miRTarBase - #MIRT003300


—
pre-miRNA Information
pre-miRNA hsa-mir-9-1   
Genomic Coordinates chr1: 156420341 - 156420429
Synonyms MIRN9-1, hsa-mir-9-1, miRNA9-1, MIR9-1
Description Homo sapiens miR-9-1 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-9-2   
Genomic Coordinates chr5: 88666853 - 88666939
Synonyms MIRN9-2, hsa-mir-9-2, miRNA9-2, MIR9-2
Description Homo sapiens miR-9-2 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-9-3   
Genomic Coordinates chr15: 89368017 - 89368106
Synonyms MIRN9-3, hsa-mir-9-3, miRNA9-3, MIR9-3
Description Homo sapiens miR-9-3 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-9-5p
Sequence 16| UCUUUGGUUAUCUAGCUGUAUGA |38
Evidence Experimental
Experiments Cloned
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BOS25P miR-9 Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Serum Real-time reverse transcription PCR
Gene Information
Gene Symbol FOXO1   
Synonyms FKH1, FKHR, FOXO1A
Description forkhead box O1
Transcript NM_002015   
Expression
Putative miRNA Targets on FOXO1
3'UTR of FOXO1
(miRNA target sites are highlighted)		 
>FOXO1|NM_002015|3'UTR
   1 GGGTTAGTGAGCAGGTTACACTTAAAAGTACTTCAGATTGTCTGACAGCAGGAACTGAGAGAAGCAGTCCAAAGATGTCT
  81 TTCACCAACTCCCTTTTAGTTTTCTTGGTTAAAAAAAAAAACAAAAAAAAAAACCCTCCTTTTTTCCTTTCGTCAGACTT
 161 GGCAGCAAAGACATTTTTCCTGTACAGGATGTTTGCCCAATGTGTGCAGGTTATGTGCTGCTGTAGATAAGGACTGTGCC
 241 ATTGGAAATTTCATTACAATGAAGTGCCAAACTCACTACACCATATAATTGCAGAAAAGATTTTCAGATCCTGGTGTGCT
 321 TTCAAGTTTTGTATATAAGCAGTAGATACAGATTGTATTTGTGTGTGTTTTTGGTTTTTCTAAATATCCAATTGGTCCAA
 401 GGAAAGTTTATACTCTTTTTGTAATACTGTGATGGGCCTCATGTCTTGATAAGTTAAACTTTTGTTTGTACTACCTGTTT
 481 TCTGCGGAACTGACGGATCACAAAGAACTGAATCTCCATTCTGCATCTCCATTGAACAGCCTTGGACCTGTTCACGTTGC
 561 CACAGAATTCACATGAGAACCAAGTAGCCTGTTATCAATCTGCTAAATTAATGGACTTGTTAAACTTTTGGAAAAAAAAA
 641 GATTAAATGCCAGCTTTGTACAGGTCTTTTCTATTTTTTTTTGTTTATTTTGTTATTTGCAAATTTGTACAAACATTTAA
 721 ATGGTTCTAATTTCCAGATAAATGATTTTTGATGTTATTGTTGGGACTTAAGAACATTTTTGGAATAGATATTGAACTGT
 801 AATAATGTTTTCTTAAAACTAGAGTCTACTTTGTTACATAGTCAGCTTGTAAATTTTGTGGAACCACAGGTATTTGGGGC
 881 AGCATTCATAATTTTCATTTTGTATTCTAACTGGATTAGTACTAATTTTATACATGCTTAACTGGTTTGTACACTTTGGG
 961 ATGCTACTTAGTGATGTTTCTGACTAATCTTAAATCATTGTAATTAGTACTTGCATATTCAACGTTTCAGGCCCTGGTTG
1041 GGCAGGAAAGTGATGTATAGTTATGGACACTTTGCGTTTCTTATTTAGGATAACTTAATATGTTTTTATGTATGTATTTT
1121 AAAGAAATTTCATCTGCTTCTACTGAACTATGCGTACTGCATAGCATCAAGTCTTCTCTAGAGACCTCTGTAGTCCTGGG
1201 AGGCCTCATAATGTTTGTAGATCAGAAAAGGGAGATCTGCATCTAAAGCAATGGTCCTTTGTCAAACGAGGGATTTTGAT
1281 CCACTTCACCATTTTGAGTTGAGCTTTAGCAAAAGTTTCCCCTCATAATTCTTTGCTCTTGTTTCAGTCCAGGTGGAGGT
1361 TGGTTTTGTAGTTCTGCCTTGAGGAATTATGTCAACACTCATACTTCATCTCATTCTCCCTTCTGCCCTGCAGATTAGAT
1441 TACTTAGCACACTGTGGAAGTTTAAGTGGAAGGAGGGAATTTAAAAATGGGACTTGAGTGGTTTGTAGAATTTGTGTTCA
1521 TAAGTTCAGATGGGTAGCAAATGGAATAGAACTTACTTAAAAATTGGGGAGATTTATTTGAAAACCAGCTGTAAGTTGTG
1601 CATTGAGATTATGTTAAAAGCCTTGGCTTAAGAATTTGAAAATTTCTTTAGCCTGTAGCAACCTAAACTGTAATTCCTAT
1681 CATTATGTTTTATTACTTTCCAATTACCTGTAACTGACAGACCAAATTAATTGGCTTTGTGTCCTATTTAGTCCATCAGT
1761 ATTTTCAAGTCATGTGGAAAGCCCAAAGTCATCACAATGAAGAGAACAGGTGCACAGCACTGTTCCTCTTGTGTTCTTGA
1841 GAAGGATCTAATTTTTCTGTATATAGCCCACATCACACTTGCTTTGTCTTGTATGTTAATTGCATCTTCATTGGCTTGGT
1921 ATTTCCTAAATGTTTAACAAGAACACAAGTGTTCCTGATAAGATTTCCTACAGTAAGCCAGCTCTATTGTAAGCTTCCCA
2001 CTGTGATGATCATTTTTTTGAAGATTCATTGAACAGCCACCACTCTATCATCCTCATTTTGGGGCAGTCCAAGACATAGC
2081 TGGTTTTAGAAACCCAAGTTCCTCTAAGCACAGCCTCCCGGGTATGTAACTGAACTTGGTGCCAAAGTACTTGTGTACTA
2161 ATTTCTATTACTACGTACTGTCACTTTCCTCCCGTGCCATTACTGCATCATAATACAAGGAACCTCAGAGCCCCCATTTG
2241 TTCATTAAAGAGGCAACTACAGCCAAAATCACTGTTAAAATCTTACTACTTCATGGAGTAGCTCTTAGGAAAATATATCT
2321 TCCTCCTGAGTCTGGGTAATTATACCTCTCCCAAGCCCCCATTGTGTGTTGAAATCCTGTCATGAATCCTTGGTAGCTCT
2401 CTGAGAACAGTGAAGTCCAGGGAAAGGCATCTGGTCTGTCTGGAAAGCAAACATTATGTGGCCTCTGGTAGTTTTTTTCC
2481 TGTAAGAATACTGACTTTCTGGAGTAATGAGTATATATCAGTTATTGTACATGATTGCTTTGTGAAATGTGCAAATGATA
2561 TCACCTATGCAGCCTTGTTTGATTTATTTTCTCTGGTTTGTACTGTTATTAAAAGCATATTGTATTATAGAGCTATTCAG
2641 ATATTTTAAATATAAAGATGTATTGTTTCCGTAATATAGACGTATGGAATATATTTAGGTAATAGATGTATTACTTGGAA
2721 AGTTCTGCTTTGACAAACTGACAAAGTCTAAATGAGCACATGTATCCCAGTGAGCAGTAAATCAATGGAACATCCCAAGA
2801 AGAGGATAAGGATGCTTAAAATGGAAATCATTCTCCAACGATATACAAATTGGACTTGTTCAACTGCTGGATATATGCTA
2881 CCAATAACCCCAGCCCCAACTTAAAATTCTTACATTCAAGCTCCTAAGAGTTCTTAATTTATAACTAATTTTAAAAGAGA
2961 AGTTTCTTTTCTGGTTTTAGTTTGGGAATAATCATTCATTAAAAAAAATGTATTGTGGTTTATGCGAACAGACCAACCTG
3041 GCATTACAGTTGGCCTCTCCTTGAGGTGGGCACAGCCTGGCAGTGTGGCCAGGGGTGGCCATGTAAGTCCCATCAGGACG
3121 TAGTCATGCCTCCTGCATTTCGCTACCCGAGTTTAGTAACAGTGCAGATTCCACGTTCTTGTTCCGATACTCTGAGAAGT
3201 GCCTGATGTTGATGTACTTACAGACACAAGAACAATCTTTGCTATAATTGTATAAAGCCATAAATGTACATAAATTATGT
3281 TTAAATGGCTTGGTGTCTTTCTTTTCTAATTATGCAGAATAAGCTCTTTATTAGGAATTTTTTGTGAAGCTATTAAATAC
3361 TTGAGTTAAGTCTTGTCAGCCACAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agUAUGUCGAUCU--AU--UGGUUUCu 5'
            ||::| ||: |  |:  :|||||| 
Target 5' gtATGTAACTGAACTTGGTGCCAAAGt 3'
 2122 - 2148 137.00 -11.30
2 
miRNA  3' aguAUGUCGAUCUAU-UGGUUUcu 5'
             |::| || || | ||||||  
Target 5' accTGTAACT-GACAGACCAAAtt 3'
 1706 - 1728 135.00 -6.00
3 
miRNA  3' agUAUGUCGAUCUA-----UUGGUUUCu 5'
            | |:||||:| |     |||| ||| 
Target 5' agACATAGCTGGTTTTAGAAACCCAAGt 3'
 2072 - 2099 133.00 -12.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN20217081 376 COSMIC
COSN31769750 455 COSMIC
COSN26507089 469 COSMIC
COSN30176241 526 COSMIC
COSN20110644 584 COSMIC
COSN6410318 584 COSMIC
COSN22286442 595 COSMIC
COSN27388934 596 COSMIC
COSN30918998 597 COSMIC
COSN31597224 598 COSMIC
COSN17794089 599 COSMIC
COSN31769749 644 COSMIC
COSN26562101 746 COSMIC
COSN1158423 1104 COSMIC
COSN20110642 1106 COSMIC
COSN31603264 1147 COSMIC
COSN26505348 1157 COSMIC
COSN26504784 1161 COSMIC
COSN31596364 1302 COSMIC
COSN15671184 1308 COSMIC
COSN31534736 1364 COSMIC
COSN21469583 1410 COSMIC
COSN21468658 1411 COSMIC
COSN28637105 1470 COSMIC
COSN31959615 1487 COSMIC
COSN24031972 2054 COSMIC
COSN17038074 2120 COSMIC
COSN31769748 2393 COSMIC
COSN9746536 2407 COSMIC
COSN8592063 2565 COSMIC
COSN8129497 2665 COSMIC
COSN27199453 2711 COSMIC
COSN24608100 2934 COSMIC
COSN31479567 2960 COSMIC
COSN26566346 3012 COSMIC
COSN15662334 3104 COSMIC
COSN23525455 3145 COSMIC
COSN8587576 3153 COSMIC
COSN31541282 3286 COSMIC
COSN19018068 3365 COSMIC
COSN8587575 3557 COSMIC
COSN31566846 3800 COSMIC
rs3841231 1114 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs745343501 8 dbSNP
rs1461720726 12 dbSNP
rs954719653 13 dbSNP
rs749877266 14 dbSNP
rs1430919534 15 dbSNP
rs374930087 17 dbSNP
rs1020662472 19 dbSNP
rs1193545322 21 dbSNP
rs1455138489 24 dbSNP
rs770526416 29 dbSNP
rs747509005 30 dbSNP
rs1457620341 35 dbSNP
rs778492835 38 dbSNP
rs1187160712 41 dbSNP
rs1009738135 53 dbSNP
rs957725137 60 dbSNP
rs562138604 64 dbSNP
rs781392626 65 dbSNP
rs976584585 66 dbSNP
rs555894254 71 dbSNP
rs1018227132 74 dbSNP
rs759124635 75 dbSNP
rs186583526 85 dbSNP
rs1312114299 86 dbSNP
rs1412543723 88 dbSNP
rs539369700 94 dbSNP
rs1347444893 97 dbSNP
rs571100538 113 dbSNP
rs1044648857 123 dbSNP
rs1168371159 132 dbSNP
rs1461067767 134 dbSNP
rs958087335 136 dbSNP
rs769157838 140 dbSNP
rs1032322935 143 dbSNP
rs181811457 144 dbSNP
rs1323938195 147 dbSNP
rs1047802662 148 dbSNP
rs112585563 149 dbSNP
rs548764406 151 dbSNP
rs115476993 155 dbSNP
rs568695333 164 dbSNP
rs1013744652 173 dbSNP
rs1479582337 175 dbSNP
rs1201811804 181 dbSNP
rs895295212 181 dbSNP
rs1472498775 192 dbSNP
rs757675738 211 dbSNP
rs1387863058 212 dbSNP
rs1055405303 229 dbSNP
rs1318418077 231 dbSNP
rs943362288 233 dbSNP
rs942295271 236 dbSNP
rs1304528005 237 dbSNP
rs1274350109 242 dbSNP
rs751966396 243 dbSNP
rs1238112318 246 dbSNP
rs1277551395 250 dbSNP
rs548765994 272 dbSNP
rs1224205308 276 dbSNP
rs1337981718 278 dbSNP
rs987388012 282 dbSNP
rs954534953 283 dbSNP
rs929590980 288 dbSNP
rs918380701 293 dbSNP
rs533899019 308 dbSNP
rs976491402 310 dbSNP
rs571218689 317 dbSNP
rs1365846966 319 dbSNP
rs1470799516 328 dbSNP
rs1355139950 335 dbSNP
rs1163142319 339 dbSNP
rs1384092813 345 dbSNP
rs1422264391 352 dbSNP
rs764605004 361 dbSNP
rs1164902453 363 dbSNP
rs1291599237 368 dbSNP
rs913758131 379 dbSNP
rs987891238 380 dbSNP
rs911026637 388 dbSNP
rs372533319 392 dbSNP
rs1442866441 395 dbSNP
rs762959559 401 dbSNP
rs1001803135 412 dbSNP
rs1357155052 420 dbSNP
rs752776640 422 dbSNP
rs1398005728 423 dbSNP
rs1341734771 424 dbSNP
rs1279633473 426 dbSNP
rs144231048 429 dbSNP
rs367970399 430 dbSNP
rs569288354 436 dbSNP
rs1187252082 443 dbSNP
rs895980829 448 dbSNP
rs1241875192 454 dbSNP
rs1446970282 455 dbSNP
rs759663800 456 dbSNP
rs1416730208 457 dbSNP
rs1025048039 459 dbSNP
rs993582467 461 dbSNP
rs777291566 466 dbSNP
rs899214413 466 dbSNP
rs374809079 467 dbSNP
rs1380571262 470 dbSNP
rs73463242 471 dbSNP
rs1233859054 473 dbSNP
rs1454459479 479 dbSNP
rs564072154 484 dbSNP
rs1325886056 492 dbSNP
rs1225543620 509 dbSNP
rs1181509603 514 dbSNP
rs1034277821 530 dbSNP
rs189789024 543 dbSNP
