pre-miRNA Information
pre-miRNA hsa-mir-210   
Genomic Coordinates chr11: 568089 - 568198
Synonyms MIRN210, mir-210, MIR210
Description Homo sapiens miR-210 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-210-3p
Sequence 66| CUGUGCGUGUGACAGCGGCUGA |87
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 12 11 - 568122 25582055 MiREDiBase
A-to-I 14 11 - 568120 26028588 MiREDiBase
C-to-U 1 11 - 568133 26209130 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs753825152 1 dbSNP
rs759616365 3 dbSNP
rs1247955373 6 dbSNP
rs558661304 9 dbSNP
rs1490451308 13 dbSNP
rs1344162213 14 dbSNP
rs745930382 15 dbSNP
rs1220183952 16 dbSNP
rs1355496181 17 dbSNP
rs1280245998 19 dbSNP
rs781628850 20 dbSNP
rs1241231800 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BX0CY6 miR-210 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Urine Quantitative real-time reverse transcription PCR
BX0CY6 miR-210 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Low Blood Reverse transcription-polymerase chain reaction
Gene Information
Gene Symbol ATP11C   
Synonyms ATPIG, ATPIQ
Description ATPase phospholipid transporting 11C
Transcript NM_173694   
Other Transcripts NM_001010986   
Expression
Putative miRNA Targets on ATP11C
3'UTR of ATP11C
(miRNA target sites are highlighted)
>ATP11C|NM_173694|3'UTR
   1 CAGAATCCGAATCTTGAACTGCCTATGTTATTGTCCTACAAGCATACTGACAGTGGTTACAGCTAAAAAAGAAAGCATGA
  81 AGAAACAACTACAAAAAGTTATCATCTCAGGATACTTGATATGCAACACACTAAACCACTCTCATGTCTAGAGTTCACAA
 161 TAAATGTTCATTAAAATACCAAATGATTCTCTTAAGCATTTACCATTATTGTAAGTAGCCTTTATGGCCAAAGCTGTAAG
 241 TTAAGAATTATATGAAAGTTGAAAGCAAGAATACTTAGAATTCTGGCTTTAGTTAGAGTAATATAACTCAAATGGGTGCT
 321 CTTTTAACCCATGAACTTTGTGAATGGATTTAAATACAATAGTATGAAGTAGAAGTTATGCAATGAGAATGAATAGATTT
 401 TGCTAATACTACTTTTTTTGCCTGGCAGAAGAAATAGACTATTTGGATCACATTTCTCATTCCTCCTAAATGATCATCTT
 481 AATTTTTTTTCCCAAGTACATAAGGAATACTTGAAAATACAGAATAACTAAATAGTATCAATGCATCAGACAGAATAGTT
 561 AATCCCTTCTGTTTACCCATGTGCTACTAATGTCTTGGTAGAATATTCTTGCCAAAAAAATACCTTGAACGCTTATGTGG
 641 AAAGTGTTAACTTACGGGTATTTTTGTGGGAATAGAAAAAAATTGTTTATTTTTTATTCTTCTGAATTAAACCCCACTTA
 721 TGGGTGTAAGCCTACTAGACTTGAAAATAAAGTATAAAACATTTCCAATCACTTAGTAGCCCCTCAAAGTAGTTAGAAAA
 801 TAAACAGATTTTTCCAGTGTTGATTTTACTGGGATCTGCAGTAAGGTGGTTTAAACCATAGTTATATAAAAATAAAGGTC
 881 ATTCTGAATATCAGCCTTTTATAATTTTATGTGAAGAGGAAGAAATATAGCTTATTTTAAACTTTTGACGGTTTTTATTT
 961 GAAAGAGATTGCATTTATGCATATATGCAGTGCTTTTTCTTAAACTTGGCCAATTTGGAAAGGGGGAAGGAGCCACCCCA
1041 AAACGGTGGTTCAGCTTGTAGAGCCATGACTCTGTGAAGATGAATGTTGTCTCTTAACTTGGACAGGGAAATGGTCTAAC
1121 TCTAAACCATGTAACTGACCTTAGTAAAGTCCTTGACTAACTGAACTAGAAGGAAGGTTTAGCCTTCTAATTAGTTCACT
1201 TGAAACATAAATGTGAAATGTCTTCATTCAATGTTAAACACATACTTTTTTGGATATAAATGACCATATTTATTTGACTG
1281 CTAGTTTTTTTGTTTTTTTTTTGTCTTTCTGGCATGCCTGTACTATTATTAATGTTTATATTGTACCTTGATTTGGAAAA
1361 GTATTGGAGTTAATCTGTATTATATTTATATAGTCCATATGGCACATTTGATTCTTCCACATATATTTTGTGTTAATGTT
1441 TAGGTATGATTTTTTTCTAAATTCTAGAAAAGAACATAATTTCAGTTATCAGAAGCCATTCCATCATTATAGACCCTTTT
1521 TCATTATTTCATTTGCTCTCATATATCAGTATTATTTTTGAGCATTTTGTTACATGTCATTCACAACTTACCTAAGTGTG
1601 CTGTGTTCTGGTAGCCCGTATTTGAGGTAAGCTGCTGAAAACAAAAGTCTCTATATTCTTTGCCTATTCCAAAGAGCTAA
1681 AAAAGTCTAACCCAGGAAAGCTTTTGATATTTTGTGTTTGTTTTCTTGTTCTTATGGTTGTTGTTGCTGTATTATGATTG
1761 CTGTTTTACATAAAATCTATGGGAACTGTGAATACAGACAAGAGAGCCACAGTAGAGAGGCTTGTTTAATGCAGTACCAT
1841 TGGAGAGTTAACAGAATAATCTAGTAGAAAAATAACTGGTTGCATGTAAAATTCCTTCCAGCCAGAAAGAAAGAAAGACA
1921 AGGAGTAAGGGGGATTTAGAGTTATGTCTCAGCTACACATTACATTGTGATACTGCAGCTCAAATTCAGAATGGCAATGA
2001 TACATGATATCATGGCCTAGATCCTTGAGAGGGACCTGGCTTTCCTTTTTAAAAGATATTTTACTGAAGAGCTAAAAACT
2081 GGCCAGTGTGGGGTTAGCAGATCGAATAACTTGAAATAGACCATGCAGTATTCCTAGCACTCAATGTAATCACCCTATTT
2161 GTGACAGAGAAAGGGAAAAAAATATAATAAGATCATCTACCTATAATTTGAATAATTTTGAGCTATCAAAATGTCTTTGT
2241 AATTTTCACAACCGCTGTCCATTGTTTGAGGATGTTACCTACTAAACTGAAAACATTCATTCCATATCTACTTACACATA
2321 CACCAGCAACAGTATAAATGTAAGCCTAACTTTGCAAAATTCGTAATAATTTAGTGATGGAATTTTTTAATAACATGCAG
2401 TATATAAATGTGCAGATTTTATGCGTGTTGACAAAATCATTTTTCAGCTTGCAAAATGGGACTGCAATATTACATTTTTC
2481 ACTTAAGCAGTTTTTTACATCTACGTTGTTGCTTTCTAAAATGAATGTGAATGCCATCTTTTATGACTGCAACTTGCCTT
2561 TTCCATTACAGAAATTTTTGTTTGATGTAATCAATAAACTTTGGTATGATATGATTGATAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' aguCGGCGACAG--UGUGCGUGUc 5'
             |:: :||||  ||| |||:| 
Target 5' tatGTTATTGTCCTACAAGCATAc 3'
24 - 47 117.00 -9.90
2
miRNA  3' agUCGGCGACAGU--GUGCGUGUc 5'
            ||   :|| ||  :|:|||:| 
Target 5' aaAGAGATTG-CATTTATGCATAt 3'
962 - 984 113.00 -8.10
3
miRNA  3' agUCGGCGACAGUGUGCGUGUc 5'
            | :|  |||:| || ||:| 
Target 5' tcATTCAATGTTAAACACATAc 3'
1224 - 1245 112.00 -9.50
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1454333473 10 dbSNP
rs751428363 12 dbSNP
rs1447556449 13 dbSNP
rs375104383 19 dbSNP
rs777554132 22 dbSNP
rs758137870 24 dbSNP
rs752422594 25 dbSNP
rs764777840 26 dbSNP
rs1273431786 42 dbSNP
rs758494464 43 dbSNP
rs1377413771 44 dbSNP
rs1346868524 54 dbSNP
rs750604730 59 dbSNP
rs1338485898 62 dbSNP
rs751637397 68 dbSNP
rs1288224387 78 dbSNP
rs1364475523 80 dbSNP
rs929877851 80 dbSNP
rs962852673 86 dbSNP
rs1305855624 111 dbSNP
rs1369105834 113 dbSNP
rs1233997376 115 dbSNP
rs1285459612 117 dbSNP
rs370517795 120 dbSNP
rs976539557 131 dbSNP
rs1214184451 170 dbSNP
rs965153510 189 dbSNP
rs1468499355 190 dbSNP
rs1194988348 196 dbSNP
rs1250718138 205 dbSNP
rs1453469858 229 dbSNP
rs1177567502 234 dbSNP
rs766507375 248 dbSNP
rs985144325 269 dbSNP
rs1158225706 272 dbSNP
rs1395173560 274 dbSNP
rs1282033629 275 dbSNP
rs957736932 277 dbSNP
rs758561719 281 dbSNP
rs762028075 290 dbSNP
rs1000476839 292 dbSNP
rs1409877487 297 dbSNP
rs2183251 306 dbSNP
rs1020507029 307 dbSNP
rs1280361272 312 dbSNP
rs1375906054 327 dbSNP
rs1390519457 357 dbSNP
