pre-miRNA Information
pre-miRNA hsa-mir-210   
Genomic Coordinates chr11: 568089 - 568198
Synonyms MIRN210, mir-210, MIR210
Description Homo sapiens miR-210 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-210-3p
Sequence 66| CUGUGCGUGUGACAGCGGCUGA |87
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 12 11 - 568122 25582055 MiREDiBase
A-to-I 14 11 - 568120 26028588 MiREDiBase
C-to-U 1 11 - 568133 26209130 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs753825152 1 dbSNP
rs759616365 3 dbSNP
rs1247955373 6 dbSNP
rs558661304 9 dbSNP
rs1490451308 13 dbSNP
rs1344162213 14 dbSNP
rs745930382 15 dbSNP
rs1220183952 16 dbSNP
rs1355496181 17 dbSNP
rs1280245998 19 dbSNP
rs781628850 20 dbSNP
rs1241231800 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BX0CY6 miR-210 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Urine Quantitative real-time reverse transcription PCR
BX0CY6 miR-210 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Low Blood Reverse transcription-polymerase chain reaction
Gene Information
Gene Symbol HECTD1   
Synonyms EULIR
Description HECT domain E3 ubiquitin protein ligase 1
Transcript NM_015382   
Expression
Putative miRNA Targets on HECTD1
3'UTR of HECTD1
(miRNA target sites are highlighted)
>HECTD1|NM_015382|3'UTR
   1 GCTTTGAAGTGCAATGGGAGACATCAGAGACTTTAAAAATACTAGTGAAGCCTCTTGTGTTTGTGTGCAGAGAAGTATAT
  81 GATCCACCATGCTAATGACACTTGCCTTTTTTTCCACCATTAAGGCTTTAAGAACATGTGGAATAAGTTTTTTAGCTGCT
 161 AATGACAAAACAAATCCTGTAACTACCCAGCCAGCAAGTATATAGCACAGAACACTGTGTTACTTTACAAGGGCTTATGT
 241 GACTGGAATAAGGTGGTCCCACTTGACTGTTCCAAAGAGCAGCTTCTCAGATCTTCAGTGTTCACTGGTAAATTTCTAAC
 321 AGTGTATTTGTGTAAAGTTTGTCATTTCATACTCCATACACTACAGTTGCTGTCACTGATCCCTGTTTTGCTGGCTTTTA
 401 AGCTACTTGGTCAAAAATCCTGCTTCCTTAAAACATAGAGAATTAATGAGCATCTCAAGCTTTTTCTTTTCCTTTTTAAT
 481 GATGCCTGCACTATCAAGAGTATTCTAGTGTTCTCTCTTTGTTTGGCATATAATCATGCACCAAACTTTTTATTTCTTTA
 561 AGGTGGGAGTATATTTTTATTTCCTAAATGCCATACTATGAAGATCAAAGTCTTAAGTGTGTTTGCAGCTCAAAAATAAA
 641 GATGTATTAAGGGGGGAAAACCTGGTCTAAGTGCAAGGCACACTTACAGCGAGTTTTACTTTCGGTTGTATTTTCTTTGT
 721 ATATTATAAACATTTATTTAACTTGTTGCCGTTTGAAGTAAAAAATTTCCAAAATGTATGCTCAACAATAATCATTAAAA
 801 TGTTTGCAGCGTACAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' agucgGCGACAGUGUGCGUGUc 5'
               :|:|  || :||:||| 
Target 5' taaaaTGTTTGCA-GCGTACAa 3'
796 - 816 116.00 -9.50
2
miRNA  3' agUCGGCGACA-GUGUGCGUGUc 5'
            :|:|   || || | ||||| 
Target 5' ctGGTCTAAGTGCA-AGGCACAc 3'
662 - 683 115.00 -8.12
3
miRNA  3' agucggCG-ACAGU-GUGCGUGuc 5'
                || | | | ||:||||  
Target 5' tgtttgGCATATAATCATGCACca 3'
520 - 543 112.00 -9.36
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30183413 1 COSMIC
COSN31559279 34 COSMIC
COSN6246316 95 COSMIC
COSN30161386 176 COSMIC
COSN31579522 352 COSMIC
COSN31570957 440 COSMIC
COSN19172248 636 COSMIC
COSN26506717 691 COSMIC
COSN26556535 750 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs201644031 2 dbSNP
rs1247073086 4 dbSNP
rs1307120524 9 dbSNP
rs1293623888 14 dbSNP
rs201479254 17 dbSNP
rs778861593 19 dbSNP
rs556595092 20 dbSNP
rs373841760 23 dbSNP
rs1362701586 25 dbSNP
rs200195698 27 dbSNP
rs763563502 28 dbSNP
rs773969401 31 dbSNP
rs773784286 33 dbSNP
rs370024702 34 dbSNP
rs765868284 35 dbSNP
rs1304719410 37 dbSNP
rs905334323 41 dbSNP
rs1424997678 42 dbSNP
rs748506823 45 dbSNP
rs977058867 49 dbSNP
rs1387332863 55 dbSNP
rs944298851 77 dbSNP
rs71417947 84 dbSNP
rs985092783 87 dbSNP
rs555523316 88 dbSNP
rs957750024 90 dbSNP
