miRTarBase - #MIRT003382


—
pre-miRNA Information
pre-miRNA hsa-mir-20a   
Genomic Coordinates chr13: 91351065 - 91351135
Synonyms MIR20, MIRN20, MIRN20A, hsa-mir-20, hsa-mir-20a, miR-20, miRNA20A, MIR20A
Description Homo sapiens miR-20a stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-20a-5p
Sequence 8| UAAAGUGCUUAUAGUGCAGGUAG |30
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 2 13 + 91351073 29950133 MiREDiBase
A-to-I 3 13 + 91351074 29233923 MiREDiBase
A-to-I 18 13 + 91351089 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs774862920 1 dbSNP
rs757295536 9 dbSNP
rs762585098 11 dbSNP
rs755819745 12 dbSNP
rs1472771133 14 dbSNP
rs1260934034 20 dbSNP
rs1390082123 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BP03IS miR-20a Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Urine Quantitative real-time reverse transcription PCR
BP03IS miR-20a Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Decrease Tumor tissue Quantitative real-time PCR
Gene Information
Gene Symbol APP   
Synonyms AAA, ABETA, ABPP, AD1, APPI, CTFgamma, CVAP, PN-II, PN2, preA4
Description amyloid beta precursor protein
Transcript NM_000484   
Other Transcripts NM_001136016 , NM_001136129 , NM_001136130 , NM_001136131 , NM_201413 , NM_201414   
Expression
Putative miRNA Targets on APP
3'UTR of APP
(miRNA target sites are highlighted)		 
>APP|NM_000484|3'UTR
   1 ACCCCCGCCACAGCAGCCTCTGAAGTTGGACAGCAAAACCATTGCTTCACTACCCATCGGTGTCCATTTATAGAATAATG
  81 TGGGAAGAAACAAACCCGTTTTATGATTTACTCATTATCGCCTTTTGACAGCTGTGCTGTAACACAAGTAGATGCCTGAA
 161 CTTGAATTAATCCACACATCAGTAATGTATTCTATCTCTCTTTACATTTTGGTCTCTATACTACATTATTAATGGGTTTT
 241 GTGTACTGTAAAGAATTTAGCTGTATCAAACTAGTGCATGAATAGATTCTCTCCTGATTATTTATCACATAGCCCCTTAG
 321 CCAGTTGTATATTATTCTTGTGGTTTGTGACCCAATTAAGTCCTACTTTACATATGCTTTAAGAATCGATGGGGGATGCT
 401 TCATGTGAACGTGGGAGTTCAGCTGCTTCTCTTGCCTAAGTATTCCTTTCCTGATCACTATGCATTTTAAAGTTAAACAT
 481 TTTTAAGTATTTCAGATGCTTTAGAGAGATTTTTTTTCCATGACTGCATTTTACTGTACAGATTGCTGCTTCTGCTATAT
 561 TTGTGATATAGGAATTAAGAGGATACACACGTTTGTTTCTTCGTGCCTGTTTTATGTGCACACATTAGGCATTGAGACTT
 641 CAAGCTTTTCTTTTTTTGTCCACGTATCTTTGGGTCTTTGATAAAGAAAAGAATCCCTGTTCATTGTAAGCACTTTTACG
 721 GGGCGGGTGGGGAGGGGTGCTCTGCTGGTCTTCAATTACCAAGAATTCTCCAAAACAATTTTCTGCAGGATGATTGTACA
 801 GAATCATTGCTTATGACATGATCGCTTTCTACACTGTATTACATAAATAAATTAAATAAAATAACCCCGGGCAAGACTTT
 881 TCTTTGAAGGATGACTACAGACATTAAATAATCGAAGTAATTTTGGGTGGGGAGAAGAGGCAGATTCAATTTTCTTTAAC
 961 CAGTCTGAAGTTTCATTTATGATACAAAAGAAGATGAAAATGGAAGTGGCAATATAAGGGGATGAGGAAGGCATGCCTGG
1041 ACAAACCCTTCTTTTAAGATGTGTCTTCAATTTGTATAAAATGGTGTTTTCATGTAAATAAATACATTCTTGGAGGAGCA
1121 AAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gauGGAC--GUGAUAUUCGUGAAAu 5'
             ||||  ||:|:|||||||||| 
Target 5' atcCCTGTTCATTGTAAGCACTTTt 3'
 693 - 717 182.00 -22.80
2 
miRNA  3' gauGGAC--GUGAUAUUCGUGAAAu 5'
             ||||  ||||||  |||:||| 
Target 5' tttCCTGATCACTAT--GCATTTTa 3'
 447 - 469 154.00 -16.70
3 
miRNA  3' gauGGACGUGAUAUU--CGUGAAAu 5'
             ::| : | ||:|  |||:||| 
Target 5' attTTTTTTCCATGACTGCATTTTa 3'
 509 - 533 134.00 -8.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
897922 7 ClinVar
809279 18 ClinVar
339626 97 ClinVar
339625 194 ClinVar
897921 289 ClinVar
897920 355 ClinVar
896311 356 ClinVar
896310 372 ClinVar
896309 454 ClinVar
896308 489 ClinVar
896307 521 ClinVar
339624 590 ClinVar
896306 624 ClinVar
896305 663 ClinVar
894858 724 ClinVar
339623 735 ClinVar
894857 738 ClinVar
894856 810 ClinVar
339622 913 ClinVar
339621 914 ClinVar
339620 967 ClinVar
339619 1015 ClinVar
COSN17936390 1 COSMIC
COSN15623167 3 COSMIC
COSN30531573 4 COSMIC
COSN31961905 22 COSMIC
COSN30167406 25 COSMIC
COSN26438156 36 COSMIC
COSN30129320 39 COSMIC
COSN24397698 52 COSMIC
COSN30102398 53 COSMIC
COSN31497718 58 COSMIC
COSN26966455 59 COSMIC
COSN506962 62 COSMIC
COSN30448972 65 COSMIC
COSN30524002 87 COSMIC
COSN31494855 105 COSMIC
COSN31504281 131 COSMIC
COSN31501568 151 COSMIC
COSN31530738 181 COSMIC
COSN25342579 284 COSMIC
COSN7142013 494 COSMIC
COSN28198051 602 COSMIC
COSN31549866 614 COSMIC
COSN31592743 710 COSMIC
COSN28772189 722 COSMIC
COSN28652840 735 COSMIC
COSN31545277 740 COSMIC
COSN31596517 840 COSMIC
COSN30545260 881 COSMIC
COSN9154867 1045 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs748508166 1 dbSNP
rs777073624 2 dbSNP
rs769101415 3 dbSNP
rs996259981 4 dbSNP
rs745519536 5 dbSNP
rs376555983 6 dbSNP
rs201922766 7 dbSNP
rs1356734177 8 dbSNP
rs777613745 9 dbSNP
rs201602257 11 dbSNP
rs756058120 13 dbSNP
rs1350555988 14 dbSNP
rs1278165273 17 dbSNP
rs201729239 18 dbSNP
rs781075094 25 dbSNP
rs1250826767 30 dbSNP
rs754705572 32 dbSNP
rs1173423327 38 dbSNP
rs751797026 40 dbSNP
rs1362590511 42 dbSNP
rs200487986 44 dbSNP
rs372670815 45 dbSNP
rs763057188 46 dbSNP
rs750491084 48 dbSNP
rs765178974 49 dbSNP
rs1481257485 50 dbSNP
rs985159470 52 dbSNP
rs1010736384 56 dbSNP
rs1471820634 58 dbSNP
rs1374388209 73 dbSNP
rs1407511078 73 dbSNP
rs952727634 79 dbSNP
rs1386423594 80 dbSNP
rs919890179 82 dbSNP
rs972977788 83 dbSNP
rs202204121 96 dbSNP
rs886056992 97 dbSNP
rs200773744 98 dbSNP
rs200154864 108 dbSNP
rs1035531706 109 dbSNP
rs1471181631 111 dbSNP
rs1245104664 114 dbSNP
rs981497267 119 dbSNP
rs1487985867 127 dbSNP
rs1213167850 131 dbSNP
rs1189111141 136 dbSNP
rs1270505836 137 dbSNP
rs531663676 139 dbSNP
rs1229582365 140 dbSNP
rs113174916 155 dbSNP
rs1423602670 158 dbSNP
rs1464490035 159 dbSNP
rs1467945548 163 dbSNP
rs970148921 164 dbSNP
rs201876780 171 dbSNP
rs1011605214 175 dbSNP
rs200917677 178 dbSNP
rs780350314 178 dbSNP
rs1031961200 187 dbSNP
rs1277622834 192 dbSNP
rs199977643 194 dbSNP
rs1216239655 198 dbSNP
rs201644219 198 dbSNP
rs1046036943 199 dbSNP
rs201380777 200 dbSNP
rs1219056706 202 dbSNP
rs950281598 202 dbSNP
rs908163637 216 dbSNP
rs901984087 218 dbSNP
rs983695777 226 dbSNP
rs952218766 228 dbSNP
rs1224036194 233 dbSNP
rs1040531485 234 dbSNP
rs943764960 236 dbSNP
rs1300570028 243 dbSNP
rs1260407227 245 dbSNP
rs1439565783 251 dbSNP
rs200058308 263 dbSNP
rs201729905 264 dbSNP
rs568756389 271 dbSNP
rs1420767245 272 dbSNP
rs200591716 274 dbSNP
rs1163061989 275 dbSNP
rs1367744955 276 dbSNP
rs889564811 285 dbSNP
rs199534609 289 dbSNP
rs201853089 290 dbSNP
rs1358714854 291 dbSNP
rs1452072147 297 dbSNP
rs1432896759 303 dbSNP
rs975249008 306 dbSNP
rs919590033 310 dbSNP
rs1226442546 312 dbSNP
rs755797592 313 dbSNP
rs1316850843 314 dbSNP
rs1402616512 316 dbSNP
rs1359790027 319 dbSNP
rs964795018 320 dbSNP
rs1019370324 321 dbSNP
rs1448232762 330 dbSNP
rs1215836791 331 dbSNP
rs532876832 333 dbSNP
rs551830226 335 dbSNP
rs1277719891 354 dbSNP
rs939934369 355 dbSNP
rs1445554583 356 dbSNP
rs1158278265 357 dbSNP
rs200736438 371 dbSNP
rs187940037 372 dbSNP
rs981297249 373 dbSNP
rs1454775319 375 dbSNP
rs201377891 379 dbSNP
rs970533877 384 dbSNP
rs1358542566 385 dbSNP
rs200600383 387 dbSNP
rs1338528938 388 dbSNP
rs1383278900 391 dbSNP
rs1445686426 394 dbSNP
rs1195497191 397 dbSNP
rs1352330930 402 dbSNP
rs199765959 404 dbSNP
rs532399598 408 dbSNP
rs558948870 410 dbSNP
rs150007519 411 dbSNP
rs200262591 414 dbSNP
rs966680337 417 dbSNP
rs1020864110 419 dbSNP
rs1484754023 432 dbSNP
rs957353499 433 dbSNP
rs201624429 434 dbSNP
rs573263845 436 dbSNP
rs1462068525 439 dbSNP
rs1330251934 446 dbSNP
rs200980048 451 dbSNP
rs200492624 454 dbSNP