rs1255439910 552 dbSNP
rs1261645712 553 dbSNP
rs888031507 557 dbSNP
rs527551438 560 dbSNP
rs1243244025 568 dbSNP
rs929664248 572 dbSNP
rs933257722 572 dbSNP
rs1334178226 573 dbSNP
rs3751437 580 dbSNP
rs1225646044 584 dbSNP
rs1351641415 589 dbSNP
rs1403538718 590 dbSNP
rs1040838594 592 dbSNP
rs1441199018 593 dbSNP
rs943801669 593 dbSNP
rs910942618 594 dbSNP
rs1297813164 595 dbSNP
rs1327308458 596 dbSNP
rs200144910 596 dbSNP
rs73173152 596 dbSNP
rs1204685822 597 dbSNP
rs1389643935 597 dbSNP
rs1374574697 598 dbSNP
rs988352472 598 dbSNP
rs1202908530 599 dbSNP
rs541965979 599 dbSNP
rs957916800 600 dbSNP
rs1393047165 601 dbSNP
rs1320977225 605 dbSNP
rs576057357 607 dbSNP
rs1451527515 608 dbSNP
rs768846140 608 dbSNP
rs1290725539 609 dbSNP
rs61963698 610 dbSNP
rs924995701 614 dbSNP
rs1408249052 619 dbSNP
rs1158422356 620 dbSNP
rs1438151160 622 dbSNP
rs980498705 625 dbSNP
rs969020810 626 dbSNP
rs925241928 634 dbSNP
rs1315670925 635 dbSNP
rs562596600 636 dbSNP
rs1262013590 644 dbSNP
rs9532558 645 dbSNP
rs960594747 646 dbSNP
rs1026579207 647 dbSNP
rs1266383901 660 dbSNP
rs774099661 664 dbSNP
rs576754289 665 dbSNP
rs1191618788 673 dbSNP
rs1490737750 673 dbSNP
rs1249487761 678 dbSNP
rs1447863717 683 dbSNP
rs1283742304 687 dbSNP
rs1161138160 689 dbSNP
rs1364287477 692 dbSNP
rs553776902 694 dbSNP
rs1239172990 697 dbSNP
rs1351169829 698 dbSNP
rs1161739424 709 dbSNP
rs1367749457 713 dbSNP
rs1024951493 716 dbSNP
rs1297966635 718 dbSNP
rs1371574970 727 dbSNP
rs1159643329 729 dbSNP
rs1308400820 733 dbSNP
rs1305576879 749 dbSNP
rs992144733 750 dbSNP
rs534513928 754 dbSNP
rs768721318 755 dbSNP
rs959728934 759 dbSNP
rs1221762941 772 dbSNP
rs1016321477 773 dbSNP
rs530277142 779 dbSNP
rs749308261 784 dbSNP
rs1234978281 788 dbSNP
rs575145761 798 dbSNP
rs1007680937 799 dbSNP
rs1006842623 805 dbSNP
rs1443914494 809 dbSNP
rs1366792896 813 dbSNP
rs889118107 821 dbSNP
rs1026597182 825 dbSNP
rs1052228146 826 dbSNP
rs1352961719 834 dbSNP
rs1041119894 837 dbSNP
rs370137322 842 dbSNP
rs1382776691 844 dbSNP
rs1007857453 847 dbSNP
rs143915100 856 dbSNP
rs569291864 861 dbSNP
rs377399089 865 dbSNP
rs1271900211 873 dbSNP
rs925103729 875 dbSNP
rs139933205 879 dbSNP
rs1454265212 881 dbSNP
rs925154335 889 dbSNP
rs566549109 890 dbSNP
rs980488815 891 dbSNP
rs780924281 895 dbSNP
rs1473197500 902 dbSNP
rs183906523 922 dbSNP
rs527788428 923 dbSNP
rs147514273 925 dbSNP
rs561601058 936 dbSNP
rs1026943245 940 dbSNP
rs1282261799 944 dbSNP
rs1339212381 945 dbSNP
rs1407438885 947 dbSNP
rs1211317201 959 dbSNP
rs1269062324 960 dbSNP
rs1215889789 961 dbSNP
rs1359442930 961 dbSNP
rs1311601866 963 dbSNP
rs1278637935 968 dbSNP
rs548128955 969 dbSNP
rs1221446433 981 dbSNP
rs1215830966 985 dbSNP
rs993635184 991 dbSNP
rs564906736 992 dbSNP
rs1240372550 995 dbSNP
rs1486976078 999 dbSNP
rs1277219060 1005 dbSNP
rs1194607244 1008 dbSNP
rs562474119 1008 dbSNP
rs1429055162 1009 dbSNP
rs1479683653 1017 dbSNP
rs778591760 1029 dbSNP
rs1007636466 1030 dbSNP
rs889176998 1038 dbSNP
rs1030435180 1049 dbSNP
rs1342885290 1050 dbSNP
rs1401482481 1051 dbSNP
rs1298480131 1062 dbSNP
rs1344447394 1069 dbSNP
rs1221534795 1074 dbSNP
rs997887775 1081 dbSNP
rs545908490 1096 dbSNP
rs1345651156 1097 dbSNP
rs889450308 1099 dbSNP
rs1282285230 1102 dbSNP
rs200586791 1106 dbSNP
rs201477809 1106 dbSNP
rs1217405258 1113 dbSNP
rs1202057010 1115 dbSNP
rs1268533777 1115 dbSNP
rs3841231 1115 dbSNP
rs397686405 1115 dbSNP
rs1357940007 1117 dbSNP
rs1173101615 1121 dbSNP
rs903585018 1123 dbSNP
rs1421034899 1124 dbSNP
rs1410633741 1125 dbSNP
rs1364639044 1127 dbSNP
rs1402654941 1137 dbSNP
rs1325286379 1138 dbSNP
rs1331435488 1139 dbSNP
rs1441419418 1143 dbSNP
rs1277754365 1147 dbSNP
rs1379018918 1148 dbSNP
rs34885278 1148 dbSNP
rs1357557142 1157 dbSNP
rs3841230 1157 dbSNP
rs765881230 1157 dbSNP
rs796726025 1157 dbSNP
rs1224953702 1161 dbSNP
rs1418944156 1161 dbSNP
rs575914593 1166 dbSNP
rs1476343205 1174 dbSNP
rs1258482759 1176 dbSNP
rs113962714 1179 dbSNP
rs1188398684 1181 dbSNP
rs1482773701 1185 dbSNP
rs1052775186 1188 dbSNP
rs917866770 1191 dbSNP
rs936633637 1195 dbSNP
rs758904031 1197 dbSNP
rs903679846 1203 dbSNP
rs375012737 1213 dbSNP
rs1056379440 1223 dbSNP
rs1164593653 1230 dbSNP
rs947901267 1231 dbSNP
rs1390976569 1234 dbSNP
rs753262908 1241 dbSNP
rs1326591605 1245 dbSNP
rs1336493468 1249 dbSNP
rs563772841 1249 dbSNP
rs1447336916 1261 dbSNP
rs1314493583 1264 dbSNP
rs1380609878 1266 dbSNP
rs938041483 1274 dbSNP
rs1293462744 1278 dbSNP
rs926628342 1280 dbSNP
rs991924247 1296 dbSNP
rs929596770 1298 dbSNP
rs952120518 1302 dbSNP
rs1458612283 1303 dbSNP
rs1203546667 1312 dbSNP
rs1242014565 1317 dbSNP
rs1442291536 1320 dbSNP
rs919306195 1329 dbSNP
rs1377377198 1330 dbSNP
rs1300230444 1335 dbSNP
rs1443622153 1350 dbSNP
rs1368741309 1367 dbSNP
rs765278912 1371 dbSNP
rs371216432 1394 dbSNP
rs1165942677 1402 dbSNP
rs966196127 1403 dbSNP
rs1019648449 1404 dbSNP
rs543892684 1412 dbSNP
rs1168702357 1420 dbSNP
rs963648436 1431 dbSNP
rs1403770901 1432 dbSNP
rs1007796819 1434 dbSNP
rs35766455 1435 dbSNP
rs1463020305 1448 dbSNP
rs1307837726 1459 dbSNP
rs1326092815 1462 dbSNP
rs953867356 1467 dbSNP
rs909477745 1468 dbSNP
rs1280528195 1472 dbSNP
rs986275692 1474 dbSNP
rs1223260420 1483 dbSNP
rs1418865953 1489 dbSNP
rs1000454969 1492 dbSNP
rs953529559 1497 dbSNP
rs1030799429 1498 dbSNP
rs1423062255 1506 dbSNP
rs1253870482 1507 dbSNP
rs9577066 1511 dbSNP
rs180977442 1512 dbSNP
rs1237418113 1530 dbSNP
rs1196220830 1538 dbSNP
rs555236093 1545 dbSNP
rs1020658088 1547 dbSNP
rs1175432750 1548 dbSNP
rs562468567 1549 dbSNP
rs1000722058 1550 dbSNP
rs538088730 1555 dbSNP
rs1246301532 1571 dbSNP
rs77243787 1581 dbSNP
rs1384300132 1583 dbSNP
rs1243663179 1584 dbSNP
rs1009391927 1589 dbSNP
rs1319529636 1594 dbSNP
rs896309245 1595 dbSNP
rs903748676 1597 dbSNP
rs772796739 1601 dbSNP
rs58134582 1603 dbSNP
rs564457403 1605 dbSNP
rs558856511 1612 dbSNP
rs1384458923 1614 dbSNP
rs748084836 1618 dbSNP
rs1256098455 1620 dbSNP
rs1349388542 1622 dbSNP
rs539136949 1623 dbSNP
rs1049097689 1627 dbSNP
rs1011994143 1628 dbSNP
rs1443227562 1631 dbSNP
rs774130709 1634 dbSNP
rs919378294 1635 dbSNP
rs542801498 1637 dbSNP
rs1395262396 1641 dbSNP
rs566583313 1644 dbSNP
rs896327156 1649 dbSNP
rs972135607 1651 dbSNP
rs1434874229 1652 dbSNP
rs45450701 1653 dbSNP
rs912045420 1657 dbSNP
rs1451772263 1659 dbSNP
rs1160530443 1703 dbSNP
rs552951317 1708 dbSNP
rs953663025 1712 dbSNP
rs918228789 1716 dbSNP
rs536241100 1717 dbSNP
rs1387685440 1718 dbSNP
rs761445954 1720 dbSNP
rs553938705 1725 dbSNP
rs17592236 1728 dbSNP
rs1176655976 1730 dbSNP
rs781310710 1731 dbSNP
rs1009254741 1733 dbSNP
rs1263483416 1739 dbSNP
rs1489369583 1741 dbSNP
rs188025180 1742 dbSNP
rs1469738409 1745 dbSNP
rs1191524736 1748 dbSNP
rs896201864 1754 dbSNP
rs986390007 1768 dbSNP
rs1034874523 1775 dbSNP
rs1180591699 1782 dbSNP
rs1253138949 1794 dbSNP
rs531480991 1805 dbSNP
rs1487339870 1808 dbSNP
rs1161955798 1809 dbSNP
rs905109437 1810 dbSNP
rs143178473 1821 dbSNP
rs1297948821 1831 dbSNP
rs1394982028 1833 dbSNP
rs930662446 1837 dbSNP
rs1310858012 1841 dbSNP
rs1376936404 1842 dbSNP
rs1244577238 1847 dbSNP
rs552046477 1852 dbSNP
rs1323140439 1856 dbSNP
rs1222107865 1858 dbSNP
rs956843062 1868 dbSNP
rs1456409371 1869 dbSNP
rs1200403576 1870 dbSNP
rs766859605 1882 dbSNP
rs1238690085 1884 dbSNP
rs897816203 1885 dbSNP
rs1180184461 1895 dbSNP
rs1416297854 1906 dbSNP
rs757530498 1909 dbSNP
rs1424554466 1917 dbSNP
rs1170199626 1919 dbSNP
rs138884600 1922 dbSNP
rs1467668418 1926 dbSNP
rs764035605 1931 dbSNP
rs1405956519 1932 dbSNP
rs1307757322 1942 dbSNP
rs1237200014 1946 dbSNP
rs1300555375 1962 dbSNP
rs1380910493 1971 dbSNP
rs1372340126 1975 dbSNP
rs1036471592 1982 dbSNP
rs560288256 1990 dbSNP
rs1300750529 1992 dbSNP
rs747013894 1994 dbSNP
rs1220205241 2005 dbSNP
rs1258703072 2007 dbSNP
rs1385079651 2008 dbSNP
rs369839147 2010 dbSNP
rs1387428126 2023 dbSNP
rs73463239 2025 dbSNP
rs1420109643 2030 dbSNP
rs1483721132 2039 dbSNP
rs911934418 2042 dbSNP
rs529697028 2048 dbSNP
rs1261281866 2050 dbSNP
rs1000796094 2054 dbSNP
rs968022703 2063 dbSNP
rs986319182 2069 dbSNP
rs1023472327 2074 dbSNP
rs1429275376 2076 dbSNP
rs1413208942 2085 dbSNP
rs778014375 2088 dbSNP
rs1156587401 2095 dbSNP
rs1455576060 2096 dbSNP
rs1360341630 2098 dbSNP
rs1378129951 2106 dbSNP
rs1197556590 2111 dbSNP
rs1448094317 2112 dbSNP
rs1337954577 2117 dbSNP
rs561450017 2117 dbSNP
rs1401673113 2126 dbSNP
rs544911766 2127 dbSNP
rs575814105 2131 dbSNP
rs1217369502 2135 dbSNP
rs34578001 2137 dbSNP
rs1280858434 2143 dbSNP
rs896306993 2147 dbSNP
rs1056323089 2150 dbSNP
rs1261386395 2151 dbSNP
rs1489386929 2156 dbSNP
rs1194865584 2157 dbSNP
rs1487741550 2160 dbSNP
rs559112253 2167 dbSNP
rs1268545801 2168 dbSNP
rs994309082 2170 dbSNP
rs967714345 2175 dbSNP
rs1426448311 2177 dbSNP
rs1414608840 2179 dbSNP
rs762958746 2182 dbSNP
rs1349326459 2189 dbSNP
rs1157510660 2191 dbSNP
rs1020597369 2217 dbSNP
rs1358242090 2217 dbSNP
rs1421067725 2222 dbSNP
