miRTarBase - #MIRT003287


—
pre-miRNA Information
pre-miRNA hsa-mir-29b-1   
Genomic Coordinates chr7: 130877459 - 130877539
Synonyms MIRN29B1, miRNA29B1, MIR29B1
Description Homo sapiens miR-29b-1 stem-loop
Comment Mourelatos et al. identified two copies of this sequence mapping to chromosome 7, and assigned the names mir-102-7.1 and mir-102-7.2 . Subsequent genome assemblies suggest the presence of only one miR-102 locus on chromosome 7. Human miR-102 is a homologue of mouse miR-29b (MIR:MI0000143) and so has been renamed here for consistency.
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-29b-2   
Genomic Coordinates chr1: 207802443 - 207802523
Synonyms MIRN29B2, mir-29b-2, MIR29B2
Description Homo sapiens miR-29b-2 stem-loop
Comment This sequence was named mir-102-1 in reference . Human miR-102 is a homologue of mouse miR-29b (MIR:MI0000143) and so has been renamed here for consistency.
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-29b-3p
Sequence 52| UAGCACCAUUUGAAAUCAGUGUU |74
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 2 7 - 130877488 29233923 MiREDiBase
A-to-I 2 1 - 207802471 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs773555186 20 dbSNP
rs1390817128 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MCL1   
Synonyms BCL2L3, EAT, MCL1-ES, MCL1L, MCL1S, Mcl-1, TM, bcl2-L-3, mcl1/EAT
Description MCL1, BCL2 family apoptosis regulator
Transcript NM_021960   
Other Transcripts NM_182763   
Expression
Putative miRNA Targets on MCL1
3'UTR of MCL1
(miRNA target sites are highlighted)		 
>MCL1|NM_021960|3'UTR
   1 CCTTACTGTAAGTGCAATAGTTGACTTTTAACCAACCACCACCACCACCAAAACCAGTTTATGCAGTTGGACTCCAAGCT
  81 GTAACTTCCTAGAGTTGCACCCTAGCAACCTAGCCAGAAAAGCAAGTGGCAAGAGGATTATGGCTAACAAGAATAAATAC
 161 ATGGGAAGAGTGCTCCCCATTGATTGAAGAGTCACTGTCTGAAAGAAGCAAAGTTCAGTTTCAGCAACAAACAAACTTTG
 241 TTTGGGAAGCTATGGAGGAGGACTTTTAGATTTAGTGAAGATGGTAGGGTGGAAAGACTTAATTTCCTTGTTGAGAACAG
 321 GAAAGTGGCCAGTAGCCAGGCAAGTCATAGAATTGATTACCCGCCGAATTCATTAATTTACTGTAGTGTTAAGAGAAGCA
 401 CTAAGAATGCCAGTGACCTGTGTAAAAGTTACAAGTAATAGAACTATGACTGTAAGCCTCAGTACTGTACAAGGGAAGCT
 481 TTTCCTCTCTCTAATTAGCTTTCCCAGTATACTTCTTAGAAAGTCCAAGTGTTCAGGACTTTTATACCTGTTATACTTTG
 561 GCTTGGTTTCCATGATTCTTACTTTATTAGCCTAGTTTATCACCAATAATACTTGACGGAAGGCTCAGTAATTAGTTATG
 641 AATATGGATATCCTCAATTCTTAAGACAGCTTGTAAATGTATTTGTAAAAATTGTATATATTTTTACAGAAAGTCTATTT
 721 CTTTGAAACGAAGGAAGTATCGAATTTACATTAGTTTTTTTCATACCCTTTTGAACTTTGCAACTTCCGTAATTAGGAAC
 801 CTGTTTCTTACAGCTTTTCTATGCTAAACTTTGTTCTGTTCAGTTCTAGAGTGTATACAGAACGAATTGATGTGTAACTG
 881 TATGCAGACTGGTTGTAGTGGAACAAATCTGATAACTATGCAGGTTTAAATTTTCTTATCTGATTTTGGTAAGTATTCCT
 961 TAGATAGGTTTTTCTTTGAAAACCTGGGATTGAGAGGTTGATGAATGGAAATTCTTTCACTTCATTATATGCAAGTTTTC
1041 AATAATTAGGTCTAAGTGGAGTTTTAAGGTTACTGATGACTTACAAATAATGGGCTCTGATTGGGCAATACTCATTTGAG
1121 TTCCTTCCATTTGACCTAATTTAACTGGTGAAATTTAAAGTGAATTCATGGGCTCATCTTTAAAGCTTTTACTAAAAGAT
1201 TTTCAGCTGAATGGAACTCATTAGCTGTGTGCATATAAAAAGATCACATCAGGTGGATGGAGAGACATTTGATCCCTTGT
1281 TTGCTTAATAAATTATAAAATGATGGCTTGGAAAAGCAGGCTAGTCTAACCATGGTGCTATTATTAGGCTTGCTTGTTAC
1361 ACACACAGGTCTAAGCCTAGTATGTCAATAAAGCAAATACTTACTGTTTTGTTTCTATTAATGATTCCCAAACCTTGTTG
1441 CAAGTTTTTGCATTGGCATCTTTGGATTTCAGTCTTGATGTTTGTTCTATCAGACTTAACCTTTTATTTCCTGTCCTTCC
1521 TTGAAATTGCTGATTGTTCTGCTCCCTCTACAGATATTTATATCAATTCCTACAGCTTTCCCCTGCCATCCCTGAACTCT
1601 TTCTAGCCCTTTTAGATTTTGGCACTGTGAAACCCCTGCTGGAAACCTGAGTGACCCTCCCTCCCCACCAAGAGTCCACA
1681 GACCTTTCATCTTTCACGAACTTGATCCTGTTAGCAGGTGGTAATACCATGGGTGCTGTGACACTAACAGTCATTGAGAG
1761 GTGGGAGGAAGTCCCTTTTCCTTGGACTGGTATCTTTTCAACTATTGTTTTATCCTGTCTTTGGGGGCAATGTGTCAAAA
1841 GTCCCCTCAGGAATTTTCAGAGGAAAGAACATTTTATGAGGCTTTCTCTAAAGTTTCCTTTGTATAGGAGTATGCTCACT
1921 TAAATTTACAGAAAGAGGTGAGCTGTGTTAAACCTCAGAGTTTAAAAGCTACTGATAAACTGAAGAAAGTGTCTATATTG
2001 GAACTAGGGTCATTTGAAAGCTTCAGTCTCGGAACATGACCTTTAGTCTGTGGACTCCATTTAAAAATAGGTATGAATAA
2081 GATGACTAAGAATGTAATGGGGAAGAACTGCCCTGCCTGCCCATCTCAGAGCCATAAGGTCATCTTTGCTAGAGCTATTT
2161 TTACCTATGTATTTATCGTTCTTGATCATAAGCCGCTTATTTATATCATGTATCTCTAAGGACCTAAAAGCACTTTATGT
2241 AGTTTTTAATTAATCTTAAGATCTGGTTACGGTAACTAAAAAAGCCTGTCTGCCAAATCCAGTGGAAACAAGTGCATAGA
2321 TGTGAATTGGTTTTTAGGGGCCCCACTTCCCAATTCATTAGGTATGACTGTGGAAATACAGACAAGGATCTTAGTTGATA
2401 TTTTGGGCTTGGGGCAGTGAGGGCTTAGGACACCCCAAGTGGTTTGGGAAAGGAGGAGGGGAGTGGTGGGTTTATAGGGG
2481 GAGGAGGAGGCAGGTGGTCTAAGTGCTGACTGGCTACGTAGTTCGGGCAAATCCTCCAAAAGGGAAAGGGAGGATTTGCT
2561 TAGAAGGATGGCGCTCCCAGTGACTACTTTTTGACTTCTGTTTGTCTTACGCTTCTCTCAGGGAAAAACATGCAGTCCTC
2641 TAGTGTTTCATGTACATTCTGTGGGGGGTGAACACCTTGGTTCTGGTTAAACAGCTGTACTTTTGATAGCTGTGCCAGGA
2721 AGGGTTAGGACCAACTACAAATTAATGTTGGTTGTCAAATGTAGTGTGTTTCCCTAACTTTCTGTTTTTCCTGAGAAAAA
2801 AAAATAAATCTTTTATTCAAATACAGGGAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uugUGACUAAAGUU--UACCACGAu 5'
             :|| | | :||  |||||||| 
Target 5' cagGCT-AGTCTAACCATGGTGCTa 3'
 1317 - 1340 153.00 -12.40
2 
miRNA  3' uuguGACUAAAGUUUACCACgau 5'
              || |||| || |||||   
Target 5' tgacCTAATTT-AACTGGTGaaa 3'
 1132 - 1153 126.00 -8.32
3 
miRNA  3' uuguGACUAAAGUU--UACCACGAu 5'
              :|| ||  ||  |||| ||| 
Target 5' ggatTTGCTTAGAAGGATGGCGCTc 3'
 2552 - 2576 125.00 -8.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN15719619 12 COSMIC
COSN30503441 22 COSMIC
COSN19205666 53 COSMIC
COSN30189641 60 COSMIC
COSN31482088 66 COSMIC
COSN31512252 74 COSMIC
COSN26983960 79 COSMIC
COSN17159063 88 COSMIC
COSN8319677 99 COSMIC
COSN17151760 101 COSMIC
COSN13468327 107 COSMIC
COSN26983962 130 COSMIC
COSN26983961 131 COSMIC
COSN31502687 131 COSMIC
COSN32050047 145 COSMIC
COSN26983959 164 COSMIC
COSN31572461 176 COSMIC
COSN31554093 213 COSMIC
COSN30108134 245 COSMIC
COSN31769400 263 COSMIC
COSN30539072 441 COSMIC
COSN7177051 508 COSMIC
COSN24219896 537 COSMIC
COSN27358256 540 COSMIC
COSN31569236 564 COSMIC
COSN4900754 579 COSMIC
COSN4743875 697 COSMIC
COSN15720117 712 COSMIC
COSN31555441 725 COSMIC
COSN31533596 800 COSMIC
COSN21642722 915 COSMIC
COSN16353252 938 COSMIC
COSN20095347 960 COSMIC
COSN31486356 1019 COSMIC
COSN15776706 1123 COSMIC
COSN31515005 1133 COSMIC
COSN7177049 1238 COSMIC
COSN31513567 1247 COSMIC
COSN25557428 1286 COSMIC
COSN26561995 1358 COSMIC
COSN26351498 1368 COSMIC
COSN31539413 1368 COSMIC
COSN31546146 2102 COSMIC
COSN28735785 2104 COSMIC
COSN31769396 2123 COSMIC
COSN24219895 2383 COSMIC
COSN27958399 2597 COSMIC
COSN30175175 2619 COSMIC
COSN15367460 2686 COSMIC
COSN21460699 2788 COSMIC
COSN22775405 2791 COSMIC
rs34355066 325 GWAS
rs878471 2104 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1292349960 1 dbSNP
rs148874038 2 dbSNP
rs756583252 6 dbSNP
rs1282568624 9 dbSNP
rs1006737391 17 dbSNP
rs1447559895 19 dbSNP
rs200971785 21 dbSNP
rs764320835 23 dbSNP
rs1398488491 25 dbSNP
rs761136566 29 dbSNP
rs752831607 31 dbSNP
rs767628417 38 dbSNP
rs775760925 38 dbSNP
rs1427179365 41 dbSNP
rs148777636 51 dbSNP
rs34100999 51 dbSNP
rs370323092 51 dbSNP
rs755159122 51 dbSNP
rs1410972323 56 dbSNP
rs587649103 63 dbSNP
rs1042976493 66 dbSNP
rs1193266369 73 dbSNP
rs184099170 75 dbSNP
rs750615476 79 dbSNP
rs1187173132 83 dbSNP
rs1418825609 87 dbSNP
rs1408719924 90 dbSNP
rs1057212417 100 dbSNP
rs587696105 104 dbSNP
rs200590372 108 dbSNP
rs754272361 108 dbSNP
rs767651113 109 dbSNP
rs938732842 114 dbSNP
rs3841831 115 dbSNP
rs776912740 120 dbSNP
rs927416475 122 dbSNP
rs1430897430 129 dbSNP
rs1482631874 133 dbSNP
rs587618423 151 dbSNP
rs1359167302 155 dbSNP
rs1235091931 157 dbSNP
rs947052836 158 dbSNP
rs1333942657 159 dbSNP
rs912873227 161 dbSNP
rs980654943 167 dbSNP
rs942201431 172 dbSNP
rs1448972280 175 dbSNP
rs1194091315 176 dbSNP
rs1205052886 187 dbSNP
rs1476856228 202 dbSNP
rs587760732 210 dbSNP
rs1323721112 213 dbSNP
rs1419168635 213 dbSNP
rs983739832 217 dbSNP
rs951024572 232 dbSNP
rs988974605 233 dbSNP
rs192106468 234 dbSNP
rs34664576 237 dbSNP
rs369449181 237 dbSNP
rs1328046496 238 dbSNP
rs1317145588 239 dbSNP
rs1342947001 240 dbSNP
rs1416067732 240 dbSNP
rs775595778 245 dbSNP
rs1354730625 250 dbSNP
rs1231319475 263 dbSNP
rs34896634 266 dbSNP
rs1380518711 267 dbSNP
rs587745463 272 dbSNP
rs587597923 276 dbSNP
rs760153527 276 dbSNP
rs1487369881 282 dbSNP
rs1213098153 289 dbSNP
rs1018040703 291 dbSNP