rs202194773 460 dbSNP
rs1032097030 461 dbSNP
rs200981079 462 dbSNP
rs1318312697 463 dbSNP
rs1159284405 468 dbSNP
rs1054943545 469 dbSNP
rs906248824 471 dbSNP
rs182834675 474 dbSNP
rs999033118 478 dbSNP
rs1406684222 480 dbSNP
rs1046568428 484 dbSNP
rs199862130 489 dbSNP
rs1337203681 495 dbSNP
rs1442478578 496 dbSNP
rs1273794605 502 dbSNP
rs1364878821 504 dbSNP
rs1232906166 509 dbSNP
rs908194392 510 dbSNP
rs201887246 514 dbSNP
rs1048029462 518 dbSNP
rs930856936 518 dbSNP
rs1271313410 519 dbSNP
rs1439833675 525 dbSNP
rs1306226755 532 dbSNP
rs1182819965 536 dbSNP
rs1246281557 538 dbSNP
rs1479517600 557 dbSNP
rs191651536 558 dbSNP
rs1201629889 570 dbSNP
rs754292576 579 dbSNP
rs201034704 583 dbSNP
rs45455403 590 dbSNP
rs748281356 591 dbSNP
rs1166009465 596 dbSNP
rs1398353216 600 dbSNP
rs139278773 603 dbSNP
rs889532960 606 dbSNP
rs1289777520 610 dbSNP
rs1433330398 614 dbSNP
rs201008117 618 dbSNP
rs199680232 624 dbSNP
rs1173311167 632 dbSNP
rs1406293795 633 dbSNP
rs931066255 638 dbSNP
rs912021116 641 dbSNP
rs1346765002 649 dbSNP
rs11549660 650 dbSNP
rs1268873368 654 dbSNP
rs987511254 655 dbSNP
rs898132746 657 dbSNP
rs1020893568 658 dbSNP
rs1489915913 658 dbSNP
rs966712982 658 dbSNP
rs1224870220 659 dbSNP
rs572356515 663 dbSNP
rs1477489193 664 dbSNP
rs1190955573 669 dbSNP
rs1374683667 670 dbSNP
rs201961275 677 dbSNP
rs1010797044 683 dbSNP
rs1178117451 686 dbSNP
rs1162410092 692 dbSNP
rs200665110 695 dbSNP
rs1426157042 698 dbSNP
rs199549432 702 dbSNP
rs776885449 703 dbSNP
rs939900852 707 dbSNP
rs1359360979 711 dbSNP
rs1486755973 713 dbSNP
rs186409009 717 dbSNP
rs1300405235 718 dbSNP
rs200286647 719 dbSNP
rs1347940140 720 dbSNP
rs1357644021 720 dbSNP
rs199700901 721 dbSNP
rs768025228 722 dbSNP
rs1033939405 724 dbSNP
rs146774213 724 dbSNP
rs1281778673 725 dbSNP
rs1224649028 728 dbSNP
rs1447479699 733 dbSNP
rs1476605928 733 dbSNP
rs200603813 734 dbSNP
rs202132811 735 dbSNP
rs1199175874 738 dbSNP
rs201621005 738 dbSNP
rs1163831745 741 dbSNP
rs200259364 747 dbSNP
rs201942871 748 dbSNP
rs906350862 750 dbSNP
rs867380299 755 dbSNP
rs537547227 757 dbSNP
rs1387831172 761 dbSNP
rs981264791 769 dbSNP
rs183019783 776 dbSNP
rs200089634 778 dbSNP
rs1216676820 780 dbSNP
rs202057479 792 dbSNP
rs200985813 794 dbSNP
rs528792746 796 dbSNP
rs199885985 797 dbSNP
rs1262565161 804 dbSNP
rs201885383 817 dbSNP
rs200853376 818 dbSNP
rs1351383004 822 dbSNP
rs566047180 823 dbSNP
rs199963586 824 dbSNP
rs899374269 825 dbSNP
rs1461552865 827 dbSNP
rs3200120 833 dbSNP
rs1237242999 835 dbSNP
rs201382660 837 dbSNP
rs1372376851 838 dbSNP
rs549234553 844 dbSNP
rs1416906841 848 dbSNP
rs1160750981 849 dbSNP
rs200692470 853 dbSNP
rs1465060324 855 dbSNP
rs1019197390 856 dbSNP
rs1039693147 858 dbSNP
rs199762023 858 dbSNP
rs201611727 863 dbSNP
rs912036895 865 dbSNP
rs1389875152 866 dbSNP
rs867304682 867 dbSNP
rs190880668 868 dbSNP
rs945440004 869 dbSNP
rs913917968 876 dbSNP
rs543194262 884 dbSNP
rs1204107258 889 dbSNP
rs1250546799 893 dbSNP
rs1186982688 897 dbSNP
rs995244959 898 dbSNP
rs199500588 899 dbSNP
rs201539056 904 dbSNP
rs1178592747 906 dbSNP
rs898264501 907 dbSNP
rs200379862 908 dbSNP
rs1432127189 909 dbSNP
rs533043229 910 dbSNP
rs1427861247 912 dbSNP
rs202081585 913 dbSNP
rs736479 914 dbSNP
rs200452592 925 dbSNP
rs970609897 928 dbSNP
rs1059461 937 dbSNP
rs1025204856 939 dbSNP
rs1300143563 942 dbSNP
rs1252402045 949 dbSNP
rs1003975709 953 dbSNP
rs1230312464 958 dbSNP
rs780567142 958 dbSNP
rs572241749 962 dbSNP
rs202141287 965 dbSNP
rs45541739 967 dbSNP
rs1206311668 975 dbSNP
rs995212130 982 dbSNP
rs915716708 985 dbSNP
rs542107566 991 dbSNP
rs1357540028 992 dbSNP
rs1490074682 993 dbSNP
rs35871145 995 dbSNP
rs780586892 995 dbSNP
rs573994403 997 dbSNP
rs1305155348 1009 dbSNP
rs936080642 1012 dbSNP
rs199902897 1013 dbSNP
rs202108412 1015 dbSNP
rs1419375863 1019 dbSNP
rs1427130017 1020 dbSNP
rs201019734 1024 dbSNP
rs1172965080 1026 dbSNP
rs1373898417 1027 dbSNP
rs1424258727 1028 dbSNP
rs1301437811 1029 dbSNP
rs200053802 1030 dbSNP
rs924725706 1048 dbSNP
rs201471700 1049 dbSNP
rs1265073365 1051 dbSNP
rs899490790 1056 dbSNP
rs1059478 1058 dbSNP
rs200544221 1059 dbSNP
rs199913244 1061 dbSNP
rs1359721298 1062 dbSNP
rs758913449 1063 dbSNP
rs1296018192 1068 dbSNP
rs376822208 1076 dbSNP
rs1039318980 1080 dbSNP
rs911902366 1082 dbSNP
rs1386840409 1083 dbSNP
rs1392238818 1090 dbSNP
rs1163855709 1095 dbSNP
rs986373038 1102 dbSNP
rs201838604 1103 dbSNP
rs112973660 1118 dbSNP
rs1485162032 1119 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HeLa , NEURO-2A , SK-N-SH
Disease MIMAT0000075;
Location of target site 3'UTR
Original Description (Extracted from the article) ... "We found that miR-20a ...

- Hebert SS; Horre K; Nicolai L; Bergmans B; et al., 2009, Neurobiology of disease.

Article - Hebert SS; Horre K; Nicolai L; Bergmans B; et al.
- Neurobiology of disease, 2009
Gene dosage effects of Amyloid precursor protein (APP) can cause familial AD. Recent evidence suggest that microRNA (miRNA) pathways, implicated in gene transcriptional control, could be involved in the development of sporadic Alzheimer's disease (AD). We therefore investigated whether miRNAs could participate in the regulation of APP gene expression. We show that miRNAs belonging to the miR-20a family (that is, miR-20a, miR-17-5p and miR-106b) could regulate APP expression in vitro and at the endogenous level in neuronal cell lines. A tight correlation between these miRNAs and APP was found during brain development and in differentiating neurons. We thus identify miRNAs as novel endogenous regulators of APP expression, suggesting that variations in miRNA expression could contribute to changes in APP expression in the brain during development and disease. This possibility is further corroborated by the observation that a statistically significant decrease in miR-106b expression was found in sporadic AD patients.
LinkOut: [PMID: 19110058]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions OVCAR-3
Location of target site 3'UTR
Original Description (Extracted from the article) ... "miR-20a targets directly at the APP 3' UTR//From these results ...

- Fan X; Liu Y; Jiang J; Ma Z; Wu H; Liu T; et al., 2010, Acta biochimica et biophysica Sinica.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gauGGAC--GUGAUAUUCGUGAAAu 5'
             ||||  ||:|:|||||||||| 
Target 5' --cCCUGUUCAUUGUAAGCACUUUu 3'
 		1 - 23
Article - Fan X; Liu Y; Jiang J; Ma Z; Wu H; Liu T; et al.
- Acta biochimica et biophysica Sinica, 2010
MicroRNAs (miRNAs) are emerging as a class of small regulated RNAs, and the alterations of miRNAs are implicated in the initiation and progression of human cancers. Our study shows that inhibition of miR-20a in OVCAR3 ovarian cancer cell line could suppress, whereas overexpression of miR-20a could enhance cell long-term proliferation and invasion. We also confirmed amyloid precursor protein (APP) as a direct target gene of miR- 20a. Furthermore, suppression of APP expression could also promote ovarian cancer cell proliferation and invasion, which is consistent with the results of miR-20a overexpression. Therefore, we concluded that the regulation of APP is an important mechanism for miR-20a to promote proliferation and invasion in ovarian cancer cells.