rs1222443864 366 dbSNP
rs1306864482 371 dbSNP
rs1336158268 375 dbSNP
rs1014450585 382 dbSNP
rs1214992150 391 dbSNP
rs1270787825 396 dbSNP
rs1467644944 398 dbSNP
rs895947251 402 dbSNP
rs1055896031 407 dbSNP
rs1234278216 409 dbSNP
rs1468374999 416 dbSNP
rs764506628 419 dbSNP
rs1418463221 431 dbSNP
rs937400849 438 dbSNP
rs1173536185 461 dbSNP
rs1167183560 466 dbSNP
rs888493350 467 dbSNP
rs1404851625 473 dbSNP
rs1048856855 479 dbSNP
rs929937360 483 dbSNP
rs1356525219 485 dbSNP
rs761287767 487 dbSNP
rs1440428260 489 dbSNP
rs765474470 492 dbSNP
rs1356644441 499 dbSNP
rs1176400695 500 dbSNP
rs1291993649 501 dbSNP
rs1472955086 506 dbSNP
rs918511455 508 dbSNP
rs1214679739 511 dbSNP
rs1354981085 511 dbSNP
rs1274639987 512 dbSNP
rs1435771715 529 dbSNP
rs976614554 533 dbSNP
rs73579518 543 dbSNP
rs1437463682 545 dbSNP
rs911048059 547 dbSNP
rs1185630918 565 dbSNP
rs1256547672 579 dbSNP
rs1201986195 596 dbSNP
rs1472484207 600 dbSNP
rs985216353 604 dbSNP
rs771663260 613 dbSNP
rs958009585 618 dbSNP
rs767264494 630 dbSNP
rs925004099 631 dbSNP
rs1421885801 638 dbSNP
rs1408489788 639 dbSNP
rs899863007 644 dbSNP
rs1376384837 648 dbSNP
rs529524457 651 dbSNP
rs1054452282 658 dbSNP
rs966380845 662 dbSNP
rs1340444348 667 dbSNP
rs1430796975 668 dbSNP
rs1271493746 673 dbSNP
rs774086185 679 dbSNP
rs1227123031 686 dbSNP
rs1280609561 704 dbSNP
rs1229002387 713 dbSNP
rs1349721366 718 dbSNP
rs1020956598 729 dbSNP
rs770671453 736 dbSNP
rs1256679358 739 dbSNP
rs1447561521 742 dbSNP
rs1014478527 745 dbSNP
rs1243983923 752 dbSNP
rs779026582 752 dbSNP
rs1168143789 753 dbSNP
rs1237799071 756 dbSNP
rs749029558 759 dbSNP
rs777661436 761 dbSNP
rs960227582 766 dbSNP
rs1402105591 774 dbSNP
rs1401869552 782 dbSNP
rs1034512634 793 dbSNP
rs903689643 800 dbSNP
rs1324108943 828 dbSNP
rs1433738447 833 dbSNP
rs1042264344 836 dbSNP
rs755981281 843 dbSNP
rs5954351 851 dbSNP
rs1001643404 857 dbSNP
rs945204021 861 dbSNP
rs1255250363 863 dbSNP
rs186838494 867 dbSNP
rs1351306230 879 dbSNP
rs888515614 885 dbSNP
rs781139026 889 dbSNP
rs994593089 914 dbSNP
rs1398137339 922 dbSNP
rs1463569229 925 dbSNP
rs758406367 934 dbSNP
rs1253844332 949 dbSNP
rs1455793812 969 dbSNP
rs1404416418 973 dbSNP
rs1192144252 979 dbSNP
rs1377362537 980 dbSNP
rs1470722808 982 dbSNP
rs750516879 983 dbSNP
rs1040974962 985 dbSNP
rs1383474497 985 dbSNP
rs1326053163 986 dbSNP
rs1458239744 999 dbSNP
rs937666509 999 dbSNP
rs1414185316 1000 dbSNP
rs1156928551 1001 dbSNP
rs926300262 1003 dbSNP
rs1300170657 1006 dbSNP
rs1336077355 1016 dbSNP
rs182518337 1017 dbSNP
rs911078509 1019 dbSNP
rs1328459190 1028 dbSNP
rs1208175705 1032 dbSNP
rs192056329 1038 dbSNP
rs1459811913 1047 dbSNP
rs936490963 1059 dbSNP
rs139827769 1061 dbSNP
rs1015766395 1068 dbSNP
rs1184470838 1075 dbSNP
rs1410365725 1077 dbSNP
rs2772194 1085 dbSNP
rs1165001765 1091 dbSNP
rs764630612 1093 dbSNP
rs1265655326 1095 dbSNP
rs1419305424 1114 dbSNP
rs1459425343 1116 dbSNP
rs982938226 1121 dbSNP
rs955743369 1124 dbSNP
rs1204063758 1128 dbSNP
rs1326676048 1136 dbSNP
rs966784876 1137 dbSNP
rs149916177 1139 dbSNP
rs1324792552 1140 dbSNP
rs1285562912 1146 dbSNP
rs1242226673 1147 dbSNP
rs997531395 1149 dbSNP
rs1336971540 1167 dbSNP
rs1380960702 1186 dbSNP
rs773984622 1187 dbSNP
rs1242736263 1190 dbSNP
rs1265048917 1193 dbSNP
rs1481109180 1200 dbSNP
rs1436405797 1213 dbSNP
rs1197909020 1215 dbSNP
rs770571440 1220 dbSNP
rs1250148755 1224 dbSNP
rs2772193 1227 dbSNP
rs1316902066 1228 dbSNP
rs1260268750 1230 dbSNP
rs1421512408 1231 dbSNP
rs1400158136 1237 dbSNP
rs1163521115 1240 dbSNP
rs1373278650 1271 dbSNP
rs1463264421 1273 dbSNP
rs75047689 1287 dbSNP
rs1369660233 1302 dbSNP
rs1165208974 1304 dbSNP
rs899833581 1305 dbSNP
rs2772192 1308 dbSNP
rs1189013341 1321 dbSNP
rs952886293 1322 dbSNP
rs1229802190 1360 dbSNP
rs1027485771 1361 dbSNP
rs1000236055 1362 dbSNP
rs1341837913 1365 dbSNP
rs774069749 1405 dbSNP
rs1260203152 1408 dbSNP
rs373328296 1425 dbSNP
rs770456418 1434 dbSNP
rs897188069 1436 dbSNP
rs1240265983 1441 dbSNP
rs1186230125 1446 dbSNP
rs1389205417 1447 dbSNP
rs1435065297 1448 dbSNP
rs1175333622 1450 dbSNP
rs1357343706 1451 dbSNP
rs566096094 1456 dbSNP
rs772754617 1492 dbSNP
rs1289379175 1497 dbSNP
rs769566416 1516 dbSNP
rs1451674106 1523 dbSNP
rs945200191 1530 dbSNP
rs1008127786 1537 dbSNP
rs889716367 1545 dbSNP
rs769383013 1553 dbSNP
rs1235465103 1558 dbSNP
rs868845765 1560 dbSNP
rs1056363837 1562 dbSNP
rs1310815447 1570 dbSNP
rs1209962372 1572 dbSNP
rs1291435958 1588 dbSNP
rs936505123 1600 dbSNP
rs1486541078 1602 dbSNP
rs925105527 1617 dbSNP
rs141976557 1619 dbSNP
rs1454485404 1620 dbSNP
rs945141432 1623 dbSNP
rs937939454 1625 dbSNP
rs188285699 1635 dbSNP
rs991811083 1641 dbSNP
rs564960128 1642 dbSNP
rs1430718406 1648 dbSNP
rs937631656 1652 dbSNP
rs1331696311 1663 dbSNP
rs927548520 1692 dbSNP
rs980340133 1702 dbSNP
rs1325614380 1705 dbSNP
rs1038080665 1710 dbSNP
rs1346925816 1725 dbSNP
rs953027448 1726 dbSNP
rs768627976 1736 dbSNP
rs1318688796 1739 dbSNP
rs1422933220 1768 dbSNP
rs148170554 1786 dbSNP
rs941008319 1787 dbSNP
rs1276845214 1789 dbSNP
rs1365873744 1800 dbSNP
rs1219045974 1807 dbSNP
rs1169522802 1821 dbSNP
rs779113604 1825 dbSNP
rs961428884 1839 dbSNP
rs754933276 1848 dbSNP
rs1019630857 1865 dbSNP
rs908263251 1896 dbSNP
rs1319300113 1905 dbSNP
rs1008203407 1910 dbSNP
rs1417215120 1913 dbSNP
rs1267009631 1933 dbSNP
rs1185797612 1937 dbSNP
rs1468541268 1950 dbSNP
rs1215112001 1954 dbSNP
rs955550230 1958 dbSNP
rs1488012168 1962 dbSNP
rs1177619329 1963 dbSNP
rs1410053798 1964 dbSNP
rs922790802 1965 dbSNP
rs975685837 1980 dbSNP
rs1411262001 1986 dbSNP
rs1478316764 2008 dbSNP
rs746965992 2016 dbSNP
rs964303766 2018 dbSNP
rs1033228890 2021 dbSNP
rs1196675667 2024 dbSNP
rs1490057419 2030 dbSNP
