT027901 XIAP X-linked inhibitor of apoptosis 1 1
MIRT027902 NKIRAS2 NFKB inhibitor interacting Ras like 2 1 1
MIRT027903 DDIT3 DNA damage inducible transcript 3 1 1
MIRT027904 RLF rearranged L-myc fusion 1 1
MIRT027905 MTHFD2L methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2 like 1 1
MIRT027906 SYNGR2 synaptogyrin 2 2 2
MIRT027907 ADSS adenylosuccinate synthase 1 1
MIRT027908 PHF19 PHD finger protein 19 1 1
MIRT027909 SGK3 serum/glucocorticoid regulated kinase family member 3 1 1
MIRT027910 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT027911 UBE2N ubiquitin conjugating enzyme E2 N 1 1
MIRT027912 CNOT6 CCR4-NOT transcription complex subunit 6 1 1
MIRT027913 FBXO21 F-box protein 21 1 1
MIRT027914 ARHGEF2 Rho/Rac guanine nucleotide exchange factor 2 1 1
MIRT027915 SPIN4 spindlin family member 4 2 2
MIRT027916 CGGBP1 CGG triplet repeat binding protein 1 1 1
MIRT027917 PPP1R12A protein phosphatase 1 regulatory subunit 12A 2 3
MIRT027918 RAB5B RAB5B, member RAS oncogene family 1 1
MIRT027919 TAOK1 TAO kinase 1 1 1
MIRT027920 EFNB2 ephrin B2 1 1
MIRT027921 NIPA1 non imprinted in Prader-Willi/Angelman syndrome 1 1 1
MIRT027922 YWHAG tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein gamma 1 1
MIRT027923 NHLRC3 NHL repeat containing 3 1 1
MIRT027924 SNX16 sorting nexin 16 1 1
MIRT027925 EVI5 ecotropic viral integration site 5 2 3
MIRT027926 PRDM16 PR/SET domain 16 1 1
MIRT027927 HOXA9 homeobox A9 2 3
MIRT027928 PROSC pyridoxal phosphate binding protein 1 1
MIRT027929 BCL2 BCL2, apoptosis regulator 1 1
MIRT027930 EIF4G1 eukaryotic translation initiation factor 4 gamma 1 1 1
MIRT027931 FAM171A1 family with sequence similarity 171 member A1 1 1
MIRT027932 MED1 mediator complex subunit 1 1 1
MIRT027933 CNNM3 cyclin and CBS domain divalent metal cation transport mediator 3 1 1
MIRT027934 PROK2 prokineticin 2 1 1
MIRT027935 ATXN1 ataxin 1 1 1
MIRT027936 FRS2 fibroblast growth factor receptor substrate 2 1 1
MIRT027937 PRKCE protein kinase C epsilon 1 1
MIRT027938 SLC39A1 solute carrier family 39 member 1 1 1
MIRT035550 SCARB1 scavenger receptor class B member 1 3 2
MIRT048714 FAM105B OTU deubiquitinase with linear linkage specificity 1 1
MIRT048715 SNX7 sorting nexin 7 1 1
MIRT048716 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT048717 PAPD5 poly(A) RNA polymerase D5, non-canonical 1 1
MIRT048718 GAPDH glyceraldehyde-3-phosphate dehydrogenase 1 1
MIRT048719 THAP9 THAP domain containing 9 1 1
MIRT048720 MOXD1 monooxygenase DBH like 1 1 1
MIRT048721 ITPR3 inositol 1,4,5-trisphosphate receptor type 3 1 1
MIRT048722 ALKBH5 alkB homolog 5, RNA demethylase 1 1
MIRT048723 ADNP2 ADNP homeobox 2 1 1
MIRT048724 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT048725 PGAM1 phosphoglycerate mutase 1 1 1
MIRT048726 FLII FLII, actin remodeling protein 1 1
MIRT048727 PMS2 PMS1 homolog 2, mismatch repair system component 1 1
MIRT048728 TMPO thymopoietin 1 1
MIRT048729 KLHL15 kelch like family member 15 1 1
MIRT048730 SMIM12 small integral membrane protein 12 1 1
MIRT048731 EDEM1 ER degradation enhancing alpha-mannosidase like protein 1 1 1
MIRT048732 DEK DEK proto-oncogene 1 1
MIRT048733 PRKAR1A protein kinase cAMP-dependent type I regulatory subunit alpha 1 1
MIRT048734 YTHDC2 YTH domain containing 2 1 1
MIRT048735 ACTN4 actinin alpha 4 1 1