LinkOut: [PMID: 20458444]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer -0.748 1.3e-5 -0.722 3.4e-5 24 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.628 1.5e-3 0.756 5.8e-5 20 Click to see details
GSE42095 Differentiated embryonic stem cells -0.579 1.9e-3 -0.581 1.8e-3 23 Click to see details
GSE38226 Liver fibrosis -0.583 2.8e-3 -0.554 4.6e-3 21 Click to see details
GSE28260 Renal cortex and medulla 0.614 1.3e-2 0.720 2.8e-3 13 Click to see details
GSE21032 Prostate cancer 0.187 4.5e-2 0.129 1.2e-1 83 Click to see details
GSE21687 Ependynoma primary tumors -0.199 5.7e-2 -0.238 2.9e-2 64 Click to see details
GSE14794 Lymphoblastoid cells -0.162 6.4e-2 -0.226 1.6e-2 90 Click to see details
GSE21849 B cell lymphoma -0.224 1.2e-1 0.201 1.5e-1 29 Click to see details
GSE19783 ER+ ER+ breast cancer -0.259 1.4e-1 -0.341 7.1e-2 20 Click to see details
GSE19536 Breast cancer -0.09 1.9e-1 -0.162 5.4e-2 100 Click to see details
GSE27834 Pluripotent stem cells -0.215 2.1e-1 -0.409 5.8e-2 16 Click to see details
GSE17306 Multiple myeloma 0.108 2.3e-1 0.143 1.6e-1 49 Click to see details
GSE17498 Multiple myeloma -0.094 2.8e-1 0.120 2.3e-1 40 Click to see details
GSE26953 Aortic valvular endothelial cells 0.102 3.2e-1 0.117 2.9e-1 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.069 3.7e-1 -0.104 3.1e-1 25 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.085 4.2e-1 0.119 3.9e-1 8 Click to see details
GSE32688 Pancreatic cancer -0.031 4.3e-1 -0.024 4.5e-1 32 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.032 4.4e-1 0.062 3.8e-1 25 Click to see details
GSE19350 CNS germ cell tumors -0.043 4.5e-1 -0.161 3.1e-1 12 Click to see details
GSE19783 ER- ER- breast cancer 0.012 4.6e-1 -0.061 3.0e-1 79 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC -0.556 0 -0.520 0 42 Click to see details
PRAD -0.461 0 -0.470 0 50 Click to see details
STAD -0.466 0 -0.533 0 32 Click to see details
THCA -0.239 0.03 -0.210 0.06 59 Click to see details
KIRC 0.221 0.04 0.264 0.01 68 Click to see details
PAAD -0.906 0.05 -1.000 0.5 4 Click to see details
CESC 0.979 0.07 0.500 0.33 3 Click to see details
ESCA -0.476 0.07 -0.309 0.18 11 Click to see details
KICH -0.223 0.14 -0.201 0.17 25 Click to see details
PCPG -0.846 0.18 -0.500 0.33 3 Click to see details
LUSC -0.143 0.2 -0.243 0.07 38 Click to see details
LUAD 0.237 0.23 0.133 0.34 12 Click to see details
BLCA -0.168 0.25 -0.203 0.21 18 Click to see details
UCEC 0.138 0.29 0.246 0.16 19 Click to see details
COAD 0.182 0.33 -0.024 0.48 8 Click to see details
LIHC 0.052 0.36 0.081 0.29 49 Click to see details
BRCA 0.03 0.39 -0.028 0.4 84 Click to see details
CHOL -0.083 0.42 -0.150 0.35 9 Click to see details
KIRP -0.022 0.45 0.011 0.48 32 Click to see details
KIRP -0.022 0.45 0.011 0.48 32 Click to see details
KIRP -0.022 0.45 0.011 0.48 32 Click to see details
1050 hsa-miR-20a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000002 HIF1A hypoxia inducible factor 1 alpha subunit 5 4
MIRT000178 TCEAL1 transcription elongation factor A like 1 5 2
MIRT000179 CCND1 cyclin D1 6 16
MIRT000180 E2F1 E2F transcription factor 1 6 7
MIRT000181 BMPR2 bone morphogenetic protein receptor type 2 5 2
MIRT000597 CDKN1A cyclin dependent kinase inhibitor 1A 5 5
MIRT001785 TGFBR2 transforming growth factor beta receptor 2 7 12
MIRT003010 MAP3K12 mitogen-activated protein kinase kinase kinase 12 2 1
MIRT003011 BCL2 BCL2, apoptosis regulator 2 1
MIRT003012 MEF2D myocyte enhancer factor 2D 2 1
MIRT003369 PTEN phosphatase and tensin homolog 6 3
MIRT003382 APP amyloid beta precursor protein 4 2
MIRT003742 RUNX1 runt related transcription factor 1 4 1
MIRT003903 NRAS NRAS proto-oncogene, GTPase 2 1
MIRT004450 VEGFA vascular endothelial growth factor A 2 1
MIRT004570 BCL2L11 BCL2 like 11 3 10
MIRT004711 MUC17 mucin 17, cell surface associated 3 1
MIRT005289 MYC MYC proto-oncogene, bHLH transcription factor 3 2
MIRT005481 BNIP2 BCL2 interacting protein 2 5 9
MIRT005627 THBS1 thrombospondin 1 3 1
MIRT005631 SMAD4 SMAD family member 4 4 7
MIRT005854 CCND2 cyclin D2 1 1
MIRT005855 E2F3 E2F transcription factor 3 2 2
MIRT005856 MAPK9 mitogen-activated protein kinase 9 1 1
MIRT005857 RB1 RB transcriptional corepressor 1 3 3
MIRT005858 RBL1 RB transcriptional corepressor like 1 1 1
MIRT005859 RBL2 RB transcriptional corepressor like 2 2 2
MIRT005860 WEE1 WEE1 G2 checkpoint kinase 3 4
MIRT006178 IRF2 interferon regulatory factor 2 4 1
MIRT006180 KIT KIT proto-oncogene receptor tyrosine kinase 4 1
MIRT006289 EGLN3 egl-9 family hypoxia inducible factor 3 4 3
MIRT006612 Tgfbr2 transforming growth factor, beta receptor II 4 4
MIRT006754 PPARG peroxisome proliferator activated receptor gamma 1 1
MIRT006755 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT006756 CRIM1 cysteine rich transmembrane BMP regulator 1 1 1
MIRT006772 MAP2K3 mitogen-activated protein kinase kinase 3 1 1
MIRT007002 PURA purine rich element binding protein A 1 1
MIRT031080 IL8 C-X-C motif chemokine ligand 8 1 1
MIRT031081 JAK1 Janus kinase 1 2 2
MIRT031082 ARHGAP12 Rho GTPase activating protein 12 3 6
MIRT031083 TSG101 tumor susceptibility 101 3 6
MIRT035531 SIRPA signal regulatory protein alpha 1 1
MIRT050476 PHF8 PHD finger protein 8 1 1
MIRT050477 GPATCH11 G-patch domain containing 11 1 1
MIRT050478 RPRD1A regulation of nuclear pre-mRNA domain containing 1A 1 1
MIRT050479 ATP8B2 ATPase phospholipid transporting 8B2 1 1
MIRT050480 PSMD2 proteasome 26S subunit, non-ATPase 2 1 1
MIRT050481 INSIG1 insulin induced gene 1 1 1
MIRT050482 RTN2 reticulon 2 2 3
MIRT050483 TCEA1 transcription elongation factor A1 1 1
MIRT050484 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT050485 RPS10 ribosomal protein S10 1 1
MIRT050486 ALDH18A1 aldehyde dehydrogenase 18 family member A1 1 1
MIRT050487 UEVLD UEV and lactate/malate dehyrogenase domains 1 1
MIRT050488 FGF7 fibroblast growth factor 7 1 1
MIRT050489 SSRP1 structure specific recognition protein 1 1 1
MIRT050490 COX5A cytochrome c oxidase subunit 5A 1 1
MIRT050491 AGO1 argonaute 1, RISC catalytic component 1 2
MIRT050492 KIAA0100 KIAA0100 1 1
MIRT050493 FHL3 four and a half LIM domains 3 1 1
MIRT050494 GDI2 GDP dissociation inhibitor 2 1 1
MIRT050495 INTS3 integrator complex subunit 3 1 1
MIRT050496 HMG20A high mobility group 20A 1 1
MIRT050497 APOA1BP NAD(P)HX epimerase 1 1
MIRT050498 PRKD3 protein kinase D3 1 1
MIRT050499 AP3S2 adaptor related protein complex 3 sigma 2 subunit 1 1
MIRT050500 PCNXL4 pecanex homolog 4 1 1
MIRT050501 IKZF5 IKAROS family zinc finger 5 1 1
MIRT050502 TMEM97 transmembrane protein 97 1 1
MIRT050503 ATP6 ATP synthase F0 subunit 6 1 1
MIRT050504 RPA2 replication protein A2 1 2
MIRT050505 PHYH phytanoyl-CoA 2-hydroxylase 1 1
MIRT050506 KIF2C kinesin family member 2C 1 1
MIRT050507 DDX5 DEAD-box helicase 5 1 2
MIRT050508 DTX2 deltex E3 ubiquitin ligase 2 1 1
MIRT050509 MPHOSPH8 M-phase phosphoprotein 8 1 1
MIRT050510 HAUS2 HAUS augmin like complex subunit 2 1 1
MIRT050511 ZNF331 zinc finger protein 331 1 1
MIRT050512 PPP6R3 protein phosphatase 6 regulatory subunit 3 2 3
MIRT050513 METTL22 methyltransferase like 22 1 1
MIRT050514 PPAN peter pan homolog (Drosophila) 1 1
MIRT050515 FBL fibrillarin 1 1
MIRT050516 RPL31 ribosomal protein L31 1 1
MIRT050517 SEPT2 septin 2 2 6
MIRT050518 TOMM20 translocase of outer mitochondrial membrane 20 1 1
MIRT050519 NCOR2 nuclear receptor corepressor 2 1 1
MIRT050520 PSD3 pleckstrin and Sec7 domain containing 3 1 1
MIRT050521 AP3D1 adaptor related protein complex 3 delta 1 subunit 1 1
MIRT050522 TBC1D15 TBC1 domain family member 15 1 1
MIRT050523 DPY19L4 dpy-19 like 4 1 1
MIRT050524 PTPN23 protein tyrosine phosphatase, non-receptor type 23 1 1
MIRT050525 C11orf68 chromosome 11 open reading frame 68 1 1