rs774285339 298 dbSNP
rs1485637388 303 dbSNP
rs1185962495 305 dbSNP
rs1365943820 306 dbSNP
rs888457964 306 dbSNP
rs1470688499 309 dbSNP
rs762914760 310 dbSNP
rs1436106954 312 dbSNP
rs1312975995 315 dbSNP
rs968548970 317 dbSNP
rs1025562693 318 dbSNP
rs587683059 321 dbSNP
rs773069035 322 dbSNP
rs34355066 325 dbSNP
rs1399757105 329 dbSNP
rs1336184401 334 dbSNP
rs762962988 346 dbSNP
rs1166431044 350 dbSNP
rs895890737 350 dbSNP
rs747963232 362 dbSNP
rs74124936 363 dbSNP
rs905670084 364 dbSNP
rs1485364047 365 dbSNP
rs1057434930 366 dbSNP
rs1002896056 372 dbSNP
rs947252336 383 dbSNP
rs1181519233 384 dbSNP
rs1236668501 385 dbSNP
rs1455308605 386 dbSNP
rs587701070 386 dbSNP
rs912905047 393 dbSNP
rs587619526 394 dbSNP
rs748880490 399 dbSNP
rs1169615332 416 dbSNP
rs1397125967 419 dbSNP
rs1390666991 420 dbSNP
rs988487568 421 dbSNP
rs933095867 424 dbSNP
rs1478941020 432 dbSNP
rs923027312 432 dbSNP
rs1347308535 433 dbSNP
rs587734066 434 dbSNP
rs1253655793 437 dbSNP
rs1340697507 439 dbSNP
rs587658622 441 dbSNP
rs1193752321 447 dbSNP
rs1195662637 449 dbSNP
rs1256592447 455 dbSNP
rs1470064869 462 dbSNP
rs974876805 469 dbSNP
rs1251621686 474 dbSNP
rs1044516271 476 dbSNP
rs1431014403 481 dbSNP
rs1194684103 483 dbSNP
rs942168832 484 dbSNP
rs1240668283 485 dbSNP
rs909420519 487 dbSNP
rs984342387 489 dbSNP
rs587602041 491 dbSNP
rs1025631460 493 dbSNP
rs781700317 493 dbSNP
rs1326876622 494 dbSNP
rs769307146 495 dbSNP
rs745392352 504 dbSNP
rs587704688 506 dbSNP
rs1380408650 507 dbSNP
rs976799382 509 dbSNP
rs895910187 513 dbSNP
rs965096325 516 dbSNP
rs1317094920 518 dbSNP
rs1453457689 526 dbSNP
rs1035796553 527 dbSNP
rs1376303389 528 dbSNP
rs1206461446 531 dbSNP
rs1261859117 537 dbSNP
rs1427360554 543 dbSNP
rs910948027 548 dbSNP
rs587651106 552 dbSNP
rs985208441 554 dbSNP
rs1001994935 556 dbSNP
rs905702630 561 dbSNP
rs74586841 562 dbSNP
rs1290801902 581 dbSNP
rs1397519222 585 dbSNP
rs1021372832 586 dbSNP
rs1276932716 596 dbSNP
rs776287888 601 dbSNP
rs1357898600 603 dbSNP
rs1011534960 604 dbSNP
rs891704614 606 dbSNP
rs955936338 607 dbSNP
rs2737825 610 dbSNP
rs770494791 617 dbSNP
rs145589907 618 dbSNP
rs1260926762 623 dbSNP
rs933020913 626 dbSNP
rs1213820844 628 dbSNP
rs587640787 635 dbSNP
rs774728206 638 dbSNP
rs1003275247 639 dbSNP
rs1485961240 639 dbSNP
rs1038792068 640 dbSNP
rs1420630019 648 dbSNP
rs905898606 652 dbSNP
rs1364591445 655 dbSNP
rs587755230 657 dbSNP
rs1296441090 662 dbSNP
rs911432702 663 dbSNP
rs1415974691 665 dbSNP
rs984244238 667 dbSNP
rs1044873409 669 dbSNP
rs1006270309 670 dbSNP
rs1352510890 678 dbSNP
rs1250804563 682 dbSNP
rs1208960786 685 dbSNP
rs1357087106 695 dbSNP
rs887869962 696 dbSNP
rs1047896561 697 dbSNP
rs773958859 698 dbSNP
rs1209393303 700 dbSNP
rs758444438 701 dbSNP
rs1352924962 713 dbSNP
rs1235632400 717 dbSNP
rs186964898 717 dbSNP
rs2737826 722 dbSNP
rs1177552530 727 dbSNP
rs587693298 729 dbSNP
rs587642479 730 dbSNP
rs587764964 731 dbSNP
rs1157045188 734 dbSNP
rs1396994490 735 dbSNP
rs910927699 737 dbSNP
rs1176026338 738 dbSNP
rs970127587 741 dbSNP
rs775088934 745 dbSNP
rs1444886970 749 dbSNP
rs143379465 750 dbSNP
rs985092758 752 dbSNP
rs1444151608 753 dbSNP
rs1367899095 755 dbSNP
rs1371142076 756 dbSNP
rs1011397263 761 dbSNP
rs1276483614 762 dbSNP
rs755381292 762 dbSNP
rs1053057607 766 dbSNP
rs997810674 788 dbSNP
rs914343984 789 dbSNP
rs587711087 791 dbSNP
rs1255090352 793 dbSNP
rs955929495 795 dbSNP
rs116763104 796 dbSNP
rs1039110190 797 dbSNP
rs1423081957 798 dbSNP
rs943154746 799 dbSNP
rs908950866 801 dbSNP
rs746161484 811 dbSNP
rs1036010238 819 dbSNP
rs1400087752 821 dbSNP
rs780453278 823 dbSNP
rs1464361781 824 dbSNP
rs970383321 825 dbSNP
rs756166995 829 dbSNP
rs775407769 833 dbSNP
rs587655920 836 dbSNP
rs1156235914 837 dbSNP
rs1272574290 846 dbSNP
rs1363404835 847 dbSNP
rs1215114720 850 dbSNP
rs768440046 857 dbSNP
rs1364007110 858 dbSNP
rs1198325723 860 dbSNP
rs918720548 860 dbSNP
rs587758171 863 dbSNP
rs1489788850 864 dbSNP
rs587713527 867 dbSNP
rs750477615 878 dbSNP
rs887837372 879 dbSNP
rs1245077663 882 dbSNP
rs1026425062 883 dbSNP
rs960529938 909 dbSNP
rs993651725 911 dbSNP
rs1477077915 914 dbSNP
rs1167566461 915 dbSNP
rs941144676 919 dbSNP
rs1404432728 920 dbSNP
rs1321124819 923 dbSNP
rs769484322 930 dbSNP
rs1346507489 931 dbSNP
rs1041022603 936 dbSNP
rs200885702 939 dbSNP
rs980086429 946 dbSNP
rs1235000667 955 dbSNP
rs374572012 958 dbSNP
rs371616046 959 dbSNP
rs199586359 960 dbSNP
rs869227088 961 dbSNP
rs145243728 963 dbSNP
rs113912701 964 dbSNP
rs3065111 964 dbSNP
rs58090782 964 dbSNP
rs1287952188 973 dbSNP
rs1021737381 979 dbSNP
rs1217413278 980 dbSNP
rs1262491032 987 dbSNP
rs1190642382 993 dbSNP
rs1282077959 993 dbSNP
rs1369436224 995 dbSNP
rs1472664255 1002 dbSNP
rs1161140469 1004 dbSNP
rs1225525083 1016 dbSNP
rs943592135 1020 dbSNP
rs1274450430 1023 dbSNP
rs889372515 1024 dbSNP
rs1221971999 1025 dbSNP
rs1049363256 1027 dbSNP
rs587633503 1030 dbSNP
rs947080733 1034 dbSNP
rs955908006 1038 dbSNP
rs867946616 1041 dbSNP
rs1445534419 1048 dbSNP
rs34035628 1058 dbSNP
rs767707916 1066 dbSNP
rs1353122681 1071 dbSNP
rs1241054516 1072 dbSNP
rs1285435147 1075 dbSNP
rs1399788560 1078 dbSNP
rs1213707790 1080 dbSNP
rs1257445101 1080 dbSNP
rs1442275890 1081 dbSNP
rs1185852665 1082 dbSNP
rs1234902322 1084 dbSNP
rs1343891299 1084 dbSNP
rs914311424 1086 dbSNP
rs1157635051 1087 dbSNP
rs1320921391 1087 dbSNP
rs988555679 1093 dbSNP
rs1436006990 1096 dbSNP
rs1173154882 1099 dbSNP
rs934487328 1103 dbSNP
rs183559867 1104 dbSNP
rs190045126 1110 dbSNP
rs981689777 1111 dbSNP
rs969971940 1113 dbSNP
rs1336083483 1114 dbSNP
rs1479229047 1116 dbSNP
rs1430978025 1119 dbSNP
rs1199802680 1127 dbSNP
rs1474992758 1129 dbSNP
rs1022906171 1132 dbSNP
rs781531097 1136 dbSNP
rs984771424 1136 dbSNP
rs1236585764 1139 dbSNP
rs1217910976 1140 dbSNP
rs757541863 1142 dbSNP
rs1257160042 1150 dbSNP
rs1344940450 1153 dbSNP
rs1199177880 1160 dbSNP
rs1275590882 1162 dbSNP
rs1458458474 1164 dbSNP
rs1235972488 1169 dbSNP
rs1447629460 1169 dbSNP
rs1455238385 1174 dbSNP
rs1198966809 1177 dbSNP
rs1026392933 1184 dbSNP
rs139951222 1187 dbSNP
rs1802505 1188 dbSNP
rs868565095 1189 dbSNP
rs866785989 1191 dbSNP
rs1331014491 1198 dbSNP
rs1218397797 1207 dbSNP
rs901926337 1212 dbSNP
rs1388683075 1216 dbSNP
rs1302078042 1220 dbSNP
rs1019076056 1229 dbSNP
rs1001346754 1233 dbSNP
rs1272401468 1233 dbSNP
rs1432048153 1238 dbSNP
rs897323469 1249 dbSNP
rs1340431669 1260 dbSNP
rs1801298 1272 dbSNP
rs1335408419 1283 dbSNP
rs748026354 1284 dbSNP
rs763951743 1289 dbSNP
rs1407824704 1296 dbSNP
rs1266078131 1297 dbSNP
rs1430925658 1299 dbSNP
rs1176790497 1302 dbSNP
rs1424246567 1310 dbSNP
rs889358840 1316 dbSNP
rs1409119273 1317 dbSNP
rs587724088 1318 dbSNP
rs938980567 1319 dbSNP
rs1168293536 1320 dbSNP
rs1419674992 1322 dbSNP
rs1459669359 1326 dbSNP
rs762874897 1333 dbSNP
rs1043986201 1336 dbSNP
rs1390172132 1337 dbSNP
rs1385151061 1339 dbSNP
rs928862115 1340 dbSNP
rs1341694225 1344 dbSNP
rs1218490927 1345 dbSNP
rs980326528 1347 dbSNP
rs948713641 1349 dbSNP
rs1245127381 1352 dbSNP
rs1487259226 1356 dbSNP
rs947048119 1356 dbSNP
rs990238414 1364 dbSNP
rs35900369 1369 dbSNP
rs1052722318 1371 dbSNP
rs1191367337 1376 dbSNP
rs1259384903 1385 dbSNP
rs1242465302 1391 dbSNP
rs966010852 1392 dbSNP
rs1462759628 1396 dbSNP
rs1456530180 1398 dbSNP
rs934393359 1399 dbSNP
rs1204140908 1400 dbSNP
rs1361200080 1401 dbSNP
rs1306104962 1402 dbSNP
rs587599693 1402 dbSNP
rs1381845044 1404 dbSNP
rs41305052 1407 dbSNP
rs1045546748 1413 dbSNP
rs887450820 1414 dbSNP
rs780819753 1415 dbSNP
rs1464042467 1417 dbSNP
rs948582433 1421 dbSNP
rs1241788936 1430 dbSNP
rs1359275121 1437 dbSNP
rs1313624526 1446 dbSNP
rs915815863 1448 dbSNP
rs199960497 1450 dbSNP
rs1027236835 1453 dbSNP
rs1384411043 1453 dbSNP
rs199858277 1453 dbSNP
rs984738874 1456 dbSNP
rs993300523 1461 dbSNP
rs1483487357 1479 dbSNP
rs1181079503 1481 dbSNP
rs952021469 1485 dbSNP
rs1336951428 1494 dbSNP
rs1422315065 1499 dbSNP
rs765101383 1502 dbSNP
rs1352437722 1503 dbSNP
rs1037225944 1506 dbSNP
rs1419135893 1511 dbSNP
rs1361397101 1512 dbSNP
rs1466954452 1515 dbSNP
rs1302644795 1522 dbSNP
rs972481279 1526 dbSNP