rs1028205691 2041 dbSNP
rs757404757 2042 dbSNP
rs1352866689 2044 dbSNP
rs1227026594 2080 dbSNP
rs754030982 2080 dbSNP
rs780038763 2091 dbSNP
rs564621689 2093 dbSNP
rs1042203865 2094 dbSNP
rs1204950811 2100 dbSNP
rs1020341842 2107 dbSNP
rs1481957088 2113 dbSNP
rs1346366012 2124 dbSNP
rs1181298541 2134 dbSNP
rs1258171627 2138 dbSNP
rs184127650 2147 dbSNP
rs753165389 2148 dbSNP
rs768110547 2149 dbSNP
rs1345014981 2150 dbSNP
rs2805902 2151 dbSNP
rs1372736916 2152 dbSNP
rs1408412298 2155 dbSNP
rs191845725 2156 dbSNP
rs1411975045 2159 dbSNP
rs1356705572 2174 dbSNP
rs937662779 2181 dbSNP
rs1002117900 2183 dbSNP
rs905070902 2188 dbSNP
rs926242997 2189 dbSNP
rs980802174 2203 dbSNP
rs1169519960 2217 dbSNP
rs1214734248 2227 dbSNP
rs1276360512 2242 dbSNP
rs765858759 2259 dbSNP
rs762375598 2281 dbSNP
rs920118189 2285 dbSNP
rs1427149674 2287 dbSNP
rs1174238047 2289 dbSNP
rs1486647934 2295 dbSNP
rs185350020 2310 dbSNP
rs940983788 2311 dbSNP
rs1412138700 2314 dbSNP
rs961504278 2318 dbSNP
rs765472019 2323 dbSNP
rs1183824921 2328 dbSNP
rs1187284283 2340 dbSNP
rs908228012 2349 dbSNP
rs1428185384 2356 dbSNP
rs769354333 2365 dbSNP
rs1019661925 2373 dbSNP
rs180671388 2384 dbSNP
rs1416589504 2419 dbSNP
rs933771229 2422 dbSNP
rs1231493355 2460 dbSNP
rs1430861145 2476 dbSNP
rs1299312915 2486 dbSNP
rs764424638 2488 dbSNP
rs922795151 2489 dbSNP
rs761573365 2493 dbSNP
rs1227373698 2498 dbSNP
rs1303973346 2521 dbSNP
rs954077852 2528 dbSNP
rs975515902 2532 dbSNP
rs1028320460 2533 dbSNP
rs964190257 2534 dbSNP
rs5954350 2536 dbSNP
rs1250109747 2543 dbSNP
rs1447962068 2543 dbSNP
rs112050885 2546 dbSNP
rs1396007046 2547 dbSNP
rs1479220708 2557 dbSNP
rs984669129 2565 dbSNP
rs1021262315 2567 dbSNP
rs1009421094 2569 dbSNP
rs1400757029 2571 dbSNP
rs1322033900 2572 dbSNP
rs376307327 2575 dbSNP
rs896280890 2590 dbSNP
rs1289069521 2591 dbSNP
rs776172477 2596 dbSNP
rs967331299 2602 dbSNP
rs937742834 2609 dbSNP
rs1230837134 2612 dbSNP
rs904884267 2620 dbSNP
rs1274148553 2624 dbSNP
rs765925197 2643 dbSNP
rs761278491 2646 dbSNP
rs1365140306 2653 dbSNP
rs773807047 2658 dbSNP
rs1229070127 2659 dbSNP
rs772597834 2671 dbSNP
rs762054919 2672 dbSNP
rs774682452 2674 dbSNP
rs1403867267 2676 dbSNP
rs768747170 2679 dbSNP
rs749451069 2685 dbSNP
rs779997719 2696 dbSNP
rs769803618 2697 dbSNP
rs202068265 2708 dbSNP
rs1186048958 2713 dbSNP
rs147813784 2714 dbSNP
rs1467558849 2715 dbSNP
rs1470834899 2720 dbSNP
rs1273333146 2741 dbSNP
rs758240350 2755 dbSNP
rs370881637 2766 dbSNP
rs754591721 2774 dbSNP
rs767340426 2778 dbSNP
rs761731607 2785 dbSNP
rs753477103 2790 dbSNP
rs189826210 2797 dbSNP
rs751009695 2799 dbSNP
rs1371797147 2800 dbSNP
rs765939378 2804 dbSNP
rs1322716695 2809 dbSNP
rs2094702 2810 dbSNP
rs912723419 2812 dbSNP
rs1327113471 2814 dbSNP
rs1416889992 2829 dbSNP
rs1034440841 2838 dbSNP
rs1002003472 2854 dbSNP
rs1406763822 2855 dbSNP
rs1208422814 2882 dbSNP
rs986884361 2891 dbSNP
rs1267034966 2903 dbSNP
rs112668027 2907 dbSNP
rs1250291179 2912 dbSNP
rs905046221 2919 dbSNP
rs1471961251 2920 dbSNP
rs1473330282 2936 dbSNP
rs1164925229 2937 dbSNP
rs1369825511 2953 dbSNP
rs921290672 2962 dbSNP
rs1038275570 2965 dbSNP
rs1396882735 2968 dbSNP
rs1431430637 2969 dbSNP
rs1005502628 2974 dbSNP
rs1349847776 2977 dbSNP
rs1409269616 2980 dbSNP
rs772640075 2983 dbSNP
rs1245420001 2989 dbSNP
rs1342344243 2991 dbSNP
rs1242811599 2995 dbSNP
rs1265111458 3001 dbSNP
rs1202271808 3002 dbSNP
rs1343272053 3007 dbSNP
rs181214509 3019 dbSNP
rs1461286019 3024 dbSNP
rs886771185 3028 dbSNP
rs1268795333 3029 dbSNP
rs111267828 3033 dbSNP
rs540967141 3047 dbSNP
rs1047209324 3052 dbSNP
rs113975381 3059 dbSNP
rs1306555395 3063 dbSNP
rs1421566389 3065 dbSNP
rs1186350000 3066 dbSNP
rs933675492 3067 dbSNP
rs866198415 3069 dbSNP
rs1431374052 3070 dbSNP
rs769486705 3071 dbSNP
rs1166542466 3074 dbSNP
rs1229159386 3082 dbSNP
rs1378066150 3083 dbSNP
rs1369866892 3084 dbSNP
rs900887841 3094 dbSNP
rs753110273 3103 dbSNP
rs1039438541 3108 dbSNP
rs1404388185 3131 dbSNP
rs1394397603 3140 dbSNP
rs190358170 3147 dbSNP
rs1366262270 3159 dbSNP
rs1451778509 3164 dbSNP
rs781729329 3178 dbSNP
rs866190748 3179 dbSNP
rs1009452180 3200 dbSNP
rs960562841 3209 dbSNP
rs1034834105 3220 dbSNP
rs1001983932 3262 dbSNP
rs1211379609 3274 dbSNP
rs1258320042 3282 dbSNP
rs1450960845 3296 dbSNP
rs56885123 3318 dbSNP
rs1165024716 3319 dbSNP
rs1049263909 3322 dbSNP
rs1186281336 3329 dbSNP
rs978969223 3329 dbSNP
rs1389254500 3331 dbSNP
rs1178098763 3343 dbSNP
rs201007214 3343 dbSNP
rs1444456415 3344 dbSNP
rs1375901889 3367 dbSNP
rs1389654314 3371 dbSNP
rs1437465598 3371 dbSNP
rs766827422 3371 dbSNP
rs776433856 3373 dbSNP
rs1364868993 3384 dbSNP
rs1484925617 3387 dbSNP
rs897452765 3401 dbSNP
rs1311013361 3402 dbSNP
rs1037281241 3409 dbSNP
rs1222499240 3410 dbSNP
rs768344634 3412 dbSNP
rs912752666 3418 dbSNP
rs1051189500 3423 dbSNP
rs1247069132 3463 dbSNP
rs1488668516 3468 dbSNP
rs1192758011 3483 dbSNP
rs1422960225 3520 dbSNP
rs1289263976 3521 dbSNP
rs369290361 3528 dbSNP
rs1365714631 3539 dbSNP
rs749949366 3547 dbSNP
rs1297636016 3552 dbSNP
rs932791198 3553 dbSNP
rs764911312 3562 dbSNP
rs1412725314 3568 dbSNP
rs1458914253 3572 dbSNP
rs1157177480 3577 dbSNP
rs973136108 3601 dbSNP
rs761518443 3615 dbSNP
rs960075340 3617 dbSNP
rs1217109353 3618 dbSNP
rs1295720804 3626 dbSNP
rs1034411660 3627 dbSNP
rs1426110727 3634 dbSNP
rs1386644101 3635 dbSNP
rs980205904 3637 dbSNP
rs1330561166 3638 dbSNP
rs746905275 3651 dbSNP
rs776395475 3656 dbSNP
rs979886246 3663 dbSNP
rs543034070 3665 dbSNP
rs763815843 3666 dbSNP
rs913883877 3677 dbSNP
rs1244700494 3678 dbSNP
rs970666610 3693 dbSNP
rs1391227489 3724 dbSNP
rs779985698 3726 dbSNP
rs186645306 3727 dbSNP
rs886988053 3732 dbSNP
rs1473599961 3733 dbSNP