rs987739665 2228 dbSNP
rs1434005066 2229 dbSNP
rs1231185852 2246 dbSNP
rs1328230595 2248 dbSNP
rs1296347531 2257 dbSNP
rs896880070 2278 dbSNP
rs960493943 2287 dbSNP
rs1223347940 2299 dbSNP
rs1035141893 2300 dbSNP
rs545148544 2305 dbSNP
rs775604226 2306 dbSNP
rs573046023 2307 dbSNP
rs1454146912 2313 dbSNP
rs910925657 2316 dbSNP
rs969617815 2318 dbSNP
rs1027601257 2324 dbSNP
rs1402839365 2325 dbSNP
rs1050665372 2333 dbSNP
rs932277882 2335 dbSNP
rs41286979 2341 dbSNP
rs1036376237 2344 dbSNP
rs1441182637 2348 dbSNP
rs1009275021 2350 dbSNP
rs557773361 2357 dbSNP
rs553039287 2358 dbSNP
rs1325264628 2365 dbSNP
rs1350413191 2369 dbSNP
rs1445873396 2373 dbSNP
rs932197914 2378 dbSNP
rs745409179 2383 dbSNP
rs1240924680 2385 dbSNP
rs1283891949 2390 dbSNP
rs1477297087 2393 dbSNP
rs1354490970 2394 dbSNP
rs758967137 2416 dbSNP
rs1212014580 2419 dbSNP
rs1290949280 2422 dbSNP
rs536276967 2425 dbSNP
rs1437789332 2437 dbSNP
rs976245477 2441 dbSNP
rs935514653 2445 dbSNP
rs573026612 2447 dbSNP
rs567347205 2460 dbSNP
rs557041510 2461 dbSNP
rs1043185540 2466 dbSNP
rs923986345 2467 dbSNP
rs1367594837 2469 dbSNP
rs538154981 2475 dbSNP
rs1471573045 2494 dbSNP
rs1164787465 2501 dbSNP
rs913454725 2502 dbSNP
rs1465062203 2511 dbSNP
rs569009842 2513 dbSNP
rs1256122032 2516 dbSNP
rs1199277552 2521 dbSNP
rs1402365009 2521 dbSNP
rs1447685016 2529 dbSNP
rs968014778 2540 dbSNP
rs1338928070 2541 dbSNP
rs1247207131 2545 dbSNP
rs1285178701 2557 dbSNP
rs1023632444 2571 dbSNP
rs1251981273 2572 dbSNP
rs1217152921 2583 dbSNP
rs534331180 2583 dbSNP
rs34972103 2587 dbSNP
rs776092275 2589 dbSNP
rs1885269 2593 dbSNP
rs770624254 2594 dbSNP
rs150281661 2598 dbSNP
rs1254784305 2616 dbSNP
rs1440368235 2619 dbSNP
rs927766738 2629 dbSNP
rs980914891 2636 dbSNP
rs746707668 2641 dbSNP
rs896987374 2645 dbSNP
rs1425706074 2647 dbSNP
rs566607004 2648 dbSNP
rs1416441211 2649 dbSNP
rs994642742 2651 dbSNP
rs1016684792 2662 dbSNP
rs1397833785 2664 dbSNP
rs1333213757 2665 dbSNP
rs376370715 2667 dbSNP
rs112254821 2668 dbSNP
rs560953489 2670 dbSNP
rs1014848329 2673 dbSNP
rs889435116 2681 dbSNP
rs543820398 2684 dbSNP
rs1254926425 2703 dbSNP
rs1464640970 2704 dbSNP
rs375498935 2712 dbSNP
rs1280669843 2714 dbSNP
rs1487724437 2722 dbSNP
rs1191243361 2730 dbSNP
rs192298668 2733 dbSNP
rs902073080 2736 dbSNP
rs565434661 2739 dbSNP
rs545236302 2760 dbSNP
rs1467709225 2761 dbSNP
rs1173222889 2762 dbSNP
rs188690273 2763 dbSNP
rs1358722734 2765 dbSNP
rs115786369 2769 dbSNP
rs979484751 2788 dbSNP
rs946177498 2789 dbSNP
rs913523719 2790 dbSNP
rs1198154664 2792 dbSNP
rs1333318454 2793 dbSNP
rs537869894 2796 dbSNP
rs1234795904 2808 dbSNP
rs1303408141 2809 dbSNP
rs1352568853 2809 dbSNP
rs1213945249 2813 dbSNP
rs570360377 2820 dbSNP
rs916568358 2822 dbSNP
rs1209019120 2825 dbSNP
rs1265255526 2826 dbSNP
rs939057767 2832 dbSNP
rs990807455 2835 dbSNP
rs1199680129 2836 dbSNP
rs1234164049 2840 dbSNP
rs748624043 2846 dbSNP
rs1355844980 2856 dbSNP
rs1034910154 2857 dbSNP
rs927600691 2863 dbSNP
rs1361379940 2871 dbSNP
rs1337532917 2878 dbSNP
rs1457767145 2880 dbSNP
rs1331936505 2885 dbSNP
rs1393517321 2887 dbSNP
rs973093803 2899 dbSNP
rs779419041 2900 dbSNP
rs542731461 2901 dbSNP
rs1237283361 2902 dbSNP
rs116617950 2903 dbSNP
rs1327275406 2914 dbSNP
rs867040788 2917 dbSNP
rs765674269 2928 dbSNP
rs754954529 2930 dbSNP
rs920307932 2932 dbSNP
rs1263388802 2936 dbSNP
rs973272849 2944 dbSNP
rs148195072 2948 dbSNP
rs1237474732 2953 dbSNP
rs1456535655 2953 dbSNP
rs889509461 2955 dbSNP
rs1412538788 2956 dbSNP
rs1180569938 2958 dbSNP
rs1408999012 2973 dbSNP
rs117958521 2987 dbSNP
rs1423391942 2989 dbSNP
rs185321939 2992 dbSNP
rs1028097243 3001 dbSNP
rs961866881 3003 dbSNP
rs1163153791 3004 dbSNP
rs1370513044 3005 dbSNP
rs1458713363 3008 dbSNP
rs537048188 3011 dbSNP
rs1014872161 3016 dbSNP
rs568537590 3028 dbSNP
rs900845354 3031 dbSNP
rs1444014409 3034 dbSNP
rs1040622948 3036 dbSNP
rs1332727320 3039 dbSNP
rs372851785 3040 dbSNP
rs902672447 3041 dbSNP
rs1310345824 3043 dbSNP
rs1043901510 3047 dbSNP
rs1178533481 3053 dbSNP
rs1233645692 3057 dbSNP
rs550249101 3058 dbSNP
rs916625312 3059 dbSNP
rs1315924110 3082 dbSNP
rs1200604432 3092 dbSNP
rs1233482581 3094 dbSNP
rs193132822 3096 dbSNP
rs1254986047 3102 dbSNP
rs35569244 3115 dbSNP
rs904620236 3118 dbSNP
rs1055626399 3131 dbSNP
rs939358895 3132 dbSNP
rs927993267 3143 dbSNP
rs891948868 3144 dbSNP
rs188090269 3145 dbSNP
rs1207898214 3146 dbSNP
rs1355551543 3155 dbSNP
rs961311930 3156 dbSNP
rs796812663 3158 dbSNP
rs1045135853 3160 dbSNP
rs1277258753 3168 dbSNP
rs1338369123 3179 dbSNP
rs1220332393 3181 dbSNP
rs1273604005 3182 dbSNP
rs566694615 3196 dbSNP
rs1374499307 3202 dbSNP
rs1304998282 3210 dbSNP
rs947661784 3214 dbSNP
rs920377434 3215 dbSNP
rs1258044914 3216 dbSNP
rs973138152 3220 dbSNP
rs1193402296 3224 dbSNP
rs1349003642 3234 dbSNP
rs940528830 3238 dbSNP
rs907720873 3243 dbSNP
rs1187672031 3245 dbSNP
rs536960434 3252 dbSNP
rs987294749 3253 dbSNP
rs983929628 3259 dbSNP
rs1413480933 3276 dbSNP
rs1402847976 3284 dbSNP
rs1173331599 3286 dbSNP
rs953865158 3291 dbSNP
rs1376898246 3303 dbSNP
rs1361608585 3311 dbSNP
rs1297374559 3312 dbSNP
rs546782697 3313 dbSNP
rs998379920 3314 dbSNP
rs1418421186 3317 dbSNP
rs766433687 3318 dbSNP
rs1191910282 3322 dbSNP
rs1021690969 3324 dbSNP
rs1348910129 3337 dbSNP
rs1031778671 3338 dbSNP
rs1216102682 3340 dbSNP
rs1284120567 3343 dbSNP
rs1489500681 3347 dbSNP
rs999770958 3349 dbSNP
rs1477729896 3353 dbSNP
rs1180321767 3358 dbSNP
rs1477286648 3368 dbSNP
rs536362400 3372 dbSNP
rs1396307846 3374 dbSNP
rs1454313745 3380 dbSNP
rs1157718626 3393 dbSNP
rs1378092863 3394 dbSNP
rs1402288199 3399 dbSNP
rs1318656455 3402 dbSNP
rs1010256872 3405 dbSNP
rs1245247278 3414 dbSNP
rs1328032056 3415 dbSNP
rs1371880696 3424 dbSNP
rs756343090 3431 dbSNP
rs1307438152 3432 dbSNP
rs902745873 3433 dbSNP
rs1356109522 3435 dbSNP
rs567201093 3440 dbSNP
rs1450413418 3441 dbSNP
rs1036280547 3444 dbSNP
rs1254137404 3448 dbSNP
rs1043974474 3452 dbSNP
rs1010996325 3453 dbSNP
rs895352138 3458 dbSNP
rs1378111297 3472 dbSNP
rs1055211631 3475 dbSNP
rs1158964044 3483 dbSNP
rs1351506821 3483 dbSNP
rs1412743034 3483 dbSNP
rs1167067380 3491 dbSNP
rs1395125385 3493 dbSNP
rs763945786 3499 dbSNP
rs1219357139 3502 dbSNP
rs1366251126 3507 dbSNP
rs550595286 3529 dbSNP
rs898815194 3534 dbSNP
rs1283791722 3540 dbSNP
rs927972457 3544 dbSNP
rs1037348084 3545 dbSNP
rs1037409398 3546 dbSNP
rs940019537 3549 dbSNP
rs940436969 3551 dbSNP
rs1197462552 3557 dbSNP
rs907585055 3558 dbSNP
rs369371669 3559 dbSNP
rs909759110 3564 dbSNP
rs530412976 3569 dbSNP
rs1439219135 3571 dbSNP
rs754257786 3574 dbSNP
rs1418245516 3576 dbSNP
rs1471728436 3577 dbSNP
rs1189788501 3579 dbSNP
rs565604388 3582 dbSNP
rs1377853539 3583 dbSNP
rs984048530 3585 dbSNP
rs1168647359 3589 dbSNP
rs551681464 3592 dbSNP
rs182616961 3593 dbSNP
rs953853381 3594 dbSNP
rs1169670603 3596 dbSNP
rs1417025023 3597 dbSNP
rs1294216766 3602 dbSNP
rs189937695 3603 dbSNP
rs1262739245 3604 dbSNP
rs144573709 3615 dbSNP
rs1253575806 3616 dbSNP
rs1340914078 3619 dbSNP
rs186612860 3621 dbSNP
rs1440288289 3622 dbSNP
rs1239177642 3623 dbSNP
rs1257903328 3629 dbSNP
rs1191462475 3632 dbSNP
rs965532131 3634 dbSNP
rs968712792 3635 dbSNP
rs1172011910 3637 dbSNP
rs1400339536 3648 dbSNP
rs574124830 3649 dbSNP
rs1313895710 3650 dbSNP
rs1360349446 3653 dbSNP
rs1311484335 3656 dbSNP
rs1031434039 3659 dbSNP
rs113132653 3660 dbSNP
rs998454080 3663 dbSNP
rs765236963 3676 dbSNP
rs956326554 3680 dbSNP
rs368311253 3683 dbSNP
rs544581528 3683 dbSNP
rs1212634285 3690 dbSNP
rs1318234842 3694 dbSNP
rs758906657 3695 dbSNP
rs970238566 3699 dbSNP
rs1203143957 3701 dbSNP
rs183408269 3710 dbSNP
rs1011151888 3725 dbSNP
rs1023246105 3726 dbSNP
rs34241243 3736 dbSNP
rs1381752638 3740 dbSNP
rs1455626418 3742 dbSNP
rs1303744624 3743 dbSNP
rs1174540723 3750 dbSNP
rs1379915623 3751 dbSNP
rs1447966533 3761 dbSNP
rs1055728829 3762 dbSNP
rs1003725755 3767 dbSNP
rs1331053083 3768 dbSNP
rs906584959 3775 dbSNP
rs754877502 3779 dbSNP
rs1322334994 3785 dbSNP
rs760551502 3790 dbSNP
rs1235842492 3792 dbSNP
rs1303763387 3801 dbSNP
rs760386405 3804 dbSNP
rs1037119958 3807 dbSNP
rs1352452754 3807 dbSNP
rs1423244167 3809 dbSNP
rs1168756266 3811 dbSNP
rs1476286807 3818 dbSNP
rs776203754 3824 dbSNP
rs1209217574 3826 dbSNP
rs577937893 3828 dbSNP
rs1251027834 3833 dbSNP
rs553212862 3839 dbSNP
rs1469932611 3842 dbSNP
rs1182170384 3843 dbSNP
rs1482888038 3844 dbSNP
rs558154157 3846 dbSNP
rs567705777 3852 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEC-1-B , Ishiwaka , Clinical specimens
Location of target site 3'UTR
Tools used in this research miRanda , miRBase Target Database , PicTar , TargetScan
Original Description (Extracted from the article) ... "FOXO1 expression was efficiently restored in the Ishikawa cell line upon simultaneous inhibition of miR-9 ...

- Myatt SS; Wang J; Monteiro LJ; Christian M; et al., 2010, Cancer research.

Article - Myatt SS; Wang J; Monteiro LJ; Christian M; et al.