rs781720580 97 dbSNP
rs1032085080 99 dbSNP
rs1474962580 101 dbSNP
rs1238706814 110 dbSNP
rs1388182334 111 dbSNP
rs186579076 113 dbSNP
rs1207875436 116 dbSNP
rs1450077824 116 dbSNP
rs1266461504 118 dbSNP
rs1451945120 123 dbSNP
rs1195486986 124 dbSNP
rs1236287699 130 dbSNP
rs1439174974 135 dbSNP
rs1159271038 137 dbSNP
rs1248687270 145 dbSNP
rs1456617048 146 dbSNP
rs1162865436 147 dbSNP
rs933620549 149 dbSNP
rs1443556709 154 dbSNP
rs753251308 155 dbSNP
rs1281006641 171 dbSNP
rs1376737236 175 dbSNP
rs1445428784 177 dbSNP
rs1025298902 179 dbSNP
rs1318167569 183 dbSNP
rs1242220796 188 dbSNP
rs1339126421 189 dbSNP
rs1273017026 192 dbSNP
rs1231219321 201 dbSNP
rs1256098021 203 dbSNP
rs1457229189 208 dbSNP
rs1252807373 217 dbSNP
rs375969911 217 dbSNP
rs1422116543 237 dbSNP
rs1013475898 239 dbSNP
rs975714515 252 dbSNP
rs959570228 253 dbSNP
rs1369202757 254 dbSNP
rs1463356003 258 dbSNP
rs963925952 269 dbSNP
rs1400252577 272 dbSNP
rs1034313685 273 dbSNP
rs1300394211 274 dbSNP
rs1001546796 279 dbSNP
rs768000959 284 dbSNP
rs1302297555 297 dbSNP
rs1048551941 306 dbSNP
rs1355637215 314 dbSNP
rs1234934622 319 dbSNP
rs994729050 324 dbSNP
rs1317044285 328 dbSNP
rs1016751121 330 dbSNP
rs1341823707 340 dbSNP
rs759970465 358 dbSNP
rs1334416401 365 dbSNP
rs897291028 382 dbSNP
rs1199883991 384 dbSNP
rs565939381 391 dbSNP
rs1409067245 399 dbSNP
rs80002178 405 dbSNP
rs944261740 421 dbSNP
rs538808869 426 dbSNP
rs1170294180 430 dbSNP
rs774725588 433 dbSNP
rs1191738738 435 dbSNP
rs1478345684 436 dbSNP
rs374377603 438 dbSNP
rs911481877 450 dbSNP
rs771228711 469 dbSNP
rs1464118721 485 dbSNP
rs1301705201 495 dbSNP
rs936378734 497 dbSNP
rs1389460618 505 dbSNP
rs1339666837 511 dbSNP
rs571483223 512 dbSNP
rs879374656 519 dbSNP
rs1232665845 521 dbSNP
rs1310315637 521 dbSNP
rs1002839339 525 dbSNP
rs1281178620 526 dbSNP
rs1239350026 528 dbSNP
rs549832369 533 dbSNP
rs1035138034 535 dbSNP
rs1188506699 537 dbSNP
rs763127665 538 dbSNP
rs1188599522 541 dbSNP
rs977898511 545 dbSNP
rs1207771408 546 dbSNP
rs966876439 547 dbSNP
rs1343452383 571 dbSNP
rs773483509 583 dbSNP
rs1291696137 585 dbSNP
rs1177390480 586 dbSNP
rs946861038 592 dbSNP
rs769863013 595 dbSNP
rs531335573 599 dbSNP
rs1431230268 604 dbSNP
rs1290369725 617 dbSNP
rs917735154 617 dbSNP
rs751617378 628 dbSNP
rs1365185982 631 dbSNP
rs1218625387 646 dbSNP
rs1304051568 651 dbSNP
rs992405253 652 dbSNP
rs567251801 659 dbSNP
rs1285598532 661 dbSNP
rs922234525 662 dbSNP
rs1218427484 664 dbSNP
rs1061988 667 dbSNP
rs532697532 672 dbSNP
rs1194872111 676 dbSNP
rs1001534079 685 dbSNP
rs952714619 686 dbSNP
rs1455200205 687 dbSNP
rs1026999356 688 dbSNP
rs1440982656 690 dbSNP
rs1379333126 700 dbSNP
rs1400972905 702 dbSNP
rs527301095 703 dbSNP
rs117186416 704 dbSNP
rs897232251 706 dbSNP
rs771997772 707 dbSNP
rs1008846310 708 dbSNP
rs11152 719 dbSNP
rs745824963 720 dbSNP
rs890033979 721 dbSNP
rs1444687222 731 dbSNP
rs1049989592 749 dbSNP
rs983951381 750 dbSNP
rs3742921 751 dbSNP
rs1321498791 757 dbSNP
rs1407082907 758 dbSNP
rs757049914 779 dbSNP
rs972533880 783 dbSNP
rs924921994 789 dbSNP
rs1416017731 805 dbSNP
rs545639781 806 dbSNP
rs1178531123 807 dbSNP
rs1472359405 809 dbSNP
rs777635083 810 dbSNP
rs917667151 811 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293 , HUVEC , MCF7
Location of target site CDS
Tools used in this research DIANA-microT , EIMMO , miRanda , miRBase Target Database , PicTar , TargetScan
Article - Fasanaro P; Greco S; Lorenzi M; Pescatori et al.