rs938868340 1529 dbSNP
rs1375571238 1535 dbSNP
rs749275603 1535 dbSNP
rs1280053322 1536 dbSNP
rs966124333 1536 dbSNP
rs1254048678 1537 dbSNP
rs1384522440 1538 dbSNP
rs1044677373 1540 dbSNP
rs1019473337 1541 dbSNP
rs1051373 1543 dbSNP
rs1200799089 1545 dbSNP
rs1446488294 1546 dbSNP
rs1239014262 1547 dbSNP
rs769502746 1548 dbSNP
rs1007714788 1550 dbSNP
rs948912289 1553 dbSNP
rs1243877445 1556 dbSNP
rs953583260 1556 dbSNP
rs1176876451 1561 dbSNP
rs1022502274 1562 dbSNP
rs1427281879 1565 dbSNP
rs1176720346 1566 dbSNP
rs1434287722 1576 dbSNP
rs1479742699 1577 dbSNP
rs914617941 1579 dbSNP
rs1205644488 1580 dbSNP
rs990144063 1591 dbSNP
rs1011074989 1592 dbSNP
rs34164836 1597 dbSNP
rs1444033722 1601 dbSNP
rs1276136742 1608 dbSNP
rs1490307048 1626 dbSNP
rs759019033 1653 dbSNP
rs1248858792 1654 dbSNP
rs1299061241 1655 dbSNP
rs185535988 1657 dbSNP
rs1360817657 1662 dbSNP
rs924669292 1662 dbSNP
rs587598540 1664 dbSNP
rs906932161 1674 dbSNP
rs1202649957 1675 dbSNP
rs1248552184 1680 dbSNP
rs1488836234 1686 dbSNP
rs1017355736 1692 dbSNP
rs1370653503 1694 dbSNP
rs1045917761 1710 dbSNP
rs1479054659 1714 dbSNP
rs756724089 1719 dbSNP
rs1423306942 1726 dbSNP
rs1410205347 1728 dbSNP
rs986012651 1732 dbSNP
rs1350000378 1733 dbSNP
rs776000116 1742 dbSNP
rs1291772318 1745 dbSNP
rs951960639 1748 dbSNP
rs1301194343 1753 dbSNP
rs948572958 1761 dbSNP
rs1219099033 1771 dbSNP
rs1277368196 1777 dbSNP
rs1315786323 1780 dbSNP
rs1213080911 1786 dbSNP
rs1027310244 1796 dbSNP
rs1322475295 1797 dbSNP
rs1220913738 1800 dbSNP
rs770530379 1801 dbSNP
rs1489573720 1803 dbSNP
rs1048925634 1811 dbSNP
rs180679633 1812 dbSNP
rs961713066 1815 dbSNP
rs1164698699 1819 dbSNP
rs1385789757 1822 dbSNP
rs1035195899 1824 dbSNP
rs1162098989 1830 dbSNP
rs1158405602 1834 dbSNP
rs905608104 1846 dbSNP
rs907374226 1856 dbSNP
rs1410431849 1867 dbSNP
rs771982125 1870 dbSNP
rs1480300013 1872 dbSNP
rs1044583094 1881 dbSNP
rs1267146524 1883 dbSNP
rs930510353 1884 dbSNP
rs77328195 1885 dbSNP
rs893382714 1891 dbSNP
rs1289710640 1892 dbSNP
rs1355920976 1899 dbSNP
rs189748465 1906 dbSNP
rs1285920227 1911 dbSNP
rs35392872 1913 dbSNP
rs924604969 1916 dbSNP
rs1472280836 1918 dbSNP
rs1181322415 1930 dbSNP
rs911974039 1931 dbSNP
rs1214447109 1934 dbSNP
rs1419741255 1939 dbSNP
rs587713214 1943 dbSNP
rs1308658618 1945 dbSNP
rs587678342 1950 dbSNP
rs1170552026 1952 dbSNP
rs1416044795 1953 dbSNP
rs1334602656 1957 dbSNP
rs1281064151 1965 dbSNP
rs1406559036 1967 dbSNP
rs768964965 1973 dbSNP
rs1011043790 1978 dbSNP
rs587770746 1981 dbSNP
rs1313149796 1982 dbSNP
rs1451680321 1987 dbSNP
rs956930157 1991 dbSNP
rs1031695058 1992 dbSNP
rs985918906 2005 dbSNP
rs1202663484 2018 dbSNP
rs1279814046 2022 dbSNP
rs35176837 2024 dbSNP
rs373089781 2026 dbSNP
rs113945232 2027 dbSNP
rs770200959 2028 dbSNP
rs1481002751 2031 dbSNP
rs1261639799 2037 dbSNP
rs1334576510 2039 dbSNP
rs1478979800 2041 dbSNP
rs906895954 2044 dbSNP
rs753072919 2046 dbSNP
rs11549748 2047 dbSNP
rs971977954 2050 dbSNP
rs1045483324 2052 dbSNP
rs962022949 2055 dbSNP
rs1484595950 2060 dbSNP
rs1261921741 2063 dbSNP
rs1335038453 2064 dbSNP
rs587615689 2064 dbSNP
rs1322323136 2066 dbSNP
rs587756927 2072 dbSNP
rs894234830 2079 dbSNP
rs969120018 2080 dbSNP
rs1023169716 2082 dbSNP
rs1331509629 2088 dbSNP
rs1344837658 2091 dbSNP
rs587684292 2095 dbSNP
rs878471 2104 dbSNP
rs1380405568 2109 dbSNP
rs1457939669 2110 dbSNP
rs930479277 2113 dbSNP
rs1247861357 2115 dbSNP
rs1452800573 2116 dbSNP
rs1321222350 2120 dbSNP
rs1479381911 2123 dbSNP
rs893283022 2145 dbSNP
rs1469370606 2148 dbSNP
rs1466359428 2150 dbSNP
rs1404173222 2153 dbSNP
rs1178939056 2155 dbSNP
rs1466847772 2164 dbSNP
rs1324852668 2173 dbSNP
rs1372918585 2174 dbSNP
rs1403570461 2189 dbSNP
rs199815201 2190 dbSNP
rs1319007092 2191 dbSNP
rs1430772641 2199 dbSNP
rs200484447 2201 dbSNP
rs1036723903 2202 dbSNP
rs1357921316 2205 dbSNP
rs1209926333 2219 dbSNP
rs1460539547 2221 dbSNP
rs1240847149 2229 dbSNP
rs587675454 2232 dbSNP
rs903184066 2233 dbSNP
rs1345304713 2243 dbSNP
rs1040372059 2251 dbSNP
rs1170095173 2251 dbSNP
rs944723879 2252 dbSNP
rs587632369 2254 dbSNP
rs986157154 2257 dbSNP
rs932039435 2259 dbSNP
rs1423346995 2261 dbSNP
rs915346401 2265 dbSNP
rs587734531 2266 dbSNP
rs587679425 2267 dbSNP
rs587602461 2273 dbSNP
rs961985764 2274 dbSNP
rs375137223 2275 dbSNP
rs1380731127 2279 dbSNP
rs34659089 2280 dbSNP
rs927656022 2282 dbSNP
rs982810065 2284 dbSNP
rs1396777116 2285 dbSNP
rs981789190 2289 dbSNP
rs969152527 2296 dbSNP
rs1286648055 2297 dbSNP
rs1396081985 2299 dbSNP
rs1184579907 2305 dbSNP
rs1023406200 2312 dbSNP
rs989198768 2313 dbSNP
rs1166450017 2316 dbSNP
rs957531979 2325 dbSNP
rs1463903119 2335 dbSNP
rs1422813734 2342 dbSNP
rs35351880 2345 dbSNP
rs758210233 2349 dbSNP
rs1391321649 2351 dbSNP
rs758430062 2352 dbSNP
rs1024354219 2353 dbSNP
rs1453590850 2360 dbSNP
rs35609481 2369 dbSNP
rs397844453 2369 dbSNP
rs35150036 2371 dbSNP
rs1396301607 2378 dbSNP
rs894205339 2383 dbSNP
rs1027427799 2388 dbSNP
rs1241666710 2389 dbSNP
rs1382796331 2390 dbSNP
rs1019391623 2391 dbSNP
rs587607080 2397 dbSNP
rs994667164 2403 dbSNP
rs1189052601 2406 dbSNP
rs1257566691 2409 dbSNP
rs1483435625 2411 dbSNP
rs1008834641 2422 dbSNP
rs1442565909 2424 dbSNP
rs1249394401 2427 dbSNP
rs1242741421 2430 dbSNP
rs1442942838 2440 dbSNP
rs1180591970 2455 dbSNP
rs897694347 2456 dbSNP
rs1036203981 2458 dbSNP
rs1157528303 2459 dbSNP
rs1379775709 2470 dbSNP
rs1466872192 2473 dbSNP
rs182383007 2474 dbSNP
rs1448453494 2477 dbSNP
rs1331482151 2481 dbSNP
rs1371927680 2487 dbSNP
rs1481532851 2489 dbSNP
rs930690609 2493 dbSNP
rs1303309099 2497 dbSNP
rs899034752 2502 dbSNP
rs890392214 2503 dbSNP
rs765448623 2513 dbSNP
rs759377888 2514 dbSNP
rs1176054465 2520 dbSNP
rs915314010 2520 dbSNP
rs1427596179 2521 dbSNP
rs1466885294 2521 dbSNP
rs989558208 2526 dbSNP
rs1353483393 2538 dbSNP
rs1439374849 2559 dbSNP
rs2737827 2568 dbSNP
rs935498669 2569 dbSNP
rs1404215278 2576 dbSNP
rs1327180593 2578 dbSNP
rs1281167837 2580 dbSNP
rs1319708151 2582 dbSNP
rs587666563 2590 dbSNP
rs765841176 2594 dbSNP
rs1273972213 2596 dbSNP
rs1383036899 2598 dbSNP
rs1202541686 2602 dbSNP
rs11850 2604 dbSNP
rs1490666337 2606 dbSNP
rs587738041 2606 dbSNP
rs1033630338 2607 dbSNP
rs968058800 2607 dbSNP
rs1164426344 2609 dbSNP
rs1418362404 2610 dbSNP
rs13677 2611 dbSNP
rs1407786830 2611 dbSNP
rs1023906569 2614 dbSNP
rs1019212361 2616 dbSNP
rs771722861 2619 dbSNP
rs1472875502 2622 dbSNP
rs1009069990 2624 dbSNP
rs587631294 2625 dbSNP
rs587763507 2628 dbSNP
rs1473440020 2629 dbSNP
rs78625781 2633 dbSNP
rs1292150409 2635 dbSNP
rs1221507603 2638 dbSNP
rs11549747 2644 dbSNP
rs899233424 2645 dbSNP
rs1222456770 2649 dbSNP
rs1290198064 2652 dbSNP
rs1489522765 2653 dbSNP
rs1036627235 2658 dbSNP
rs1293876363 2661 dbSNP
rs940551229 2664 dbSNP
rs1183215712 2666 dbSNP
rs1385357315 2670 dbSNP
rs10206 2671 dbSNP
rs1443473150 2686 dbSNP
rs897582969 2691 dbSNP
rs1420160990 2699 dbSNP
rs1350095219 2701 dbSNP
rs1317417397 2712 dbSNP
rs1343169933 2713 dbSNP
rs1015142685 2718 dbSNP
rs1383709885 2719 dbSNP
rs1245350623 2725 dbSNP
rs1312927968 2729 dbSNP
rs1008749260 2730 dbSNP
rs890352368 2732 dbSNP
rs1206185856 2734 dbSNP
rs1284067734 2736 dbSNP
rs1445606137 2743 dbSNP
rs36123358 2755 dbSNP
rs947915498 2760 dbSNP
rs916290226 2761 dbSNP
rs1241390432 2763 dbSNP
rs1351366686 2764 dbSNP
rs1282960907 2766 dbSNP
rs587767833 2768 dbSNP
rs1381584082 2770 dbSNP
rs893846645 2777 dbSNP
rs936447757 2779 dbSNP
rs754763165 2780 dbSNP
rs1405574288 2789 dbSNP
rs1415960036 2790 dbSNP
rs1337080078 2791 dbSNP
rs1407115465 2791 dbSNP
rs1053717294 2792 dbSNP
rs935379041 2793 dbSNP
rs746333411 2794 dbSNP
rs912021679 2797 dbSNP
rs1156330061 2801 dbSNP
rs1221309835 2801 dbSNP
rs1349054923 2801 dbSNP
rs1264072841 2805 dbSNP
rs781738829 2806 dbSNP
rs1473318030 2809 dbSNP
rs3178056 2811 dbSNP
rs1201335075 2816 dbSNP
rs3178057 2818 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HeLa
Disease 4170.0;
Location of target site 3'UTR
Tools used in this research miRanda
Original Description (Extracted from the article) ... "when the mir-29 target site from the Mcl-1 3芒鈧鈩UTR is inserted into the luciferase construct ...