- Cancer research, 2010
Endometrial cancer is the most common malignancy of the lower female reproductive tract. The tumor suppressor FOXO1 is downregulated in endometrial cancer compared with normal endometrium but the underlying mechanisms are not well understood. Using microRNA (miR) target prediction algorithms, we identified several miRs that potentially bind the 3'-untranslated region of FOXO1 transcripts. Expression profiling of normal and malignant endometrial samples by quantitative real-time PCR and Northern blot analysis revealed an inverse correlation between the levels of FOXO1 protein and the abundance of several of the in silico-predicted miRs, suggesting that loss of FOXO1 expression in endometrial cancer may be mediated by miRs. To determine the role of candidate miRs, we used the endometrial cancer cell lines HEC-1B and Ishikawa, which express FOXO1 at high and low levels, respectively. Expression of miR-9, miR-27, miR-96, miR-153, miR-182, miR-183, or miR-186, but not miR-29a, miR-128, miR-152, or miR-486 mimetics in HEC-1B cells was sufficient to significantly reduce the abundance of FOXO1. Conversely, FOXO1 expression was efficiently restored in the Ishikawa cell line upon simultaneous inhibition of miR-9, miR-27, miR-96, miR-153, miR-183, and miR-186. Moreover, induction of FOXO1 in Ishikawa cells by miR inhibitors was accompanied by G1 cell cycle arrest and cell death, and was attenuated by the small interfering RNA-mediated downregulation of FOXO1 expression. Our findings identify several miRs overexpressed in endometrial cancer that function in concert to repress FOXO1 expression. Further, aberrant miR expression results in deregulated cell cycle control and impaired apoptotic responses, and thus, may be central to endometrial tumorigenesis.
LinkOut: [PMID: 20028871]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions 293T , NIH 3T3
Location of target site 3'UTR
Original Description (Extracted from the article) ... miR-9 binds to and represses pMir-Report reporters for both FoxO1 and FoxO3 3芒鈧虏 UTR regions. ...

- Senyuk V; Zhang Y; Liu Y; Ming M; Premanand et al., 2013, Proceedings of the National Academy of Sciences of the United States of America.

Article - Senyuk V; Zhang Y; Liu Y; Ming M; Premanand et al.
- Proceedings of the National Academy of Sciences of the United States of America, 2013
MicroRNA-9 (miR-9) is emerging as a critical regulator of organ development and neurogenesis. It is also deregulated in several types of solid tumors; however, its role in hematopoiesis and leukemogenesis is not yet known. Here we show that miR-9 is detected in hematopoietic stem cells and hematopoietic progenitor cells, and that its expression increases during hematopoietic differentiation. Ectopic expression of miR-9 strongly accelerates terminal myelopoiesis and promotes apoptosis in vitro and in vivo. Conversely, in hematopoietic progenitor cells, the inhibition of miR-9 with a miRNA sponge blocks myelopoiesis. Ecotropic viral integration site 1 (EVI1), required for normal embryogenesis, is considered an oncogene because its inappropriate up-regulation induces malignant transformation in solid and hematopoietic cancers. Here we show that EVI1 binds to the promoter of miR-9-3, leading to DNA hypermethylation of the promoter and repression of miR-9. Moreover, miR-9 expression reverses a myeloid differentiation block that is induced by EVI1. Our findings indicate that EVI1, when inappropriately expressed, delays or blocks myeloid differentiation at least in part by DNA hypermethylation and down-regulation of miR-9. It was reported that Forkhead box class O genes (FoxOs) inhibit myeloid differentiation and prevent differentiation of leukemia-initiating cells. Here we identify both FoxO1 and FoxO3 as direct targets of miR-9 in hematopoietic cells and find that up-regulation of FoxO3 inhibits miR-9-induced myelopoiesis. These results reveal a unique role of miR-9 in myelopoiesis and in the pathogenesis of EVI1-induced myeloid neoplasms and provide insights into the epigenetic regulation of miR9 in tumorigenesis.
LinkOut: [PMID: 23509296]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions A549
Location of target site 3'UTR
Tools used in this research PicTar , previous_study , TargetScan
Original Description (Extracted from the article) ... "FoxO1 is a target of miR-9. These findings suggest that oncogenic miR-9 targeted FoxO1 to promote cell growth ...

- Chen X; Zhu L; Ma Z; Sun G; Luo X; Li M; et al., 2015, Scientific reports.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' aguaugucgaucuauuGGUUUCu 5'
                          |||||| 
Target 5' ---uxxxxxxaxxxxxCCAAAGa 3'
 		1 - 20
Article - Chen X; Zhu L; Ma Z; Sun G; Luo X; Li M; et al.
- Scientific reports, 2015
EGFR-targeted cancer therapy is a breakthrough in non-small cell carcinoma. miRNAs have been proved to play important roles in cancer. Currently, for the role of miRNAs in EGFR-targeted cancer therapy is unclear. In this study, first we found that erlotinib reduced the expression of miR-9. MiR-9 expression was increased in human lung cancer tissues compared with peripheral normal tissues, and miR-9 promoted the growth of NSCLC cells. Overexpression of miR-9 decreased the growth inhibitory effect of erlotinib. Second, miR-9 decreased FoxO1 expression by directly inhibition of its mRNA translation. Adenovirus-mediated overexpression of FoxO1 or siRNA-mediated downregulation of FoxO1 negatively regulated cell growth. And exogenous overexpression FoxO1 reduced the pro-growth effect of miR-9. Finally, we found that erlotinib upregulated FoxO1 protein expression. Moreover, overexpression of miR-9 decreased erlotinib-induced FoxO1 expression, and overexpression of FoxO1 enhanced the growth inhibitory effects of erlotinib. Additionally, we found that erlotinib downregulates miR-9 expression through suppressing the transcrption of miR-9-1 and enhanced DNA methylation maybe involved. These findings suggest that oncogenic miR-9 targeted FoxO1 to promote cell growth, and downregulation of this axis was involved in erlotinib's growth inhibitory effects. Clarifying the regulation of miRNAs by erlotinib may indicate novel strategies for enhancing EGFR-targeted cancer therapy.
LinkOut: [PMID: 26593208]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' aguaugucgaucuauuGGUUUCu 5'
                          |||||| 
Target 5' ---uxxxxxxaxxxxxCCAAAGa 3'
 		1 - 20
Article - Yan C; Chen J; Li M; Xuan W; Su D; You H; et al.
- Diabetologia, 2016
AIM/HYPOTHESIS: MicroRNA-9 (miR-9) is involved in the regulation of pancreatic beta cell function. However, its role in gluconeogenesis is still unclear. Our objective was to investigate the role of miR-9 in hepatic glucose production (HGP). METHODS: MiR-9 expression was measured in livers of high-fat diet (HFD) mice and ob/ob mice. The methylation status of the miR-9-3 promoter regions in hepatocytes was determined by the methylation-specific PCR procedure. The binding activity of DNA methyltransferase (DNMT)1, DNMT3a and DNMT3b on the miR-9-3 promoter was detected by chromatin immunoprecipitation (ChIP) and quantitative real-time PCR assays. HGP was evaluated in vitro and in vivo. Glucose tolerance, insulin tolerance and pyruvate tolerance tests were also performed. RESULTS: Reduced miR-9 expression and hypermethylation of the miR-9-3 promoter were observed in the livers of obese mice. Further study showed that the binding of DNMT1, but not of DNMT3a and DNMT3b, to the miR-9-3 promoter was increased in hepatocytes from ob/ob mice. Knockdown of DNMT1 alleviated the decrease in hepatic miR-9 expression in vivo and in vitro. Overexpression of hepatic miR-9 improved insulin sensitivity in obese mice and inhibited HGP. In addition, deletion of hepatic miR-9 led to an increase in random and fasting blood glucose levels in lean mice. Importantly, silenced forkhead box O1 (FOXO1) expression reversed the gluconeogenesis and glucose production in hepatocytes induced by miR-9 deletion. CONCLUSIONS/INTERPRETATION: Our observations suggest that the decrease in miR-9 expression contributes to an inappropriately activated gluconeogenesis in obese mice.
LinkOut: [PMID: 27003684]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE17306 Multiple myeloma -0.535 3.7e-5 -0.383 3.3e-3 49 Click to see details
GSE42095 Differentiated embryonic stem cells -0.604 1.1e-3 -0.594 1.4e-3 23 Click to see details
GSE28544 Breast cancer -0.462 1.2e-2 -0.533 3.7e-3 24 Click to see details
GSE19536 Breast cancer -0.177 3.9e-2 -0.030 3.8e-1 100 Click to see details
GSE28260 Renal cortex and medulla 0.505 3.9e-2 0.462 5.6e-2 13 Click to see details
GSE19783 ER- ER- breast cancer -0.18 5.6e-2 -0.018 4.4e-1 79 Click to see details
GSE21687 Ependynoma primary tumors 0.198 5.8e-2 0.134 1.5e-1 64 Click to see details
GSE14794 Lymphoblastoid cells 0.156 7.1e-2 0.163 6.2e-2 90 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.215 1.5e-1 -0.087 3.4e-1 25 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.279 2.3e-1 0.267 2.4e-1 9 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.132 2.6e-1 0.240 1.2e-1 25 Click to see details
GSE19783 ER+ ER+ breast cancer -0.121 3.1e-1 -0.126 3.0e-1 20 Click to see details
GSE19350 CNS germ cell tumors 0.115 3.6e-1 0.334 1.4e-1 12 Click to see details
GSE17498 Multiple myeloma -0.047 3.9e-1 -0.011 4.7e-1 40 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.06 4.0e-1 0.341 7.1e-2 20 Click to see details
GSE26953 Aortic valvular endothelial cells 0.048 4.1e-1 0.110 3.0e-1 24 Click to see details
GSE27834 Pluripotent stem cells 0.057 4.2e-1 0.047 4.3e-1 16 Click to see details
GSE38226 Liver fibrosis 0.044 4.2e-1 0.066 3.9e-1 21 Click to see details
GSE32688 Pancreatic cancer 0.028 4.4e-1 -0.012 4.7e-1 32 Click to see details
GSE21849 B cell lymphoma 0.008 4.8e-1 -0.089 3.2e-1 29 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA -0.479 0 -0.490 0 84 Click to see details
PAAD 0.984 0.01 1.000 0.5 4 Click to see details
LUAD -0.627 0.01 -0.713 0 12 Click to see details
LIHC -0.279 0.03 -0.293 0.02 49 Click to see details
CESC 0.918 0.13 1.000 0.5 3 Click to see details
KIRC -0.129 0.15 -0.129 0.15 68 Click to see details
PCPG 0.799 0.21 1.000 0.5 3 Click to see details
HNSC -0.128 0.21 -0.078 0.31 42 Click to see details
ESCA 0.258 0.22 0.091 0.4 11 Click to see details
BLCA -0.19 0.23 0.146 0.28 18 Click to see details
COAD -0.283 0.25 -0.429 0.14 8 Click to see details
CHOL 0.239 0.27 -0.100 0.4 9 Click to see details
STAD -0.106 0.28 -0.072 0.35 32 Click to see details
PRAD -0.081 0.29 0.011 0.47 50 Click to see details
THCA 0.072 0.29 -0.037 0.39 59 Click to see details
KIRP 0.091 0.31 0.060 0.37 32 Click to see details
UCEC 0.085 0.36 0.056 0.41 19 Click to see details
KICH 0.039 0.43 -0.132 0.26 25 Click to see details
LUSC -0.007 0.48 -0.100 0.28 38 Click to see details
LUSC -0.007 0.48 -0.100 0.28 38 Click to see details
LUSC -0.007 0.48 -0.100 0.28 38 Click to see details
329 hsa-miR-9-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000025 MMP13 matrix metallopeptidase 13 2 1
MIRT000026 REST RE1 silencing transcription factor 3 2
MIRT000029 CDH1 cadherin 1 4 3
MIRT000639 POU2F2 POU class 2 homeobox 2 2 1