- The Journal of biological chemistry, 2009
miR-210 is a key player of cell response to hypoxia, modulating cell survival, VEGF-driven endothelial cell migration, and the ability of endothelial cells to form capillary-like structures. A crucial step in understanding microRNA (miRNA) function is the identification of their targets. However, only few miR-210 targets have been identified to date. Here, we describe an integrated strategy for large-scale identification of new miR-210 targets by combining transcriptomics and proteomics with bioinformatic approaches. To experimentally validate candidate targets, the RNA-induced silencing complex (RISC) loaded with miR-210 was purified by immunoprecipitation along with its mRNA targets. The complex was significantly enriched in mRNAs of 31 candidate targets, such as BDNF, GPD1L, ISCU, NCAM, and the non-coding RNA Xist. A subset of the newly identified targets was further confirmed by 3'-untranslated region (UTR) reporter assays, and hypoxia induced down-modulation of their expression was rescued blocking miR-210, providing support for the approach validity. In the case of 9 targets, such as PTPN1 and P4HB, miR-210 seed-pairing sequences localized in the coding sequence or in the 5'-UTR, in line with recent data extending miRNA targeting beyond the "classic" 3'-UTR recognition. Finally, Gene Ontology analysis of the targets highlights known miR-210 impact on cell cycle regulation and differentiation, and predicts a new role of this miRNA in RNA processing, DNA binding, development, membrane trafficking, and amino acid catabolism. Given the complexity of miRNA actions, we view such a multiprong approach as useful to adequately describe the multiple pathways regulated by miR-210 during physiopathological processes.
LinkOut: [PMID: 19826008]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC 0.285 0.02 0.287 0.02 49 Click to see details
LUAD 0.467 0.06 0.434 0.08 12 Click to see details
PAAD 0.86 0.07 0.800 0.1 4 Click to see details
KICH 0.289 0.08 0.225 0.14 25 Click to see details
STAD 0.246 0.09 0.173 0.17 32 Click to see details
UCEC 0.304 0.1 0.349 0.07 19 Click to see details
ESCA 0.387 0.12 -0.055 0.44 11 Click to see details
COAD -0.456 0.13 -0.286 0.25 8 Click to see details
PRAD 0.129 0.19 -0.009 0.48 50 Click to see details
THCA 0.045 0.37 0.097 0.23 59 Click to see details
HNSC 0.046 0.39 -0.129 0.21 42 Click to see details
PCPG 0.345 0.39 0.500 0.33 3 Click to see details
CESC -0.306 0.4 -0.500 0.33 3 Click to see details
BRCA 0.025 0.41 0.022 0.42 84 Click to see details
LUSC 0.028 0.43 -0.023 0.45 38 Click to see details
KIRC 0.013 0.46 0.005 0.48 68 Click to see details
CHOL 0.035 0.46 -0.100 0.4 9 Click to see details
BLCA 0.008 0.49 -0.100 0.35 18 Click to see details
KIRP 0.001 0.5 0.009 0.48 32 Click to see details
KIRP 0.001 0.5 0.009 0.48 32 Click to see details
KIRP 0.001 0.5 0.009 0.48 32 Click to see details
126 hsa-miR-210-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000149 HOXA9 homeobox A9 4 1
MIRT000150 TP53I11 tumor protein p53 inducible protein 11 2 1
MIRT000151 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 2 1
MIRT000152 HOXA1 homeobox A1 2 1
MIRT000153 FGFRL1 fibroblast growth factor receptor like 1 6 3
MIRT000156 RAD52 RAD52 homolog, DNA repair protein 5 3
MIRT001930 NPTX1 neuronal pentraxin 1 3 2
MIRT002024 EFNA3 ephrin A3 8 8
MIRT003153 BDNF brain derived neurotrophic factor 5 1
MIRT003154 PTPN1 protein tyrosine phosphatase, non-receptor type 1 5 1
MIRT003155 P4HB prolyl 4-hydroxylase subunit beta 6 2
MIRT003156 UBQLN1 ubiquilin 1 3 1
MIRT003157 SERTAD2 SERTA domain containing 2 3 1
MIRT003158 SEH1L SEH1 like nucleoporin 3 1
MIRT003159 NCAM1 neural cell adhesion molecule 1 4 1
MIRT003160 MID1IP1 MID1 interacting protein 1 3 1
MIRT003161 MDGA1 MAM domain containing glycosylphosphatidylinositol anchor 1 3 1
MIRT003162 KIAA1161 myogenesis regulating glycosidase (putative) 3 1
MIRT003163 ISCU iron-sulfur cluster assembly enzyme 6 7
MIRT003164 HOXA3 homeobox A3 3 1
MIRT003165 GPD1L glycerol-3-phosphate dehydrogenase 1 like 7 2
MIRT003166 DENND6A DENN domain containing 6A 3 1
MIRT003167 CPEB2 cytoplasmic polyadenylation element binding protein 2 5 1
MIRT003168 CDK10 cyclin dependent kinase 10 3 1
MIRT003169 ABCB9 ATP binding cassette subfamily B member 9 3 1
MIRT003170 CBX1 chromobox 1 3 1
MIRT003171 XIST X inactive specific transcript (non-protein coding) 4 1
MIRT003172 TNPO1 transportin 1 3 1
MIRT003173 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 3 1
MIRT003174 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 3 1
MIRT003175 NIPBL NIPBL, cohesin loading factor 3 1
MIRT003176 MIB1 mindbomb E3 ubiquitin protein ligase 1 3 1