MIRT048736 TERF2 telomeric repeat binding factor 2 1 1
MIRT048737 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT048738 PAQR4 progestin and adipoQ receptor family member 4 1 1
MIRT053181 ALK ALK receptor tyrosine kinase 3 1
MIRT053390 CCNG1 cyclin G1 1 1
MIRT053391 RAB35 RAB35, member RAS oncogene family 1 1
MIRT053392 CASP2 caspase 2 1 1
MIRT053393 SOX5 SRY-box 5 1 1
MIRT053394 ABCD1 ATP binding cassette subfamily D member 1 1 1
MIRT053395 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT053396 ATG7 autophagy related 7 1 1
MIRT053397 RASA1 RAS p21 protein activator 1 1 1
MIRT053398 CCND2 cyclin D2 1 1
MIRT053783 GSK3B glycogen synthase kinase 3 beta 4 1
MIRT054654 ZEB1 zinc finger E-box binding homeobox 1 3 1
MIRT054656 SNAI2 snail family transcriptional repressor 2 3 1
MIRT054678 SLC1A1 solute carrier family 1 member 1 2 1
MIRT054679 SLC6A6 solute carrier family 6 member 6 4 2
MIRT078464 MAP3K3 mitogen-activated protein kinase kinase kinase 3 2 2
MIRT079298 NPTX1 neuronal pentraxin 1 2 2
MIRT203592 BRWD1 bromodomain and WD repeat domain containing 1 2 2
MIRT257150 TMEM170B transmembrane protein 170B 2 2
MIRT282640 IGF1R insulin like growth factor 1 receptor 2 2
MIRT291999 SIN3B SIN3 transcription regulator family member B 2 2
MIRT437837 IARS isoleucyl-tRNA synthetase 1 1
MIRT438045 RECK reversion inducing cysteine rich protein with kazal motifs 5 3
MIRT438129 TRIB3 tribbles pseudokinase 3 2 1
MIRT438804 SYCP1 synaptonemal complex protein 1 1 1
MIRT452671 GPR156 G protein-coupled receptor 156 2 2
MIRT453461 PITPNM3 PITPNM family member 3 2 2
MIRT454765 STOML3 stomatin like 3 2 2
MIRT462316 CWC25 CWC25 spliceosome associated protein homolog 2 2
MIRT467855 SLC25A25 solute carrier family 25 member 25 2 2
MIRT468527 SERPINH1 serpin family H member 1 2 2
MIRT470490 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 2 2
MIRT477660 EFHD2 EF-hand domain family member D2 2 2
MIRT479790 CCND1 cyclin D1 4 2
MIRT481283 ATXN1L ataxin 1 like 2 2
MIRT491594 CCL22 C-C motif chemokine ligand 22 2 2
MIRT500672 TSKU tsukushi, small leucine rich proteoglycan 2 2
MIRT501010 SPPL2A signal peptide peptidase like 2A 2 4
MIRT501681 PFN1 profilin 1 2 8
MIRT501919 MBD4 methyl-CpG binding domain 4, DNA glycosylase 2 4
MIRT502390 GATSL2 cytosolic arginine sensor for mTORC1 subunit 2 2 2
MIRT503221 ACER2 alkaline ceramidase 2 2 2
MIRT503540 RPL7L1 ribosomal protein L7 like 1 2 6
MIRT505703 SESN2 sestrin 2 2 2
MIRT509888 RPS23 ribosomal protein S23 2 4
MIRT525372 SYNM synemin 2 2
MIRT529420 MALT1 MALT1 paracaspase 2 2
MIRT533377 UBE2D4 ubiquitin conjugating enzyme E2 D4 (putative) 2 4
MIRT533469 TRIM71 tripartite motif containing 71 2 2
MIRT533595 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT535082 PODXL podocalyxin like 2 2
MIRT541183 MORF4L1 mortality factor 4 like 1 2 2
MIRT544139 PGK1 phosphoglycerate kinase 1 2 2
MIRT547915 HOXA5 homeobox A5 2 2
MIRT555926 NUP43 nucleoporin 43 2 2
MIRT557240 CRAMP1L cramped chromatin regulator homolog 1 2 2
MIRT557939 FAM73A mitoguardin 1 2 2
MIRT558455 DDAH1 dimethylarginine dimethylaminohydrolase 1 2 2
MIRT561177 TNFRSF10A TNF receptor superfamily member 10a 2 2
MIRT562310 GINM1 glycoprotein integral membrane 1 2 2
MIRT566586 NUP50 nucleoporin 50 2 2
MIRT573341 TUBD1 tubulin delta 1 2 2
MIRT576270 Cd59a CD59a antigen 1 1
MIRT612971 GID4 GID complex subunit 4 homolog 2 6