MIRT000640 BCL6 B-cell CLL/lymphoma 6 2 1
MIRT000641 ETS1 ETS proto-oncogene 1, transcription factor 3 2
MIRT001202 RAB34 RAB34, member RAS oncogene family 5 2
MIRT001736 BACE1 beta-secretase 1 2 1
MIRT001937 PRDM1 PR/SET domain 1 4 3
MIRT003193 NFKB1 nuclear factor kappa B subunit 1 4 7
MIRT003300 FOXO1 forkhead box O1 4 2
MIRT003323 NTRK3 neurotrophic receptor tyrosine kinase 3 3 5
MIRT004982 NR2E1 nuclear receptor subfamily 2 group E member 1 4 1
MIRT005390 ONECUT2 one cut homeobox 2 5 2
MIRT005783 CDX2 caudal type homeobox 2 2 1
MIRT006781 AP3B1 adaptor related protein complex 3 beta 1 subunit 4 1
MIRT006782 CCNG1 cyclin G1 4 2
MIRT006833 SRF serum response factor 2 1
MIRT006892 SIRT1 sirtuin 1 3 2
MIRT006894 TGFBI transforming growth factor beta induced 1 1
MIRT007035 SOCS5 suppressor of cytokine signaling 5 3 2
MIRT007060 ID2 inhibitor of DNA binding 2, HLH protein 2 1
MIRT007326 FOXO3 forkhead box O3 3 1
MIRT007372 CCND1 cyclin D1 1 1
MIRT021318 KLRC1 killer cell lectin like receptor C1 1 1
MIRT021319 DSP desmoplakin 1 1
MIRT021320 POGZ pogo transposable element derived with ZNF domain 1 1
MIRT021321 CCL19 C-C motif chemokine ligand 19 1 1
MIRT021322 EFNA1 ephrin A1 1 1
MIRT021323 SMARCA1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1 1 1
MIRT021324 NRIP3 nuclear receptor interacting protein 3 1 1
MIRT021325 MYF6 myogenic factor 6 1 1
MIRT021326 LRP1 LDL receptor related protein 1 1 1
MIRT021327 SLC35E2 solute carrier family 35 member E2 1 1
MIRT021328 HOXC12 homeobox C12 1 1
MIRT021329 SYNE1 spectrin repeat containing nuclear envelope protein 1 1 1
MIRT021330 STK3 serine/threonine kinase 3 1 1
MIRT021331 SLC7A2 solute carrier family 7 member 2 1 1
MIRT021332 PLEKHB1 pleckstrin homology domain containing B1 1 1
MIRT021333 RASSF8 Ras association domain family member 8 1 1
MIRT021334 PELP1 proline, glutamate and leucine rich protein 1 1 1
MIRT021335 ATG10 autophagy related 10 1 1
MIRT021336 SPTBN1 spectrin beta, non-erythrocytic 1 1 1
MIRT021337 C7orf31 chromosome 7 open reading frame 31 1 1
MIRT021338 CMTM2 CKLF like MARVEL transmembrane domain containing 2 1 1
MIRT021339 CERS4 ceramide synthase 4 1 1
MIRT021340 PPAP2A phospholipid phosphatase 1 1 1
MIRT021341 KCNJ15 potassium voltage-gated channel subfamily J member 15 1 1
MIRT021342 SUMF2 sulfatase modifying factor 2 1 1
MIRT021343 UGDH UDP-glucose 6-dehydrogenase 1 1
MIRT021344 CXXC5 CXXC finger protein 5 1 1
MIRT021345 TCL1B T-cell leukemia/lymphoma 1B 1 1
MIRT021346 EP300 E1A binding protein p300 1 1
MIRT021347 AUH AU RNA binding methylglutaconyl-CoA hydratase 1 1
MIRT021348 TRRAP transformation/transcription domain associated protein 1 1
MIRT021349 DMXL1 Dmx like 1 1 1
MIRT021350 EOGT EGF domain specific O-linked N-acetylglucosamine transferase 1 1
MIRT021351 RCC2 regulator of chromosome condensation 2 1 1
MIRT021352 PIGB phosphatidylinositol glycan anchor biosynthesis class B 1 1
MIRT021353 NAV1 neuron navigator 1 1 1
MIRT021354 ATP6V1C2 ATPase H+ transporting V1 subunit C2 1 1
MIRT021355 PLCB4 phospholipase C beta 4 1 1
MIRT021356 IGF2R insulin like growth factor 2 receptor 1 1
MIRT021357 MDM4 MDM4, p53 regulator 1 1
MIRT021358 AVIL advillin 1 1
MIRT021359 APBB2 amyloid beta precursor protein binding family B member 2 1 1
MIRT021360 CA13 carbonic anhydrase 13 1 1
MIRT021361 FLNB filamin B 1 1
MIRT021362 IREB2 iron responsive element binding protein 2 1 1
MIRT021363 KLRK1 killer cell lectin like receptor K1 1 1
MIRT021364 CDH3 cadherin 3 1 1
MIRT021365 MCC mutated in colorectal cancers 1 1
MIRT021366 SYNE2 spectrin repeat containing nuclear envelope protein 2 1 1
MIRT021367 MAP1B microtubule associated protein 1B 1 1
MIRT021368 NFATC3 nuclear factor of activated T-cells 3 1 1
MIRT021369 SPAG9 sperm associated antigen 9 1 1
MIRT021370 ZNF407 zinc finger protein 407 1 1
MIRT021371 SEC23IP SEC23 interacting protein 1 1
MIRT021372 NBEA neurobeachin 1 1
MIRT021373 SLC2A5 solute carrier family 2 member 5 1 1
MIRT021374 PQLC3 PQ loop repeat containing 3 1 1
MIRT021375 C9orf89 caspase recruitment domain family member 19 1 1
MIRT021376 NCOR2 nuclear receptor corepressor 2 1 1
MIRT021377 P4HA2 prolyl 4-hydroxylase subunit alpha 2 1 1
MIRT021378 MYLK myosin light chain kinase 1 1
MIRT021379 NIN ninein 1 1
MIRT021380 FERMT1 fermitin family member 1 1 1
MIRT021381 PRKD3 protein kinase D3 1 1
MIRT021382 SYAP1 synapse associated protein 1 3 3
MIRT021383 TRPM7 transient receptor potential cation channel subfamily M member 7 1 1
MIRT021384 GPBP1L1 GC-rich promoter binding protein 1 like 1 1 1
MIRT021385 UHMK1 U2AF homology motif kinase 1 1 1
MIRT021386 SLC39A14 solute carrier family 39 member 14 1 1
MIRT021387 SNX7 sorting nexin 7 1 1
MIRT021388 LMNA lamin A/C 1 1
MIRT021389 FBN2 fibrillin 2 1 1
MIRT021390 PXDN peroxidasin 1 1
MIRT021391 TBPL1 TATA-box binding protein like 1 1 1
MIRT021392 NIPA1 non imprinted in Prader-Willi/Angelman syndrome 1 1 1
MIRT021393 FAIM Fas apoptotic inhibitory molecule 1 1
MIRT021394 KMT2D lysine methyltransferase 2D 1 1
MIRT021395 VIM vimentin 1 1
MIRT021396 CHSY1 chondroitin sulfate synthase 1 1 1
MIRT021397 XRN2 5'-3' exoribonuclease 2 1 1
MIRT021398 HIST1H4H histone cluster 1 H4 family member h 2 6
MIRT021399 TWISTNB TWIST neighbor 2 2
MIRT021400 ZBED3 zinc finger BED-type containing 3 3 3
MIRT021401 VEGFA vascular endothelial growth factor A 2 1
MIRT021402 CHMP2B charged multivesicular body protein 2B 2 1
MIRT021403 STMN1 stathmin 1 3 2
MIRT021404 GRN granulin precursor 1 1
MIRT021405 TTC7B tetratricopeptide repeat domain 7B 1 1
MIRT021406 TAGLN transgelin 1 1
MIRT021407 EFCAB14 EF-hand calcium binding domain 14 1 1
MIRT021408 FSTL3 follistatin like 3 1 1
MIRT021409 BIK BCL2 interacting killer 1 1
MIRT021410 SPI1 Spi-1 proto-oncogene 1 1
MIRT021411 HLA-A major histocompatibility complex, class I, A 1 1
MIRT021412 CALML5 calmodulin like 5 1 1
MIRT021413 HTR3A 5-hydroxytryptamine receptor 3A 1 1
MIRT021414 F2 coagulation factor II, thrombin 1 1
MIRT021415 LPXN leupaxin 1 1
MIRT021416 LINC00483 long intergenic non-protein coding RNA 483 1 1
MIRT021417 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT021418 MTX3 metaxin 3 1 1
MIRT021419 AKR1CL1 aldo-keto reductase family 1 member C8, pseudogene 1 1
MIRT021420 IDS iduronate 2-sulfatase 1 1
MIRT021421 ELF3 E74 like ETS transcription factor 3 1 1
MIRT021422 GNAT2 G protein subunit alpha transducin 2 1 1
MIRT021423 SLC30A4 solute carrier family 30 member 4 1 1
MIRT021424 IPO7 importin 7 1 1
MIRT021425 WNT8A Wnt family member 8A 1 1
MIRT021426 GIP gastric inhibitory polypeptide 1 1
MIRT021427 SLC22A5 solute carrier family 22 member 5 1 1
MIRT021428 SPON2 spondin 2 1 1
MIRT021429 MAGEA2B MAGE family member A2B 1 1
MIRT021430 ATL1 atlastin GTPase 1 1 1
MIRT021431 RHOV ras homolog family member V 1 1
MIRT021432 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT021433 LRRTM1 leucine rich repeat transmembrane neuronal 1 1 1
MIRT021434 WNT6 Wnt family member 6 1 1
MIRT021435 NKX2-2 NK2 homeobox 2 1 1
MIRT021436 SLC25A30 solute carrier family 25 member 30 1 1
MIRT021437 CUEDC1 CUE domain containing 1 1 1
MIRT021438 ALDH1A3 aldehyde dehydrogenase 1 family member A3 1 1
MIRT021439 MN1 MN1 proto-oncogene, transcriptional regulator 1 1
MIRT021440 ABCC1 ATP binding cassette subfamily C member 1 1 1
MIRT021441 SLC22A3 solute carrier family 22 member 3 1 1
MIRT021442 AKR1B10 aldo-keto reductase family 1 member B10 1 1
MIRT021443 KIF1B kinesin family member 1B 1 1
MIRT021444 E2F7 E2F transcription factor 7 1 1
MIRT021445 HN1L Jupiter microtubule associated homolog 2 1 1
MIRT021446 SNHG16 small nucleolar RNA host gene 16 1 1
MIRT021447 CYP39A1 cytochrome P450 family 39 subfamily A member 1 1 1
MIRT021448 MORF4L1 mortality factor 4 like 1 1 1
MIRT021449 ARHGEF10 Rho guanine nucleotide exchange factor 10 1 1
MIRT021450 RABGAP1 RAB GTPase activating protein 1 1 1
MIRT021451 TBC1D9 TBC1 domain family member 9 1 1
MIRT021452 ATP11C ATPase phospholipid transporting 11C 1 1
MIRT021453 FRMD4B FERM domain containing 4B 1 1
MIRT021454 SNAI2 snail family transcriptional repressor 2 1 1
MIRT021455 OPTN optineurin 1 1
MIRT021456 FNBP1 formin binding protein 1 1 1
MIRT021457 PTPRK protein tyrosine phosphatase, receptor type K 1 1
MIRT021459 SDC1 syndecan 1 1 1
MIRT021460 EEF2K eukaryotic elongation factor 2 kinase 1 1
MIRT021461 ATP7A ATPase copper transporting alpha 1 1
MIRT021462 CERS2 ceramide synthase 2 1 1
MIRT021463 ACADSB acyl-CoA dehydrogenase, short/branched chain 1 1
MIRT021464 COL12A1 collagen type XII alpha 1 chain 1 1
MIRT021465 PDZK1 PDZ domain containing 1 1 1
MIRT021466 CAPZA1 capping actin protein of muscle Z-line alpha subunit 1 1 1
MIRT021467 PPP4R2 protein phosphatase 4 regulatory subunit 2 1 1
MIRT021468 SERAC1 serine active site containing 1 1 1
MIRT021469 TESK2 testis-specific kinase 2 1 1
MIRT021470 LDLRAP1 low density lipoprotein receptor adaptor protein 1 1 1
MIRT021471 MYH9 myosin heavy chain 9 3 3
MIRT021472 KLF5 Kruppel like factor 5 1 1
MIRT021473 FAM46A family with sequence similarity 46 member A 1 1
MIRT021474 CCNDBP1 cyclin D1 binding protein 1 1 1
MIRT021475 RBFOX2 RNA binding protein, fox-1 homolog 2 1 1
MIRT021476 MAP3K3 mitogen-activated protein kinase kinase kinase 3 1 1
MIRT021477 POU2F1 POU class 2 homeobox 1 1 1
MIRT021478 SYNGR2 synaptogyrin 2 2 2
MIRT021479 SYPL1 synaptophysin like 1 1 1
MIRT021480 GFOD1 glucose-fructose oxidoreductase domain containing 1 1 1
MIRT021481 RNF44 ring finger protein 44 1 1
MIRT021482 TC2N tandem C2 domains, nuclear 1 1
MIRT021483 COLEC12 collectin subfamily member 12 1 1
MIRT021484 ID4 inhibitor of DNA binding 4, HLH protein 1 1
MIRT021485 CNOT6 CCR4-NOT transcription complex subunit 6 1 1
MIRT021486 CD34 CD34 molecule 1 1
MIRT021487 MESDC1 talin rod domain containing 1 1 1
MIRT045780 BOD1L1 biorientation of chromosomes in cell division 1 like 1 1 1
MIRT045781 ITGB3BP integrin subunit beta 3 binding protein 1 1
MIRT045782 QARS glutaminyl-tRNA synthetase 1 1
MIRT045783 KIF1A kinesin family member 1A 1 1
MIRT053098 PPARA peroxisome proliferator activated receptor alpha 1 1
MIRT053115 PRTG protogenin 1 1
MIRT053212 KLF17 Kruppel like factor 17 2 1
MIRT053357 CPEB4 cytoplasmic polyadenylation element binding protein 4 2 1
MIRT053358 CYFIP2 cytoplasmic FMR1 interacting protein 2 2 1
MIRT053359 ENDOD1 endonuclease domain containing 1 2 1
MIRT053360 HBP1 HMG-box transcription factor 1 2 1
MIRT053361 JAK1 Janus kinase 1 2 1
MIRT053362 KLF6 Kruppel like factor 6 2 1
MIRT053363 LHFPL2 LHFPL tetraspan subfamily member 2 2 1
MIRT053364 MAP3K8 mitogen-activated protein kinase kinase kinase 8 2 1
MIRT053365 RAB8B RAB8B, member RAS oncogene family 2 1
MIRT053366 RHAG Rh-associated glycoprotein 2 1
MIRT053367 RHOH ras homolog family member H 2 1
MIRT053368 RYBP RING1 and YY1 binding protein 2 1
MIRT053369 SERPINB9 serpin family B member 9 2 1
MIRT053370 TAL1 TAL bHLH transcription factor 1, erythroid differentiation factor 2 1
MIRT053371 TFRC transferrin receptor 2 1
MIRT053372 TRAK2 trafficking kinesin protein 2 2 1
MIRT053373 VAMP5 vesicle associated membrane protein 5 2 1
MIRT053481 MMP2 matrix metallopeptidase 2 1 1
MIRT053482 MMP9 matrix metallopeptidase 9 1 1
MIRT053793 CREB1 cAMP responsive element binding protein 1 3 1
MIRT053794 NF1 neurofibromin 1 3 1