MIRT003177 HECTD1 HECT domain E3 ubiquitin protein ligase 1 3 1
MIRT003178 ELK3 ELK3, ETS transcription factor 3 1
MIRT003179 DDAH1 dimethylarginine dimethylaminohydrolase 1 4 1
MIRT003180 CLASP2 cytoplasmic linker associated protein 2 3 1
MIRT003181 CHD9 chromodomain helicase DNA binding protein 9 3 1
MIRT003182 ATP11C ATPase phospholipid transporting 11C 3 1
MIRT003183 APC APC, WNT signaling pathway regulator 3 1
MIRT003184 E2F3 E2F transcription factor 3 7 5
MIRT003185 ACVR1B activin A receptor type 1B 2 1
MIRT003916 MRE11A MRE11 homolog, double strand break repair nuclease 2 1
MIRT003917 XPA XPA, DNA damage recognition and repair factor 2 1
MIRT004672 MNT MAX network transcriptional repressor 4 2
MIRT006326 AIFM3 apoptosis inducing factor, mitochondria associated 3 3 2
MIRT006519 CASP8AP2 caspase 8 associated protein 2 4 1
MIRT006663 VMP1 vacuole membrane protein 1 3 2
MIRT006830 TFRC transferrin receptor 3 2
MIRT047002 PFDN2 prefoldin subunit 2 1 1
MIRT047003 U2AF2 U2 small nuclear RNA auxiliary factor 2 1 1
MIRT047004 UBA1 ubiquitin like modifier activating enzyme 1 1 1
MIRT047005 ESPL1 extra spindle pole bodies like 1, separase 1 1
MIRT047006 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT047007 SCN1B sodium voltage-gated channel beta subunit 1 1 1
MIRT047008 RCC2 regulator of chromosome condensation 2 1 1
MIRT053179 HSD17B1 hydroxysteroid 17-beta dehydrogenase 1 2 1
MIRT054098 NDUFA4 NDUFA4, mitochondrial complex associated 4 2
MIRT054099 SDHD succinate dehydrogenase complex subunit D 6 4
MIRT054141 STMN1 stathmin 1 3 1
MIRT054142 DIMT1L DIM1 dimethyladenosine transferase 1 homolog 4 2
MIRT054186 ROD1 polypyrimidine tract binding protein 3 3 1
MIRT054203 ALDH5A1 aldehyde dehydrogenase 5 family member A1 4 1
MIRT054204 FOXN3 forkhead box N3 5 2
MIRT054205 MCM3 minichromosome maintenance complex component 3 4 1
MIRT054206 IGFBP3 insulin like growth factor binding protein 3 6 2
MIRT054207 COL4A2 collagen type IV alpha 2 chain 6 2
MIRT054208 INPP5A inositol polyphosphate-5-phosphatase A 4 1
MIRT054209 EHD2 EH domain containing 2 4 1
MIRT054210 SH3BGRL SH3 domain binding glutamate rich protein like 5 2
MIRT054248 PTPN2 protein tyrosine phosphatase, non-receptor type 2 3 1
MIRT054321 LDHA lactate dehydrogenase A 2 1
MIRT054324 LDHB lactate dehydrogenase B 2 1
MIRT054349 HIF1A hypoxia inducible factor 1 alpha subunit 5 2
MIRT054714 FOXP3 forkhead box P3 3 1
MIRT054794 HIF3A hypoxia inducible factor 3 alpha subunit 3 1
MIRT115688 MGRN1 mahogunin ring finger 1 2 3
MIRT170674 INSIG1 insulin induced gene 1 1 1
MIRT437785 BNIP3 BCL2 interacting protein 3 5 2
MIRT438739 KCMF1 potassium channel modulatory factor 1 1 1
MIRT439407 TNPO3 transportin 3 1 1
MIRT439629 SIPA1L3 signal induced proliferation associated 1 like 3 1 1
MIRT439632 SIN3A SIN3 transcription regulator family member A 1 1
MIRT439740 RPL22 ribosomal protein L22 1 1
MIRT439886 PSAP prosaposin 1 1
MIRT439918 PPP1R2 protein phosphatase 1 regulatory inhibitor subunit 2 1 1
MIRT439928 POU2AF1 POU class 2 associating factor 1 1 1
MIRT440033 ICMT isoprenylcysteine carboxyl methyltransferase 2 3
MIRT440255 MEF2D myocyte enhancer factor 2D 1 1
MIRT440491 HMGCS1 3-hydroxy-3-methylglutaryl-CoA synthase 1 2 3
MIRT440570 GIT2 GIT ArfGAP 2 1 1
MIRT440647 FCHSD2 FCH and double SH3 domains 2 1 1
MIRT440830 DEAF1 DEAF1, transcription factor 1 1
MIRT440866 CSNK1E casein kinase 1 epsilon 1 1
MIRT472232 NFIC nuclear factor I C 2 2
MIRT473190 MITF melanogenesis associated transcription factor 2 2
MIRT477856 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 2 2
MIRT497528 ZNF607 zinc finger protein 607 2 2
MIRT509770 SERTM1 serine rich and transmembrane domain containing 1 2 6
MIRT524407 CNTNAP5 contactin associated protein like 5 2 4
MIRT535209 PKIA cAMP-dependent protein kinase inhibitor alpha 2 4
MIRT554511 RUNX1T1 RUNX1 translocation partner 1 2 4
MIRT558069 ESCO2 establishment of sister chromatid cohesion N-acetyltransferase 2 2 2
MIRT572273 KCNJ6 potassium voltage-gated channel subfamily J member 6 2 2
MIRT574255 DOCK7 dedicator of cytokinesis 7 2 4
MIRT575621 Foxn3 forkhead box N3 2 2
MIRT575742 Zfp618 zinc finger protein 618 1 1
MIRT609050 VAMP4 vesicle associated membrane protein 4 2 2
MIRT611143 TNRC6B trinucleotide repeat containing 6B 2 4
MIRT699226 SLCO3A1 solute carrier organic anion transporter family member 3A1 2 2
MIRT703060 GTDC1 glycosyltransferase like domain containing 1 2 2
MIRT716005 ASB11 ankyrin repeat and SOCS box containing 11 2 2
MIRT731682 BTK Bruton tyrosine kinase 3 1
MIRT733090 DLEU2L deleted in lymphocytic leukemia 2-like 3 0
MIRT733091 BRCA2 BRCA2, DNA repair associated 3 0
MIRT733156 ITGA5 integrin subunit alpha 5 1 0
MIRT733501 GATA1 GATA binding protein 1 3 0