MIRT614998 GABRB1 gamma-aminobutyric acid type A receptor beta1 subunit 2 2
MIRT622020 STK17B serine/threonine kinase 17b 2 2
MIRT640562 CPE carboxypeptidase E 2 2
MIRT642241 PAK4 p21 (RAC1) activated kinase 4 2 2
MIRT646584 ANKRD36 ankyrin repeat domain 36 2 2
MIRT648861 ABCA6 ATP binding cassette subfamily A member 6 2 2
MIRT652226 TRAPPC3L trafficking protein particle complex 3 like 2 2
MIRT655805 NOTCH2 notch 2 2 2
MIRT656982 KDM5A lysine demethylase 5A 2 2
MIRT658778 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 2 2
MIRT660466 ASH1L ASH1 like histone lysine methyltransferase 2 2
MIRT668470 EXOSC2 exosome component 2 2 2
MIRT689954 ZNF185 zinc finger protein 185 with LIM domain 2 2
MIRT690112 ZFAND1 zinc finger AN1-type containing 1 2 2
MIRT697755 USP5 ubiquitin specific peptidase 5 2 2
MIRT705941 ACY1 aminoacylase 1 2 2
MIRT705981 ABHD14A-ACY1 ABHD14A-ACY1 readthrough 2 2
MIRT723429 MIPOL1 mirror-image polydactyly 1 2 2
MIRT723490 WDR33 WD repeat domain 33 2 2
MIRT725556 CTSB cathepsin B 2 2
MIRT731565 PTPN9 protein tyrosine phosphatase, non-receptor type 9 3 1
MIRT732322 MTSS1 MTSS1, I-BAR domain containing 3 1
MIRT732695 HBEGF heparin binding EGF like growth factor 3 0
MIRT734622 GDNF glial cell derived neurotrophic factor 1 0
MIRT735085 PAX6 paired box 6 2 0
MIRT735992 FHL1 four and a half LIM domains 1 5 1
MIRT736590 ZDHHC5 zinc finger DHHC-type containing 5 3 0
MIRT736666 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 3 0
MIRT755968 DTL denticleless E3 ubiquitin protein ligase homolog 3 1
MIRT756106 PTEN phosphatase and tensin homolog 3 1
MIRT756475 ARHGAP6 Rho GTPase activating protein 6 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-96 Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miR-96 Enoxacin approved 3229 Quantitative real-time PCR HEK293 cells 18641635 2008 up-regulated
miR-96 Vorinostat (SAHA) approved 5311 Microarray A549 human non-small cell lung cancer cells 19513533 2009 up-regulated
miR-96 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-96 ACTH approved 16132265 Microarray adrenal gland 22128032 2012 down-regulated
miR-96 (S)-3,5-dihydroxyphenylglycine (DHPG) NULL 443586 Quantitative real-time PCR mouse brain 22309833 2012 up-regulated
miR-96 Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 up-regulated
miR-96 ACTH approved 16132265 Quantitative real-time PCR adrenals and granulosa cells 24205079 2014 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-96 Cisplatin 5460033 NSC119875 approved resistant cell line (W1)
hsa-miR-96-5p 2-(ethoxymethyl)-4,7-dimethoxy-6-[6-(4-methylpiperazin-1-yl)-1h-benzimidazol-2-yl]-1h-benzimidazole 398957 NSC709341 resistant
hsa-miR-96-5p 4-n-(7-chloro-3-phenylquinolin-4-yl)-1-n,1-n-diethylpentane-1,4-diamine;hydroiodide 24182056 NSC13477 resistant
hsa-miR-96-5p Destruxin e 107863 NSC361127 resistant
hsa-miR-96-5p Methyl 2-[33,34,35,36-tetrahydroxy-11,19,27-tris(2-methoxy-2-oxoethyl)-7,15,23,31-tetramethyl-3,11,19,27-tetrazapentacyclo[27.3.1.15,9.113,17.121,25]hexatriaconta-1(32),5,7,9(36),13,15,17(35),21(34),2 395595 NSC700325 resistant
hsa-miR-96-5p N,N-diethyl-2-[(E)-(3-methoxy-13-methyl-7,8,9,11,12,14,15,16-octahydro-6H-cyclopenta[a]phenanthren-17-ylidene)amino]oxyethanamine 6065911 NSC680094 resistant
hsa-miR-96-5p Trail sensitive High Non-Small Cell Lung Cancer cell line (CALU-1, A459, H460)