- Mott JL; Kobayashi S; Bronk SF; Gores GJ, 2007, Oncogene.

Article - Mott JL; Kobayashi S; Bronk SF; Gores GJ
- Oncogene, 2007
Cellular expression of Mcl-1, an anti-apoptotic Bcl-2 family member, is tightly regulated. Recently, Bcl-2 expression was shown to be regulated by microRNAs, small endogenous RNA molecules that regulate protein expression through sequence-specific interaction with messenger RNA. By analogy, we reasoned that Mcl-1 expression may also be regulated by microRNAs. We chose human immortalized, but non-malignant, H69 cholangiocyte and malignant KMCH cholangiocarcinoma cell lines for these studies, because Mcl-1 is dysregulated in cells with the malignant phenotype. By in silico analysis, we identified a putative target site in the Mcl-1 mRNA for the mir-29 family, and found that mir-29b was highly expressed in cholangiocytes. Interestingly, mir-29b was downregulated in malignant cells, consistent with Mcl-1 protein upregulation. Enforced mir-29b expression reduced Mcl-1 protein expression in KMCH cells. This effect was direct, as mir-29b negatively regulated the expression of an Mcl-1 3' untranslated region (UTR)-based reporter construct. Enforced mir-29b expression reduced Mcl-1 cellular protein levels and sensitized the cancer cells to tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) cytotoxicity. Transfection of non-malignant cells (that express high levels of mir-29) with a locked-nucleic acid antagonist of mir-29b increased Mcl-1 levels and reduced TRAIL-mediated apoptosis. Thus mir-29 is an endogenous regulator of Mcl-1 protein expression, and thereby, apoptosis.
LinkOut: [PMID: 17404574]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Mraz M; Pospisilova S; Malinova K; Slapak et al.
- Leukemia & lymphoma, 2009
MicroRNAs (miRNAs) are short, non-coding RNAs, which function as evolutionary conserved regulators of a gene expression. They have essential roles in development, cell differentiation, proliferation, apoptosis and chromosome structure. MiRNAs constitute about 3-5% of predicted genes in the human genome (i.e. about 1000); and 20-30% of the protein-coding genes are estimated to be regulated by the miRNAs. The primary evidence that miRNAs possibly act as a novel class of oncogenes/tumor-suppressors comes from the discovery of the miR-15a and miR-16-1 in 13q14 region deleted in chronic lymphocytic leukemia (CLL). Moreover, miRNA signatures have been used to classify tumor types. There have recently been several reports on the miRNAs role in CLL pathogenesis and disease subtypes (according to IgV(H) mutation status). In this report, we will review the published observations and present our miRNA profiling data in aggressive CLL with TP53 abnormalities (deletion and/or mutation of p53 gene). We have identified a deregulated miRNA expression pattern (down regulation of miR-34a, miR-29 and miR-17-5p) in these samples, compared to cells with wild-type TP53. It has previously been shown that miR-34a is directly regulated by p53 and targets BCL-2, miR-29c regulates the MCL-1 and TCL-1 proto-oncogenes and the miR-17-5p targets important cell cycle regulatory molecules. Consequently, these three miRNAs could potentially play important roles in the pathogenesis of aggressive CLL.
LinkOut: [PMID: 19347736]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions K562
Disease MIMAT0000100;
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... "A marked reduction in the luciferase/Renilla ratio was seen for MCL-1 ...

- Garzon R; Heaphy CE; Havelange V; Fabbri M; et al., 2009, Blood.

Article - Garzon R; Heaphy CE; Havelange V; Fabbri M; et al.
- Blood, 2009
MicroRNAs (miRNAs) are associated with cytogenetics and molecular subtypes of acute myelogeneous leukemia (AML), but their impact on AML pathogenesis is poorly understood. We have previously shown that miR-29b expression is deregulated in primary AML blasts. In this work, we investigated the functional role of miR-29b in leukemogenesis. Restoration of miR-29b in AML cell lines and primary samples induces apoptosis and dramatically reduces tumorigenicity in a xenograft leukemia model. Transcriptome analysis after ectopic transfection of synthetic miR-29b into leukemia cells indicates that miR-29b target apoptosis, cell cycle, and proliferation pathways. A significant enrichment for apoptosis genes, including MCL-1, was found among the mRNAs inversely correlated with miR-29b expression in 45 primary AML samples. Together, the data support a tumor suppressor role for miR-29 and provide a rationale for the use of synthetic miR-29b oligonucleotides as a novel strategy to improve treatment response in AML.
LinkOut: [PMID: 19850741]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293T
Location of target site 3'UTR
Tools used in this research miRanda , TargetScan
Original Description (Extracted from the article) ... Bcl-2 and Mcl-1 Are Direct Targets of miR-29. ...

- Xiong Y; Fang JH; Yun JP; Yang J; Zhang Y; et al., 2010, Hepatology (Baltimore, Md.).

Article - Xiong Y; Fang JH; Yun JP; Yang J; Zhang Y; et al.
- Hepatology (Baltimore, Md.), 2010
UNLABELLED: Based on microarray data, we have previously shown a significant down-regulation of miR-29 in hepatocellular carcinoma (HCC) tissues. To date, the role of miR-29 deregulation in hepatocarcinogenesis and the signaling pathways by which miR-29 exerts its function and modulates the malignant phenotypes of HCC cells remain largely unknown. In this study, we confirmed that reduced expression of miR-29 was a frequent event in HCC tissues using both Northern blot and real-time quantitative reverse-transcription polymerase chain reaction. More interestingly, we found that miR-29 down-regulation was significantly associated with worse disease-free survival of HCC patients. Both gain- and loss-of-function studies revealed that miR-29 could sensitize HCC cells to apoptosis that was triggered by either serum starvation and hypoxia or chemotherapeutic drugs, which mimicked the tumor growth environment in vivo and the clinical treatment. Moreover, introduction of miR-29 dramatically repressed the ability of HCC cells to form tumor in nude mice. Subsequent investigation characterized two antiapoptotic molecules, Bcl-2 and Mcl-1, as direct targets of miR-29. Furthermore, silencing of Bcl-2 and Mcl-1 phenocopied the proapoptotic effect of miR-29, whereas overexpression of these proteins attenuated the effect of miR-29. In addition, enhanced expression of miR-29 resulted in the loss of mitochondrial potential and the release of cytochrome c to cytoplasm, suggesting that miR-29 may promote apoptosis through a mitochondrial pathway that involves Mcl-1 and Bcl-2. CONCLUSION: Our data highlight an important role of miR-29 in the regulation of apoptosis and in the molecular etiology of HCC, and implicate the potential application of miR-29 in prognosis prediction and in cancer therapy.
LinkOut: [PMID: 20041405]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545215. RNA binding protein: AGO4. Condition:Control PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 6 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions artificial tissues
Location of target site 3'UTR
Original Description (Extracted from the article) ... miR-29 family resulted in decreased levels of its targets DNMT3a and MCL1. ...

- Kovalchuk O; Zemp FJ; Filkowski JN; et al., 2010, Carcinogenesis.

Article - Kovalchuk O; Zemp FJ; Filkowski JN; et al.
- Carcinogenesis, 2010
The radiation-induced bystander effect (RIBE) is a phenomenon whereby unexposed cells exhibit molecular symptoms of stress exposure when adjacent or nearby cells are traversed by ionizing radiation (IR). Recent data suggest that RIBE may be epigenetically mediated by microRNAs (miRNAs), which are small regulatory molecules that target messenger RNA transcripts for translational inhibition. Here, we analyzed microRNAome changes in bystander tissues after alpha-particle microbeam irradiation of three-dimensional artificial human tissues using miRNA microarrays. Our results indicate that IR leads to a deregulation of miRNA expression in bystander tissues. We report that major bystander end points, including apoptosis, cell cycle deregulation and DNA hypomethylation, may be mediated by altered expression of miRNAs. Specifically, c-MYC-mediated upregulation of the miR-17 family was associated with decreased levels of E2F1 and RB1, suggesting a switch to a proliferative state in bystander tissues, while priming these cells for impending death signals. Upregulation of the miR-29 family resulted in decreased levels of its targets DNMT3a and MCL1, consequently affecting DNA methylation and apoptosis. Altered expression of miR-16 led to changes in expression of BCL2, suggesting modulation of apoptosis. Thus, our data clearly show that miRNAs play a profound role in the manifestation of late RIBE end points. In summary, this study creates a roadmap for understanding the role of microRNAome in RIBE and for developing novel RIBE biomarkers.
LinkOut: [PMID: 20643754]
Experimental Support 7 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions PC3 , DU145
Disease prostate cancer
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... miR-29b inhibits McI-I in PC3 cells ...

- Steele R; Mott JL; Ray RB, 2010, Genes & cancer.

Article - Steele R; Mott JL; Ray RB
- Genes & cancer, 2010
c-myc promoter binding protein (MBP-1) is a multi-functional protein known to regulate expression of targets involved in the malignant phenotype. We have previously demonstrated that exogenous expression of MBP-1 inhibits prostate tumor growth, although the mechanism of growth inhibition is not well understood. We hypothesized that MBP-1 may modulate microRNA (miRNA) expression for regulation of prostate cancer cell growth. In this study, we demonstrated that exogenous MBP-1 upregulates miR-29b by 5-9 fold in prostate cancer cells as measured by real-time quantitative reverse transcription-PCR. Subsequent studies indicated that exogenous expression of miR-29b inhibited Mcl-1, COL1A1, and COL4A1. Further, a novel target with potential implications for invasion and metastasis, matrix metallopeptidase-2 (MMP-2), was identified and confirmed to be a miR-29b target in prostate cancer cells. Together our results demonstrated that exogenous expression of miR-29b regulates prostate cancer cell growth by modulating anti-apoptotic and pro-metastatic matrix molecules, implicating therapeutic potential of miR-29b for prostate cancer inhibition.
LinkOut: [PMID: 20657750]
Experimental Support 8 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 4170.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 9 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 4170.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 10 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Fresh human primary pDCs
Location of target site 3'UTR
Tools used in this research RNAhybrid , TargetScan
Article - Hong Y; Wu J; Zhao J; Wang H; Liu Y; Chen et al.
- PloS one, 2013
Glucocorticoids (GCs) are frequently used to treat many of the acute disease manifestations associated with inflammatory and autoimmune disorders. However, Toll-like receptor (TLR) pathway-activated plasmacytoid dendritic cells (pDCs) are resistant to GC-induced apoptosis, which leads to the inefficiency of GCs in the treatment of type I interferon-related autoimmune diseases, such as systemic lupus erythematosus (SLE). Therefore, compounds promoting pDC apoptosis may be helpful for improving the efficacy of GCs. In this study, we performed screening to identify microRNAs (miRNAs) involved in TLR-inhibited GC-induced pDC apoptosis and found an array of miRNAs that may regulate pDC apoptosis. Among those demonstrating altered expression, 6 miRNAs were inhibited in TLR-activated pDCs. Bioinformatics analysis and functional studies indicated that miR-29b and miR-29c were 2 key miRNAs involved in TLR-inhibited GC-induced pDC apoptosis. Furthermore, both of these miRNAs promoted pDC apoptosis by directly targeting Mcl-1 and Bcl-2 in human primary pDCs. Our findings provide new targets that could improve the efficacy of GCs for the treatment of SLE.
LinkOut: [PMID: 23894561]
Experimental Support 11 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions GN1C
Location of target site 3'UTR
Tools used in this research MicroCosm , miRanda , PicTar , PITA , TargetScan
Original Description (Extracted from the article) ... miR-29a and miR-29b targeted MCL1 mRNA in GICs and increased apoptosis ...