MIRT054041 ELAVL1 ELAV like RNA binding protein 1 3 1
MIRT054042 DICER1 dicer 1, ribonuclease III 5 3
MIRT054196 MALAT1 metastasis associated lung adenocarcinoma transcript 1 (non-protein coding) 4 1
MIRT054369 Cthrc1 collagen triple helix repeat containing 1 3 1
MIRT054715 CXCR4 C-X-C motif chemokine receptor 4 3 3
MIRT054798 FOXP1 forkhead box P1 3 1
MIRT100125 HIST1H2AI histone cluster 1 H2A family member i 2 6
MIRT251627 KCNJ2 potassium voltage-gated channel subfamily J member 2 2 2
MIRT303632 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 4 3
MIRT437375 PRTG protogenin 3 1
MIRT437469 ACAT1 acetyl-CoA acetyltransferase 1 3 1
MIRT437956 HDAC4 histone deacetylase 4 1 1
MIRT437986 DRD2 dopamine receptor D2 1 1
MIRT438117 MIRLET7D microRNA let-7d 1 1
MIRT438536 TGFBR2 transforming growth factor beta receptor 2 3 2
MIRT438746 MTHFD1 methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1 3 1
MIRT438753 BCL2L11 BCL2 like 11 3 1
MIRT442709 UBE4B ubiquitination factor E4B 2 2
MIRT442743 SERINC5 serine incorporator 5 2 2
MIRT444344 GALNTL6 polypeptide N-acetylgalactosaminyltransferase like 6 2 2
MIRT445645 NPY4R neuropeptide Y receptor Y4 2 2
MIRT447217 ATXN7 ataxin 7 2 2
MIRT468282 SFT2D2 SFT2 domain containing 2 2 2
MIRT468533 SERPINH1 serpin family H member 1 2 2
MIRT482004 AMOTL1 angiomotin like 1 2 12
MIRT485305 NFAT5 nuclear factor of activated T-cells 5 2 6
MIRT492094 TAOK1 TAO kinase 1 2 6
MIRT493465 IPPK inositol-pentakisphosphate 2-kinase 2 4
MIRT493883 FAM73B mitoguardin 2 2 4
MIRT497210 CDH7 cadherin 7 2 2
MIRT507388 EN2 engrailed homeobox 2 2 4
MIRT511642 HIST1H3F histone cluster 1 H3 family member f 2 4
MIRT511782 HIST1H2AE histone cluster 1 H2A family member e 2 4
MIRT513555 IL5 interleukin 5 2 2
MIRT517439 HIST2H2AC histone cluster 2 H2A family member c 2 2
MIRT526994 ARL8B ADP ribosylation factor like GTPase 8B 2 2
MIRT530210 NSUN7 NOP2/Sun RNA methyltransferase family member 7 2 2
MIRT534703 RNF103-CHMP3 RNF103-CHMP3 readthrough 2 4
MIRT538532 CHMP3 charged multivesicular body protein 3 2 4
MIRT547741 KIAA1468 KIAA1468 2 2
MIRT548083 GIGYF1 GRB10 interacting GYF protein 1 2 2
MIRT553524 TMEM245 transmembrane protein 245 2 4
MIRT555487 PNRC2 proline rich nuclear receptor coactivator 2 2 2
MIRT558992 CA8 carbonic anhydrase 8 2 2
MIRT609369 SOD2 superoxide dismutase 2 2 2
MIRT609845 ZNF557 zinc finger protein 557 2 2
MIRT610639 PIGM phosphatidylinositol glycan anchor biosynthesis class M 2 2
MIRT620230 PACS1 phosphofurin acidic cluster sorting protein 1 2 2
MIRT622432 NUDT19 nudix hydrolase 19 2 2
MIRT624367 CDK12 cyclin dependent kinase 12 2 2
MIRT624796 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 2 2
MIRT626462 CMKLR1 chemerin chemokine-like receptor 1 2 2
MIRT626610 ACAA2 acetyl-CoA acyltransferase 2 2 4
MIRT629750 SCD5 stearoyl-CoA desaturase 5 2 2
MIRT630036 MTL5 testis expressed metallothionein like protein 2 2
MIRT634055 NUP155 nucleoporin 155 2 2
MIRT637896 SLC19A3 solute carrier family 19 member 3 2 2
MIRT640384 EMC1 ER membrane protein complex subunit 1 2 4
MIRT641973 PCMTD2 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 2 2
MIRT643403 PAX1 paired box 1 2 2
MIRT645378 MKX mohawk homeobox 2 2
MIRT646920 TRIM14 tripartite motif containing 14 2 2
MIRT649452 WDR70 WD repeat domain 70 2 2
MIRT650621 UMPS uridine monophosphate synthetase 2 2
MIRT651245 ZMAT4 zinc finger matrin-type 4 2 2
MIRT653306 SMU1 DNA replication regulator and spliceosomal factor 2 2
MIRT653594 SLC35B3 solute carrier family 35 member B3 2 2
MIRT655095 PI4K2A phosphatidylinositol 4-kinase type 2 alpha 2 2
MIRT656624 LRRC15 leucine rich repeat containing 15 2 2
MIRT656891 KIF1C kinesin family member 1C 2 2
MIRT658522 ESR1 estrogen receptor 1 5 2
MIRT660676 ANKFY1 ankyrin repeat and FYVE domain containing 1 2 2
MIRT663674 TMEM216 transmembrane protein 216 2 2
MIRT679093 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT682590 CPA4 carboxypeptidase A4 2 2
MIRT690125 ZFAND1 zinc finger AN1-type containing 1 2 2
MIRT704058 EDEM3 ER degradation enhancing alpha-mannosidase like protein 3 2 2
MIRT705652 ANP32B acidic nuclear phosphoprotein 32 family member B 2 2
MIRT707304 PRRX1 paired related homeobox 1 2 2
MIRT711360 VPS8 VPS8, CORVET complex subunit 2 2
MIRT712224 RNF146 ring finger protein 146 2 2
MIRT719696 STX6 syntaxin 6 2 2
MIRT722385 TRMT13 tRNA methyltransferase 13 homolog 2 2
MIRT723019 MSR1 macrophage scavenger receptor 1 2 2
MIRT723398 OAF out at first homolog 2 2
MIRT731146 ATG5 autophagy related 5 1 1
MIRT731304 CUL4A cullin 4A 3 1
MIRT731346 IL6 interleukin 6 2 1
MIRT731560 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT731562 PDGFRB platelet derived growth factor receptor beta 1 1
MIRT731820 NRP1 neuropilin 1 3 1
MIRT731992 IGF2BP1 insulin like growth factor 2 mRNA binding protein 1 3 1
MIRT732216 BCL2 BCL2, apoptosis regulator 2 1
MIRT732359 SOX7 SRY-box 7 3 1
MIRT732970 ADIPOQ adiponectin, C1Q and collagen domain containing 3 0
MIRT732971 TUG1 taurine up-regulated 1 (non-protein coding) 3 0
MIRT735865 KRAS KRAS proto-oncogene, GTPase 1 0
MIRT736698 PTEN phosphatase and tensin homolog 3 0
MIRT736828 THBS2 thrombospondin 2 2 0
MIRT737142 EIF5A2 eukaryotic translation initiation factor 5A2 3 0
MIRT755614 SHMT1 serine hydroxymethyltransferase 1 2 1
MIRT755615 KCNMA1 potassium calcium-activated channel subfamily M alpha 1 1 1
MIRT755618 MTHFD1L methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1 like 2 1
MIRT755732 Pdgfrb platelet derived growth factor receptor beta 2 1
MIRT755979 TLR4 toll-like receptor 4 3 1
MIRT756027 CPEB3 cytoplasmic polyadenylation element binding protein 3 5 1
MIRT756101 DACT3 dishevelled binding antagonist of beta catenin 3 3 1
MIRT756215 TOP2B DNA topoisomerase II beta 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-9 Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-9 Ethanol NULL 702 Microarray fetal mouse brains 19091803 2009 up-regulated
miR-9 Atorvastatin approved 60823 Quantitative real-time PCR Cardiomyocyte 23860036 2013 down-regualted
miR-9 Ethanol NULL 702 Quantitative real-time PCR Cerebellar Granule Neurons cells 24554719 2014 down-regulated
miR-9 Glucose NULL 5793 Microarray endothelial cells 24394957 2014 up-regulated
miR-9 Iron-sulfates and Aluminum-sulfates NULL NULL Northern blot human neural cells 17629564 2007 up-regulated
miR-9 17beta-estradiol (E2) approved 5757 Microarray MCF-7 breast cancer cells 19528081 2009 down-regulated
miR-9 N-(4-hydroxyphenyl)-retinamide (4HPR) NULL 5288209 Quantitative real-time PCR human retinal pigment epithelial (ARPE-19) cells 20806079 2010 up-regulated
miR-9 Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-9 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-9 Sulindac sulfide approved 5352624 Quantitative real-time PCR HCT116 colon tumor cells 22286762 2012 down-regulated
miR-9 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-9 Bicalutamide approved 2375 Microarray prostate 22674191 2012 down-regulated
miR-9 Goserelin approved 47725 Microarray prostate 22674191 2012 down-regulated
miR-9 Temozolomide approved 5394 Quantitative real-time PCR glioblastoma cells. 22722712 2012 down-regulated
miR-9 All-trans-retinoic acid (ATRA) approved 444795 Northern blot spina bifida rat fetus 17962954 2007 down-regulated
miR-9 Longevinex NULL NULL Quantitative real-time PCR ischemia/reperfusion [I/R] rat model 21203465 2011 down-regulated
miR-9 Longevinex NULL NULL Quantitative real-time PCR normal heart 21203465 2011 up-regulated
miR-9 Resveratrol NULL 445154 Quantitative real-time PCR ischemia/reperfusion [I/R] rat model 21203465 2011 down-regulated
miR-9 Resveratrol NULL 445154 Quantitative real-time PCR normal heart 21203465 2011 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-9-5p (11E)-11-(2-aminoethylidene)-15,16-dimethoxy-20-methyl-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaen-19-one 11452147 NSC725665 sensitive
hsa-miR-9-5p (1r,2s,6e,10s,11r,13s,17r)-11-hydroxy-2,6,10-trimethyl-14-methylidene-16,18-dioxatricyclo[8.6.2.013,17]octadec-6-en-15-one 5469628 NSC690970 resistant
hsa-miR-9-5p (1S,2R,6S)-1,4,10,12-tetraphenyl-4,8,10,11-tetrazatricyclo[6.4.0.02,6]dodec-11-ene-3,5-dione 394280 NSC697646 resistant
hsa-miR-9-5p (1S,2S,4R,7Z,11S)-4,8-dimethyl-12-methylidene-3,14-dioxatricyclo[9.3.0.02,4]tetradec-7-ene-9,13-dione 5459262 NSC672120 resistant
hsa-miR-9-5p (2s,3s,7as)-3-hydroxy-2-[(e)-prop-1-enyl]-2,3,7,7a-tetrahydrofuro[3,4-b]pyran-5-one 24202877 NSC726146 resistant
hsa-miR-9-5p (3-hydroxy-4-methoxyphenyl)-(7-methoxy-1,3-benzodioxol-5-yl)methanone 46949031 NSC758027 sensitive
hsa-miR-9-5p (3E)-3,4-dichloro-2,4-dinitro-1-N,1-N'-diphenylbuta-1,3-diene-1,1-diamine 5470211 NSC698398 resistant
hsa-miR-9-5p (3e)-4-chloro-3-[(6-chloro-2-methylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1h-indol-2-one 5471424 NSC711079 sensitive
hsa-miR-9-5p (3r,3as)-3-phenyl-3a,4-dihydrochromeno[4,3-c]pyrazole-2(3h)-carboxamide 374676 NSC652810 sensitive
hsa-miR-9-5p (3R,5R)-3,5-bis(4-methylphenyl)spiro[cyclohexane-4,2'-indene]-1,1',3'-trione 385845 NSC677244 sensitive
hsa-miR-9-5p (3z)-1-(2,6-dichlorophenyl)-3-[(4-hydroxy-3,5-dimethoxyphenyl)methylidene]indol-2-one 60147866 NSC752703 sensitive
hsa-miR-9-5p (3z)-3-[(2,6-dimethylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-5-hydroxy-1-methylindol-2-one 24205836 NSC736818 sensitive
hsa-miR-9-5p (5E)-2-benzyl-2-[(dimethylamino)methyl]-5-[(2-methoxyphenyl)methylidene]cyclopentan-1-one;hydrochloride 6516829 NSC639521 sensitive
hsa-miR-9-5p (7-acetamido-2-acetyloxy-1-methoxy-10-methylsulfanyl-9-oxo-6,7-dihydro-5H-benzo[a]heptalen-3-yl) acetate 435732 NSC374980 sensitive
hsa-miR-9-5p (e)-1-(2,4-dimethoxyphenyl)-3-(2,4,6-trimethoxyphenyl)prop-2-en-1-one 16753966 NSC751956 sensitive
hsa-miR-9-5p (E)-1-[4-(quinazolin-4-ylamino)phenyl]-3-(2,4,6-trimethoxyphenyl)prop-2-en-1-one 155816064 NSC760015 sensitive
hsa-miR-9-5p (Z)-(2,4-dinitrophenoxy)imino-oxido-(4-phenylmethoxycarbonylpiperazin-1-yl)azanium 11626484 NSC731700 resistant
hsa-miR-9-5p (Z)-(4-butoxycarbonylpiperazin-1-yl)-(2,4-dinitrophenoxy)imino-oxidoazanium 11495269 NSC731701 resistant
hsa-miR-9-5p .alpha.-chloro-n-(p-methoxyphenyl)succinimide 99724 NSC191909 resistant
hsa-miR-9-5p [(3s,8r,10r,13s,17e)-10,13-dimethyl-17-(phenylcarbamoyloxyimino)-1,2,3,4,7,8,9,11,12,14,15,16-dodecahydrocyclopenta[a]phenanthren-3-yl] n-phenylcarbamate 9569960 NSC629229 resistant
hsa-miR-9-5p [(5r,9e,14s,15r,15ar)-5-hydroxy-10,14-dimethyl-3,6-dimethylidene-2-oxo-4,5,7,8,11,12,13,14,15,15a-decahydro-3ah-cyclotetradeca[b]furan-15-yl] acetate 24204960 NSC733752 resistant
hsa-miR-9-5p [(8R,9S,10R,13S,14S,17S)-13-methyl-3-oxo-2,6,7,8,9,10,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-17-yl] N-(2-chloroethyl)-N-nitrosocarbamate 320801 NSC269719 sensitive
hsa-miR-9-5p [(E)-(1-chloro-2-methylpropylidene)amino] N-(4-cyanophenyl)carbamate 5466030 NSC672058 resistant
hsa-miR-9-5p [(E)-1-chloropropylideneamino] N-(4-methoxyphenyl)carbamate 5466263 NSC682833 resistant
hsa-miR-9-5p [(Z)-(1-chloro-2-methylpropylidene)amino] N-(5-fluoro-2-methylphenyl)carbamate 9556257 NSC682835 resistant
hsa-miR-9-5p [1-[[[2-amino-6-chloro-5-[(4-chlorophenyl)diazenyl]pyrimidin-4-yl]amino]methyl]-3-phenylmethoxycyclobutyl]methanol 385284 NSC676395 resistant