rs1180177809 3742 dbSNP
rs554393804 3766 dbSNP
rs1407520850 3772 dbSNP
rs1406097739 3775 dbSNP
rs367977210 3785 dbSNP
rs1034906427 3788 dbSNP
rs1025570144 3789 dbSNP
rs1424464708 3798 dbSNP
rs1309140091 3842 dbSNP
rs998233024 3847 dbSNP
rs900853056 3856 dbSNP
rs1191869401 3877 dbSNP
rs1490875738 3880 dbSNP
rs1287330273 3898 dbSNP
rs1320856074 3902 dbSNP
rs1039408032 3912 dbSNP
rs1002057238 3919 dbSNP
rs1482070925 3927 dbSNP
rs1342593042 3930 dbSNP
rs1252873327 3933 dbSNP
rs969590266 3941 dbSNP
rs1027416762 3948 dbSNP
rs775453888 3952 dbSNP
rs1306865715 3960 dbSNP
rs1183773665 3968 dbSNP
rs1411951355 3972 dbSNP
rs1169693299 3980 dbSNP
rs1444376197 3980 dbSNP
rs182458797 3981 dbSNP
rs1428310719 3983 dbSNP
rs386827926 3983 dbSNP
rs946237174 3984 dbSNP
rs913440575 3985 dbSNP
rs758378038 3986 dbSNP
rs1381662093 3991 dbSNP
rs376991450 3991 dbSNP
rs749360958 3991 dbSNP
rs752462150 3991 dbSNP
rs1406212517 3993 dbSNP
rs769598359 3999 dbSNP
rs1228860850 4004 dbSNP
rs1299458317 4008 dbSNP
rs1339816601 4010 dbSNP
rs1343169456 4015 dbSNP
rs1302132620 4019 dbSNP
rs1443046338 4045 dbSNP
rs1212399102 4051 dbSNP
rs993106957 4057 dbSNP
rs1461094484 4065 dbSNP
rs1189462295 4076 dbSNP
rs1004448205 4077 dbSNP
rs773234724 4085 dbSNP
rs1300298388 4088 dbSNP
rs1460874704 4122 dbSNP
rs1415667627 4129 dbSNP
rs1051261062 4133 dbSNP
rs932837444 4135 dbSNP
rs927307485 4138 dbSNP
rs1255691768 4144 dbSNP
rs980176232 4145 dbSNP
rs189179222 4152 dbSNP
rs899964934 4185 dbSNP
rs138009273 4197 dbSNP
rs1226471982 4231 dbSNP
rs1275351283 4240 dbSNP
rs1347114465 4241 dbSNP
rs183632238 4248 dbSNP
rs1261269413 4263 dbSNP
rs913933781 4274 dbSNP
rs1209543050 4275 dbSNP
rs988154949 4277 dbSNP
rs757486873 4278 dbSNP
rs1483509844 4279 dbSNP
rs939310260 4279 dbSNP
rs191468476 4280 dbSNP
rs927869284 4281 dbSNP
rs1193832988 4286 dbSNP
rs1457337333 4290 dbSNP
rs150354464 4305 dbSNP
rs1386064480 4306 dbSNP
rs1381429187 4311 dbSNP
rs1324045904 4317 dbSNP
rs969286097 4329 dbSNP
rs1434139440 4332 dbSNP
rs1282586950 4341 dbSNP
rs1322866124 4365 dbSNP
rs1225332568 4373 dbSNP
rs1229133607 4401 dbSNP
rs1270233339 4403 dbSNP
rs1348889674 4416 dbSNP
rs998134361 4419 dbSNP
rs965402744 4422 dbSNP
rs1453705156 4423 dbSNP
rs1197839295 4424 dbSNP
rs1268846802 4428 dbSNP
rs188122010 4432 dbSNP
rs140373800 4444 dbSNP
rs1409309759 4447 dbSNP
rs1282092976 4449 dbSNP
rs1017927910 4467 dbSNP
rs1392557091 4475 dbSNP
rs754019573 4489 dbSNP
rs1006591605 4490 dbSNP
rs1351085504 4491 dbSNP
rs375107722 4492 dbSNP
rs1410509570 4497 dbSNP
rs962085951 4498 dbSNP
rs1014595817 4499 dbSNP
rs41312781 4500 dbSNP
rs890079942 4507 dbSNP
rs1029876843 4508 dbSNP
rs764782805 4512 dbSNP
rs756770709 4515 dbSNP
rs997498543 4521 dbSNP
rs1337952379 4527 dbSNP
rs557806667 4549 dbSNP
rs1220780930 4565 dbSNP
rs1010790968 4567 dbSNP
rs763764506 4582 dbSNP
rs1207930623 4592 dbSNP
rs1247737572 4598 dbSNP
rs184990901 4603 dbSNP
rs762422169 4604 dbSNP
rs1470579542 4607 dbSNP
rs1369879705 4608 dbSNP
rs1442524176 4611 dbSNP
rs1162766748 4623 dbSNP
rs1370943975 4633 dbSNP
rs892571992 4635 dbSNP
rs1032908175 4638 dbSNP
rs144918632 4644 dbSNP
rs767489333 4651 dbSNP
rs1394370015 4669 dbSNP
rs1390929926 4680 dbSNP
rs938982097 4685 dbSNP
rs1342545203 4702 dbSNP
rs759453266 4703 dbSNP
rs753163402 4714 dbSNP
rs774362140 4719 dbSNP
rs927944998 4719 dbSNP
rs1231199499 4735 dbSNP
rs1243540772 4738 dbSNP
rs1480008463 4743 dbSNP
rs980754145 4744 dbSNP
rs947948845 4747 dbSNP
rs1257823156 4756 dbSNP
rs920466537 4757 dbSNP
rs1459648907 4762 dbSNP
rs973656427 4779 dbSNP
rs1205410141 4780 dbSNP
rs961878216 4781 dbSNP
rs1372479415 4783 dbSNP
rs1014628324 4792 dbSNP
rs987146680 4810 dbSNP
rs2805901 4811 dbSNP
rs1404452628 4815 dbSNP
rs748269830 4816 dbSNP
rs942020124 4827 dbSNP
rs146438992 4832 dbSNP
rs1366329179 4834 dbSNP
rs997131025 4837 dbSNP
rs900097823 4843 dbSNP
rs1455018596 4855 dbSNP
rs1381258299 4857 dbSNP
rs142539677 4861 dbSNP
rs1401351029 4862 dbSNP
rs1387304162 4863 dbSNP
rs983574897 4869 dbSNP
rs1320831073 4870 dbSNP
rs951268795 4871 dbSNP
rs1385588156 4873 dbSNP
rs747367234 4876 dbSNP
rs1011494699 4885 dbSNP
rs892604567 4887 dbSNP
rs1185221593 4888 dbSNP
rs1184619381 4891 dbSNP
rs1052558526 4892 dbSNP
rs1442597800 4895 dbSNP
rs1260952001 4905 dbSNP
rs1003628887 4908 dbSNP
rs977065041 4920 dbSNP
rs965302789 4927 dbSNP
rs760190619 4928 dbSNP
rs1175937031 4939 dbSNP
rs906557626 4941 dbSNP
rs1045461077 4942 dbSNP
rs1433311278 4945 dbSNP
rs1287557210 4948 dbSNP
rs1361711112 4956 dbSNP
rs1193898169 4987 dbSNP
rs1387806722 4995 dbSNP
rs948050019 4996 dbSNP
rs1222420127 5005 dbSNP
rs1448210133 5009 dbSNP
rs920524001 5034 dbSNP
rs1259873303 5043 dbSNP
rs749938079 5050 dbSNP
rs940535915 5051 dbSNP
rs1192812503 5052 dbSNP
rs907705378 5053 dbSNP
rs1248577611 5062 dbSNP
rs192606596 5068 dbSNP
rs954443107 5070 dbSNP
rs1314946323 5077 dbSNP
rs1157222001 5079 dbSNP
rs1432123586 5098 dbSNP
rs921657987 5102 dbSNP
rs974833831 5112 dbSNP
rs761465677 5113 dbSNP
rs1364311833 5122 dbSNP
rs1403792840 5126 dbSNP
rs1288353150 5136 dbSNP
rs1003456614 5155 dbSNP
rs1221671818 5162 dbSNP
rs1305895234 5171 dbSNP
rs1316351157 5173 dbSNP
rs906082250 5177 dbSNP
rs776175754 5186 dbSNP
rs1022978460 5192 dbSNP
rs1289489647 5193 dbSNP
rs758923862 5233 dbSNP
rs1044684021 5245 dbSNP
rs1011152232 5246 dbSNP
rs1366401587 5258 dbSNP
rs369459774 5269 dbSNP
rs1407588023 5278 dbSNP
rs768386387 5282 dbSNP
rs909238824 5288 dbSNP
rs1424522037 5300 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293 , HUVEC , MCF7
Location of target site CDS
Tools used in this research DIANA-microT , EIMMO , miRanda , miRBase Target Database , PicTar , TargetScan
Article - Fasanaro P; Greco S; Lorenzi M; Pescatori et al.