- Aldaz B; Sagardoy A; Nogueira L; Guruceaga et al., 2013, PloS one.

Article - Aldaz B; Sagardoy A; Nogueira L; Guruceaga et al.
- PloS one, 2013
Glioblastoma multiforme (GBM)-initiating cells (GICs) represent a tumor subpopulation with neural stem cell-like properties that is responsible for the development, progression and therapeutic resistance of human GBM. We have recently shown that blockade of NFkappaB pathway promotes terminal differentiation and senescence of GICs both in vitro and in vivo, indicating that induction of differentiation may be a potential therapeutic strategy for GBM. MicroRNAs have been implicated in the pathogenesis of GBM, but a high-throughput analysis of their role in GIC differentiation has not been reported. We have established human GIC cell lines that can be efficiently differentiated into cells expressing astrocytic and neuronal lineage markers. Using this in vitro system, a microarray-based high-throughput analysis to determine global expression changes of microRNAs during differentiation of GICs was performed. A number of changes in the levels of microRNAs were detected in differentiating GICs, including over-expression of hsa-miR-21, hsa-miR-29a, hsa-miR-29b, hsa-miR-221 and hsa-miR-222, and down-regulation of hsa-miR-93 and hsa-miR-106a. Functional studies showed that miR-21 over-expression in GICs induced comparable cell differentiation features and targeted SPRY1 mRNA, which encodes for a negative regulator of neural stem-cell differentiation. In addition, miR-221 and miR-222 inhibition in differentiated cells restored the expression of stem cell markers while reducing differentiation markers. Finally, miR-29a and miR-29b targeted MCL1 mRNA in GICs and increased apoptosis. Our study uncovers the microRNA dynamic expression changes occurring during differentiation of GICs, and identifies miR-21 and miR-221/222 as key regulators of this process.
LinkOut: [PMID: 24155920]
Experimental Support 12 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
Experimental Support 13 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions ES2
Location of target site 3'UTR
Tools used in this research unspecified
Original Description (Extracted from the article) ... "mimic significantly suppressed luciferase activity of a reporter gene containing the Mcl-1 mRNA 3芒鈧虏-UTR (Fig. 5C). Moreover ...

- Sugio A; Iwasaki M; Habata S; Mariya T; et al., 2014, Gynecologic oncology.

Article - Sugio A; Iwasaki M; Habata S; Mariya T; et al.
- Gynecologic oncology, 2014
OBJECTIVE: Ovarian cancer is the leading cause of death from gynecologic cancer, reflecting its often late diagnosis and its chemoresistance. We identified a set of microRNAs whose expression is altered upon BAG3 knockdown. Our primary objective was to examine the relationships between BAG3, miR-29b and Mcl-1, an antiapoptotic Bcl-2 family protein, in ovarian cancer cells. METHODS: Ovarian cancer cells were cultured and their responsiveness to paclitaxel was tested. Microarray analysis was performed to identify microRNAs differentially expressed in ES2 BAG3 knockdown ovarian cancer cells and their control cells. Primary ovarian cancer tissues were obtained from 56 patients operated on for ovarian cancer. The patients' clinical and pathological data were obtained from their medical records. RESULTS: BAG3 knockdown increased the chemosensitivity to paclitaxel of ES2 ovarian clear cell carcinoma cells to a greater degree than AMOC2 serous adenocarcinoma cells. qRT-PCR analysis showed that miR-29b expression was significantly upregulated in primary cancer tissue expressing low levels of BAG3, as compared to tissue expressing high levels. Moreover, levels of miR-29b correlated significantly with progression-free survival. Upregulation of miR-29b also reduced levels of Mcl-1 and sensitized ES2 cells to low-dose paclitaxel. CONCLUSIONS: BAG3 knockdown appears to downregulate expression of Mcl-1 through upregulation of miR-29b, thereby increasing the chemosensitivity of ovarian clear cell carcinoma cells. This suggests that BAG3 is a key determinant of the responsiveness of ovarian cancer cells, especially clear cell carcinoma, to paclitaxel and that BAG3 may be a useful therapeutic target for the treatment of ovarian cancer.
LinkOut: [PMID: 24992675]
Experimental Support 14 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Tools used in this research previous_study
Original Description (Extracted from the article) ... "A negative expression correlation level for miR-29a and the two target genes (Bcl-2: rs = 芒藛鈥0.572 ...

- Xu L; Xu Y; Jing Z; Wang X; Zha X; Zeng C; et al., 2014, Experimental hematology & oncology.

Article - Xu L; Xu Y; Jing Z; Wang X; Zha X; Zeng C; et al.
- Experimental hematology & oncology, 2014
OBJECTIVES: The miR-29 family have been demonstrated acting as vital tumor suppressor in multiple cancers as well as regulators in the adaptive immune system. Little is known about their role in leukemogenesis. The purpose of this study is to analyze the expression pattern of miR-29a/29b and its target genes Mcl-1 (myeloid cell leukemia sequence 1) and B-cell lymphoma 2 (Bcl-2) in myeloid leukemia. METHODS: Quantitative real-time PCR was used for detecting genes expression level in peripheral blood mononuclear cells (PBMCs) from 10 cases with newly diagnosed, untreated acute myeloid leukemia (AML) and 14 cases with newly diagnosed, untreated chronic myeloid leukemia (CML) in chronic phase, and 14 healthy individual (HI) served as controls. Correlation between the relative expression levels of different genes have been analyzed. RESULTS: Significant lower expression of miR-29a/29b and higher expression level of two potential target genes Bcl-2 and Mcl-1 were found in PBMCs from AML and CML patients compared with HI group. In addtion, miR-29a expression in AML was significantly lower than that in CML. Moreover, negative correlation between miR-29a/29b and its target genes have been found. While, positive correlation between relative expression level of miR-29a and miR-29b or Bcl-2 and Mcl-1 were presented in the total 38 research objects. CONCLUSION: Down-regulated miR-29a and miR-29b, and accompanying up-regulated Bcl-2 and Mcl-1 are the common feature in myeloid leukemias. These data further support the role for miR-29a/29b dysregulation in myeloid leukemogenesis and the therapeutic promise of regulating miR-29a/29b expression for myeloid leukemia in the future.
LinkOut: [PMID: 25006537]
Experimental Support 15 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions Peripheral blood mononuclear cells
Disease MIMAT0000100
Tools used in this research PicTar and PITA
Original Description (Extracted from the article) ... "we determined that MCL-1 and JAK3 expression levels in T cells were counter-regulated by miR-29b and miR-198 ...

- Gigante M; Pontrelli P; Herr W; Gigante M; et al., 2016, Journal of translational medicine.

Article - Gigante M; Pontrelli P; Herr W; Gigante M; et al.
- Journal of translational medicine, 2016
BACKGROUND: Mammalian microRNAs (miR) regulate the expression of genes relevant for the development of adaptive and innate immunity against cancer. Since T cell dysfunction has previously been reported in patients with renal cell carcinoma (RCC; clear cell type), we aimed to analyze these immune cells for genetic and protein differences when compared to normal donor T cells freshly after isolation and 35 days after in vitro stimulation (IVS) with HLA-matched RCC tumor cells. METHODS: We investigated gene expression profiles of tumor-reactive CD8(+) T cells obtained from RCC patient and compared with their HLA-matched healthy sibling donors using a microarray approach. In addition, miRNAs analysis was performed in a validation cohort of peripheral blood CD8(+) T cells from 25 RCC patients compared to 15 healthy volunteers. RESULTS: We observed that CD8(+) T cells from RCC patients expressed reduced levels of anti-apoptotic and proliferation-associated gene products when compared with normal donor T cells both pre- and post-IVS. In particular, JAK3 and MCL-1 were down-regulated in patient CD8(+) T cells versus their normal counterparts, likely due to defective suppressor activity of miR-29b and miR-198 in RCC CD8(+) T cells. Indeed, specific inhibition of miR-29b or miR-198 in peripheral blood mononuclear cells (PBMCs) isolated from RCC patients, resulted in the up-regulation of JAK3 and MCL-1 proteins and significant improvement of cell survival in vitro. CONCLUSIONS: Our results suggest that miR-29b and miR-198 dysregulation in RCC patient CD8(+) T cells is associated with dysfunctional immunity and foreshadow the development of miR-targeted therapeutics to correct such T cell defects in vivo.
LinkOut: [PMID: 27063186]
Experimental Support 16 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116 , DLD-1 , HT55 , HT29 , SW837 , VACO4S
Disease Crohn's disease fibrosis
Original Description (Extracted from the article) ... We propose that an anti-fibrotic miR-29b/IL-6 IL8/MCL-1L axis may influence intestinal fibrosis in CD ...

- Nijhuis A; Curciarello R; Mehta S; Feakins et al., 2017, Cell and tissue research.