hsa-miR-9-5p [1-[[[2-amino-6-chloro-5-[(4-chlorophenyl)diazenyl]pyrimidin-4-yl]amino]methyl]-3-phenylmethoxycyclobutyl]methanol 385284 NSC676395 resistant
hsa-miR-9-5p [3-[(2e,4e,6e,8e)-3,7-dimethyl-9-(2,6,6-trimethylcyclohexen-1-yl)nona-2,4,6,8-tetraenoyl]oxy-5-(5-fluoro-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methyl (2e,4e,6e,8e)-3,7-dimethyl-9-(2,6,6-trimethylcyclohe 5468409 NSC669728 sensitive
hsa-miR-9-5p [4-amino-2-[(4-chlorophenyl)amino]thiazol-5-yl]-(4-methoxyphenyl)methanone 399621 NSC710530 sensitive
hsa-miR-9-5p 1-(2,5,8,11,14,17-hexaoxabicyclo[16.4.0]docosa-1(18),19,21-trien-20-yl)prop-2-en-1-one 375484 NSC655266 resistant
hsa-miR-9-5p 1-(3-chlorophenyl)-2-hexyl-2h-1,3,5-triazine-4,6-diamine;hydrochloride 24180956 NSC3083 sensitive
hsa-miR-9-5p 1-(benzylsulfinyl)-2,4-dinitrobenzene 275684 NSC122656 resistant
hsa-miR-9-5p 1-[(3E)-3,4-dichloro-2,4-dinitro-1-piperidin-1-ylbuta-1,3-dienyl]piperidine 3107921 NSC698394 resistant
hsa-miR-9-5p 1-[(e)-1,3-benzodioxol-5-ylmethylideneamino]-3-(2-chlorophenyl)urea 9572409 NSC715192 sensitive
hsa-miR-9-5p 1-[(Z)-2-cyano-1-pyrrolidin-1-ylethenyl]-3-phenylurea 5468918 NSC679095 sensitive
hsa-miR-9-5p 1-[[2-(2-chloroethyl)-4,5-dimethoxyphenyl]methyl]-6-methoxy-3,4-dihydroisoquinoline;hydrochloride 392600 NSC693142 resistant
hsa-miR-9-5p 1-[3-chloro-4-(4-phenylbutyl)phenyl]-6,6-dimethyl-1,3,5-triazine-2,4-diamine;hydrochloride 24191814 NSC128184 sensitive
hsa-miR-9-5p 1-[4-fluoro-3-(trifluoromethyl)phenyl]-6,6-dimethyl-1,3,5-triazine-2,4-diamine 425379 NSC173516 sensitive
hsa-miR-9-5p 1-adamantyl 4-[(3,6-dioxocyclohexa-1,4-dien-1-yl)methylamino]benzoate 387401 NSC681151 resistant
hsa-miR-9-5p 1-benzyl-3-[[5-(4-chlorophenyl)-7-(p-tolyl)pyrrolo[2,3-d]pyrimidin-4-yl]amino]thiourea 3001721 NSC667707 sensitive
hsa-miR-9-5p 10,16-bis[2-(dimethylamino)ethyl]-5-methoxy-1,9,10,16-tetrazapentacyclo[9.6.2.02,7.08,19.014,18]nonadeca-2(7),3,5,8,11(19),12,14(18)-heptaene-15,17-dione 399630 NSC710547 sensitive
hsa-miR-9-5p 11-hydroxyusambarine chlorhydrate 401426 NSC715082 sensitive
hsa-miR-9-5p 11,16-diphenyl-11,16-diazapentacyclo[6.5.5.02,7.09,13.014,18]octadeca-2,4,6-triene-10,12,15,17-tetrone 363087 NSC627652 sensitive
hsa-miR-9-5p 14-[2-(dimethylamino)ethyl]-n-[3-[3-[[14-[2-(dimethylamino)ethyl]-4-methoxy-8,14,15-triazatetracyclo[7.6.1.02,7.013,16]hexadeca-1(15),2(7),3,5,9,11,13(16)-heptaene-10-carbonyl]amino]propyl-methylamino 135426710 NSC710552 sensitive
hsa-miR-9-5p 16-methoxy-4-(4-methoxyphenyl)-9-propan-2-yl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 390916 NSC689137 sensitive
hsa-miR-9-5p 2-((2,7-dimethoxy-9-acridinyl)sulfinyl)-n,n-diethylethanamine 395392 NSC699928 resistant
hsa-miR-9-5p 2-(1-propynyl)-3,17.beta.-estradiol 388008 NSC682429 sensitive
hsa-miR-9-5p 2-(2-chlorophenyl)-3-[5-(1,2,4-triazol-4-ylmethyl)-1,3,4-oxadiazol-2-yl]-1,3-thiazolidin-4-one 45029357 NSC746513 sensitive
hsa-miR-9-5p 2-(2-hydroxyethyl)-8-phenyl-5,12,14-trioxa-2-azatetracyclo[7.7.0.03,7.011,15]hexadeca-1(16),3(7),9,11(15)-tetraen-6-one 50900736 NSC750211 sensitive
hsa-miR-9-5p 2-(naphthalen-2-yl)-1-(3,4,5-trimethoxyphenyl)-1h-imidazole 11559546 NSC736993 sensitive
hsa-miR-9-5p 2-[(e)-[2-chloro-6-(4-nitrophenyl)imidazo[2,1-b][1,3]thiazol-5-yl]methylideneamino]guanidine;hydrochloride 9572530 NSC720135 sensitive
hsa-miR-9-5p 2-[(e)-[6-(2,4-dichloro-5-nitrophenyl)-2,3-dihydroimidazo[2,1-b][1,3]thiazol-5-yl]methylideneamino]guanidine 16099260 NSC722867 sensitive
hsa-miR-9-5p 2-[(Z)-2-[3-[3-methoxy-5-(trifluoromethyl)phenyl]-1,2,4-triazol-1-yl]ethenyl]-1,3,4-oxadiazole 57524026 NSC757569 sensitive
hsa-miR-9-5p 2-[16-(3,4-dimethoxyphenyl)-12,14-diphenyl-10-oxa-3,5,6,8,12,13-hexazatetracyclo[7.7.0.02,6.011,15]hexadeca-1(9),2,4,7,11(15),13-hexaen-4-yl]acetonitrile 391834 NSC691421 resistant
hsa-miR-9-5p 2-[2-chloro-4-(4,6-diamino-2,2-dimethyl-1,3,5-triazin-1-yl)phenoxy]-1-morpholin-4-ylethanone;ethanesulfonic acid 284536 NSC140380 sensitive
hsa-miR-9-5p 2-amino-1-N,9-N-bis[10-[(4-hydroxyphenyl)methyl]-7,11,14-trimethyl-2,5,9,12,15-pentaoxo-3-propan-2-yl-8-oxa-1,4,11,14-tetrazabicyclo[14.3.0]nonadecan-6-yl]-4,6-dimethyl-3-oxophenoxazine-1,9-dicarboxamide 16129921 NSC684901 sensitive
hsa-miR-9-5p 2-ethylaminoestradiol 384235 NSC673652 sensitive
hsa-miR-9-5p 2-methoxy-4-(3,4,5-trimethoxybenzyl)phenol 368064 NSC638388 sensitive
hsa-miR-9-5p 2-methylthieno[3,2-f][1]benzothiole-4,8-dione 375901 NSC656238 sensitive
hsa-miR-9-5p 2-methylthio-1,4-naphthoquinone 96324 NSC67209 resistant
hsa-miR-9-5p 2,3-bis(4,5-dimethyl-3,6-dioxo-cyclohexa-1,4-dien-1-yl)-5,6-dimethyl-1,4-benzoquinone 394545 NSC698090 resistant
hsa-miR-9-5p 2,3-dichloro-5,6,7,8-tetrahydronaphthalene-1,4-diol 320303 NSC267319 resistant
hsa-miR-9-5p 2,4-dimethylpentan-3-yl 4-[(3,6-dioxocyclohexa-1,4-dien-1-yl)methylamino]benzoate 387690 NSC681719 resistant
hsa-miR-9-5p 2,4-dinitro-1-benzofuran 332391 NSC329127 resistant
hsa-miR-9-5p 2,5-bis[(dimethylamino)methyl]cyclopentan-1-one;hydrochloride 368963 NSC131233 resistant
hsa-miR-9-5p 2,6-dimethoxy-4-(7-methyl-6-(1-piperidinyl)-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-8-yl)phenol 383126 NSC671167 sensitive
hsa-miR-9-5p 2,7-dimethoxy-9-[[2-(diethylamino)ethyl]thio]acridine 395391 NSC699927 resistant
hsa-miR-9-5p 3-(1H-indol-3-yl)-N-[[3-[[[3-(1H-indol-3-yl)-2-bicyclo[2.2.1]heptanyl]amino]methyl]phenyl]methyl]bicyclo[2.2.1]heptan-2-amine 397159 NSC704562 sensitive
hsa-miR-9-5p 3-(4-methoxyphenyl)-4-methyl-8-pyrrolidin-1-yl-8H-thieno[2,3-b]pyrrolizin-4-ium;iodide 388538 NSC683518 sensitive
hsa-miR-9-5p 3-(4,6-diamino-2,2-dimethyl-1,3,5-triazin-1-yl)benzonitrile 271921 NSC115928 sensitive
hsa-miR-9-5p 3-[(2,3-dimethoxyphenyl)methyl]-7,8-dimethoxy-5-methylsulfanyl-2,5-dihydro-1H-3-benzazepin-4-one 359177 NSC619859 sensitive
hsa-miR-9-5p 3-[(e)-carbazol-9-yliminomethyl]-4-hydroxy-5-methoxybenzaldehyde 135436314 NSC718153 sensitive
hsa-miR-9-5p 3-[3-[2-chloro-4-(4,6-diamino-2,2-dimethyl-1,3,5-triazin-1-yl)phenoxy]propylcarbamoylamino]benzenesulfonyl fluoride;ethanesulfonic acid 275314 NSC122060 sensitive
hsa-miR-9-5p 3-[3-[4-(4,6-diamino-2,2-dimethyl-1,3,5-triazin-1-yl)phenyl]propanoylamino]benzenesulfonyl fluoride;ethanesulfonic acid 270820 NSC113908 sensitive
hsa-miR-9-5p 3-[4-[3-(4,6-diamino-2,2-dimethyl-1,3,5-triazin-1-yl)phenyl]butyl]benzenesulfonyl fluoride;ethanesulfonic acid 277387 NSC126228 sensitive
hsa-miR-9-5p 3-[5-(4-amino-2,6-dibromophenyl)-1,3,4-oxadiazol-2-yl]-1-(1H-benzimidazol-2-yl)propan-1-one 71451481 NSC761980 sensitive
hsa-miR-9-5p 3-benzyl-2-[(2e)-2-[(4-bromophenyl)methylidene]hydrazinyl]-5,6,7,8-tetrahydro-[1]benzothiolo[2,3-d]pyrimidin-4-one 45028588 NSC743399 sensitive
hsa-miR-9-5p 3-bromo-n-[(5-chloro-2-hydroxyphenyl)carbamothioyl]benzamide 3967840 NSC215721 sensitive
hsa-miR-9-5p 3-chloro-4-[4-[3-(4,6-diamino-2,2-dimethyl-1,3,5-triazin-1-yl)phenyl]butyl]benzenesulfonyl fluoride;ethanesulfonic acid 278058 NSC127157 sensitive
hsa-miR-9-5p 3-phenacyliden-5-brom-2-indolinon 5351299 NSC294961 resistant
hsa-miR-9-5p 3-piperidinone, 3,5-bis[(3,4-dichlorophenyl)methylene]- 5388806 NSC638643 sensitive
hsa-miR-9-5p 4-(6-hydrazino-7-methyl-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-8-yl)-2,6-dimethoxyphenol 383133 NSC671174 sensitive
hsa-miR-9-5p 4-[(3E)-3,4-dichloro-1-morpholin-4-yl-2,4-dinitrobuta-1,3-dienyl]morpholine 1618703 NSC698395 resistant
hsa-miR-9-5p 4-amino-5-(5-chloro-1-benzofuran-2-carbonyl)-2-(4-chloro-2-methylanilino)thiophene-3-carbonitrile 328931 NSC309895 sensitive
hsa-miR-9-5p 4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1H-2-benzofuran-1-yl)-N-[3-(trifluoromethyl)phenyl]butanamide 369471 NSC641241 sensitive
hsa-miR-9-5p 4-piperidinone, 1-methyl-2,6-bis[(2-nitrophenyl)methylene]- 5468197 NSC673650 resistant
hsa-miR-9-5p 5-amino-10,16-bis[2-(dimethylamino)ethyl]-1,9,10,16-tetrazapentacyclo[9.6.2.02,7.08,19.014,18]nonadeca-2(7),3,5,8,11(19),12,14(18)-heptaene-15,17-dione 399633 NSC710550 sensitive
hsa-miR-9-5p 5-fluoranyl-7-nitro-quinolin-8-ol 260644 NSC92207 sensitive
hsa-miR-9-5p 5-fluoro-4-methoxy-1-(5-oxo-2H-furan-2-yl)pyrimidin-2-one 330094 NSC315844 resistant
hsa-miR-9-5p 5-iodo-2-{[(2)-3-phenylprop-2-enoyl]amino}benzamide 45029271 NSC745962 sensitive
hsa-miR-9-5p 5-phenoxysulfonyl-1-methyl-4-nitroimidazole 81400 NSC38087 resistant
hsa-miR-9-5p 5,6-bis[(5-methyl-1,3,4-thiadiazol-2-yl)sulfanyl]pyrazine-2,3-dicarbonitrile 395616 NSC700361 resistant
hsa-miR-9-5p 6-(2-fluorophenyl)-5H-[1,3]dioxolo[4,5-g]quinoline-8-thione 3910131 NSC700269 sensitive
hsa-miR-9-5p 6-(3-aminopropyl)-3-nitro-9-phenylindeno[1,2-c]isoquinoline-5,11-dione;hydrochloride 17755120 NSC737671 sensitive
hsa-miR-9-5p 6-(4-methylphenyl)-2-(4-methylsulfonylphenyl)-4,5-dihydropyridazin-3-one 72375194 NSC762908 sensitive
hsa-miR-9-5p 6-(pyridin-3-yl)[1,3]dioxolo[4,5-g]quinolin-8(5h)-one 375864 NSC656162 sensitive
hsa-miR-9-5p 6-[(3,5-dimethoxy-N-methylanilino)methyl]-5-methylpyrido[2,3-d]pyrimidine-2,4-diamine;hydrochloride 382164 NSC669615 sensitive
hsa-miR-9-5p 6-amino-5,6-dihydrocyclopenta[c]thiophen-4-one hydrochloride 396928 NSC704113 resistant
hsa-miR-9-5p 6,7-bis(hydroxymethyl)-8-(3,4,5-trimethoxyphenyl)-5,6,7,8-tetrahydrobenzo[f][1,3]benzodioxol-5-ol 235235 NSC36373 sensitive
hsa-miR-9-5p 7-chloro-1-methyl-phenothiazone 369386 NSC641150 sensitive
hsa-miR-9-5p 7-chlorobenzo[c]quinolizin-11-ium-6-amine;chloride 386892 NSC679795 sensitive
hsa-miR-9-5p 7-epi-10-deacetylbaccatin iii 6712096 NSC656178 sensitive
hsa-miR-9-5p 8-(3,4-dimethoxyphenyl)-2-(2-hydroxyethyl)-5-oxa-2-azatetracyclo[7.7.0.03,7.011,15]hexadeca-1(9),3(7),10,15-tetraen-6-one 54579427 NSC751500 sensitive
hsa-miR-9-5p 8-(4-hydroxy-3,5-dimethoxyphenyl)-7-methyl-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-6-ol 383128 NSC671169 sensitive
hsa-miR-9-5p 8-(6-fluorohexyl)-3-methyl-1-phenyl-1,3,8-triazaspiro[4.5]decan-4-one;hydrochloride 380336 NSC665863 resistant
hsa-miR-9-5p 8-[(2e)-2-(3-butyl-4-oxo-1,3-thiazolidin-2-ylidene)hydrazinyl]-1,3-dimethyl-7h-purine-2,6-dione 9572578 NSC720616 sensitive
hsa-miR-9-5p 8-[4-(4-fluorophenyl)-4-oxobutyl]-1-phenyl-3-propan-2-yl-1,3,8-triazaspiro[4.5]decan-4-one;hydrochloride 380261 NSC665740 resistant
hsa-miR-9-5p 8-benzyl-1-phenyl-3-oxa-1,8-diazaspiro[4.5]decan-4-one 380263 NSC665741 sensitive
hsa-miR-9-5p 8-hydroxy-5-iodoquinoline 96111 NSC53183 sensitive
hsa-miR-9-5p 9-(2-chloroethylsulfinyl)-2,7-dimethoxy-acridine 395390 NSC699926 resistant
hsa-miR-9-5p 9-benzyl-6-chloro-8-ethenyl-9h-purine 401179 NSC714380 resistant
hsa-miR-9-5p 9-ethoxy-2,5,11-trimethyl-6h-pyrido[4,3-b]carbazol-2-ium acetate 373614 NSC650263 sensitive
hsa-miR-9-5p 9-tert-butyl-4-(4-methoxyphenyl)-16-methyl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 376302 NSC657017 sensitive
hsa-miR-9-5p 9-tert-butyl-4-(4-nitrophenyl)-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14,16,18-tetraene-3,5-dione 381785 NSC668851 resistant
hsa-miR-9-5p Acnistin f 495538 NSC657923 resistant
hsa-miR-9-5p Antibiotic x-14766a 434840 NSC359239 sensitive
hsa-miR-9-5p Antineoplastic-643001 5351386 NSC643001 sensitive
hsa-miR-9-5p Basic fuchsin 12447 NSC10466 sensitive
hsa-miR-9-5p Bc 76 246230 NSC58905 sensitive
hsa-miR-9-5p Benzo[1,2-b:4,5-b']dithiophene-4,8-diol, diacetate 393649 NSC695914 sensitive