- The Journal of biological chemistry, 2009
miR-210 is a key player of cell response to hypoxia, modulating cell survival, VEGF-driven endothelial cell migration, and the ability of endothelial cells to form capillary-like structures. A crucial step in understanding microRNA (miRNA) function is the identification of their targets. However, only few miR-210 targets have been identified to date. Here, we describe an integrated strategy for large-scale identification of new miR-210 targets by combining transcriptomics and proteomics with bioinformatic approaches. To experimentally validate candidate targets, the RNA-induced silencing complex (RISC) loaded with miR-210 was purified by immunoprecipitation along with its mRNA targets. The complex was significantly enriched in mRNAs of 31 candidate targets, such as BDNF, GPD1L, ISCU, NCAM, and the non-coding RNA Xist. A subset of the newly identified targets was further confirmed by 3'-untranslated region (UTR) reporter assays, and hypoxia induced down-modulation of their expression was rescued blocking miR-210, providing support for the approach validity. In the case of 9 targets, such as PTPN1 and P4HB, miR-210 seed-pairing sequences localized in the coding sequence or in the 5'-UTR, in line with recent data extending miRNA targeting beyond the "classic" 3'-UTR recognition. Finally, Gene Ontology analysis of the targets highlights known miR-210 impact on cell cycle regulation and differentiation, and predicts a new role of this miRNA in RNA processing, DNA binding, development, membrane trafficking, and amino acid catabolism. Given the complexity of miRNA actions, we view such a multiprong approach as useful to adequately describe the multiple pathways regulated by miR-210 during physiopathological processes.
LinkOut: [PMID: 19826008]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PRAD 0.315 0.01 0.144 0.16 50 Click to see details
COAD -0.751 0.02 -0.857 0 8 Click to see details
HNSC -0.269 0.04 -0.173 0.14 42 Click to see details
THCA 0.22 0.05 0.275 0.02 59 Click to see details
BLCA -0.379 0.06 -0.453 0.03 18 Click to see details
KIRC -0.161 0.09 -0.155 0.1 68 Click to see details
LIHC 0.163 0.13 0.132 0.18 49 Click to see details
ESCA -0.33 0.16 -0.182 0.3 11 Click to see details
STAD -0.161 0.19 -0.048 0.4 32 Click to see details
PAAD 0.589 0.21 0.000 0.5 4 Click to see details
UCEC -0.2 0.21 -0.170 0.24 19 Click to see details
LUSC 0.117 0.24 0.120 0.24 38 Click to see details
CHOL 0.234 0.27 0.333 0.19 9 Click to see details
PCPG 0.53 0.32 1.000 0.5 3 Click to see details
KICH 0.086 0.34 0.064 0.38 25 Click to see details
KIRP -0.068 0.36 -0.125 0.25 32 Click to see details
LUAD 0.103 0.38 0.049 0.44 12 Click to see details
BRCA -0.026 0.41 -0.023 0.42 84 Click to see details
CESC 0.183 0.44 -0.500 0.33 3 Click to see details
CESC 0.183 0.44 -0.500 0.33 3 Click to see details
CESC 0.183 0.44 -0.500 0.33 3 Click to see details
126 hsa-miR-210-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000149 HOXA9 homeobox A9 4 1
MIRT000150 TP53I11 tumor protein p53 inducible protein 11 2 1
MIRT000151 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 2 1
MIRT000152 HOXA1 homeobox A1 2 1
MIRT000153 FGFRL1 fibroblast growth factor receptor like 1 6 3
MIRT000156 RAD52 RAD52 homolog, DNA repair protein 5 3
MIRT001930 NPTX1 neuronal pentraxin 1 3 2
MIRT002024 EFNA3 ephrin A3 8 8
MIRT003153 BDNF brain derived neurotrophic factor 5 1
MIRT003154 PTPN1 protein tyrosine phosphatase, non-receptor type 1 5 1
MIRT003155 P4HB prolyl 4-hydroxylase subunit beta 6 2
MIRT003156 UBQLN1 ubiquilin 1 3 1
MIRT003157 SERTAD2 SERTA domain containing 2 3 1
MIRT003158 SEH1L SEH1 like nucleoporin 3 1
MIRT003159 NCAM1 neural cell adhesion molecule 1 4 1
MIRT003160 MID1IP1 MID1 interacting protein 1 3 1
MIRT003161 MDGA1 MAM domain containing glycosylphosphatidylinositol anchor 1 3 1
MIRT003162 KIAA1161 myogenesis regulating glycosidase (putative) 3 1
MIRT003163 ISCU iron-sulfur cluster assembly enzyme 6 7
MIRT003164 HOXA3 homeobox A3 3 1
MIRT003165 GPD1L glycerol-3-phosphate dehydrogenase 1 like 7 2
MIRT003166 DENND6A DENN domain containing 6A 3 1
MIRT003167 CPEB2 cytoplasmic polyadenylation element binding protein 2 5 1
MIRT003168 CDK10 cyclin dependent kinase 10 3 1
MIRT003169 ABCB9 ATP binding cassette subfamily B member 9 3 1
MIRT003170 CBX1 chromobox 1 3 1
MIRT003171 XIST X inactive specific transcript (non-protein coding) 4 1
MIRT003172 TNPO1 transportin 1 3 1
MIRT003173 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 3 1
MIRT003174 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 3 1
MIRT003175 NIPBL NIPBL, cohesin loading factor 3 1
MIRT003176 MIB1 mindbomb E3 ubiquitin protein ligase 1 3 1
MIRT003177 HECTD1 HECT domain E3 ubiquitin protein ligase 1 3 1
MIRT003178 ELK3 ELK3, ETS transcription factor 3 1
MIRT003179 DDAH1 dimethylarginine dimethylaminohydrolase 1 4 1
MIRT003180 CLASP2 cytoplasmic linker associated protein 2 3 1
MIRT003181 CHD9 chromodomain helicase DNA binding protein 9 3 1
MIRT003182 ATP11C ATPase phospholipid transporting 11C 3 1
MIRT003183 APC APC, WNT signaling pathway regulator 3 1
MIRT003184 E2F3 E2F transcription factor 3 7 5
MIRT003185 ACVR1B activin A receptor type 1B 2 1
MIRT003916 MRE11A MRE11 homolog, double strand break repair nuclease 2 1
MIRT003917 XPA XPA, DNA damage recognition and repair factor 2 1
MIRT004672 MNT MAX network transcriptional repressor 4 2
MIRT006326 AIFM3 apoptosis inducing factor, mitochondria associated 3 3 2
MIRT006519 CASP8AP2 caspase 8 associated protein 2 4 1
MIRT006663 VMP1 vacuole membrane protein 1 3 2
MIRT006830 TFRC transferrin receptor 3 2
MIRT047002 PFDN2 prefoldin subunit 2 1 1
MIRT047003 U2AF2 U2 small nuclear RNA auxiliary factor 2 1 1
MIRT047004 UBA1 ubiquitin like modifier activating enzyme 1 1 1
MIRT047005 ESPL1 extra spindle pole bodies like 1, separase 1 1
MIRT047006 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT047007 SCN1B sodium voltage-gated channel beta subunit 1 1 1
MIRT047008 RCC2 regulator of chromosome condensation 2 1 1
MIRT053179 HSD17B1 hydroxysteroid 17-beta dehydrogenase 1 2 1
MIRT054098 NDUFA4 NDUFA4, mitochondrial complex associated 4 2
MIRT054099 SDHD succinate dehydrogenase complex subunit D 6 4
MIRT054141 STMN1 stathmin 1 3 1
MIRT054142 DIMT1L DIM1 dimethyladenosine transferase 1 homolog 4 2
MIRT054186 ROD1 polypyrimidine tract binding protein 3 3 1
MIRT054203 ALDH5A1 aldehyde dehydrogenase 5 family member A1 4 1
MIRT054204 FOXN3 forkhead box N3 5 2
MIRT054205 MCM3 minichromosome maintenance complex component 3 4 1
MIRT054206 IGFBP3 insulin like growth factor binding protein 3 6 2
MIRT054207 COL4A2 collagen type IV alpha 2 chain 6 2
MIRT054208 INPP5A inositol polyphosphate-5-phosphatase A 4 1
MIRT054209 EHD2 EH domain containing 2 4 1
MIRT054210 SH3BGRL SH3 domain binding glutamate rich protein like 5 2
MIRT054248 PTPN2 protein tyrosine phosphatase, non-receptor type 2 3 1
MIRT054321 LDHA lactate dehydrogenase A 2 1
MIRT054324 LDHB lactate dehydrogenase B 2 1
MIRT054349 HIF1A hypoxia inducible factor 1 alpha subunit 5 2