hsa-miR-96-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-96-5p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-96-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-96-5p Imatinib 5291 NSC743414 approved sensitive High Myelogenous Leukemia cell line (MYL)
hsa-miR-96-5p Cisplatin 5460033 NSC119875 approved resistant High Ehrlich Ascites Tumor cell line (EHR2,P6, P12, P36, P72, EHR2/1.3)
hsa-miR-96-5p Doxorubicin 31703 NSC123127 approved resistant High Ehrlich Ascites Tumor cell line (EHR2,P6, P12, P36, P72, EHR2/1.3)
hsa-miR-96-5p Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7, LY2)
hsa-miR-96-5p Fluorouracil 3385 NSC19893 approved resistant High Colon Cancer cell line (KM12C)
hsa-miR-96-5p Cisplatin 5460033 NSC119875 approved sensitive Low Osteosarcoma cell line (U-2-OS)
hsa-miR-96-5p Cisplatin 5460033 NSC119875 approved sensitive Low Breast Cancer cell line (HCC1937)
hsa-miR-96-5p Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer cell line (PEO1)
hsa-miR-96-5p Cisplatin 5460033 NSC119875 approved sensitive High Esophageal Squamous Cell Carcinoma tissue and cell line (TE1, TE5, TE8, TE9, TE10, TE11, TE13)
hsa-miR-96-5p Docetaxel 148124 NSC628503 approved sensitive High Prostate Cancer cell line (DU-145)
hsa-miR-96-5p Chemotherapy sensitive High Epithelial Ovarian Cancer tissue
hsa-miR-96-5p Fluorouracil 3385 NSC19893 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-96-5p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-96-5p Cisplatin 5460033 NSC119875 approved resistant Low Esophageal Cancer cell line (TE-1, ECa-109, EC-9706)
hsa-miR-96-5p Fluorouracil 3385 NSC19893 approved sensitive Low Colorectal Cancer cell line (HT-29, DLD-1, HCT-116)
hsa-miR-96-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (COC1)
hsa-miR-96-5p Taxane 9548828 resistant High Prostate Cancer cell line (PC-3, PR20)
hsa-miR-96-5p Paclitaxel 36314 NSC125973 approved resistant High Lung Adenocarcinoma cell line (A549)
hsa-miR-96-5p Paclitaxel 36314 NSC125973 approved resistant High Lung Adenocarcinoma cell line (A549)
hsa-miR-96-5p Plx-4720 24180719 NSC757438 resistant Low Thyroid Cancer cell line (8505c, BCPAP)
hsa-miR-96-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-96-5p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-96-5p Oxaliplatin 6857599 NSC266046 approved resistant Low Colon Cancer cell line (HCT-15, SW480)
hsa-miR-96-5p Fluorouracil 3385 NSC19893 approved sensitive High Colorectal Cancer cell line (DLD-1)
hsa-miR-96-5p Cisplatin 5460033 NSC119875 approved resistant Low Urothelial Bladder Cancer cell line (T24)
hsa-miR-96-5p Gemcitabine 60750 NSC613327 approved resistant Low Urothelial Bladder Cancer cell line (T24)
hsa-miR-96-5p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-96-5p Doxorubicin 31703 NSC123127 approved resistant Low Hepatocellular Carcinoma cell line (SNU387, HLF)
hsa-miR-96-5p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (DU-145R)
hsa-miR-96-5p Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (500nM)
hsa-miR-96-5p Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (2uM)
hsa-miR-96-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (500nM)
hsa-miR-96-5p Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-miR-96-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-miR-96-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (2uM)