Article - Nijhuis A; Curciarello R; Mehta S; Feakins et al.
- Cell and tissue research, 2017
The miR-29 family is involved in fibrosis in multiple organs, including the intestine where miR-29b facilitates TGF-beta-mediated up-regulation of collagen in mucosal fibroblasts from Crohn's disease (CD) patients. Myeloid cell leukemia-1 (MCL-1), a member of the B-cell CLL/Lymphoma 2 (BCL-2) apoptosis family, is involved in liver fibrosis and is targeted by miR-29b via its 3'-UTR in cultured cell lines. We investigate the role of MCL-1 and miR-29b in primary intestinal fibroblasts and tissue from stricturing CD patients. Transfection of CD intestinal fibroblasts with pre-miR-29b resulted in a significant increase in the mRNA expression of MCL-1 isoforms [MCL-1Long (L)/Extra Short (ES) and MCL-1Short (S)], although MCL-1S was expressed at significantly lower levels. Western blotting predominantly detected the anti-apoptotic MCL-1L isoform, and immunofluorescence showed that staining was localised in discrete nuclear foci. Transfection with pre-miR-29b or anti-miR-29b resulted in a significant increase or decrease, respectively, in MCL-1L foci. CD fibroblasts treated with IL-6 and IL-8, inflammatory cytokines upstream of MCL-1, increased the total mass of MCL-1L-positive foci. Furthermore, transfection of intestinal fibroblasts with pre-miR-29b resulted in an increase in mRNA and protein levels of IL-6 and IL-8. Finally, immunohistochemistry showed reduced MCL-1 protein expression in fibrotic CD samples compared to non-stricturing controls. Together, our findings suggest that induction of MCL-1 by IL-6/IL-8 may surmount any direct down-regulation by miR-29b via its 3'-UTR. We propose that an anti-fibrotic miR-29b/IL-6 IL-8/MCL-1L axis may influence intestinal fibrosis in CD. In the future, therapeutic modulation of this pathway might contribute to the management of fibrosis in CD.
LinkOut: [PMID: 28190086]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000369026.2 | 3UTR | UCUAACCAUGGUGCUAUUAUUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000369026.2 | 3UTR | UCUAACCAUGGUGCUAUUAUUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545215
Method / RBP PAR-CLIP / AGO4
Cell line / Condition HEK293 / Control
Location of target site ENST00000369026.2 | 3UTR | UCUAACCAUGGUGCUAUUAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000369026.2 | 3UTR | CAGGCUAGUCUAACCAUGGUGCUAUUAUUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000369026.2 | 3UTR | UCUAACCAUGGUGCUAUUAUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000369026.2 | 3UTR | CAGGCUAGUCUAACCAUGGUGCUAUUAUUAGGCUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000369026.2 | 3UTR | UCUAACCAUGGUGCUAUUAUUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000369026.2 | 3UTR | GCUAGUCUAACCAUGGUGCUAUUAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000369026.2 | 3UTR | UCUAACCAUGGUGCUAUUAUUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 10 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000369026.2 | 3UTR | CAGGCUAGUCUAACCAUGGUGCUAUUAUUAGGCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 11 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000369026.2 | 3UTR | UCUAACCAUGGUGCUAUUAUUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21849 B cell lymphoma 0.478 4.4e-3 0.435 9.2e-3 29 Click to see details
GSE17306 Multiple myeloma 0.324 1.2e-2 0.298 1.9e-2 49 Click to see details
GSE21032 Prostate cancer 0.238 1.5e-2 0.140 1.0e-1 83 Click to see details
GSE27834 Pluripotent stem cells 0.425 5.0e-2 0.229 2.0e-1 16 Click to see details
GSE38226 Liver fibrosis -0.336 6.8e-2 -0.331 7.1e-2 21 Click to see details
GSE28544 Breast cancer -0.296 8.0e-2 -0.420 2.1e-2 24 Click to see details
GSE32688 Pancreatic cancer -0.229 1.0e-1 -0.181 1.6e-1 32 Click to see details
GSE21687 Ependynoma primary tumors -0.145 1.3e-1 -0.098 2.2e-1 64 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.21 1.6e-1 0.237 1.3e-1 25 Click to see details
GSE17498 Multiple myeloma 0.153 1.7e-1 0.137 2.0e-1 40 Click to see details
GSE14794 Lymphoblastoid cells 0.097 1.8e-1 0.064 2.7e-1 90 Click to see details
GSE42095 Differentiated embryonic stem cells 0.193 1.9e-1 0.074 3.7e-1 23 Click to see details
GSE26953 Aortic valvular endothelial cells -0.163 2.2e-1 -0.253 1.2e-1 24 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.383 2.3e-1 -0.829 2.1e-2 6 Click to see details
GSE28260 Renal cortex and medulla -0.199 2.6e-1 -0.049 4.4e-1 13 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.136 2.8e-1 0.038 4.4e-1 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.102 3.1e-1 0.104 3.1e-1 25 Click to see details
GSE19536 Breast cancer -0.047 3.2e-1 -0.096 1.7e-1 100 Click to see details
GSE19783 ER+ ER+ breast cancer 0.102 3.3e-1 0.128 3.0e-1 20 Click to see details
GSE19783 ER- ER- breast cancer -0.041 3.6e-1 -0.064 2.9e-1 79 Click to see details
GSE19350 CNS germ cell tumors 0.072 4.1e-1 0.133 3.4e-1 12 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
UCEC -0.641 0 -0.653 0 19 Click to see details
BLCA 0.648 0 0.723 0 18 Click to see details
PCPG 0.995 0.03 1.000 0.5 3 Click to see details
KIRP -0.307 0.04 -0.317 0.04 32 Click to see details
PRAD -0.207 0.07 -0.263 0.03 50 Click to see details
LUAD 0.43 0.08 0.622 0.02 12 Click to see details
ESCA -0.337 0.16 -0.291 0.19 11 Click to see details
CESC 0.734 0.24 0.500 0.33 3 Click to see details
LUSC 0.113 0.25 0.036 0.42 38 Click to see details
STAD 0.116 0.26 0.171 0.17 32 Click to see details
THCA -0.071 0.3 -0.109 0.21 59 Click to see details
CHOL -0.201 0.3 -0.167 0.33 9 Click to see details
LIHC 0.071 0.31 0.128 0.19 49 Click to see details
BRCA -0.047 0.34 -0.084 0.22 84 Click to see details
KIRC 0.042 0.37 0.059 0.32 68 Click to see details
KICH -0.067 0.38 -0.205 0.16 25 Click to see details
PAAD 0.025 0.49 0.400 0.3 4 Click to see details
HNSC -0.004 0.49 -0.007 0.48 42 Click to see details
COAD -0.001 0.5 0.119 0.39 8 Click to see details
COAD -0.001 0.5 0.119 0.39 8 Click to see details
COAD -0.001 0.5 0.119 0.39 8 Click to see details
248 hsa-miR-29b-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000095 TGFB3 transforming growth factor beta 3 2 1
MIRT000096 HDAC4 histone deacetylase 4 4 4
MIRT000097 CTNNBIP1 catenin beta interacting protein 1 4 4
MIRT000098 COL5A3 collagen type V alpha 3 chain 2 2
MIRT000099 COL4A2 collagen type IV alpha 2 chain 2 2
MIRT000100 COL1A1 collagen type I alpha 1 chain 8 8
MIRT000101 ACVR2A activin A receptor type 2A 1 1
MIRT000445 SP1 Sp1 transcription factor 5 6
MIRT000684 CDK6 cyclin dependent kinase 6 6 5
MIRT000930 BACE1 beta-secretase 1 3 1
MIRT002310 SFPQ splicing factor proline and glutamine rich 3 1
MIRT002316 DNAJB11 DnaJ heat shock protein family (Hsp40) member B11 3 1
MIRT003026 DNMT3B DNA methyltransferase 3 beta 4 7
MIRT003029 DNMT3A DNA methyltransferase 3 alpha 5 9
MIRT003287 MCL1 MCL1, BCL2 family apoptosis regulator 7 20
MIRT003290 BCL2 BCL2, apoptosis regulator 4 3
MIRT003661 DNMT1 DNA methyltransferase 1 4 2
MIRT003736 S100B S100 calcium binding protein B 3 1
MIRT003813 VEGFA vascular endothelial growth factor A 9 9
MIRT004308 ESR1 estrogen receptor 1 2 1
MIRT004312 NCOA3 nuclear receptor coactivator 3 2 1
MIRT004419 TET1 tet methylcytosine dioxygenase 1 4 2
MIRT004510 TCL1A T-cell leukemia/lymphoma 1A 5 4
MIRT005381 Mmp15 matrix metallopeptidase 15 3 1
MIRT005383 MMP15 matrix metallopeptidase 15 2 1
MIRT005385 MMP24 matrix metallopeptidase 24 4 2
MIRT005387 Mmp24 matrix metallopeptidase 24 2 1
MIRT005486 GRN granulin precursor 4 1
MIRT005522 FGG fibrinogen gamma chain 2 1
MIRT005533 FGA fibrinogen alpha chain 2 1
MIRT005534 FGB fibrinogen beta chain 2 1
MIRT005567 COL3A1 collagen type III alpha 1 chain 5 4
MIRT005568 COL4A1 collagen type IV alpha 1 chain 7 9
MIRT005570 MMP2 matrix metallopeptidase 2 5 8
MIRT005614 BBC3 BCL2 binding component 3 2 2
MIRT005667 ADAM12 ADAM metallopeptidase domain 12 5 3
MIRT005669 NID1 nidogen 1 4 1
MIRT006054 HMGA2 high mobility group AT-hook 2 3 1
MIRT006058 TGFB2 transforming growth factor beta 2 3 2
MIRT006059 TGFB1 transforming growth factor beta 1 2 1
MIRT006060 BMP1 bone morphogenetic protein 1 3 2
MIRT006098 PTEN phosphatase and tensin homolog 7 3
MIRT006251 NASP nuclear autoantigenic sperm protein 2 1
MIRT006486 PPP1R13B protein phosphatase 1 regulatory subunit 13B 2 1
MIRT006488 CDC42 cell division cycle 42 4 2
MIRT006753 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT006815 PIK3CG phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma 3 1
MIRT006915 NKIRAS2 NFKB inhibitor interacting Ras like 2 5 3
MIRT007011 RAX retina and anterior neural fold homeobox 2 1
MIRT007033 TBX21 T-box 21 1 1
MIRT007034 IFNG interferon gamma 1 1
MIRT007102 DUSP2 dual specificity phosphatase 2 3 3
MIRT007254 FOS Fos proto-oncogene, AP-1 transcription factor subunit 3 3
MIRT027237 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 2 2
MIRT027238 IMPDH1 inosine monophosphate dehydrogenase 1 2 2
MIRT027239 MYCN MYCN proto-oncogene, bHLH transcription factor 3 3
MIRT048359 SCAF8 SR-related CTD associated factor 8 1 1
MIRT048360 CLDN1 claudin 1 1 1
MIRT048361 MRPS35 mitochondrial ribosomal protein S35 1 1
MIRT048362 RSL24D1 ribosomal L24 domain containing 1 1 1
MIRT048363 LRP10 LDL receptor related protein 10 1 1
MIRT048364 HP1BP3 heterochromatin protein 1 binding protein 3 1 1
MIRT048365 B4GALT5 beta-1,4-galactosyltransferase 5 1 1
MIRT048366 KIAA1671 KIAA1671 1 1
MIRT048367 NNT nicotinamide nucleotide transhydrogenase 1 1
MIRT048368 IFIH1 interferon induced with helicase C domain 1 1 1
MIRT048369 TPT1 tumor protein, translationally-controlled 1 1 1
MIRT048370 RUNDC3B RUN domain containing 3B 1 1
MIRT048371 CECR2 CECR2, histone acetyl-lysine reader 1 1
MIRT048372 TPD52L2 tumor protein D52 like 2 1 1
MIRT048373 NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit 1 1
MIRT048374 CIT citron rho-interacting serine/threonine kinase 1 1
MIRT048375 GNB2L1 receptor for activated C kinase 1 1 1
MIRT048376 SMARCC1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin subfamily c member 1 1 1
MIRT048377 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 1
MIRT048378 PIGN phosphatidylinositol glycan anchor biosynthesis class N 1 1
MIRT048379 RPS4X ribosomal protein S4, X-linked 1 1
MIRT048380 CCSAP centriole, cilia and spindle associated protein 1 1
MIRT048381 CALU calumenin 1 1
MIRT048382 NREP neuronal regeneration related protein 1 1
MIRT048383 MKI67 marker of proliferation Ki-67 1 1
MIRT053293 TDG thymine DNA glycosylase 5 5
MIRT053581 CCND2 cyclin D2 5 3
MIRT053738 COL4A5 collagen type IV alpha 5 chain 1 1
MIRT053739 COL7A1 collagen type VII alpha 1 chain 1 1
MIRT053740 COL15A1 collagen type XV alpha 1 chain 1 1
MIRT053741 COL2A1 collagen type II alpha 1 chain 1 1
MIRT053742 COL4A6 collagen type IV alpha 6 chain 1 1
MIRT053743 CSGALNACT2 chondroitin sulfate N-acetylgalactosaminyltransferase 2 1 1
MIRT053744 SOX12 SRY-box 12 1 1
MIRT053745 MAP2K6 mitogen-activated protein kinase kinase 6 1 1
MIRT053746 TGIF2 TGFB induced factor homeobox 2 1 1
MIRT053747 SERPINH1 serpin family H member 1 2 2
MIRT053748 NOTCH2 notch 2 4 1
MIRT053749 PPARD peroxisome proliferator activated receptor delta 1 1
MIRT054045 SNAI3 snail family transcriptional repressor 3 2 1