MIRT054714 FOXP3 forkhead box P3 3 1
MIRT054794 HIF3A hypoxia inducible factor 3 alpha subunit 3 1
MIRT115688 MGRN1 mahogunin ring finger 1 2 3
MIRT170674 INSIG1 insulin induced gene 1 1 1
MIRT437785 BNIP3 BCL2 interacting protein 3 5 2
MIRT438739 KCMF1 potassium channel modulatory factor 1 1 1
MIRT439407 TNPO3 transportin 3 1 1
MIRT439629 SIPA1L3 signal induced proliferation associated 1 like 3 1 1
MIRT439632 SIN3A SIN3 transcription regulator family member A 1 1
MIRT439740 RPL22 ribosomal protein L22 1 1
MIRT439886 PSAP prosaposin 1 1
MIRT439918 PPP1R2 protein phosphatase 1 regulatory inhibitor subunit 2 1 1
MIRT439928 POU2AF1 POU class 2 associating factor 1 1 1
MIRT440033 ICMT isoprenylcysteine carboxyl methyltransferase 2 3
MIRT440255 MEF2D myocyte enhancer factor 2D 1 1
MIRT440491 HMGCS1 3-hydroxy-3-methylglutaryl-CoA synthase 1 2 3
MIRT440570 GIT2 GIT ArfGAP 2 1 1
MIRT440647 FCHSD2 FCH and double SH3 domains 2 1 1
MIRT440830 DEAF1 DEAF1, transcription factor 1 1
MIRT440866 CSNK1E casein kinase 1 epsilon 1 1
MIRT472232 NFIC nuclear factor I C 2 2
MIRT473190 MITF melanogenesis associated transcription factor 2 2
MIRT477856 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 2 2
MIRT497528 ZNF607 zinc finger protein 607 2 2
MIRT509770 SERTM1 serine rich and transmembrane domain containing 1 2 6
MIRT524407 CNTNAP5 contactin associated protein like 5 2 4
MIRT535209 PKIA cAMP-dependent protein kinase inhibitor alpha 2 4
MIRT554511 RUNX1T1 RUNX1 translocation partner 1 2 4
MIRT558069 ESCO2 establishment of sister chromatid cohesion N-acetyltransferase 2 2 2
MIRT572273 KCNJ6 potassium voltage-gated channel subfamily J member 6 2 2
MIRT574255 DOCK7 dedicator of cytokinesis 7 2 4
MIRT575621 Foxn3 forkhead box N3 2 2
MIRT575742 Zfp618 zinc finger protein 618 1 1
MIRT609050 VAMP4 vesicle associated membrane protein 4 2 2
MIRT611143 TNRC6B trinucleotide repeat containing 6B 2 4
MIRT699226 SLCO3A1 solute carrier organic anion transporter family member 3A1 2 2
MIRT703060 GTDC1 glycosyltransferase like domain containing 1 2 2
MIRT716005 ASB11 ankyrin repeat and SOCS box containing 11 2 2
MIRT731682 BTK Bruton tyrosine kinase 3 1
MIRT733090 DLEU2L deleted in lymphocytic leukemia 2-like 3 0
MIRT733091 BRCA2 BRCA2, DNA repair associated 3 0
MIRT733156 ITGA5 integrin subunit alpha 5 1 0
MIRT733501 GATA1 GATA binding protein 1 3 0
MIRT733503 SMAD2 SMAD family member 2 3 0
MIRT733525 MIR210HG MIR210 host gene 2 0
MIRT733615 TGFBI transforming growth factor beta induced 2 0
MIRT734175 KRAS KRAS proto-oncogene, GTPase 2 0
MIRT734293 PTEN phosphatase and tensin homolog 1 0
MIRT734568 STAT6 signal transducer and activator of transcription 6 1 0
MIRT734966 ADAMTS6 ADAM metallopeptidase with thrombospondin type 1 motif 6 1 0
MIRT736294 ID2 inhibitor of DNA binding 2, HLH protein 1 0
MIRT737104 FABP4 fatty acid binding protein 4, adipocyte 3 0
MIRT756028 NTN4 netrin 4 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-210 Vincristine approved 5978 Quantitative real-time PCR Hep-2 cells 23780424 2013 up-regualted
miR-210 Lenalidomide approved 216326 Quantitative real-time PCR peripheral blood CD14+ monocytes 25287904 2014 down-regulated
miR-210 Arsenic trioxide approved 14888 Microarray lymphoblast cell line TK-6 17108120 2006 down-regulated
miR-210 5-Fluorouracil approved 3385 Quantitative real-time PCR colon cancer cells 17702597 2007 down-regulated
miR-210 Arsenic trioxide approved 14888 Microarray HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-210 Arsenic trioxide approved 14888 Quantitative real-time PCR HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-210 Arsenic trioxide approved 14888 Quantitative real-time PCR HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-210 Ginsenoside Rh2 NULL 119307 Microarray human glioma cells U251 21372826 2011 down-regulated
miR-210 Aidi injection NULL NULL Microarray human breast cancer cells 21563499 2011 down-regulated
miR-210 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer HB2 22076154 2011 down-regulated
miR-210 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer MDA-MB231 22076154 2011 down-regulated
miR-210 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer SKBR3 22076154 2011 down-regulated
miR-210 Trastuzumab approved NULL Microarray HER2-positive breast cancer 22384020 2012 down-regulated
miR-210 Trastuzumab approved NULL Quantitative real-time PCR HER2-positive breast cancer 22384020 2012 down-regulated
miR-210 Trastuzumab approved NULL Microarray BT474 cells 22384020 2012 down-regulated
miR-210 Curcumin NULL 969516 Quantitative real-time PCR Y79 RB cells. 22510010 2012 down-regulated
miR-210 Bicalutamide approved 2375 Microarray prostate 22674191 2012 down-regulated
miR-210 Goserelin approved 47725 Microarray prostate 22674191 2012 down-regulated
miR-210 Olea europaea leaf extract NULL NULL Quantitative real-time PCR glioblastoma cells. 22722712 2012 up-regulated
miR-210 Temozolomide approved 5394 Quantitative real-time PCR glioblastoma cells. 22722712 2012 up-regulated
miR-210 Nicotine approved 89594 Microarray Rat adrenal pheochromocytoma PC12 cell 18845019 2009 down-regulated
miR-210 Comfrey NULL 6440495 Microarray rat liver 21370286 2011 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-210 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-mir-210 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-210 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-210 Paclitaxel 36314 NSC125973 approved resistant cell line (W1)
hsa-mir-210 Androstenedione 6128 NSC9563 sensitive cell line (MCF-7)
hsa-mir-210 Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-210 Tamoxifen 2733525 NSC180973 approved resistant tissue (ER-positive breast cancer)
hsa-mir-210 Fluorouracil 3385 NSC19893 approved sensitive cell line (OE19)
hsa-mir-210 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-mir-210 Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)
hsa-miR-210-3p (E)-1-[3,5-bis[(dimethylamino)methyl]-4-hydroxyphenyl]-3-phenylprop-2-en-1-one 6374691 NSC677784 resistant
hsa-miR-210-3p (e)-3-chloro-3-(4-methoxyphenyl)-2-(4-nitrophenyl)prop-2-enal 5387396 NSC623175 resistant
hsa-miR-210-3p [(E)-(1-chloro-2-methylpropylidene)amino] N-anilinocarbamate 5494354 NSC682841 resistant
hsa-miR-210-3p [(E)-1-chloropropylideneamino] N-[2-(trifluoromethoxy)phenyl]carbamate 5466266 NSC682836 resistant
hsa-miR-210-3p [2-[(e)-(carbamothioylhydrazono)methyl]-6-methoxy-phenoxy]-hydroxy-copper; 2-(2-pyridyl)pyridine 135484845 NSC638302 resistant
hsa-miR-210-3p 1-(4-ethoxyphenyl)-3-(2-methyl-5-propan-2-ylphenyl)urea 240168 NSC46213 sensitive
hsa-miR-210-3p 1-(4-nitrophenyl)-3-(2-pyridyl)thiourea 3005383 NSC695329 sensitive
hsa-miR-210-3p 1-(naphthalen-1-ylmethyl)-4-[1-(naphthalen-1-ylmethyl)piperidin-4-yl]piperidine 364095 NSC669995 resistant
hsa-miR-210-3p 1-[2-(4-nitrophenyl)-2-oxoethyl]-4-pentylpyridin-1-ium bromide 24181037 NSC4290 resistant
hsa-miR-210-3p 11-(3-methoxyphenyl)-2,12,15-triazapentacyclo[11.7.1.03,8.09,21.014,19]henicosa-1,3,5,7,9,11,13(21),14(19),15,17-decaen-20-one 54608964 NSC697747 resistant