hsa-miR-96-5p Cisplatin 5460033 NSC119875 approved resistant Low Head And Neck Squamous Cell Carcinoma cell line (Cal 27, FaDu)
hsa-miR-96-5p Cytarabine 6253 NSC287459 approved sensitive Low Acute Myeloid Leukemia cell line (HL60, THP-1)
hsa-miR-96-5p Fluorouracil 3385 NSC19893 approved resistant Low Colorectal Cancer cell line (HCT-116, HCT-8)
hsa-miR-96-5p Oxaliplatin 6857599 NSC266046 approved resistant Low Colorectal Cancer cell line (HCT-116, HCT-8)
hsa-miR-96-5p Fluorouracil 3385 NSC19893 approved sensitive High Colorectal Cancer cell line (HT-29)
hsa-miR-96-5p Imatinib 5291 NSC743414 approved sensitive Low Chronic Myelogenous Leukemia cell line (K562, MEG01)
hsa-miR-96-5p Gefitinib 123631 NSC715055 approved sensitive High Non-Small Cell Lung Cancer cell line (HCC827)
hsa-miR-96-5p Sorafenib 216239 NSC747971 approved resistant Low Hepatocellular Carcinoma tissue
hsa-miR-96-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-96-5p Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-96-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-96-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-96-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM43)
hsa-miR-96-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM47)
hsa-miR-96-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-96-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-96-5p Exemestane 60198 NSC713563 approved resistant cell line (MCF-7)
hsa-miR-96-5p Testosterone 6013 NSC9700 approved resistant cell line (MCF-7)
hsa-miR-96-5p Testosterone+Anastrozole resistant cell line (MCF-7)
hsa-miR-96-5p Testosterone+Exemestane resistant cell line (MCF-7)
hsa-miR-96-5p Testosterone+Letrozole resistant cell line (MCF-7)
hsa-miR-96-5p Testosterone+Tamoxifen resistant cell line (MCF-7)
hsa-miR-96-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-96-5p Sunitinib 5329102 NSC750690 approved resistant tissue (clear cell renal cell carcinoma)
hsa-miR-96-5p Fluorouracil 3385 NSC19893 approved sensitive cell line (HCT15)
hsa-miR-96-5p Cisplatin 5460033 NSC119875 approved resistant cell line (MGC-803)
hsa-miR-96-5p Ethanol+Tamoxifen sensitive cell line (LY2)
hsa-miR-96-5p Sunitinib 5329102 NSC750690 approved sensitive tissue (CardA)
hsa-miR-96-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-96-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (HuH28)
hsa-miR-96-5p Tamoxifen 2733525 NSC180973 approved sensitive cell line (TamR8)
hsa-miR-96-5p Tamoxifen 2733525 NSC180973 approved sensitive cell line (TamR4)
hsa-miR-96-5p Paclitaxel 36314 NSC125973 approved resistant cell line (PC3PR20)
hsa-miR-96-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-96-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-96-5p Bortezomib 387447 NSC681239 approved resistant cell line (CCRF-CEM) (200 nM)
hsa-miR-96-5p Bortezomib 387447 NSC681239 approved resistant cell line (CCRF-CEM) (100 nM)
hsa-miR-96-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)
hsa-miR-96-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-96-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (MDAH-2774)
hsa-miR-96-5p Cisplatin 5460033 NSC119875 approved resistant cell line (TOV-112D)
hsa-miR-96-5p Cisplatin 5460033 NSC119875 approved resistant cell line (OVSAHO)

Error report submission