hsa-miR-9-5p Benzo[g]quinoxaline-5,10-dione, 5,10-dihydro-2,3-dimethyl- 353644 NSC602617 sensitive
hsa-miR-9-5p Bioxiran 11254 NSC629 sensitive
hsa-miR-9-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-9-5p Cgp 57380 11644425 NSC741567 resistant
hsa-miR-9-5p Chemdivam_000505 403081 NSC717553 sensitive
hsa-miR-9-5p Chloroform;(1S,12R)-20-methyl-16-nitro-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-2,4(8),9,13(18),14,16-hexaene-11,19-dione 45027874 NSC730009 sensitive
hsa-miR-9-5p Chromeno[2,3-f]quinolin-7-one 385093 NSC676028 resistant
hsa-miR-9-5p Di-n-octyl-secalonsaure a 430141 NSC268925 sensitive
hsa-miR-9-5p Di-p-tolyliodinium bromide 54601177 NSC8985 sensitive
hsa-miR-9-5p Diethoxybis(1,4-naphthochinone-2-olato)titanium(iv) 368297 NSC638842 sensitive
hsa-miR-9-5p Diethyl (E)-2-(5-methyl-2,4-dioxo-3-prop-2-ynylpyrimidin-1-yl)but-2-enedioate 5469887 NSC693986 resistant
hsa-miR-9-5p Diethylcyanine 5717105 NSC97374 sensitive
hsa-miR-9-5p Diisopropoxybis(1,4-naphthochinone-2-olato)titanium(iv) 368058 NSC638383 sensitive
hsa-miR-9-5p Dimethyl 3-bromo-3-(bromomethyl)cyclopropane-1,2-dicarboxylate 395481 NSC700122 resistant
hsa-miR-9-5p Dndi1417002 395921 NSC701016 resistant
hsa-miR-9-5p Emd-534085 23634407 NSC763564 sensitive
hsa-miR-9-5p Ethyl (2Z)-2-[(2-chlorophenyl)methylidene]-5-methyl-3-oxo-[1,3]thiazolo[2,3-b][1,3]thiazol-4-ium-6-carboxylate 5478638 NSC658291 sensitive
hsa-miR-9-5p Ethyl 2-ethyl-1-oxo-1,2-dihydropyrimido[1,6-a]benzimidazole-4-carboxylate 395848 NSC700851 resistant
hsa-miR-9-5p Eupachlorin 5458217 NSC114567 resistant
hsa-miR-9-5p Go-y032 1714173 NSC751465 sensitive
hsa-miR-9-5p Gw832467x 6539439 NSC756401 resistant
hsa-miR-9-5p Hexachlorophene 3598 NSC757055 sensitive
hsa-miR-9-5p Iodine green 54605107 NSC8673 sensitive
hsa-miR-9-5p Kijanimicin sodium salt 54707591 NSC329515 sensitive
hsa-miR-9-5p L-cysteine, s-[(4-chlorophenyl)diphenylmethyl]- 275977 NSC123138 sensitive
hsa-miR-9-5p L-cysteine, s-[(4-methylphenyl)diphenylmethyl]- (9ci) 275978 NSC123139 sensitive
hsa-miR-9-5p L-cysteine, s-[bis(4-methylphenyl)phenylmethyl]- 275979 NSC123140 sensitive
hsa-miR-9-5p Lmpk12050091 165203 NSC646923 sensitive
hsa-miR-9-5p Ls-144126 135538372 NSC42369 sensitive
hsa-miR-9-5p Methyl (e)-3-[2-[[methyl-(4-methylphenyl)-oxo-lambda6-sulfanylidene]amino]phenyl]prop-2-enoate 24202623 NSC716715 sensitive
hsa-miR-9-5p Methyl (Z)-4-[(5-bromothiophen-2-yl)methylideneamino]-4,4-dicyanobut-2-enoate 5470186 NSC698282 resistant
hsa-miR-9-5p Methyl (Z)-4,4-dicyano-4-(thiophen-2-ylmethylideneamino)but-2-enoate 5470184 NSC698280 resistant
hsa-miR-9-5p Methyl (Z)-4,4-dicyano-4-[(3-methylthiophen-2-yl)methylideneamino]but-2-enoate 5470185 NSC698281 resistant
hsa-miR-9-5p Methyl 5-(3,5-dimethoxybenzyl)-2-hydroxy-5h-benzo[b]carbazole-1-carboxylate 404480 NSC720716 sensitive
hsa-miR-9-5p Methyl 5-(hydroxyamino)-2,6-dimethyl-4-[2-(trifluoromethyl)phenyl]pyridine-3-carboxylate 382124 NSC669517 resistant
hsa-miR-9-5p N'-carbamimidoyl-2-chloro-6-(2,5-dimethoxy-4-nitrophenyl)imidazo[2,1-b][1,3]thiazole-5-carboximidamide;hydrochloride 24202932 NSC726311 sensitive
hsa-miR-9-5p N-(1,2,3-trihydroxy-10-methylsulfanyl-9-oxo-6,7-dihydro-5h-benzo[a]heptalen-7-yl)benzamide 369939 NSC642306 sensitive
hsa-miR-9-5p N-[(e)-[6-(2,5-dimethylanilino)-1-(4-hydroxyphenyl)-2-methyl-1,6-dioxohexan-3-ylidene]amino]-2-hydroxynaphthalene-1-carboxamide 9555801 NSC630357 sensitive
hsa-miR-9-5p N-[2-(dimethylamino)ethyl]-1-[3-[3-[[4-[2-(dimethylamino)ethylcarbamoyl]-9-oxo-10h-acridin-1-yl]amino]propyl-methylamino]propylamino]-9-oxo-10h-acridine-4-carboxamide 399637 NSC710554 sensitive
hsa-miR-9-5p N-[4-[[[2-(4-chloroanilino)pyridine-3-carbonyl]amino]sulfamoyl]phenyl]acetamide 16126694 NSC737147 sensitive
hsa-miR-9-5p N-anthracen-2-yl-8-chloro-5,5-dioxoimidazo[1,2-b][1,4,2]benzodithiazine-7-carboxamide 403255 NSC717956 sensitive
hsa-miR-9-5p N-benzyl-1-[10-[4-(benzylamino)-2-methylquinolin-1-ium-1-yl]decyl]-2-methylquinolin-1-ium-4-amine;perchlorate 387881 NSC682094 sensitive
hsa-miR-9-5p N-cyclohexyl-4-[(2,4-diaminopteridin-6-yl)methyl-methylamino]benzamide 393097 NSC694482 sensitive
hsa-miR-9-5p N,N'-bis[(6-methoxynaphthalen-2-yl)methyl]hexane-1,6-diamine;hydrochloride 385310 NSC676426 sensitive
hsa-miR-9-5p N~2~,n~4~-di(1-adamantyl)-6-chloro-1,3,5-triazine-2,4-diamine 394865 NSC698954 sensitive
hsa-miR-9-5p Neuro_000210 435731 NSC374979 sensitive
hsa-miR-9-5p NSC644919 NSC644919 sensitive
hsa-miR-9-5p NSC688995 NSC688995 sensitive
hsa-miR-9-5p NSC751830 NSC751830 resistant
hsa-miR-9-5p Pipamperone 4830 NSC759178 sensitive
hsa-miR-9-5p Sanguilutine pseudobase 371258 NSC645317 sensitive
hsa-miR-9-5p Sb-223133 22464120 NSC756420 resistant
hsa-miR-9-5p Simvastatin 54454 NSC633782 approved sensitive
hsa-miR-9-5p Sphinxolide f 5470536 NSC702924 resistant
hsa-miR-9-5p Spiropitan 5265 NSC170983 resistant
hsa-miR-9-5p Stereoisomer of nsc 674066-o NSC674067 sensitive
hsa-miR-9-5p Suavedol 65631 NSC141545 sensitive
hsa-miR-9-5p Tiazofurin 323701 NSC286193 sensitive
hsa-miR-9-5p Timtec1_008492 397075 NSC704388 sensitive
hsa-miR-9-5p Triciribine phosphate 43860 NSC280594 resistant
hsa-miR-9-5p Vorinostat 5311 NSC701852 approved sensitive
hsa-miR-9-5p Waol a fd-211 10354084 NSC726144 resistant
hsa-miR-9-5p Trail sensitive High Non-Small Cell Lung Cancer cell line (CALU-1, A459, H460)
hsa-miR-9-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-9-5p Etoposide 36462 NSC141540 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-9-5p Imatinib 5291 NSC743414 approved sensitive High Myelogenous Leukemia cell line (MYL)
hsa-miR-9-5p Daunorubicin 30323 NSC82151 approved resistant High Lymphoblastic Leukemia tissue
hsa-miR-9-5p Prednisolone 5755 NSC9120 approved resistant High Lymphoblastic Leukemia tissue
hsa-miR-9-5p Vincristine 5978 approved resistant High Lymphoblastic Leukemia tissue
hsa-miR-9-5p L-Asparaginase resistant High Lymphoblastic Leukemia tissue
hsa-miR-9-5p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (SUIT-2, CAPAN-1)
hsa-miR-9-5p Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer tissue and cell line (SKOV3)
hsa-miR-9-5p Temozolomide 5394 NSC362856 approved resistant Low Glioblastoma cell line (U87, T98G, BT145, BT164)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer tissue and cell line (C13, OV2008, A2780)
hsa-miR-9-5p Rucaparib phosphate 9931953 sensitive Low Ovarian Cancer tissue and cell line (C13)
hsa-miR-9-5p Docetaxel 148124 NSC628503 approved sensitive High Prostate Cancer cell line (PC-3)
hsa-miR-9-5p Temozolomide 5394 NSC362856 approved resistant Low Glioblastoma cell line (U87, T98G)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer tissue and cell line
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved sensitive Low Primary Epithelial Ovarian Cancer Primary Epithelial Ovarian Cancer Single Cells
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-miR-9-5p Paclitaxel 36314 NSC125973 approved sensitive Low Epithelial Ovarian Cancer tissue and cell line (SKOV3, A2780)
hsa-miR-9-5p Dexamethasone 5743 NSC34521 approved resistant High Myeloma cell line (MM1R, MM1S)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer tissue
hsa-miR-9-5p Doxorubicin 31703 NSC123127 approved sensitive High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-9-5p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (TAMR4)
hsa-miR-9-5p Temozolomide 5394 NSC362856 approved resistant Low Glioblastoma cell line (A172, U-251MG)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved resistant Low Urothelial Bladder Cancer cell line (T24)
hsa-miR-9-5p Gemcitabine 60750 NSC613327 approved resistant Low Urothelial Bladder Cancer cell line (T24)
hsa-miR-9-5p Cetuximab sensitive Low Hepatocellular Carcinoma cell line (Hep3B, Huh-7)
hsa-miR-9-5p [5-[2,4-Bis((3S)-3-methylmorpholin-4-yl)pyrido[2,3-d]pyrimidin-7-yl]-2-methoxyphenyl]methanol 25262965 NSC758871 resistant Low Breast Cancer cell line (MCF-7)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-9-5p Sunitinib 5329102 NSC750690 approved resistant High Renal Cell Cancer tissue
hsa-miR-9-5p Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (500nM)
hsa-miR-9-5p Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-miR-9-5p Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (2uM)
hsa-miR-9-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (500nM)
hsa-miR-9-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-miR-9-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (2uM)
hsa-miR-9-5p Daunorubicin 30323 NSC82151 approved sensitive Low Myeloid Leukemia cell line (THP-1, KG-1, HL60, Kasumi-1F)
hsa-miR-9-5p Temozolomide 5394 NSC362856 approved sensitive Low Glioma cell line (U251)
hsa-miR-9-5p Alkannin 72521 resistant Low Oral Cancer cell line (CAL-27, SCC-9)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved sensitive Low Gastric Cancer cell line (MKN45, HGC-27)
hsa-miR-9-5p Etoposide 36462 NSC141540 approved resistant Low Leukemia cell line (K562)
hsa-miR-9-5p Imatinib 5291 NSC743414 approved resistant Low Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-9-5p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-miR-9-5p Gefitinib 123631 NSC715055 approved sensitive Low Colorectal Cancer cell line (HCT-116)
hsa-miR-9-5p Regorafenib 11167602 NSC763932 approved sensitive Low Colorectal Cancer cell line (HCT-116)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved sensitive Low Hepatocellular Carcinoma cell line (HepG2, Hep3B, Huh-7, SNU387, SNU449)
hsa-miR-9-5p Gefitinib 123631 NSC715055 approved sensitive High Non-Small Cell Lung Cancer cell line (HCC827)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved sensitive Low Gastric Cancer cell line (MGC803)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved resistant Low Triple-Negative Breast Cancer cell line (HEK-293T, MDA-MB-468)
hsa-miR-9-5p Tamoxifen 2733525 NSC180973 approved resistant Low Breast Cancer cell line (MCF-7)
hsa-miR-9-5p Fluorouracil 3385 NSC19893 approved sensitive Low Colorectal Cancer cell line (HCT-116, HT-29)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-9-5p Temozolomide 5394 NSC362856 approved sensitive Low Glioma cell line (U87, U251)
hsa-miR-9-5p Temozolomide 5394 NSC362856 approved resistant High Glioblastoma cell line (U251)
hsa-miR-9-5p Temozolomide 5394 NSC362856 approved sensitive cell line (U251)
hsa-miR-9-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-9-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)
hsa-miR-9-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-9-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-9-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM11)
hsa-miR-9-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-9-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-9-5p Exemestane 60198 NSC713563 approved resistant cell line (MCF-7)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-9-5p Fluorouracil 3385 NSC19893 approved resistant cell line (HCT15)
hsa-miR-9-5p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (RPMI2650)
hsa-miR-9-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-9-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (H23)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved resistant cell line (OVCAR3)

Error report submission