hsa-miR-210-3p 17-acetyl-9,14-dihydroxy-16-methyl-15-(4-methylphenyl)-15-azatetracyclo[8.7.0.01,14.03,8]heptadeca-3,5,7,9,12,16-hexaene-2,11-dione 405612 NSC722982 resistant
hsa-miR-210-3p 1h-benz[g]indol-5-ol, 2-phenyl 371327 NSC645431 resistant
hsa-miR-210-3p 2-[[4-anilino-5-[8-[4-anilino-5-[(1-hydroxynaphthalen-2-yl)oxymethyl]-1,2,4-triazol-3-yl]octyl]-1,2,4-triazol-3-yl]methoxy]naphthalen-1-ol 394049 NSC697167 resistant
hsa-miR-210-3p 2-[9-[(7-oxocyclohepta-1,3,5-trien-1-yl)amino]nonylamino]cyclohepta-2,4,6-trien-1-one 358331 NSC618296 resistant
hsa-miR-210-3p 2-amino-5,8-dihydroxy-1,4-naphthoquinone 377209 NSC658441 resistant
hsa-miR-210-3p 2-bromo-4-(5-fluoro-1,3-benzothiazol-2-yl)aniline 399248 NSC709925 sensitive
hsa-miR-210-3p 2-hydroxy-5-({(e)-[(10-hydroxyacridin-9(10h)-ylidene)methyl]diazenyl}sulfonyl)benzoic acid 363212 NSC627890 resistant
hsa-miR-210-3p 3'-chloro-3-nitro-o-salicylotoluidide 332278 NSC328477 resistant
hsa-miR-210-3p 3-((4-(methylthio)phenoxy)methyl)-2-oxiranol 366923 NSC636087 resistant
hsa-miR-210-3p 4-(2-phenylethylamino)naphthalene-1,2-dione 367789 NSC637731 resistant
hsa-miR-210-3p 4-[(E)-2-piperidin-1-ylethenyl]benzo[g]quinoline-5,10-dione 5781544 NSC642968 resistant
hsa-miR-210-3p 4-[(r)-[(2s,5r)-2,5-dimethyl-4-prop-2-enylpiperazin-1-yl]-(3-methoxyphenyl)methyl]-n-pentan-3-ylbenzamide;hydrochloride 5471112 NSC708822 resistant
hsa-miR-210-3p 4-[2-(methylamino)-1-methylsulfanylethyl]benzene-1,2-diol 412349 NSC39215 resistant
hsa-miR-210-3p 4-[4-(4-sulfinobutyldisulfanyl)butyldisulfanyl]butane-1-sulfinic acid 361262 NSC624205 resistant
hsa-miR-210-3p 4-acetamido-n-[(e)-(2,4-dichlorophenyl)methylideneamino]-2-methoxybenzamide 9572428 NSC716142 sensitive
hsa-miR-210-3p 4-aminodithiolane-4-carboxylic acid 269217 NSC109825 resistant
hsa-miR-210-3p 4-hydroxy-3-[1-(1-hydroxy-3,4-dioxonaphthalen-2-yl)-3-phenylpropyl]naphthalene-1,2-dione 272651 NSC117274 resistant
hsa-miR-210-3p 4,4-dimethylspiro[1,3,2-oxazaphospholidin-2-ium-2,2'-3h-1,3,2-benzoxazaphosphol-2-ium]-5-one 6330525 NSC351866 resistant
hsa-miR-210-3p 4b-hydroxy-10,10-dimethoxy-9ah-indeno[1,2-a]inden-9-one 363252 NSC628000 resistant
hsa-miR-210-3p 4h,7h-furo[2',3',4':4,5]naphth[2,1-e][1,3]oxazin-4-one, 8-(4-chlorophenyl)-8,9-dihydro- 373969 NSC651001 resistant
hsa-miR-210-3p 5,6,7-trimethoxy-N-(4H-pyrazolo[1,5-a]indol-2-yl)-1H-indole-2-carboxamide 404173 NSC720326 resistant
hsa-miR-210-3p 6-(3-chloropropyl)-3-nitroindeno[1,2-c]isoquinoline-5,11-dione 17755848 NSC731154 resistant
hsa-miR-210-3p 6-benzyloxyhexanal 389877 NSC686505 resistant
hsa-miR-210-3p 7-[(E)-2-(1,6-dimethylquinolin-1-ium-2-yl)ethenyl]-5-methylquinolin-8-ol 135483953 NSC86371 resistant
hsa-miR-210-3p 7-[(naphthalen-1-ylamino)(phenyl)methyl]quinolin-8-ol 256754 NSC84092 resistant
hsa-miR-210-3p 7-chloro-6-n-(2-fluoroethylamino)-5,8-quinolinedione 379079 NSC663286 resistant
hsa-miR-210-3p 7-o,8-o-isopropylidene iriomoteolide 3a 24808220 NSC753164 resistant
hsa-miR-210-3p 9h-quino[4,3,2-de][1,10]phenanthrolin-9-one, 2-phenyl- 4567749 NSC686553 resistant
hsa-miR-210-3p Acetyltrophanthidin 261075 NSC92954 resistant
hsa-miR-210-3p Adenosine, 2-bromo-2'-deoxy- 334838 NSC341936 resistant
hsa-miR-210-3p Asimicinone 393461 NSC695394 resistant
hsa-miR-210-3p Benzo[b]naphtho[2,3-d]furan-6,11-dione, 4-chloro-3-hydroxy 371025 NSC644902 resistant
hsa-miR-210-3p Benzo[g]pteridine-2,4(3h,10h)-dione, 10-(2,4-dimethylphenyl)-3-methyl- 363228 NSC627974 resistant
hsa-miR-210-3p Benzo[g]pteridine-2,4(3h,10h)-dione, 10-(4-chlorophenyl)-3,7,8-trimethyl- 363246 NSC627992 resistant
hsa-miR-210-3p Benzo[g]pteridine-2,4(3h,10h)-dione, 3-methyl-10-[3-(methylthio)phenyl]- 363242 NSC627988 resistant
hsa-miR-210-3p Benzo[g]quinoxaline-5,10-dione, 5,10-dihydro-2,3-dimethyl- 353644 NSC602617 resistant
hsa-miR-210-3p Celcot rm 67277 NSC37168 resistant
hsa-miR-210-3p Cytarabine 6253 NSC287459 approved resistant
hsa-miR-210-3p Destruxin a 122810 NSC361126 resistant
hsa-miR-210-3p Di-p-tolyliodinium bromide 54601177 NSC8985 resistant
hsa-miR-210-3p Diethoxybis(1,4-naphthochinone-2-olato)titanium(iv) 368297 NSC638842 resistant
hsa-miR-210-3p Dihydrorotenone 243725 NSC53866 resistant
hsa-miR-210-3p Diisopropoxybis(1,4-naphthochinone-2-olato)titanium(iv) 368058 NSC638383 resistant
hsa-miR-210-3p Discorhabdin i 135409047 NSC656206 resistant
hsa-miR-210-3p Dpbq 364074 NSC629713 resistant
hsa-miR-210-3p Ethyl 6-chloro-4-phenyl-2-(piperazin-1-ylmethyl)quinoline-3-carboxylate 369623 NSC641536 resistant
hsa-miR-210-3p Ethyl 6-hydroxy-4-(4-methoxyphenyl)-6-methyl-3-oxo-2-phenyl-1,4,5,7-tetrahydroindazole-5-carboxylate 392845 NSC693857 resistant
hsa-miR-210-3p Gnmlngdfmleynr-uhfffaoysa-n 402862 NSC717147 sensitive
hsa-miR-210-3p Gw612286x 9822610 NSC756278 sensitive
hsa-miR-210-3p Gw811761x 6539382 NSC756375 sensitive
hsa-miR-210-3p Herbimycin 6436247 NSC305978 resistant
hsa-miR-210-3p Hypothemycin 5458809 NSC354462 resistant
hsa-miR-210-3p Indole-2,3-dione, 5-methyl-, 3-[(o-nitrophenyl)hydrazone] 3632950 NSC117915 sensitive
hsa-miR-210-3p J3.572.907k 396709 NSC703318 resistant
hsa-miR-210-3p Methyl 10-acetyl-3-(4-methylphenyl)sulfonyl-9-(2-methylprop-1-enyl)-3,10-diazatricyclo[6.4.1.04,13]trideca-1,4,6,8(13),11-pentaene-11-carboxylate NSC621968 resistant
hsa-miR-210-3p Methyl 8-[(4-chlorophenyl)carbamoyl]naphthalene-1-carboxylate 364289 NSC630307 resistant
hsa-miR-210-3p N-(2-morpholin-4-ylethyl)-5-nitroquinolin-4-amine;hydrochloride 372042 NSC646859 resistant
hsa-miR-210-3p N-(3-chloro-1,4-dioxonaphthalen-2-yl)-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1H-2-benzofuran-1-yl)butanamide 369463 NSC641233 resistant
hsa-miR-210-3p N-(3,5-dicyano-2-(4-methylphenyl)-6-oxo-4-phenyl-1(6h)-pyridinyl)-4-methylbenzenesulfonamide 390286 NSC687578 resistant
hsa-miR-210-3p N-[(1E)-1-(1-hydroxypyridin-2-ylidene)ethyl]iminoazepane-1-carbothioamide 5369124 NSC351075 resistant
hsa-miR-210-3p N-[1,1,1,3,3,3-hexafluoro-2-(4-fluoroanilino)propan-2-yl]butanamide 389152 NSC684836 resistant
hsa-miR-210-3p Naphtho[2,3-d]-1,3-dioxepin-6,11-dione, 4-methyl- NSC626868 resistant
hsa-miR-210-3p Naphtho[2,3-d]oxazole-4,9-dione, 2-(1,1-dimethylethyl)- 370622 NSC643915 resistant
hsa-miR-210-3p Niosh/br9826000 359483 NSC620462 resistant
hsa-miR-210-3p NSC619321 NSC619321 sensitive
hsa-miR-210-3p NSC621321 NSC621321 resistant
hsa-miR-210-3p NSC631451 NSC631451 resistant
hsa-miR-210-3p NSC634766 NSC634766 resistant
hsa-miR-210-3p NSC635414 NSC635414 resistant
hsa-miR-210-3p Pentyl 6-(chloromethyl)-2-oxo-2h-chromene-3-carboxylate 402498 NSC716524 resistant
hsa-miR-210-3p Pmp (van) 72508 NSC1906 resistant
hsa-miR-210-3p Scillirosidin, glycoside 222160 NSC7534 resistant
hsa-miR-210-3p Sesbanimide 163490 NSC355461 resistant
hsa-miR-210-3p Snc 80 123924 NSC707484 resistant
hsa-miR-210-3p Streptovaricin b 135443622 NSC156215 resistant
hsa-miR-210-3p Tetratert-butyl 8,11-dimethoxytricyclo[4.3.3.01,6]dodeca-7,10-diene-7,9,10,12-tetracarboxylate 362411 NSC626176 resistant
hsa-miR-210-3p Tolonium chloride 7083 NSC36758 resistant