MIRT050526 CTR9 CTR9 homolog, Paf1/RNA polymerase II complex component 1 1
MIRT050527 PAIP1 poly(A) binding protein interacting protein 1 1 1
MIRT050528 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 1
MIRT050529 CDT1 chromatin licensing and DNA replication factor 1 1 1
MIRT050530 RPL30 ribosomal protein L30 1 1
MIRT050531 MRS2 MRS2, magnesium transporter 1 1
MIRT050532 TMX4 thioredoxin related transmembrane protein 4 1 1
MIRT050533 LAMTOR1 late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 2 7
MIRT050534 LPHN3 adhesion G protein-coupled receptor L3 1 1
MIRT050535 RBM10 RNA binding motif protein 10 1 1
MIRT050536 EMR2 adhesion G protein-coupled receptor E2 1 1
MIRT050537 FBXO3 F-box protein 3 1 1
MIRT050538 MLXIP MLX interacting protein 1 2
MIRT050539 RNGTT RNA guanylyltransferase and 5'-phosphatase 1 1
MIRT050540 MAD1L1 MAD1 mitotic arrest deficient like 1 1 1
MIRT050541 DLC1 DLC1 Rho GTPase activating protein 1 1
MIRT050542 NUP214 nucleoporin 214 1 1
MIRT050543 PAQR5 progestin and adipoQ receptor family member 5 1 1
MIRT050544 BTBD2 BTB domain containing 2 1 1
MIRT050545 XYLT2 xylosyltransferase 2 1 1
MIRT050546 ZNF398 zinc finger protein 398 1 1
MIRT050547 CEP120 centrosomal protein 120 1 1
MIRT050548 IL17RC interleukin 17 receptor C 1 1
MIRT050549 UBE2C ubiquitin conjugating enzyme E2 C 4 2
MIRT050550 PGK1 phosphoglycerate kinase 1 1 1
MIRT050551 ORMDL3 ORMDL sphingolipid biosynthesis regulator 3 1 2
MIRT050552 TUBB tubulin beta class I 1 1
MIRT050553 TDRD3 tudor domain containing 3 1 1
MIRT050554 DLG5 discs large MAGUK scaffold protein 5 1 1
MIRT050555 VEZF1 vascular endothelial zinc finger 1 1 1
MIRT050556 CCDC88C coiled-coil domain containing 88C 1 1
MIRT050557 USP10 ubiquitin specific peptidase 10 1 1
MIRT050558 KIAA1191 KIAA1191 2 6
MIRT050559 STAT3 signal transducer and activator of transcription 3 5 4
MIRT050560 GATA6 GATA binding protein 6 2 9
MIRT050561 RPL18A ribosomal protein L18a 1 1
MIRT050562 TMEM66 store-operated calcium entry associated regulatory factor 1 1
MIRT050563 ARL9 ADP ribosylation factor like GTPase 9 1 1
MIRT050564 CTSA cathepsin A 1 1
MIRT050565 ABCA3 ATP binding cassette subfamily A member 3 1 1
MIRT050566 MRPL13 mitochondrial ribosomal protein L13 1 1
MIRT050567 MAN1C1 mannosidase alpha class 1C member 1 1 1
MIRT050568 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT050569 BACH1 BTB domain and CNC homolog 1 1 1
MIRT050570 RFC3 replication factor C subunit 3 1 1
MIRT050571 ARHGEF7 Rho guanine nucleotide exchange factor 7 1 2
MIRT050572 GPN2 GPN-loop GTPase 2 1 1
MIRT050573 LDHB lactate dehydrogenase B 1 1
MIRT050574 PTPRS protein tyrosine phosphatase, receptor type S 1 1
MIRT050575 PPP2R1A protein phosphatase 2 scaffold subunit Aalpha 1 1
MIRT050576 CDK16 cyclin dependent kinase 16 1 1
MIRT050577 WBP4 WW domain binding protein 4 1 1
MIRT050578 CCNB1 cyclin B1 1 1
MIRT050579 POGZ pogo transposable element derived with ZNF domain 1 1
MIRT050580 KLHL15 kelch like family member 15 1 2
MIRT050581 RTFDC1 replication termination factor 2 domain containing 1 1 1
MIRT050582 FLNA filamin A 1 1
MIRT050583 PLXNA1 plexin A1 1 2
MIRT050584 ADSS adenylosuccinate synthase 1 1
MIRT050585 MANEAL mannosidase endo-alpha like 2 3
MIRT050586 NUP188 nucleoporin 188 1 1
MIRT050587 ECI1 enoyl-CoA delta isomerase 1 1 1
MIRT050588 NCOA3 nuclear receptor coactivator 3 1 2
MIRT050589 MORF4L2 mortality factor 4 like 2 1 1
MIRT050590 ATL3 atlastin GTPase 3 2 4
MIRT050591 FOXJ3 forkhead box J3 2 4
MIRT050592 PRRC2C proline rich coiled-coil 2C 1 1
MIRT050593 RPL21 ribosomal protein L21 1 1
MIRT050594 SELENBP1 selenium binding protein 1 1 1
MIRT050595 YBX1 Y-box binding protein 1 1 1
MIRT050596 B4GALT2 beta-1,4-galactosyltransferase 2 1 1
MIRT050597 PYGB glycogen phosphorylase B 1 1
MIRT050598 AKR7A2 aldo-keto reductase family 7 member A2 2 3
MIRT050599 C9orf78 chromosome 9 open reading frame 78 1 1
MIRT050600 STIL STIL, centriolar assembly protein 1 1
MIRT050601 CDK19 cyclin dependent kinase 19 1 1
MIRT050602 KDM4D lysine demethylase 4D 1 1
MIRT050603 UQCRC1 ubiquinol-cytochrome c reductase core protein I 1 1
MIRT050604 RUFY2 RUN and FYVE domain containing 2 2 3
MIRT050605 RPS27 ribosomal protein S27 1 1
MIRT050606 BTN3A1 butyrophilin subfamily 3 member A1 1 2
MIRT050607 PBXIP1 PBX homeobox interacting protein 1 1 1
MIRT050608 ARFGEF2 ADP ribosylation factor guanine nucleotide exchange factor 2 1 1
MIRT050609 NUDT21 nudix hydrolase 21 1 1
MIRT050610 NETO2 neuropilin and tolloid like 2 2 5
MIRT050611 SLC25A28 solute carrier family 25 member 28 1 1
MIRT050612 NAP1L1 nucleosome assembly protein 1 like 1 1 1
MIRT050613 PHC1 polyhomeotic homolog 1 1 1
MIRT050614 ZNF706 zinc finger protein 706 1 1
MIRT050615 CCDC47 coiled-coil domain containing 47 1 1
MIRT050616 ARPC2 actin related protein 2/3 complex subunit 2 1 1
MIRT050617 EIF4G2 eukaryotic translation initiation factor 4 gamma 2 1 2
MIRT050618 MAGOHB mago homolog B, exon junction complex core component 1 1
MIRT050619 ZNF598 zinc finger protein 598 1 1
MIRT050620 LEPREL4 prolyl 3-hydroxylase family member 4 (non-enzymatic) 1 1
MIRT050621 CERS2 ceramide synthase 2 1 1
MIRT050622 LYPD6 LY6/PLAUR domain containing 6 1 1
MIRT050623 HEXIM1 hexamethylene bisacetamide inducible 1 1 1
MIRT050624 WAC WW domain containing adaptor with coiled-coil 2 7
MIRT050625 ZNFX1 zinc finger NFX1-type containing 1 2 6
MIRT050626 RBM12B RNA binding motif protein 12B 2 4
MIRT052914 LIMK1 LIM domain kinase 1 4 1
MIRT052971 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 2 2
MIRT053007 GJA1 gap junction protein alpha 1 3 1
MIRT053023 DUSP2 dual specificity phosphatase 2 5 5
MIRT053109 ITGB8 integrin subunit beta 8 2 1
MIRT053159 SMAD7 SMAD family member 7 3 1
MIRT053208 MAP3K5 mitogen-activated protein kinase kinase kinase 5 3 1
MIRT053332 MCL1 MCL1, BCL2 family apoptosis regulator 4 2
MIRT053505 TP53INP1 tumor protein p53 inducible nuclear protein 1 5 3
MIRT053563 EGR2 early growth response 2 3 1
MIRT054860 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 3 1
MIRT055020 TPRG1L tumor protein p63 regulated 1 like 2 3
MIRT055382 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 6
MIRT055649 WDR37 WD repeat domain 37 1 1
MIRT056476 PFKP phosphofructokinase, platelet 2 9
MIRT056811 REEP3 receptor accessory protein 3 2 3
MIRT057384 TNKS2 tankyrase 2 2 3
MIRT057822 SLC30A7 solute carrier family 30 member 7 2 2
MIRT058912 FAM46C family with sequence similarity 46 member C 1 1
MIRT059186 CRY2 cryptochrome circadian clock 2 1 1
MIRT060075 TMEM138 transmembrane protein 138 1 1
MIRT060678 KLHL20 kelch like family member 20 1 1
MIRT061181 MED17 mediator complex subunit 17 2 3
MIRT061789 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 10
MIRT063054 ULK1 unc-51 like autophagy activating kinase 1 2 2
MIRT063434 SKI SKI proto-oncogene 1 1
MIRT064435 GPR137B G protein-coupled receptor 137B 2 4
MIRT064797 ZBTB18 zinc finger and BTB domain containing 18 2 3
MIRT065364 TMBIM6 transmembrane BAX inhibitor motif containing 6 1 1
MIRT065670 ACVR1B activin A receptor type 1B 2 6
MIRT065858 GDF11 growth differentiation factor 11 2 2
MIRT065886 RAB5B RAB5B, member RAS oncogene family 2 9
MIRT067229 FOXJ2 forkhead box J2 2 2
MIRT068492 NHLRC3 NHL repeat containing 3 1 1
MIRT070839 EIF2S1 eukaryotic translation initiation factor 2 subunit alpha 2 4
MIRT070995 SMOC1 SPARC related modular calcium binding 1 2 2
MIRT071324 CMPK1 cytidine/uridine monophosphate kinase 1 1 1
MIRT071903 ZFYVE9 zinc finger FYVE-type containing 9 2 2
MIRT072247 B2M beta-2-microglobulin 2 10
MIRT072567 USP3 ubiquitin specific peptidase 3 1 1
MIRT073117 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT073374 ABHD2 abhydrolase domain containing 2 1 1
MIRT073407 SEMA4B semaphorin 4B 1 1