MIRT733503 SMAD2 SMAD family member 2 3 0
MIRT733525 MIR210HG MIR210 host gene 2 0
MIRT733615 TGFBI transforming growth factor beta induced 2 0
MIRT734175 KRAS KRAS proto-oncogene, GTPase 2 0
MIRT734293 PTEN phosphatase and tensin homolog 1 0
MIRT734568 STAT6 signal transducer and activator of transcription 6 1 0
MIRT734966 ADAMTS6 ADAM metallopeptidase with thrombospondin type 1 motif 6 1 0
MIRT736294 ID2 inhibitor of DNA binding 2, HLH protein 1 0
MIRT737104 FABP4 fatty acid binding protein 4, adipocyte 3 0
MIRT756028 NTN4 netrin 4 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-210 Vincristine approved 5978 Quantitative real-time PCR Hep-2 cells 23780424 2013 up-regualted
miR-210 Lenalidomide approved 216326 Quantitative real-time PCR peripheral blood CD14+ monocytes 25287904 2014 down-regulated
miR-210 Arsenic trioxide approved 14888 Microarray lymphoblast cell line TK-6 17108120 2006 down-regulated
miR-210 5-Fluorouracil approved 3385 Quantitative real-time PCR colon cancer cells 17702597 2007 down-regulated
miR-210 Arsenic trioxide approved 14888 Microarray HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-210 Arsenic trioxide approved 14888 Quantitative real-time PCR HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-210 Arsenic trioxide approved 14888 Quantitative real-time PCR HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-210 Ginsenoside Rh2 NULL 119307 Microarray human glioma cells U251 21372826 2011 down-regulated
miR-210 Aidi injection NULL NULL Microarray human breast cancer cells 21563499 2011 down-regulated
miR-210 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer HB2 22076154 2011 down-regulated
miR-210 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer MDA-MB231 22076154 2011 down-regulated
miR-210 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer SKBR3 22076154 2011 down-regulated
miR-210 Trastuzumab approved NULL Microarray HER2-positive breast cancer 22384020 2012 down-regulated
miR-210 Trastuzumab approved NULL Quantitative real-time PCR HER2-positive breast cancer 22384020 2012 down-regulated
miR-210 Trastuzumab approved NULL Microarray BT474 cells 22384020 2012 down-regulated
miR-210 Curcumin NULL 969516 Quantitative real-time PCR Y79 RB cells. 22510010 2012 down-regulated
miR-210 Bicalutamide approved 2375 Microarray prostate 22674191 2012 down-regulated
miR-210 Goserelin approved 47725 Microarray prostate 22674191 2012 down-regulated
miR-210 Olea europaea leaf extract NULL NULL Quantitative real-time PCR glioblastoma cells. 22722712 2012 up-regulated
miR-210 Temozolomide approved 5394 Quantitative real-time PCR glioblastoma cells. 22722712 2012 up-regulated
miR-210 Nicotine approved 89594 Microarray Rat adrenal pheochromocytoma PC12 cell 18845019 2009 down-regulated
miR-210 Comfrey NULL 6440495 Microarray rat liver 21370286 2011 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-210 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-mir-210 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-210 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-210 Paclitaxel 36314 NSC125973 approved resistant cell line (W1)
hsa-mir-210 Androstenedione 6128 NSC9563 sensitive cell line (MCF-7)
hsa-mir-210 Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-210 Tamoxifen 2733525 NSC180973 approved resistant tissue (ER-positive breast cancer)
hsa-mir-210 Fluorouracil 3385 NSC19893 approved sensitive cell line (OE19)
hsa-mir-210 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-mir-210 Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)
hsa-miR-210-3p (E)-1-[3,5-bis[(dimethylamino)methyl]-4-hydroxyphenyl]-3-phenylprop-2-en-1-one 6374691 NSC677784 resistant
hsa-miR-210-3p (e)-3-chloro-3-(4-methoxyphenyl)-2-(4-nitrophenyl)prop-2-enal 5387396 NSC623175 resistant
hsa-miR-210-3p [(E)-(1-chloro-2-methylpropylidene)amino] N-anilinocarbamate 5494354 NSC682841 resistant
hsa-miR-210-3p [(E)-1-chloropropylideneamino] N-[2-(trifluoromethoxy)phenyl]carbamate 5466266 NSC682836 resistant
hsa-miR-210-3p [2-[(e)-(carbamothioylhydrazono)methyl]-6-methoxy-phenoxy]-hydroxy-copper; 2-(2-pyridyl)pyridine 135484845 NSC638302 resistant
hsa-miR-210-3p 1-(4-ethoxyphenyl)-3-(2-methyl-5-propan-2-ylphenyl)urea 240168 NSC46213 sensitive
hsa-miR-210-3p 1-(4-nitrophenyl)-3-(2-pyridyl)thiourea 3005383 NSC695329 sensitive
hsa-miR-210-3p 1-(naphthalen-1-ylmethyl)-4-[1-(naphthalen-1-ylmethyl)piperidin-4-yl]piperidine 364095 NSC669995 resistant
hsa-miR-210-3p 1-[2-(4-nitrophenyl)-2-oxoethyl]-4-pentylpyridin-1-ium bromide 24181037 NSC4290 resistant
hsa-miR-210-3p 11-(3-methoxyphenyl)-2,12,15-triazapentacyclo[11.7.1.03,8.09,21.014,19]henicosa-1,3,5,7,9,11,13(21),14(19),15,17-decaen-20-one 54608964 NSC697747 resistant