hsa-miR-210-3p Z48861686 4784054 NSC745813 resistant
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Temozolomide 5394 NSC362856 approved resistant High Glioblastoma cell line (U251MG, U251R, U87MG, M059K, M059J)
hsa-miR-210-3p Imatinib 5291 NSC743414 approved resistant High Myelogenous Leukemia cell line (MYL)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colon Cancer cell line (HT-29)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colon Cancer cell line (HT-29)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant High Ehrlich Ascites Tumor cell line (EHR2,P6, P12, P36, P72, EHR2/1.3)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant High Ehrlich Ascites Tumor cell line (EHR2,P6, P12, P36, P72, EHR2/1.3)
hsa-miR-210-3p Trastuzumab resistant Low Breast Cancer tissue and cell line (BT-474, BTR65)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Vincristine 5978 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant Low Cervical Cancer tissue and cell line (SiHa, Cask)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant High Laryngeal Cancer cell line (Hep2)
hsa-miR-210-3p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-210-3p Docetaxel 148124 NSC628503 approved resistant High Prostate Cancer cell line (DU-145)
hsa-miR-210-3p Asparaginate 5460875 sensitive Low Pediatric Acute Lymphoblastic Leukemia Reh cells
hsa-miR-210-3p Dexamethasone 5743 NSC34521 approved sensitive Low Pediatric Acute Lymphoblastic Leukemia Reh cells
hsa-miR-210-3p Daunorubicin 30323 NSC82151 approved sensitive Low Pediatric Acute Lymphoblastic Leukemia Reh cells
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved sensitive High Esophageal Adenocarcinoma cell line (OE19)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant High Hepatocellular Carcinoma tissue and cell line (HepG2)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (SW1990)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (SW1990)
hsa-miR-210-3p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR20)
hsa-miR-210-3p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR70)
hsa-miR-210-3p Dexamethasone 5743 NSC34521 approved sensitive High Myeloma cell line (MM1R, MM1S)
hsa-miR-210-3p Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-210-3p Daunorubicin 30323 NSC82151 approved sensitive High Acute Myeloid Leukemia cell line (U-937, KG-1)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Ductal Adenocarcinoma cell line (MIA-PaCa-2)
hsa-miR-210-3p Trametinib 11707110 NSC758246 approved sensitive Low Melanoma cell line (MML-1)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-miR-210-3p Tamoxifen 2733525 NSC180973 approved resistant Low Breast Cancer cell line (TAMR4, TAMR8)
hsa-miR-210-3p Aromatase Inhibitor sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Epirubicin 41867 NSC256942 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-210-3p Docetaxel 148124 NSC628503 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-210-3p Vinorelbine 44424639 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-210-3p 1'-Acetoxychavicol acetate 119104 NSC711510 resistant Low Cervical Cancer cell line (Ca Ski, SiHa)
hsa-miR-210-3p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-210-3p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive Low Renal Cell Cancer cell line (Caki-2)
hsa-miR-210-3p Vinblastine 442111 NSC90636 approved sensitive Low Renal Cell Cancer cell line (Caki-2)
hsa-miR-210-3p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colorectal Cancer cell line (LS174T)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Cholangiocarcinoma cell line (KKU-213, KKU-055, KKU-100)
hsa-miR-210-3p Docetaxel 148124 NSC628503 approved resistant Low Breast Cancer tissue
hsa-miR-210-3p Palbociclib 5330286 NSC758247 approved sensitive High Breast Cancer cell line (T47D)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive High Ovarian Cancer cell line (SKOV3)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer cell line (SKOV3)
hsa-miR-210-3p Cetuximab + Folfox(Fluorouracil + Leucovorin + Oxaliplatin) sensitive High Metastatic Colorectal Cancer tissue
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved sensitive Low Colorectal Cancer cell line (HT-29)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Cancer cell line (BXPC-3)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colorectal Adenocarcinoma cell line (HT-29)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Cancer cell line (PANC-1)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant Low Oral Cancer cell line (SAS, HSC-3, HSC-4)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive High Endometrial Serous Carcinoma cell line (USPC1)
hsa-miR-210-3p Imatinib 5291 NSC743414 approved sensitive Low Chronic Myelogenous Leukemia tissue
hsa-miR-210-3p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375)
hsa-miR-210-3p Sunitinib 5329102 NSC750690 approved resistant Low Renal Cell Cancer tissue
hsa-miR-210-3p Temozolomide 5394 NSC362856 approved resistant Low Glioma cell line (U87)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-210-3p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (PLC/PRF5-R1, PLC/PRF5-R2, PLC/PRF5)
hsa-miR-210-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (A375)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (total RNA)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (mitochondrial RNA)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (HeyA8)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM11)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM43)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant cell line (BAS)
hsa-miR-210-3p Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-210-3p Exemestane 60198 NSC713563 approved resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone 6013 NSC9700 approved resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Exemestane resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Letrozole resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Anastrozole resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Tamoxifen resistant cell line (MCF-7)
hsa-miR-210-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-210-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-210-3p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-210-3p Tamoxifen 2733525 NSC180973 approved resistant cell line (TamR4)
hsa-miR-210-3p Tamoxifen 2733525 NSC180973 approved resistant cell line (TamR8)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR20)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR200)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR70)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-210-3p Bortezomib 387447 NSC681239 approved sensitive cell line (CCRF-CEM) (100 nM)
hsa-miR-210-3p Bortezomib 387447 NSC681239 approved sensitive cell line (CCRF-CEM) (200 nM)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (Panc1-GR1)
hsa-miR-210-3p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line (H23)
hsa-miR-210-3p Cetuximab sensitive tissue (colorectal carcinoma)

Error report submission