MIRT074789 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT074891 CHD9 chromodomain helicase DNA binding protein 9 1 1
MIRT075775 KIAA0513 KIAA0513 2 6
MIRT076177 GID4 GID complex subunit 4 homolog 2 5
MIRT077064 KRT10 keratin 10 2 8
MIRT077831 MINK1 misshapen like kinase 1 2 3
MIRT078811 UNK unkempt family zinc finger 2 2
MIRT079344 CCDC137 coiled-coil domain containing 137 2 3
MIRT079411 FOXK2 forkhead box K2 2 5
MIRT079772 CABLES1 Cdk5 and Abl enzyme substrate 1 2 2
MIRT080178 PRKACB protein kinase cAMP-activated catalytic subunit beta 2 2
MIRT080848 RAB12 RAB12, member RAS oncogene family 1 1
MIRT081117 LDLR low density lipoprotein receptor 2 9
MIRT081198 MIDN midnolin 2 11
MIRT081981 GRAMD1A GRAM domain containing 1A 1 1
MIRT082290 FNBP1L formin binding protein 1 like 2 6
MIRT083739 PARD6B par-6 family cell polarity regulator beta 1 1
MIRT083960 RAB22A RAB22A, member RAS oncogene family 2 5
MIRT084344 RRM2 ribonucleotide reductase regulatory subunit M2 2 3
MIRT085173 SLC5A3 solute carrier family 5 member 3 2 4
MIRT085375 SPOPL speckle type BTB/POZ protein like 1 1
MIRT085867 TANC1 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 1 1
MIRT086425 NABP1 nucleic acid binding protein 1 2 7
MIRT087604 ATG16L1 autophagy related 16 like 1 4 2
MIRT088033 UBXN2A UBX domain protein 2A 2 4
MIRT088337 MAPRE3 microtubule associated protein RP/EB family member 3 2 8
MIRT090633 U2SURP U2 snRNP associated SURP domain containing 2 7
MIRT092685 C3ORF38 chromosome 3 open reading frame 38 2 8
MIRT093800 KLF3 Kruppel like factor 3 2 2
MIRT093941 SLAIN2 SLAIN motif family member 2 1 1
MIRT095200 SMAD5 SMAD family member 5 1 1
MIRT095719 ANKH ANKH inorganic pyrophosphate transport regulator 3 9
MIRT095997 ATP6V0E1 ATPase H+ transporting V0 subunit e1 1 1
MIRT096308 SQSTM1 sequestosome 1 1 1
MIRT097128 FCHO2 FCH domain only 2 2 3
MIRT097603 POLR3G RNA polymerase III subunit G 1 1
MIRT097649 LYSMD3 LysM domain containing 3 1 1
MIRT099308 QKI QKI, KH domain containing RNA binding 2 4
MIRT099355 C6ORF120 chromosome 6 open reading frame 120 1 1
MIRT099824 SOX4 SRY-box 4 2 10
MIRT100277 MICB MHC class I polypeptide-related sequence B 1 1
MIRT100454 ZBTB9 zinc finger and BTB domain containing 9 1 1
MIRT100945 CENPQ centromere protein Q 2 4
MIRT102221 HBP1 HMG-box transcription factor 1 2 3
MIRT102294 DNAJB9 DnaJ heat shock protein family (Hsp40) member B9 2 10
MIRT103189 SP4 Sp4 transcription factor 2 6
MIRT104161 PHTF2 putative homeodomain transcription factor 2 2 6
MIRT104394 ANKIB1 ankyrin repeat and IBR domain containing 1 1 1
MIRT108651 ZBTB33 zinc finger and BTB domain containing 33 2 5
MIRT108719 XIAP X-linked inhibitor of apoptosis 2 2
MIRT110266 GBF1 golgi brefeldin A resistant guanine nucleotide exchange factor 1 1 1
MIRT112089 TIMM17A translocase of inner mitochondrial membrane 17A 2 6
MIRT115779 CAPN15 calpain 15 2 2
MIRT121800 GRPEL2 GrpE like 2, mitochondrial 1 1
MIRT122363 RGMB repulsive guidance molecule family member b 2 4
MIRT124125 GINS4 GINS complex subunit 4 2 4
MIRT125725 TRIM8 tripartite motif containing 8 1 1
MIRT126308 ACADSB acyl-CoA dehydrogenase, short/branched chain 1 1
MIRT126344 ZRANB1 zinc finger RANBP2-type containing 1 1 1
MIRT126550 MASTL microtubule associated serine/threonine kinase like 2 3
MIRT127161 VPS26A VPS26, retromer complex component A 1 1
MIRT129131 ARCN1 archain 1 1 1
MIRT130070 TXNIP thioredoxin interacting protein 2 5
MIRT132394 PPP1R12B protein phosphatase 1 regulatory subunit 12B 1 1
MIRT133313 ORAI1 ORAI calcium release-activated calcium modulator 1 1 1
MIRT134275 DNM1L dynamin 1 like 1 1
MIRT135706 PIP4K2C phosphatidylinositol-5-phosphate 4-kinase type 2 gamma 1 1
MIRT135793 GNS glucosamine (N-acetyl)-6-sulfatase 2 7
MIRT136562 TXLNA taxilin alpha 1 1
MIRT138110 BRMS1L breast cancer metastasis-suppressor 1 like 1 1
MIRT138348 FRMD6 FERM domain containing 6 1 1
MIRT138792 SUSD6 sushi domain containing 6 1 1
MIRT140626 PLEKHO2 pleckstrin homology domain containing O2 1 1
MIRT140794 SMAD6 SMAD family member 6 1 1
MIRT141126 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141698 RCCD1 RCC1 domain containing 1 1 1
MIRT142095 CCP110 centriolar coiled-coil protein 110 1 1
MIRT142381 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT144207 SNTB2 syntrophin beta 2 1 1
MIRT144294 NFAT5 nuclear factor of activated T-cells 5 2 9
MIRT144978 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT145019 TNFAIP1 TNF alpha induced protein 1 1 1
MIRT145597 LASP1 LIM and SH3 protein 1 2 3
MIRT146071 RUNDC1 RUN domain containing 1 1 1
MIRT147118 MAP3K3 mitogen-activated protein kinase kinase kinase 3 1 1
MIRT147273 KPNA2 karyopherin subunit alpha 2 2 11
MIRT147921 CAMTA1 calmodulin binding transcription activator 1 1 1
MIRT148868 ANKRD12 ankyrin repeat domain 12 1 1
MIRT151690 CHAF1A chromatin assembly factor 1 subunit A 1 1
MIRT151799 BLOC1S3 biogenesis of lysosomal organelles complex 1 subunit 3 1 1
MIRT151853 ARHGAP35 Rho GTPase activating protein 35 1 1
MIRT151932 TBC1D17 TBC1 domain family member 17 1 1
MIRT152367 ARHGEF18 Rho/Rac guanine nucleotide exchange factor 18 1 1
MIRT152673 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT153327 MAVS mitochondrial antiviral signaling protein 2 4
MIRT153454 TTPAL alpha tocopherol transfer protein like 1 1
MIRT153969 PRNP prion protein 2 3
MIRT155231 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT155333 IFNAR1 interferon alpha and beta receptor subunit 1 1 1
MIRT155886 SIK1 salt inducible kinase 1 2 2
MIRT156404 RAPGEF4 Rap guanine nucleotide exchange factor 4 1 1
MIRT156640 C2ORF69 chromosome 2 open reading frame 69 1 1
MIRT157145 FAM117B family with sequence similarity 117 member B 1 1
MIRT157585 MTMR3 myotubularin related protein 3 1 1
MIRT158288 ASB1 ankyrin repeat and SOCS box containing 1 1 1
MIRT158573 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT159105 NRBP1 nuclear receptor binding protein 1 2 3
MIRT159399 FEZ2 fasciculation and elongation protein zeta 2 1 1
MIRT160004 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT164198 GAB1 GRB2 associated binding protein 1 1 1
MIRT164524 MSMO1 methylsterol monooxygenase 1 2 3
MIRT164659 WHSC1 nuclear receptor binding SET domain protein 2 1 1
MIRT164720 ADD1 adducin 1 1 1
MIRT166062 FAF2 Fas associated factor family member 2 1 1
MIRT167840 HECA hdc homolog, cell cycle regulator 1 1
MIRT168216 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT169663 AGFG2 ArfGAP with FG repeats 2 1 1
MIRT170564 CASP2 caspase 2 1 1
MIRT170849 TAX1BP1 Tax1 binding protein 1 2 5
MIRT172197 OXR1 oxidation resistance 1 1 1
MIRT173112 E2F5 E2F transcription factor 5 1 1
MIRT173688 PRPF4 pre-mRNA processing factor 4 1 1
MIRT175379 ACSL4 acyl-CoA synthetase long chain family member 4 2 2
MIRT175594 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT175644 PHF6 PHD finger protein 6 1 1
MIRT176079 CHIC1 cysteine rich hydrophobic domain 1 1 1
MIRT178062 SAMD8 sterile alpha motif domain containing 8 2 2
MIRT182517 ZBTB37 zinc finger and BTB domain containing 37 2 2
MIRT187472 PCBP2 poly(rC) binding protein 2 2 4
MIRT188183 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 2 2
MIRT194849 UBFD1 ubiquitin family domain containing 1 1 1
MIRT199106 ZNF532 zinc finger protein 532 2 2
MIRT199283 SH3GLB1 SH3 domain containing GRB2 like, endophilin B1 2 2
MIRT200924 ZNF264 zinc finger protein 264 2 6
MIRT201019 ZNF805 zinc finger protein 805 2 2
MIRT205046 CREB1 cAMP responsive element binding protein 1 2 2
MIRT205281 STK11IP serine/threonine kinase 11 interacting protein 2 2
MIRT206192 RAB10 RAB10, member RAS oncogene family 2 4
MIRT208975 SKIL SKI like proto-oncogene 2 10
MIRT213203 REST RE1 silencing transcription factor 2 2
MIRT213321 KIAA0232 KIAA0232 2 2