MIRT054192 AKT2 AKT serine/threonine kinase 2 4 2
MIRT054574 PER1 period circadian clock 1 3 1
MIRT060983 LAMC1 laminin subunit gamma 1 3 1
MIRT061662 BTG2 BTG anti-proliferation factor 2 2 4
MIRT067385 TMTC3 transmembrane and tetratricopeptide repeat containing 3 2 4
MIRT079942 RNF138 ring finger protein 138 2 2
MIRT080798 SH3GLB1 SH3 domain containing GRB2 like, endophilin B1 2 4
MIRT081893 KCTD15 potassium channel tetramerization domain containing 15 2 8
MIRT082515 CALM3 calmodulin 3 2 2
MIRT085293 CCNT2 cyclin T2 2 6
MIRT102856 INSIG1 insulin induced gene 1 2 2
MIRT207249 TET3 tet methylcytosine dioxygenase 3 2 2
MIRT207755 VHL von Hippel-Lindau tumor suppressor 2 4
MIRT210969 TET2 tet methylcytosine dioxygenase 2 1 1
MIRT211650 ABCE1 ATP binding cassette subfamily E member 1 2 2
MIRT213230 REST RE1 silencing transcription factor 2 10
MIRT225103 GOLGA7 golgin A7 2 2
MIRT250481 MAZ MYC associated zinc finger protein 2 2
MIRT264266 FAM102B family with sequence similarity 102 member B 2 2
MIRT267090 ZFP91 ZFP91 zinc finger protein 2 2
MIRT303363 MXD1 MAX dimerization protein 1 2 1
MIRT316344 ULBP2 UL16 binding protein 2 2 2
MIRT401476 AIM1 crystallin beta-gamma domain containing 1 2 1
MIRT437369 LAMC2 laminin subunit gamma 2 3 1
MIRT437372 ITGA6 integrin subunit alpha 6 3 2
MIRT437552 COL5A2 collagen type V alpha 2 chain 1 1
MIRT437553 COL10A1 collagen type X alpha 1 chain 1 1
MIRT437554 SPARC secreted protein acidic and cysteine rich 1 1
MIRT437555 FBN1 fibrillin 1 1 1
MIRT437556 LOX lysyl oxidase 2 2
MIRT437557 PDGFRB platelet derived growth factor receptor beta 2 2
MIRT437710 PHACTR2 phosphatase and actin regulator 2 2 1
MIRT437713 TUBB2A tubulin beta 2A class IIa 2 1
MIRT437716 EMP1 epithelial membrane protein 1 2 1
MIRT437719 SNX24 sorting nexin 24 2 1
MIRT437722 AMFR autocrine motility factor receptor 2 1
MIRT437725 RIOK3 RIO kinase 3 2 1
MIRT437728 WDR26 WD repeat domain 26 4 3
MIRT437731 DSC2 desmocollin 2 2 1
MIRT437870 IL32 interleukin 32 1 1
MIRT438911 GATA3 GATA binding protein 3 2 1
MIRT438912 PDGFRA platelet derived growth factor receptor alpha 2 1
MIRT438913 PDGFC platelet derived growth factor C 2 1
MIRT438914 PDGFB platelet derived growth factor subunit B 2 1
MIRT438915 PDGFA platelet derived growth factor subunit A 2 1
MIRT438916 MMP9 matrix metallopeptidase 9 2 1
MIRT438917 LOXL4 lysyl oxidase like 4 2 1
MIRT438918 LOXL2 lysyl oxidase like 2 2 1
MIRT438919 ITGB1 integrin subunit beta 1 2 1
MIRT438920 ANGPTL4 angiopoietin like 4 2 1
MIRT454812 NEDD9 neural precursor cell expressed, developmentally down-regulated 9 2 2
MIRT456827 MORF4L2 mortality factor 4 like 2 2 8
MIRT462151 RPL22 ribosomal protein L22 2 2
MIRT465314 TRAM2 translocation associated membrane protein 2 2 2
MIRT467808 SLC2A14 solute carrier family 2 member 14 2 2
MIRT467829 SLC29A2 solute carrier family 29 member 2 2 2
MIRT467971 SLC16A1 solute carrier family 16 member 1 2 4
MIRT468225 SGK1 serum/glucocorticoid regulated kinase 1 2 2
MIRT469448 REL REL proto-oncogene, NF-kB subunit 2 2
MIRT469723 RAB40C RAB40C, member RAS oncogene family 2 2
MIRT469841 R3HDM4 R3H domain containing 4 2 2
MIRT472643 NAA40 N(alpha)-acetyltransferase 40, NatD catalytic subunit 2 2
MIRT474209 LEPRE1 prolyl 3-hydroxylase 1 1 1
MIRT474576 KLHDC3 kelch domain containing 3 2 2
MIRT475837 HDGF heparin binding growth factor 2 4
MIRT476721 FRK fyn related Src family tyrosine kinase 2 4
MIRT477473 ELMSAN1 ELM2 and Myb/SANT domain containing 1 2 2
MIRT478668 CTC1 CST telomere replication complex component 1 2 14
MIRT478710 CSRNP2 cysteine and serine rich nuclear protein 2 2 2
MIRT478985 COMMD2 COMM domain containing 2 2 2
MIRT479826 CCNA2 cyclin A2 2 8
MIRT479901 CCDC117 coiled-coil domain containing 117 2 2
MIRT480066 CAND1 cullin associated and neddylation dissociated 1 2 2
MIRT482012 AMER1 APC membrane recruitment protein 1 2 8
MIRT489024 C1QTNF6 C1q and TNF related 6 5 2
MIRT492513 RAET1L retinoic acid early transcript 1L 2 2
MIRT493825 FSCN1 fascin actin-bundling protein 1 2 2
MIRT495936 SLC7A5P2 solute carrier family 7 member 5 pseudogene 2 2 2
MIRT496358 PPY pancreatic polypeptide 2 2
MIRT496662 TMEM237 transmembrane protein 237 2 2
MIRT497644 GLDN gliomedin 2 2
MIRT501878 MORF4L1 mortality factor 4 like 1 2 8
MIRT502932 CDC42SE1 CDC42 small effector 1 2 4
MIRT506750 LDOC1L retrotransposon Gag like 6 2 6
MIRT507168 GAS2L3 growth arrest specific 2 like 3 2 2
MIRT514918 MDM2 MDM2 proto-oncogene 2 6
MIRT523962 DYNLT1 dynein light chain Tctex-type 1 2 4
MIRT527675 CASP8 caspase 8 2 2
MIRT536936 HECW1 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 2 2
MIRT537359 FJX1 four jointed box 1 2 2
MIRT537687 ENPP2 ectonucleotide pyrophosphatase/phosphodiesterase 2 2 2
MIRT538124 DDX6 DEAD-box helicase 6 2 2
MIRT538813 C21orf91 chromosome 21 open reading frame 91 2 2
MIRT546938 PTP4A1 protein tyrosine phosphatase type IVA, member 1 2 2
MIRT547104 PLAG1 PLAG1 zinc finger 2 2
MIRT547823 ISG20L2 interferon stimulated exonuclease gene 20 like 2 2 2
MIRT548237 FEM1B fem-1 homolog B 2 2
MIRT550036 WWTR1 WW domain containing transcription regulator 1 2 2
MIRT552619 ZBTB5 zinc finger and BTB domain containing 5 2 2
MIRT556562 LIMS1 LIM zinc finger domain containing 1 2 2
MIRT558857 CDC23 cell division cycle 23 2 2
MIRT565485 SPRTN SprT-like N-terminal domain 2 2
MIRT568205 CBX6 chromobox 6 2 2
MIRT576774 Tmem127 transmembrane protein 127 2 2
MIRT576958 Pigs phosphatidylinositol glycan anchor biosynthesis, class S 2 3
MIRT610003 PIGS phosphatidylinositol glycan anchor biosynthesis class S 2 3
MIRT616511 COX7A2L cytochrome c oxidase subunit 7A2 like 2 2
MIRT640887 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 2
MIRT641350 RAB11FIP1 RAB11 family interacting protein 1 2 2
MIRT642978 TESPA1 thymocyte expressed, positive selection associated 1 2 2
MIRT643634 YY2 YY2 transcription factor 2 2
MIRT644386 ZNF286A zinc finger protein 286A 2 2
MIRT650749 YAE1D1 Yae1 domain containing 1 2 2
MIRT661585 EPHX2 epoxide hydrolase 2 2 2
MIRT664287 RNMTL1 mitochondrial rRNA methyltransferase 3 2 2
MIRT689393 ZNF850 zinc finger protein 850 2 2
MIRT693815 SEC31A SEC31 homolog A, COPII coat complex component 2 2
MIRT694532 TRIM72 tripartite motif containing 72 2 2
MIRT694628 ZFPM1 zinc finger protein, FOG family member 1 2 2
MIRT695135 PRY2 PTPN13-like, Y-linked 2 2 2
MIRT695152 PRY PTPN13-like, Y-linked 2 2
MIRT703640 FBRS fibrosin 2 2
MIRT704551 CNBP CCHC-type zinc finger nucleic acid binding protein 2 2
MIRT704967 CBX2 chromobox 2 2 2
MIRT705497 ASXL2 additional sex combs like 2, transcriptional regulator 2 2
MIRT707993 OTUD4 OTU deubiquitinase 4 2 2
MIRT708741 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT710621 COLEC10 collectin subfamily member 10 2 2
MIRT713056 IFRD1 interferon related developmental regulator 1 2 2
MIRT715515 MAPKBP1 mitogen-activated protein kinase binding protein 1 2 2
MIRT720770 FAM193A family with sequence similarity 193 member A 2 2
MIRT731925 AQP4 aquaporin 4 3 1
MIRT732673 HMGB1 high mobility group box 1 3 0
MIRT734350 IL6 interleukin 6 1 0
MIRT734351 TP53 tumor protein p53 1 0
MIRT734565 BCL2L11 BCL2 like 11 2 0
MIRT734770 TRIM44 tripartite motif containing 44 2 0
MIRT734771 CCNE1 cyclin E1 2 0
MIRT735260 STAT3 signal transducer and activator of transcription 3 6 1
MIRT735414 HBP1 HMG-box transcription factor 1 3 0
MIRT735537 HIF3A hypoxia inducible factor 3 alpha subunit 3 0
MIRT735639 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 3 0
MIRT735641 AKT3 AKT serine/threonine kinase 3 3 0
MIRT735943 DNM3OS DNM3 opposite strand/antisense RNA 4 0
MIRT737493 SMAD3 SMAD family member 3 1 0
MIRT737577 SNAI1 snail family transcriptional repressor 1 2 0
MIRT755941 SLMAP sarcolemma associated protein 4 1
MIRT755963 ROBO1 roundabout guidance receptor 1 5 1
MIRT755964 SRGAP2 SLIT-ROBO Rho GTPase activating protein 2 5 1
MIRT756271 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon 3 1
MIRT756364 LIN7A lin-7 homolog A, crumbs cell polarity complex component 2 1
MIRT756474 COL5A1 collagen type V alpha 1 chain 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-29b 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray Pancreatic Cancer MiaPACA-2 cells 19407485 2009 up-regulated
miR-29b 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray Pancreatic Cancer PANC-1 cells 19407485 2009 up-regulated
miR-29b 5-aza-2'-deoxycytidine (5-Aza-CdR) + trichostatin A(TSA) NULL NULL Microarray Pancreatic Cancer MiaPACA-2 cells 19407485 2009 up-regulated
miR-29b 5-aza-2'-deoxycytidine (5-Aza-CdR) + trichostatin A(TSA) NULL NULL Microarray Pancreatic Cancer PANC-1 cells 19407485 2009 up-regulated
miR-29b Trichostatin A (TSA) NULL 444732 Microarray Pancreatic Cancer MiaPACA-2 cells 19407485 2009 up-regulated
miR-29b Trichostatin A (TSA) NULL 444732 Microarray Pancreatic Cancer PANC-1 cells 19407485 2009 up-regulated
miR-29b Glucose NULL 5793 Microarray proximal tubule cell line HK-2 20067797 2010 down-regulated
miR-29b Dihydrotestosterone(DHT) NULL 10635 Microarray prostate cancer 20945501 2011 up-regulated
miR-29b Dihydrotestosterone(DHT) NULL 10635 Quantitative real-time PCR prostate cancer 20945501 2011 up-regulated
miR-29b Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-29b Enoxacin approved 3229 Quantitative real-time PCR HCT-116 and RKO colon cancer cell lines 21368194 2011 up-regulated
miR-29b Ginsenoside Rh2 NULL 119307 Microarray human glioma cells U251 21372826 2011 up-regulated
miR-29b Testosterone + 1,25-Dihydroxyvitamin D3 approved NULL Microarray prostate cancer 21592394 2011 up-regulated
miR-29b Progesterone approved 5994 Microarray Breast cancer 22330642 2012 down-regulated
miR-29b Progesterone approved 5994 Quantitative real-time PCR Breast cancer 22330642 2012 down-regulated
miR-29b Trastuzumab approved NULL Microarray SKBR3 cells. 22384020 2012 up-regulated
miR-29b Glucocorticoid NULL NULL Quantitative real-time PCR Eosinophilic esophagitis 22815788 2012 up-regulated
miR-29b Glucocorticoid NULL NULL TaqMan low-density array Eosinophilic esophagitis 22815788 2012 up-regulated
miR-29b CCl4 NULL 5943 Quantitative real-time PCR liver 22393047 2012 down-regulated
miR-29b Estrogen NULL NULL Quantitative real-time PCR liver 22393047 2012 up-regulated
miR-29b Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 down-regulated
miR-29b 5-aminoimidazole-4-carboxamide-1-β-d-ribofuranoside (AICAR) NULL 16078949 Microarray hepatocytes 23107762 2013 down-regulated
miR-29b Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-29b Phenethyl isothiocyanate(PEITC) NULL 16741 Microarray neonatal mice liver 20145010 2010 down-regulated
miR-29b Benzo(a)pyrene NULL 2336 Microarray Adult male B6C3F1 mice 21569818 2011 up-regulated
miR-29b Cocaine NULL 446220 Next-generation sequencing ventral striatum 21708909 2011 down-regulated
miR-29b Urethane NULL 5641 Quantitative real-time PCR mouse lung 24361357 2014 down-regulated
miR-29b Ethanol NULL 702 Quantitative real-time PCR Cerebellar Granule Neurons cells 24554719 2014 down-regulated
miR-29b Rapamycin approved 5284616 Quantitative real-time PCR HL-1 cells 25062042 2014 up-regualted
miR-29b Estradiol benzoate (EB) NULL NULL Quantitative real-time PCR adult germ cell 22334722 2012 up-regulated
miR-29b Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 up-regulated