hsa-miR-210-3p 17-acetyl-9,14-dihydroxy-16-methyl-15-(4-methylphenyl)-15-azatetracyclo[8.7.0.01,14.03,8]heptadeca-3,5,7,9,12,16-hexaene-2,11-dione 405612 NSC722982 resistant
hsa-miR-210-3p 1h-benz[g]indol-5-ol, 2-phenyl 371327 NSC645431 resistant
hsa-miR-210-3p 2-[[4-anilino-5-[8-[4-anilino-5-[(1-hydroxynaphthalen-2-yl)oxymethyl]-1,2,4-triazol-3-yl]octyl]-1,2,4-triazol-3-yl]methoxy]naphthalen-1-ol 394049 NSC697167 resistant
hsa-miR-210-3p 2-[9-[(7-oxocyclohepta-1,3,5-trien-1-yl)amino]nonylamino]cyclohepta-2,4,6-trien-1-one 358331 NSC618296 resistant
hsa-miR-210-3p 2-amino-5,8-dihydroxy-1,4-naphthoquinone 377209 NSC658441 resistant
hsa-miR-210-3p 2-bromo-4-(5-fluoro-1,3-benzothiazol-2-yl)aniline 399248 NSC709925 sensitive
hsa-miR-210-3p 2-hydroxy-5-({(e)-[(10-hydroxyacridin-9(10h)-ylidene)methyl]diazenyl}sulfonyl)benzoic acid 363212 NSC627890 resistant
hsa-miR-210-3p 3'-chloro-3-nitro-o-salicylotoluidide 332278 NSC328477 resistant
hsa-miR-210-3p 3-((4-(methylthio)phenoxy)methyl)-2-oxiranol 366923 NSC636087 resistant
hsa-miR-210-3p 4-(2-phenylethylamino)naphthalene-1,2-dione 367789 NSC637731 resistant
hsa-miR-210-3p 4-[(E)-2-piperidin-1-ylethenyl]benzo[g]quinoline-5,10-dione 5781544 NSC642968 resistant
hsa-miR-210-3p 4-[(r)-[(2s,5r)-2,5-dimethyl-4-prop-2-enylpiperazin-1-yl]-(3-methoxyphenyl)methyl]-n-pentan-3-ylbenzamide;hydrochloride 5471112 NSC708822 resistant
hsa-miR-210-3p 4-[2-(methylamino)-1-methylsulfanylethyl]benzene-1,2-diol 412349 NSC39215 resistant
hsa-miR-210-3p 4-[4-(4-sulfinobutyldisulfanyl)butyldisulfanyl]butane-1-sulfinic acid 361262 NSC624205 resistant
hsa-miR-210-3p 4-acetamido-n-[(e)-(2,4-dichlorophenyl)methylideneamino]-2-methoxybenzamide 9572428 NSC716142 sensitive
hsa-miR-210-3p 4-aminodithiolane-4-carboxylic acid 269217 NSC109825 resistant
hsa-miR-210-3p 4-hydroxy-3-[1-(1-hydroxy-3,4-dioxonaphthalen-2-yl)-3-phenylpropyl]naphthalene-1,2-dione 272651 NSC117274 resistant
hsa-miR-210-3p 4,4-dimethylspiro[1,3,2-oxazaphospholidin-2-ium-2,2'-3h-1,3,2-benzoxazaphosphol-2-ium]-5-one 6330525 NSC351866 resistant
hsa-miR-210-3p 4b-hydroxy-10,10-dimethoxy-9ah-indeno[1,2-a]inden-9-one 363252 NSC628000 resistant
hsa-miR-210-3p 4h,7h-furo[2',3',4':4,5]naphth[2,1-e][1,3]oxazin-4-one, 8-(4-chlorophenyl)-8,9-dihydro- 373969 NSC651001 resistant
hsa-miR-210-3p 5,6,7-trimethoxy-N-(4H-pyrazolo[1,5-a]indol-2-yl)-1H-indole-2-carboxamide 404173 NSC720326 resistant
hsa-miR-210-3p 6-(3-chloropropyl)-3-nitroindeno[1,2-c]isoquinoline-5,11-dione 17755848 NSC731154 resistant
hsa-miR-210-3p 6-benzyloxyhexanal 389877 NSC686505 resistant
hsa-miR-210-3p 7-[(E)-2-(1,6-dimethylquinolin-1-ium-2-yl)ethenyl]-5-methylquinolin-8-ol 135483953 NSC86371 resistant
hsa-miR-210-3p 7-[(naphthalen-1-ylamino)(phenyl)methyl]quinolin-8-ol 256754 NSC84092 resistant
hsa-miR-210-3p 7-chloro-6-n-(2-fluoroethylamino)-5,8-quinolinedione 379079 NSC663286 resistant
hsa-miR-210-3p 7-o,8-o-isopropylidene iriomoteolide 3a 24808220 NSC753164 resistant
hsa-miR-210-3p 9h-quino[4,3,2-de][1,10]phenanthrolin-9-one, 2-phenyl- 4567749 NSC686553 resistant
hsa-miR-210-3p Acetyltrophanthidin 261075 NSC92954 resistant
hsa-miR-210-3p Adenosine, 2-bromo-2'-deoxy- 334838 NSC341936 resistant
hsa-miR-210-3p Asimicinone 393461 NSC695394 resistant
hsa-miR-210-3p Benzo[b]naphtho[2,3-d]furan-6,11-dione, 4-chloro-3-hydroxy 371025 NSC644902 resistant
hsa-miR-210-3p Benzo[g]pteridine-2,4(3h,10h)-dione, 10-(2,4-dimethylphenyl)-3-methyl- 363228 NSC627974 resistant
hsa-miR-210-3p Benzo[g]pteridine-2,4(3h,10h)-dione, 10-(4-chlorophenyl)-3,7,8-trimethyl- 363246 NSC627992 resistant
hsa-miR-210-3p Benzo[g]pteridine-2,4(3h,10h)-dione, 3-methyl-10-[3-(methylthio)phenyl]- 363242 NSC627988 resistant
hsa-miR-210-3p Benzo[g]quinoxaline-5,10-dione, 5,10-dihydro-2,3-dimethyl- 353644 NSC602617 resistant
hsa-miR-210-3p Celcot rm 67277 NSC37168 resistant
hsa-miR-210-3p Cytarabine 6253 NSC287459 approved resistant
hsa-miR-210-3p Destruxin a 122810 NSC361126 resistant
hsa-miR-210-3p Di-p-tolyliodinium bromide 54601177 NSC8985 resistant
hsa-miR-210-3p Diethoxybis(1,4-naphthochinone-2-olato)titanium(iv) 368297 NSC638842 resistant
hsa-miR-210-3p Dihydrorotenone 243725 NSC53866 resistant
hsa-miR-210-3p Diisopropoxybis(1,4-naphthochinone-2-olato)titanium(iv) 368058 NSC638383 resistant
hsa-miR-210-3p Discorhabdin i 135409047 NSC656206 resistant
hsa-miR-210-3p Dpbq 364074 NSC629713 resistant
hsa-miR-210-3p Ethyl 6-chloro-4-phenyl-2-(piperazin-1-ylmethyl)quinoline-3-carboxylate 369623 NSC641536 resistant
hsa-miR-210-3p Ethyl 6-hydroxy-4-(4-methoxyphenyl)-6-methyl-3-oxo-2-phenyl-1,4,5,7-tetrahydroindazole-5-carboxylate 392845 NSC693857 resistant
hsa-miR-210-3p Gnmlngdfmleynr-uhfffaoysa-n 402862 NSC717147 sensitive