MIRT216423 SERF1A small EDRK-rich factor 1A 2 2
MIRT216448 SERF1B small EDRK-rich factor 1B 2 2
MIRT216661 F2R coagulation factor II thrombin receptor 2 2
MIRT220118 CAV1 caveolin 1 2 2
MIRT222673 EIF4H eukaryotic translation initiation factor 4H 2 6
MIRT222908 CROT carnitine O-octanoyltransferase 1 1
MIRT224747 DPYSL2 dihydropyrimidinase like 2 2 2
MIRT224885 MAK16 MAK16 homolog 1 1
MIRT227326 TRIM32 tripartite motif containing 32 4 1
MIRT230965 PRRG4 proline rich and Gla domain 4 2 2
MIRT238172 ANKRD33B ankyrin repeat domain 33B 2 10
MIRT241294 ZC3H12C zinc finger CCCH-type containing 12C 2 8
MIRT242196 TTC9 tetratricopeptide repeat domain 9 2 4
MIRT242657 SALL3 spalt like transcription factor 3 2 4
MIRT243778 AFF1 AF4/FMR2 family member 1 1 1
MIRT244588 HOOK3 hook microtubule tethering protein 3 2 2
MIRT244945 PRRG1 proline rich and Gla domain 1 2 1
MIRT246959 TSKU tsukushi, small leucine rich proteoglycan 2 2
MIRT247079 CEP57 centrosomal protein 57 1 1
MIRT248850 SESN2 sestrin 2 1 1
MIRT250444 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 1 1
MIRT254248 TRAPPC10 trafficking protein particle complex 10 1 1
MIRT257279 FOXC1 forkhead box C1 2 2
MIRT266048 FJX1 four jointed box 1 2 4
MIRT266853 SLC25A44 solute carrier family 25 member 44 2 2
MIRT280207 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 2 2
MIRT280991 SPRED1 sprouty related EVH1 domain containing 1 2 2
MIRT283172 C16ORF52 chromosome 16 open reading frame 52 2 2
MIRT286945 SOCS7 suppressor of cytokine signaling 7 2 2
MIRT289571 KDM6B lysine demethylase 6B 2 2
MIRT291931 TPM4 tropomyosin 4 2 2
MIRT293645 PVR poliovirus receptor 2 4
MIRT296868 REV1 REV1, DNA directed polymerase 1 1
MIRT299337 CYBRD1 cytochrome b reductase 1 1 1
MIRT302434 CLIP4 CAP-Gly domain containing linker protein family member 4 2 2
MIRT303488 NAGK N-acetylglucosamine kinase 2 6
MIRT322520 HMBOX1 homeobox containing 1 2 2
MIRT325510 PTPDC1 protein tyrosine phosphatase domain containing 1 2 2
MIRT363922 UBE2V2 ubiquitin conjugating enzyme E2 V2 2 2
MIRT368882 BCL2L2 BCL2 like 2 2 2
MIRT397684 ATXN7L3B ataxin 7 like 3B 2 2
MIRT400046 ADRBK2 G protein-coupled receptor kinase 3 2 2
MIRT437765 PRKG1 protein kinase, cGMP-dependent, type I 3 1
MIRT437766 PRKG1 protein kinase, cGMP-dependent, type I 3 1
MIRT437767 PRKG1 protein kinase, cGMP-dependent, type I 3 1
MIRT437768 Prkg1 protein kinase, cGMP-dependent, type 1 3 1
MIRT437769 Prkg1 protein kinase, cGMP-dependent, type I 3 1
MIRT437944 RGS5 regulator of G protein signaling 5 3 1
MIRT438054 ETV1 ETS variant 1 4 1
MIRT438160 EPAS1 endothelial PAS domain protein 1 1 1
MIRT438351 FBXO31 F-box protein 31 4 2
MIRT438791 TP53 tumor protein p53 1 1
MIRT438806 DNMT1 DNA methyltransferase 1 1 1
MIRT438812 PKD1 polycystin 1, transient receptor potential channel interacting 1 1
MIRT439181 ZNF800 zinc finger protein 800 1 1
MIRT439185 ZNF770 zinc finger protein 770 1 1
MIRT439192 ZNF597 zinc finger protein 597 1 1
MIRT439211 ZNF280C zinc finger protein 280C 1 1
MIRT439214 ZNF280B zinc finger protein 280B 1 1
MIRT439225 ZNF12 zinc finger protein 12 2 7
MIRT439256 ZBTB7A zinc finger and BTB domain containing 7A 2 3
MIRT439257 ZBTB6 zinc finger and BTB domain containing 6 1 1
MIRT439259 ZBTB4 zinc finger and BTB domain containing 4 2 7
MIRT439269 YOD1 YOD1 deubiquitinase 2 3
MIRT439286 WDR89 WD repeat domain 89 1 1
MIRT439291 WDR1 WD repeat domain 1 1 1
MIRT439295 VTI1A vesicle transport through interaction with t-SNAREs 1A 1 1
MIRT439300 VPS13C vacuolar protein sorting 13 homolog C 1 1
MIRT439306 VDAC1 voltage dependent anion channel 1 1 1
MIRT439319 UXS1 UDP-glucuronate decarboxylase 1 1 1
MIRT439327 USP32 ubiquitin specific peptidase 32 2 3
MIRT439332 USP28 ubiquitin specific peptidase 28 1 1
MIRT439337 USP16 ubiquitin specific peptidase 16 1 1
MIRT439349 UBR5 ubiquitin protein ligase E3 component n-recognin 5 1 1
MIRT439366 UBC ubiquitin C 1 1
MIRT439372 TWF1 twinfilin actin binding protein 1 1 1
MIRT439399 TOPORS TOP1 binding arginine/serine rich protein 1 1
MIRT439410 TNFRSF21 TNF receptor superfamily member 21 2 3
MIRT439416 TMX3 thioredoxin related transmembrane protein 3 1 1
MIRT439423 TMEM67 transmembrane protein 67 1 1
MIRT439427 TMEM64 transmembrane protein 64 2 3
MIRT439435 TMEM167A transmembrane protein 167A 1 1
MIRT439439 TMEM127 transmembrane protein 127 2 9
MIRT439440 TMEM123 transmembrane protein 123 1 1
MIRT439460 TGOLN2 trans-golgi network protein 2 1 1
MIRT439478 TCF4 transcription factor 4 3 1
MIRT439489 TADA2B transcriptional adaptor 2B 1 1
MIRT439512 STX6 syntaxin 6 1 1
MIRT439521 STK17B serine/threonine kinase 17b 1 1
MIRT439535 SSX2IP SSX family member 2 interacting protein 1 1
MIRT439537 SSH2 slingshot protein phosphatase 2 1 1
MIRT439566 SOD2 superoxide dismutase 2 2 3
MIRT439590 SLK STE20 like kinase 1 1
MIRT439594 SLC4A7 solute carrier family 4 member 7 1 1
MIRT439606 SLC35F5 solute carrier family 35 member F5 2 5
MIRT439620 SLC16A9 solute carrier family 16 member 9 1 1
MIRT439633 SIKE1 suppressor of IKBKE 1 1 1
MIRT439644 SGTB small glutamine rich tetratricopeptide repeat containing beta 2 3
MIRT439648 PEAK1 pseudopodium enriched atypical kinase 1 1 1
MIRT439654 SRSF2 serine and arginine rich splicing factor 2 2 5
MIRT439680 SENP1 SUMO1/sentrin specific peptidase 1 1 1
MIRT439688 SEC23A Sec23 homolog A, coat complex II component 1 1
MIRT439692 SEC16A SEC16 homolog A, endoplasmic reticulum export factor 1 1
MIRT439703 SCAMP2 secretory carrier membrane protein 2 2 3
MIRT439711 SAMD9L sterile alpha motif domain containing 9 like 1 1
MIRT439715 SACS sacsin molecular chaperone 1 1
MIRT439742 RPL17 ribosomal protein L17 1 1
MIRT439758 RNF216 ring finger protein 216 1 1
MIRT439776 RFXANK regulatory factor X associated ankyrin containing protein 1 1
MIRT439786 REEP5 receptor accessory protein 5 1 1
MIRT439809 RBBP7 RB binding protein 7, chromatin remodeling factor 1 1
MIRT439821 RAN RAN, member RAS oncogene family 2 9
MIRT439832 RABEP1 rabaptin, RAB GTPase binding effector protein 1 1 1
MIRT439837 RAB30 RAB30, member RAS oncogene family 1 1
MIRT439848 RAB11FIP1 RAB11 family interacting protein 1 2 5
MIRT439853 PURB purine rich element binding protein B 2 3
MIRT439863 PTPN4 protein tyrosine phosphatase, non-receptor type 4 2 9
MIRT439874 PTGES3 prostaglandin E synthase 3 1 1
MIRT439875 PTGER4 prostaglandin E receptor 4 1 1
MIRT439905 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT439910 PPP3R1 protein phosphatase 3 regulatory subunit B, alpha 1 1
MIRT439915 PPP1R3B protein phosphatase 1 regulatory subunit 3B 1 1
MIRT439933 POLQ DNA polymerase theta 1 1
MIRT439940 PNPLA4 patatin like phospholipase domain containing 4 1 1
MIRT439954 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT439959 PKMYT1 protein kinase, membrane associated tyrosine/threonine 1 1 1
MIRT439971 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT439977 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 1
MIRT439991 PGM2L1 phosphoglucomutase 2 like 1 1 1
MIRT440006 PDZD11 PDZ domain containing 11 1 1
MIRT440025 PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 1 1
MIRT440046 PANK3 pantothenate kinase 3 1 1
MIRT440068 NUP98 nucleoporin 98 1 1
MIRT440072 NUP35 nucleoporin 35 1 1
MIRT440093 NR2C2 nuclear receptor subfamily 2 group C member 2 2 7
MIRT440099 NPAT nuclear protein, coactivator of histone transcription 2 3
MIRT440112 NIPA1 non imprinted in Prader-Willi/Angelman syndrome 1 2 5
MIRT440138 NCAPD2 non-SMC condensin I complex subunit D2 1 1
MIRT440145 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT440158 N4BP1 NEDD4 binding protein 1 1 1
MIRT440170 MXI1 MAX interactor 1, dimerization protein 1 1
MIRT440208 MTF1 metal regulatory transcription factor 1 1 1
MIRT440233 MKRN1 makorin ring finger protein 1 1 1