miR-29b-3p Docosahexaenoic acid NULL 445580 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-29b Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (HepG2, SK-HEP-1)
hsa-miR-29b-3p (1S,10R,12R,14R,15S)-15-hydroxyspiro[13,16-dioxapentacyclo[8.5.1.01,10.03,8.012,14]hexadeca-3,5,7-triene-11,3'-2,4-dioxatricyclo[7.3.1.05,13]trideca-1(12),5,7,9(13),10-pentaene]-2,9-dione 388424 NSC683332 resistant
hsa-miR-29b-3p (5Z)-5-[(4-oxothieno[2,3-b]thiochromen-2-yl)methylidene]-2-sulfanylideneimidazolidin-4-one 5468927 NSC679240 resistant
hsa-miR-29b-3p (6aS)-3-[5-[4-(2-diethoxyphosphorylethyl)piperazin-1-yl]pentoxy]-2-methoxy-6a,7,8,9-tetrahydropyrrolo[2,1-c][1,4]benzodiazepin-11-one 25113728 NSC744025 resistant
hsa-miR-29b-3p 1-adamantylmethyl 4-[(2,5-dihydroxyphenyl)methylamino]benzoate 391131 NSC689857 resistant
hsa-miR-29b-3p 2-((5-methyl-3-isoxazolyl)amino)-4-((5-methyl-3-isoxazolyl)imino)-1(4h)-naphthalenone 373420 NSC649750 sensitive
hsa-miR-29b-3p 2-(1-adamantyl)ethyl 4-[(2,5-dihydroxyphenyl)methylamino]benzoate 403758 NSC719177 resistant
hsa-miR-29b-3p 2-(3-(2-methoxy-4-(4-methylene-5-oxotetrahydro-2-furanyl)phenoxy)propyl)-1h-isoindole-1,3(2h)-dione 381521 NSC668277 resistant
hsa-miR-29b-3p 2-[(dimethylamino)methyl]-3-[(Z)-heptadec-10-enyl]-5-methoxybenzene-1,4-diol;hydrochloride 5387959 NSC630004 resistant
hsa-miR-29b-3p 2-[[(E)-3-(2-chlorophenyl)prop-2-enoyl]amino]-5-iodobenzamide 53329762 NSC748148 resistant
hsa-miR-29b-3p 2-acetylimidazo[4,5-b]pyridin 4 tolyl 3 thiosemicarbazone 135440014 NSC674106 resistant
hsa-miR-29b-3p 2-amino-1-N,9-N-bis[10-[(4-hydroxyphenyl)methyl]-7,11,14-trimethyl-2,5,9,12,15-pentaoxo-3-propan-2-yl-8-oxa-1,4,11,14-tetrazabicyclo[14.3.0]nonadecan-6-yl]-4,6-dimethyl-3-oxophenoxazine-1,9-dicarboxamide 16129921 NSC684901 resistant
hsa-miR-29b-3p 2-amino-1-N,9-N-bis[10-[(4-methoxyphenyl)methyl]-7,11,14-trimethyl-2,5,9,12,15-pentaoxo-3-propan-2-yl-8-oxa-1,4,11,14-tetrazabicyclo[14.3.0]nonadecan-6-yl]-4,6-dimethyl-3-oxophenoxazine-1,9-dicarboxamide 16129907 NSC684908 resistant
hsa-miR-29b-3p 2-amino-9-chloro-3,5-bis(4-chlorophenyl)pyrimido[4,5-c]quinolin-1-one 16126264 NSC741296 resistant
hsa-miR-29b-3p 2,3-bis(4,5-dimethyl-3,6-dioxo-cyclohexa-1,4-dien-1-yl)-5,6-dimethyl-1,4-benzoquinone 394545 NSC698090 sensitive
hsa-miR-29b-3p 3-(4-chlorophenyl)-5-methyl-[1,2]oxazolo[5,4-d]triazin-4-one 399226 NSC709900 resistant
hsa-miR-29b-3p 4-[4-[2,3-bis(hydroxymethyl)pyrrol-1-yl]butanoylamino]-n-[5-[[5-[3-(dimethylamino)propylcarbamoyl]-1-methylpyrrol-3-yl]carbamoyl]-1-methylpyrrol-3-yl]-1-methylpyrrole-2-carboxamide 384021 NSC673131 resistant
hsa-miR-29b-3p 5-(4-methoxyphenyl)-3-(3,4,5-trimethoxyphenyl)-4,5-dihydro-1h-pyrazole 49865894 NSC748404 resistant
hsa-miR-29b-3p 5,11-dimethyl-1h-benzo[a]carbazole-1,4(11h)-dione 372651 NSC648148 resistant
hsa-miR-29b-3p Acetic acid;3-[4-(2-hydroxyethyl)piperidin-1-yl]-N-[6-[3-[4-(2-hydroxyethyl)piperidin-1-yl]propanoylamino]-9,10-dioxoanthracen-2-yl]propanamide 374314 NSC651841 resistant
hsa-miR-29b-3p Beacon red 135421797 NSC12455 resistant
hsa-miR-29b-3p Benzoic acid, 3,4,5-trihydroxy-, phenyl ester 333279 NSC333571 resistant
hsa-miR-29b-3p Csa13 24205348 NSC735211 sensitive
hsa-miR-29b-3p Mefloquine hydrochloride 456309 NSC157387 sensitive
hsa-miR-29b-3p Methyl 3-hydroxy-3-[(15R)-15-tetracyclo[6.6.2.02,7.09,14]hexadeca-2,4,6,9,11,13-hexaenyl]propanedithioate 383730 NSC672159 resistant
hsa-miR-29b-3p Methyl 6-[[(3S,4aR,6aR,6bS,8R,8aR,12aS,14aR,14bR)-8a-[3-[3,4-dihydroxy-6-methyl-5-(3,4,5-trihydroxyoxan-2-yl)oxyoxan-2-yl]oxy-4,5-dihydroxyoxan-2-yl]oxycarbonyl-8-hydroxy-4,4,6a,6b,11,11,14b-heptamethyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropi 385532 NSC676788 sensitive
hsa-miR-29b-3p Naphth[2,3-d]oxazol-9-one, 2-methyl-4-(phenylimino)- 160386 NSC650573 sensitive
hsa-miR-29b-3p NSC148077 NSC148077 resistant
hsa-miR-29b-3p NSC175490 NSC175490 resistant
hsa-miR-29b-3p NSC175493 NSC175493 resistant
hsa-miR-29b-3p NSC85701 NSC85701 resistant
hsa-miR-29b-3p Oxin 1923 NSC2039 approved resistant
hsa-miR-29b-3p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Etoposide 36462 NSC141540 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved resistant High Breast Cancer cell line (MDA-435)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive High Breast Cancer cell line (MDA-MB-435, MDA-MB-436, SKBr3, BT-474, MDA-MB-231, MCF7)
hsa-miR-29b-3p Imatinib 5291 NSC743414 approved resistant High Myelogenous Leukemia cell line (MYL)
hsa-miR-29b-3p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7, LY2)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-miR-29b-3p Cyclopamine 442972 NSC734950 resistant Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved resistant Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-29b-3p Etoposide 36462 NSC141540 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Decitabine 451668 approved sensitive Low Acute Myeloid Leukemia tissue and cell line (Kasumi-1, NB4, FDC-P1-KITmut)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved resistant High Bladder Cancer cell line (RT4, J82,TCCSUP, UM-UC-3,RT112,CUBIII)
hsa-miR-29b-3p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (RKO)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved sensitive Low Cholangiocarcinoma cell line (HuCCT1, HuH28)
hsa-miR-29b-3p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-29b-3p Ethanol 702 NSC85228 approved resistant Low Cerebellum Granule Neuron tissue
hsa-miR-29b-3p Chemotherapy sensitive Low Ovarian Cancer tissue
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive Low Ovarian Cancer cell line (ES2, AMOC2)
hsa-miR-29b-3p Fluorouracil 3385 NSC19893 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-29b-3p Bortezomib 387447 NSC681239 approved sensitive Low Melanoma cell line (RPMI8226)
hsa-miR-29b-3p Carfilzomib 11556711 NSC756640 approved sensitive Low Melanoma cell line (RPMI8226)
hsa-miR-29b-3p Ixazomib 25183872 approved sensitive Low Melanoma cell line (RPMI8226)
hsa-miR-29b-3p Interferon-Gamma sensitive Low Colorectal Cancer cell line (HCT-116, HT-29, LS174T, SW480,SW620, HEK293)
hsa-miR-29b-3p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR200)
hsa-miR-29b-3p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR70)
hsa-miR-29b-3p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Platinum 23939 resistant Low Ovarian Cancer tissue
hsa-miR-29b-3p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-29b-3p Imatinib 5291 NSC743414 approved resistant High Gastrointestinal Stromal Tumor cell line (882R-NC, 882R-OE, 882R-KD)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549, H1299)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive High Gallbladder Cancer cell line (GBC-SD, NOZ)
hsa-miR-29b-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-29b-3p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-29b-3p Curcumin 969516 NSC32982 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved resistant High Cholangiocarcinoma cell line (CCLP-1, MzChA-1)
hsa-miR-29b-3p Oxaliplatin 6857599 NSC266046 approved sensitive Low Colorectal Cancer cell line (SW480)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (PC-3-R)
hsa-miR-29b-3p Methotrexate 126941 NSC740 approved sensitive Low Osteosarcoma tissue and cell line (MG-63, U-2-OS)
hsa-miR-29b-3p Crizotinib 11626560 NSC749005 approved resistant High Non-Small Cell Lung Cancer cell line (NCI-H2228, DFCI032)
hsa-miR-29b-3p Lorlatinib 71731823 NSC780108 approved resistant High Non-Small Cell Lung Cancer cell line (NCI-H2228, DFCI032)
hsa-miR-29b-3p Doxorubicin 31703 NSC123127 approved sensitive Low Osteosarcoma cell line (MG-63)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved sensitive Low Pancreatic Cancer cell line (PANC-1 cell, BXPC-3)
hsa-miR-29b-3p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7, MCF-7-21)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive Low Endometrial Cancer cell line (HEC-1-B)
hsa-miR-29b-3p Fluorouracil 3385 NSC19893 approved sensitive High Colorectal Cancer cell line (HT-29)
hsa-miR-29b-3p Oxaliplatin 6857599 NSC266046 approved sensitive Low Colon Cancer cell line (SW480, SW620)
hsa-miR-29b-3p Temozolomide 5394 NSC362856 approved sensitive Low Glioma cell line (LN229, U87MG, U251)
hsa-miR-29b-3p Temozolomide 5394 NSC362856 approved sensitive Low Glioblastoma cell line (U251, U87MG)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-29b-3p Oxaliplatin 6857599 NSC266046 approved sensitive Low Colorectal Cancer cell line (HT-29, DLD1)
hsa-miR-29b-3p Bortezomib 387447 NSC681239 approved resistant Low Multiple Myeloma tissue
hsa-miR-29b-3p Palbociclib 5330286 NSC758247 approved sensitive High Breast Cancer cell line (MDA-MB-231, Hs578t, SKBR3, MCF-7)
hsa-miR-29b-3p Temozolomide 5394 NSC362856 approved sensitive Low Glioma tissue
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-29b-3p Fluorouracil 3385 NSC19893 approved resistant Low Colorectal Cancer cell line (HT-29, HCT-116, SW480, SW620, LoVo, SW48, DLD-1, Caco-1, HCT-15)
hsa-miR-29b-3p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-29b-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (mitochondrial RNA)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (cytosolic RNA)
hsa-miR-29b-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-29b-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (SKVO3ip1)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved resistant cell line (HeyA8)
hsa-miR-29b-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-29b-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-29b-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-29b-3p Exemestane 60198 NSC713563 approved resistant cell line (MCF-7)
hsa-miR-29b-3p Testosterone 6013 NSC9700 approved resistant cell line (MCF-7)
hsa-miR-29b-3p Testosterone+Anastrozole resistant cell line (MCF-7)
hsa-miR-29b-3p Testosterone+Letrozole resistant cell line (MCF-7)
hsa-miR-29b-3p Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved resistant cell line (MGC-803)
hsa-miR-29b-3p 4-Hydroxytamoxifen+Tamoxifen resistant cell line (LY2)
hsa-miR-29b-3p Ethanol+Tamoxifen resistant cell line (LY2)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-29b-3p Pegylated interferon alpha+Ribavirin sensitive tissue (chronic hepatitis C)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (HuH28)
hsa-miR-29b-3p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-29b-3p Tamoxifen 2733525 NSC180973 approved sensitive cell line (TamR4)
hsa-miR-29b-3p Oxaliplatin 6857599 NSC266046 approved sensitive cell line (IGROV-1)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (IGROV-1)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR200)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR70)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-29b-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-29b-3p Bortezomib 387447 NSC681239 approved resistant cell line (CCRF-CEM) (100 nM)
hsa-miR-29b-3p Bortezomib 387447 NSC681239 approved sensitive cell line (CCRF-CEM) (200 nM)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved resistant cell line (OVCAR3)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (H23)
hsa-miR-29b-3p Cetuximab sensitive tissue (colorectal carcinoma)

Error report submission