hsa-miR-210-3p Gw612286x 9822610 NSC756278 sensitive
hsa-miR-210-3p Gw811761x 6539382 NSC756375 sensitive
hsa-miR-210-3p Herbimycin 6436247 NSC305978 resistant
hsa-miR-210-3p Hypothemycin 5458809 NSC354462 resistant
hsa-miR-210-3p Indole-2,3-dione, 5-methyl-, 3-[(o-nitrophenyl)hydrazone] 3632950 NSC117915 sensitive
hsa-miR-210-3p J3.572.907k 396709 NSC703318 resistant
hsa-miR-210-3p Methyl 10-acetyl-3-(4-methylphenyl)sulfonyl-9-(2-methylprop-1-enyl)-3,10-diazatricyclo[6.4.1.04,13]trideca-1,4,6,8(13),11-pentaene-11-carboxylate NSC621968 resistant
hsa-miR-210-3p Methyl 8-[(4-chlorophenyl)carbamoyl]naphthalene-1-carboxylate 364289 NSC630307 resistant
hsa-miR-210-3p N-(2-morpholin-4-ylethyl)-5-nitroquinolin-4-amine;hydrochloride 372042 NSC646859 resistant
hsa-miR-210-3p N-(3-chloro-1,4-dioxonaphthalen-2-yl)-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1H-2-benzofuran-1-yl)butanamide 369463 NSC641233 resistant
hsa-miR-210-3p N-(3,5-dicyano-2-(4-methylphenyl)-6-oxo-4-phenyl-1(6h)-pyridinyl)-4-methylbenzenesulfonamide 390286 NSC687578 resistant
hsa-miR-210-3p N-[(1E)-1-(1-hydroxypyridin-2-ylidene)ethyl]iminoazepane-1-carbothioamide 5369124 NSC351075 resistant
hsa-miR-210-3p N-[1,1,1,3,3,3-hexafluoro-2-(4-fluoroanilino)propan-2-yl]butanamide 389152 NSC684836 resistant
hsa-miR-210-3p Naphtho[2,3-d]-1,3-dioxepin-6,11-dione, 4-methyl- NSC626868 resistant
hsa-miR-210-3p Naphtho[2,3-d]oxazole-4,9-dione, 2-(1,1-dimethylethyl)- 370622 NSC643915 resistant
hsa-miR-210-3p Niosh/br9826000 359483 NSC620462 resistant
hsa-miR-210-3p NSC619321 NSC619321 sensitive
hsa-miR-210-3p NSC621321 NSC621321 resistant
hsa-miR-210-3p NSC631451 NSC631451 resistant
hsa-miR-210-3p NSC634766 NSC634766 resistant
hsa-miR-210-3p NSC635414 NSC635414 resistant
hsa-miR-210-3p Pentyl 6-(chloromethyl)-2-oxo-2h-chromene-3-carboxylate 402498 NSC716524 resistant
hsa-miR-210-3p Pmp (van) 72508 NSC1906 resistant
hsa-miR-210-3p Scillirosidin, glycoside 222160 NSC7534 resistant
hsa-miR-210-3p Sesbanimide 163490 NSC355461 resistant
hsa-miR-210-3p Snc 80 123924 NSC707484 resistant
hsa-miR-210-3p Streptovaricin b 135443622 NSC156215 resistant
hsa-miR-210-3p Tetratert-butyl 8,11-dimethoxytricyclo[4.3.3.01,6]dodeca-7,10-diene-7,9,10,12-tetracarboxylate 362411 NSC626176 resistant
hsa-miR-210-3p Tolonium chloride 7083 NSC36758 resistant
hsa-miR-210-3p Z48861686 4784054 NSC745813 resistant
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Temozolomide 5394 NSC362856 approved resistant High Glioblastoma cell line (U251MG, U251R, U87MG, M059K, M059J)
hsa-miR-210-3p Imatinib 5291 NSC743414 approved resistant High Myelogenous Leukemia cell line (MYL)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colon Cancer cell line (HT-29)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colon Cancer cell line (HT-29)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant High Ehrlich Ascites Tumor cell line (EHR2,P6, P12, P36, P72, EHR2/1.3)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant High Ehrlich Ascites Tumor cell line (EHR2,P6, P12, P36, P72, EHR2/1.3)
hsa-miR-210-3p Trastuzumab resistant Low Breast Cancer tissue and cell line (BT-474, BTR65)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Vincristine 5978 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant Low Cervical Cancer tissue and cell line (SiHa, Cask)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant High Laryngeal Cancer cell line (Hep2)
hsa-miR-210-3p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-210-3p Docetaxel 148124 NSC628503 approved resistant High Prostate Cancer cell line (DU-145)
hsa-miR-210-3p Asparaginate 5460875 sensitive Low Pediatric Acute Lymphoblastic Leukemia Reh cells
hsa-miR-210-3p Dexamethasone 5743 NSC34521 approved sensitive Low Pediatric Acute Lymphoblastic Leukemia Reh cells
hsa-miR-210-3p Daunorubicin 30323 NSC82151 approved sensitive Low Pediatric Acute Lymphoblastic Leukemia Reh cells
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved sensitive High Esophageal Adenocarcinoma cell line (OE19)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant High Hepatocellular Carcinoma tissue and cell line (HepG2)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (SW1990)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (SW1990)
hsa-miR-210-3p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR20)
hsa-miR-210-3p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR70)
hsa-miR-210-3p Dexamethasone 5743 NSC34521 approved sensitive High Myeloma cell line (MM1R, MM1S)
hsa-miR-210-3p Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-210-3p Daunorubicin 30323 NSC82151 approved sensitive High Acute Myeloid Leukemia cell line (U-937, KG-1)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Ductal Adenocarcinoma cell line (MIA-PaCa-2)