MIRT440235 MKNK2 MAP kinase interacting serine/threonine kinase 2 2 7
MIRT440260 MECP2 methyl-CpG binding protein 2 2 3
MIRT440278 MAPK1 mitogen-activated protein kinase 1 2 5
MIRT440284 MAP3K2 mitogen-activated protein kinase kinase kinase 2 2 3
MIRT440286 MAP3K14 mitogen-activated protein kinase kinase kinase 14 1 1
MIRT440296 M6PR mannose-6-phosphate receptor, cation dependent 2 9
MIRT440318 LPGAT1 lysophosphatidylglycerol acyltransferase 1 1 1
MIRT440325 LIMA1 LIM domain and actin binding 1 2 5
MIRT440340 LAPTM4A lysosomal protein transmembrane 4 alpha 2 13
MIRT440346 LAMC1 laminin subunit gamma 1 1 1
MIRT440357 KLHL28 kelch like family member 28 2 9
MIRT440369 KIF23 kinesin family member 23 2 5
MIRT440386 CCSER2 coiled-coil serine rich protein 2 1 1
MIRT440388 ATG14 autophagy related 14 1 1
MIRT440391 EFCAB14 EF-hand calcium binding domain 14 2 3
MIRT440410 KATNAL1 katanin catalytic subunit A1 like 1 2 3
MIRT440417 ITPKB inositol-trisphosphate 3-kinase B 1 1
MIRT440427 ITCH itchy E3 ubiquitin protein ligase 1 1
MIRT440430 IQSEC1 IQ motif and Sec7 domain 1 1 1
MIRT440451 INPP5F inositol polyphosphate-5-phosphatase F 1 1
MIRT440469 IER3 immediate early response 3 1 1
MIRT440506 HIF1AN hypoxia inducible factor 1 alpha subunit inhibitor 1 1
MIRT440509 HAUS8 HAUS augmin like complex subunit 8 2 3
MIRT440520 HCP5 HLA complex P5 (non-protein coding) 1 1
MIRT440537 GPAM glycerol-3-phosphate acyltransferase, mitochondrial 1 1
MIRT440543 GOLGA1 golgin A1 1 1
MIRT440557 GNAS GNAS complex locus 1 1
MIRT440561 GLO1 glyoxalase I 2 3
MIRT440573 GIGYF1 GRB10 interacting GYF protein 1 2 9
MIRT440583 GBP3 guanylate binding protein 3 1 1
MIRT440590 GAK cyclin G associated kinase 1 1
MIRT440593 GABPB1 GA binding protein transcription factor beta subunit 1 2 3
MIRT440595 GABBR1 gamma-aminobutyric acid type B receptor subunit 1 1 1
MIRT440601 FYCO1 FYVE and coiled-coil domain containing 1 1 1
MIRT440609 FTSJD1 cap methyltransferase 2 1 1
MIRT440633 FMNL3 formin like 3 1 1
MIRT440646 FEM1C fem-1 homolog C 2 9
MIRT440653 FBXO48 F-box protein 48 1 1
MIRT440657 FBXO21 F-box protein 21 1 1
MIRT440660 FBXO10 F-box protein 10 1 1
MIRT440662 FBXL5 F-box and leucine rich repeat protein 5 2 13
MIRT440674 FAM83D family with sequence similarity 83 member D 1 1
MIRT440677 FAM57A family with sequence similarity 57 member A 1 1
MIRT440685 FAM129A family with sequence similarity 129 member A 2 7
MIRT440686 FAM126B family with sequence similarity 126 member B 2 3
MIRT440693 FAM102A family with sequence similarity 102 member A 1 1
MIRT440699 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT440703 ETF1 eukaryotic translation termination factor 1 1 1
MIRT440712 ERAP1 endoplasmic reticulum aminopeptidase 1 1 1
MIRT440720 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT440729 EIF5A2 eukaryotic translation initiation factor 5A2 1 1
MIRT440752 EEA1 early endosome antigen 1 1 1
MIRT440755 E2F2 E2F transcription factor 2 1 1
MIRT440759 DYNC1LI2 dynein cytoplasmic 1 light intermediate chain 2 2 3
MIRT440767 DUSP18 dual specificity phosphatase 18 1 1
MIRT440797 DNAJC27 DnaJ heat shock protein family (Hsp40) member C27 1 1
MIRT440826 DENND5B DENN domain containing 5B 1 1
MIRT440840 DDHD1 DDHD domain containing 1 1 1
MIRT440857 CTSS cathepsin S 1 1
MIRT440873 CRTC3 CREB regulated transcription coactivator 3 1 1
MIRT440876 CRK CRK proto-oncogene, adaptor protein 2 3
MIRT440886 CPOX coproporphyrinogen oxidase 1 1
MIRT440918 CNOT7 CCR4-NOT transcription complex subunit 7 1 1
MIRT440933 CLOCK clock circadian regulator 1 1
MIRT440941 CIT citron rho-interacting serine/threonine kinase 1 1
MIRT440943 CHURC1 churchill domain containing 1 1 1
MIRT440953 CFL2 cofilin 2 2 3
MIRT440954 CEP97 centrosomal protein 97 2 3
MIRT440976 CD47 CD47 molecule 1 1
MIRT440986 CCL1 C-C motif chemokine ligand 1 1 1
MIRT441010 CAPRIN2 caprin family member 2 2 5
MIRT441022 CAMK2N2 calcium/calmodulin dependent protein kinase II inhibitor 2 1 1
MIRT441030 TMEM245 transmembrane protein 245 1 1
MIRT441031 C9orf40 chromosome 9 open reading frame 40 2 7
MIRT441033 C7orf60 base methyltransferase of 25S rRNA 2 homolog 1 1
MIRT441036 C7orf43 chromosome 7 open reading frame 43 1 1
MIRT441043 C5orf28 transmembrane protein 267 1 1
MIRT441050 PRR14L proline rich 14 like 1 1
MIRT441055 SUCO SUN domain containing ossification factor 2 5
MIRT441057 C1orf63 arginine and serine rich protein 1 1 1
MIRT441073 FAM210A family with sequence similarity 210 member A 2 3
MIRT441080 ELMSAN1 ELM2 and Myb/SANT domain containing 1 1 1
MIRT441082 C14orf28 chromosome 14 open reading frame 28 1 1
MIRT441084 METTL21D valosin containing protein lysine methyltransferase 1 1
MIRT441088 C11orf30 EMSY, BRCA2 interacting transcriptional repressor 2 9
MIRT441094 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT441097 BTBD7 BTB domain containing 7 1 1
MIRT441126 BAGE5 BAGE family member 5 1 1
MIRT441138 ATXN1 ataxin 1 2 3
MIRT441150 ATP2B1 ATPase plasma membrane Ca2+ transporting 1 1 1
MIRT441164 ATG2B autophagy related 2B 1 1
MIRT441167 ATG2A autophagy related 2A 1 1
MIRT441187 ARL1 ADP ribosylation factor like GTPase 1 1 1
MIRT441189 ARID4B AT-rich interaction domain 4B 2 5
MIRT441201 ARHGAP1 Rho GTPase activating protein 1 2 7
MIRT441213 ARAP2 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 1 1
MIRT441217 AP1G1 adaptor related protein complex 1 gamma 1 subunit 1 1
MIRT441223 ANKRD52 ankyrin repeat domain 52 2 3
MIRT441227 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT441232 ANKFY1 ankyrin repeat and FYVE domain containing 1 1 1
MIRT441235 ALDH9A1 aldehyde dehydrogenase 9 family member A1 1 1
MIRT441239 AKTIP AKT interacting protein 1 1
MIRT441293 ACBD5 acyl-CoA binding domain containing 5 1 1
MIRT441296 ACAP2 ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 1 1
MIRT441312 ABCA1 ATP binding cassette subfamily A member 1 1 1
MIRT441316 AAK1 AP2 associated kinase 1 1 1
MIRT441880 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 2 2
MIRT442202 CCDC132 VPS50, EARP/GARPII complex subunit 2 2
MIRT442551 SLCO5A1 solute carrier organic anion transporter family member 5A1 2 2
MIRT442768 NRIP3 nuclear receptor interacting protein 3 2 2
MIRT442802 CEP170 centrosomal protein 170 2 4
MIRT443258 A1CF APOBEC1 complementation factor 2 2
MIRT443712 LLPH LLP homolog, long-term synaptic facilitation 2 2
MIRT444311 SREK1IP1 SREK1 interacting protein 1 2 2
MIRT444437 EMC1 ER membrane protein complex subunit 1 2 2
MIRT448315 WNK3 WNK lysine deficient protein kinase 3 2 2
MIRT448365 TSR1 TSR1, ribosome maturation factor 2 6
MIRT448645 NPNT nephronectin 2 2
MIRT448728 ITGA2 integrin subunit alpha 2 2 2
MIRT449173 SORCS2 sortilin related VPS10 domain containing receptor 2 2 2
MIRT450189 TMEM9B TMEM9 domain family member B 2 2
MIRT450915 CADM2 cell adhesion molecule 2 2 2
MIRT450954 ATAD2 ATPase family, AAA domain containing 2 2 2
MIRT458293 FUT10 fucosyltransferase 10 2 2
MIRT463554 ZBTB5 zinc finger and BTB domain containing 5 2 4
MIRT464847 RPS27A ribosomal protein S27a 2 12
MIRT465236 TRIP10 thyroid hormone receptor interactor 10 2 2
MIRT465539 PRICKLE4 prickle planar cell polarity protein 4 2 2
MIRT466455 TFAM transcription factor A, mitochondrial 2 8
MIRT467495 SMIM13 small integral membrane protein 13 2 6
MIRT467895 SLC22A23 solute carrier family 22 member 23 2 2
MIRT468161 SGPL1 sphingosine-1-phosphate lyase 1 2 2
MIRT468185 SGMS1 sphingomyelin synthase 1 2 2
MIRT469861 PXK PX domain containing serine/threonine kinase like 2 8
MIRT470052 PTGFRN prostaglandin F2 receptor inhibitor 2 2
MIRT471004 PITPNA phosphatidylinositol transfer protein alpha 2 2
MIRT472168 NIN ninein 2 4
MIRT472288 NFIB nuclear factor I B 2 4
MIRT473167 MLLT1 MLLT1, super elongation complex subunit 2 2
MIRT474598 KLF6 Kruppel like factor 6 2 2