hsa-miR-210-3p Trametinib 11707110 NSC758246 approved sensitive Low Melanoma cell line (MML-1)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-miR-210-3p Tamoxifen 2733525 NSC180973 approved resistant Low Breast Cancer cell line (TAMR4, TAMR8)
hsa-miR-210-3p Aromatase Inhibitor sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Epirubicin 41867 NSC256942 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-210-3p Docetaxel 148124 NSC628503 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-210-3p Vinorelbine 44424639 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-210-3p 1'-Acetoxychavicol acetate 119104 NSC711510 resistant Low Cervical Cancer cell line (Ca Ski, SiHa)
hsa-miR-210-3p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-210-3p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive Low Renal Cell Cancer cell line (Caki-2)
hsa-miR-210-3p Vinblastine 442111 NSC90636 approved sensitive Low Renal Cell Cancer cell line (Caki-2)
hsa-miR-210-3p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colorectal Cancer cell line (LS174T)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Cholangiocarcinoma cell line (KKU-213, KKU-055, KKU-100)
hsa-miR-210-3p Docetaxel 148124 NSC628503 approved resistant Low Breast Cancer tissue
hsa-miR-210-3p Palbociclib 5330286 NSC758247 approved sensitive High Breast Cancer cell line (T47D)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive High Ovarian Cancer cell line (SKOV3)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer cell line (SKOV3)
hsa-miR-210-3p Cetuximab + Folfox(Fluorouracil + Leucovorin + Oxaliplatin) sensitive High Metastatic Colorectal Cancer tissue
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved sensitive Low Colorectal Cancer cell line (HT-29)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Cancer cell line (BXPC-3)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colorectal Adenocarcinoma cell line (HT-29)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Cancer cell line (PANC-1)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant Low Oral Cancer cell line (SAS, HSC-3, HSC-4)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive High Endometrial Serous Carcinoma cell line (USPC1)
hsa-miR-210-3p Imatinib 5291 NSC743414 approved sensitive Low Chronic Myelogenous Leukemia tissue
hsa-miR-210-3p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375)
hsa-miR-210-3p Sunitinib 5329102 NSC750690 approved resistant Low Renal Cell Cancer tissue
hsa-miR-210-3p Temozolomide 5394 NSC362856 approved resistant Low Glioma cell line (U87)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-210-3p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (PLC/PRF5-R1, PLC/PRF5-R2, PLC/PRF5)
hsa-miR-210-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (A375)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (total RNA)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (mitochondrial RNA)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (HeyA8)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM11)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM43)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant cell line (BAS)
hsa-miR-210-3p Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-210-3p Exemestane 60198 NSC713563 approved resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone 6013 NSC9700 approved resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Exemestane resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Letrozole resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Anastrozole resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Tamoxifen resistant cell line (MCF-7)
hsa-miR-210-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-210-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-210-3p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-210-3p Tamoxifen 2733525 NSC180973 approved resistant cell line (TamR4)
hsa-miR-210-3p Tamoxifen 2733525 NSC180973 approved resistant cell line (TamR8)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR20)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR200)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR70)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-210-3p Bortezomib 387447 NSC681239 approved sensitive cell line (CCRF-CEM) (100 nM)
hsa-miR-210-3p Bortezomib 387447 NSC681239 approved sensitive cell line (CCRF-CEM) (200 nM)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (Panc1-GR1)
hsa-miR-210-3p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line (H23)
hsa-miR-210-3p Cetuximab sensitive tissue (colorectal carcinoma)

Error report submission