MIRT475410 ICMT isoprenylcysteine carboxyl methyltransferase 2 4
MIRT475477 HSPA8 heat shock protein family A (Hsp70) member 8 2 6
MIRT476130 GPR157 G protein-coupled receptor 157 2 6
MIRT477116 FAM160B1 family with sequence similarity 160 member B1 2 6
MIRT477193 F3 coagulation factor III, tissue factor 2 8
MIRT477286 ERGIC2 ERGIC and golgi 2 2 2
MIRT478722 CSNK1A1 casein kinase 1 alpha 1 2 4
MIRT479040 COIL coilin 2 10
MIRT479064 CNOT6L CCR4-NOT transcription complex subunit 6 like 2 8
MIRT479268 CHSY1 chondroitin sulfate synthase 1 2 2
MIRT480567 BZW1 basic leucine zipper and W2 domains 1 2 2
MIRT480676 BSCL2 BSCL2, seipin lipid droplet biogenesis associated 2 2
MIRT480786 BMP2 bone morphogenetic protein 2 2 2
MIRT480953 BBX BBX, HMG-box containing 2 8
MIRT481882 ANKRD50 ankyrin repeat domain 50 2 2
MIRT482138 AKAP11 A-kinase anchoring protein 11 2 12
MIRT482477 ADAR adenosine deaminase, RNA specific 2 4
MIRT484868 ZNF70 zinc finger protein 70 2 4
MIRT484885 ZNF652 zinc finger protein 652 2 2
MIRT484922 ZFYVE26 zinc finger FYVE-type containing 26 2 4
MIRT485095 SLC30A1 solute carrier family 30 member 1 2 4
MIRT485193 PTP4A1 protein tyrosine phosphatase type IVA, member 1 2 4
MIRT485331 MYO1D myosin ID 2 2
MIRT485368 MYLIP myosin regulatory light chain interacting protein 2 12
MIRT485588 FOXQ1 forkhead box Q1 2 2
MIRT486029 LPAR2 lysophosphatidic acid receptor 2 2 2
MIRT486757 CNOT4 CCR4-NOT transcription complex subunit 4 2 6
MIRT489607 ZDHHC20 zinc finger DHHC-type containing 20 2 10
MIRT491660 PDRG1 p53 and DNA damage regulated 1 2 10
MIRT491807 ZFYVE21 zinc finger FYVE-type containing 21 2 8
MIRT492011 UGCG UDP-glucose ceramide glucosyltransferase 2 2
MIRT492377 SEMA7A semaphorin 7A (John Milton Hagen blood group) 2 2
MIRT492786 PDGFB platelet derived growth factor subunit B 2 2
MIRT493619 HMGB3 high mobility group box 3 2 6
MIRT494427 BTG2 BTG anti-proliferation factor 2 2 4
MIRT496064 MORC1 MORC family CW-type zinc finger 1 2 2
MIRT500724 TRIM37 tripartite motif containing 37 2 2
MIRT502008 MAP7 microtubule associated protein 7 2 8
MIRT503213 ACER2 alkaline ceramidase 2 2 2
MIRT503562 MDM2 MDM2 proto-oncogene 2 4
MIRT503610 ZNF780A zinc finger protein 780A 2 2
MIRT503829 TMEM242 transmembrane protein 242 2 4
MIRT503967 ZNF180 zinc finger protein 180 2 6
MIRT504566 ZNF417 zinc finger protein 417 2 6
MIRT504641 MFSD8 major facilitator superfamily domain containing 8 2 6
MIRT505060 ZNF202 zinc finger protein 202 2 6
MIRT505866 POLR1B RNA polymerase I subunit B 2 4
MIRT506282 PDPK1 3-phosphoinositide dependent protein kinase 1 2 2
MIRT506378 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 6
MIRT506458 NACC2 NACC family member 2 2 4
MIRT506547 MORF4L1 mortality factor 4 like 1 2 8
MIRT506622 MARCH6 membrane associated ring-CH-type finger 6 2 8
MIRT506685 LZIC leucine zipper and CTNNBIP1 domain containing 2 4
MIRT506873 KIAA1147 KIAA1147 2 2
MIRT506887 KIAA0101 PCNA clamp associated factor 2 4
MIRT506991 HNRNPR heterogeneous nuclear ribonucleoprotein R 2 2
MIRT507203 FZD9 frizzled class receptor 9 2 6
MIRT507440 ELK4 ELK4, ETS transcription factor 2 4
MIRT507947 BTF3L4 basic transcription factor 3 like 4 2 6
MIRT508576 CEP72 centrosomal protein 72 2 4
MIRT508745 ZNF682 zinc finger protein 682 2 4
MIRT508837 GPR155 G protein-coupled receptor 155 2 2
MIRT509130 BMP8B bone morphogenetic protein 8b 2 6
MIRT509745 EFCAB11 EF-hand calcium binding domain 11 2 4
MIRT510029 CRISPLD2 cysteine rich secretory protein LCCL domain containing 2 2 4
MIRT511267 KLHL36 kelch like family member 36 2 6
MIRT511320 KIAA1551 KIAA1551 2 2
MIRT511556 HMGB1 high mobility group box 1 2 6
MIRT512322 ACTR2 ARP2 actin related protein 2 homolog 2 6
MIRT513467 NARS asparaginyl-tRNA synthetase 2 6
MIRT513709 RBM20 RNA binding motif protein 20 2 4
MIRT513751 PKNOX1 PBX/knotted 1 homeobox 1 3 3
MIRT514101 EPS15L1 epidermal growth factor receptor pathway substrate 15 like 1 2 6
MIRT514137 SERF2 small EDRK-rich factor 2 2 2
MIRT514320 FXYD5 FXYD domain containing ion transport regulator 5 2 6
MIRT514998 DNTTIP2 deoxynucleotidyltransferase terminal interacting protein 2 2 2
MIRT515205 CRCP CGRP receptor component 2 2
MIRT515575 TMEM134 transmembrane protein 134 2 2
MIRT516060 MED18 mediator complex subunit 18 2 2
MIRT516559 MIXL1 Mix paired-like homeobox 2 2
MIRT516799 PTRF caveolae associated protein 1 2 4
MIRT517021 COX19 COX19, cytochrome c oxidase assembly factor 2 2
MIRT517187 SLC28A1 solute carrier family 28 member 1 2 2
MIRT517260 PRIM1 DNA primase subunit 1 2 4
MIRT518317 ZNF514 zinc finger protein 514 2 4
MIRT518468 KIF6 kinesin family member 6 2 2
MIRT518699 KCNMB1 potassium calcium-activated channel subfamily M regulatory beta subunit 1 2 2
MIRT518804 MED16 mediator complex subunit 16 2 4
MIRT518863 NEK8 NIMA related kinase 8 2 2
MIRT518972 GRK7 G protein-coupled receptor kinase 7 2 2
MIRT519432 KCNA7 potassium voltage-gated channel subfamily A member 7 2 4
MIRT519548 TMEM38A transmembrane protein 38A 2 2
MIRT520082 YIPF4 Yip1 domain family member 4 2 2
MIRT520156 WSB1 WD repeat and SOCS box containing 1 2 2
MIRT521010 SOCS5 suppressor of cytokine signaling 5 2 2
MIRT521304 RRAGD Ras related GTP binding D 2 4
MIRT521549 QSOX1 quiescin sulfhydryl oxidase 1 2 4
MIRT522172 NR2F6 nuclear receptor subfamily 2 group F member 6 2 4
MIRT522505 MFN1 mitofusin 1 2 2
MIRT523083 HYPK huntingtin interacting protein K 2 2
MIRT523654 FOXK1 forkhead box K1 2 4
MIRT524083 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT524251 DCTN6 dynactin subunit 6 2 2
MIRT524295 CYCS cytochrome c, somatic 2 2
MIRT524457 CNKSR3 CNKSR family member 3 2 2
MIRT524706 BTG3 BTG anti-proliferation factor 3 2 8
MIRT524984 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT525204 ZNF93 zinc finger protein 93 2 2
MIRT525488 TPK1 thiamin pyrophosphokinase 1 2 2
MIRT526639 NME6 NME/NM23 nucleoside diphosphate kinase 6 2 2
MIRT527206 XIRP2 xin actin binding repeat containing 2 2 2
MIRT527259 TMEM196 transmembrane protein 196 2 2
MIRT527474 CLEC12B C-type lectin domain family 12 member B 2 4
MIRT528374 ZMYM1 zinc finger MYM-type containing 1 2 4
MIRT530003 TNFAIP8L1 TNF alpha induced protein 8 like 1 2 4
MIRT530591 ABHD15 abhydrolase domain containing 15 2 2
MIRT530989 EXO5 exonuclease 5 2 4
MIRT531480 TNFRSF10B TNF receptor superfamily member 10b 2 4
MIRT531779 TXK TXK tyrosine kinase 2 4
MIRT531839 MTPAP mitochondrial poly(A) polymerase 2 4
MIRT532053 FHDC1 FH2 domain containing 1 2 2
MIRT532618 SPTLC2 serine palmitoyltransferase long chain base subunit 2 2 2
MIRT532922 ZNF385A zinc finger protein 385A 2 2
MIRT533881 TBL1XR1 transducin beta like 1 X-linked receptor 1 2 2
MIRT534008 SUV420H1 lysine methyltransferase 5B 2 2
MIRT534573 RPS6KA5 ribosomal protein S6 kinase A5 2 4
MIRT534631 RNASEH1 ribonuclease H1 2 4
MIRT535033 PRKAR1A protein kinase cAMP-dependent type I regulatory subunit alpha 2 2
MIRT536446 KMT2B lysine methyltransferase 2B 2 6
MIRT536503 KIAA0922 transmembrane 131 like 2 2
MIRT536542 KCNJ8 potassium voltage-gated channel subfamily J member 8 2 2
MIRT537450 FBXL7 F-box and leucine rich repeat protein 7 2 2
MIRT537742 ELAVL2 ELAV like RNA binding protein 2 2 2
MIRT538040 DNAJB6 DnaJ heat shock protein family (Hsp40) member B6 2 2
MIRT538070 DIAPH2 diaphanous related formin 2 2 2
MIRT539427 ADAT2 adenosine deaminase, tRNA specific 2 2 2
MIRT540278 FAM89A family with sequence similarity 89 member A 2 2
MIRT541093 RLIM ring finger protein, LIM domain interacting 2 2
MIRT542063 SLC25A46 solute carrier family 25 member 46 2 2
MIRT542145 DIS3L DIS3 like exosome 3'-5' exoribonuclease 2 2
MIRT542271 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT543188 FICD FIC domain containing 2 2
MIRT543511 PLS1 plastin 1 2 2
MIRT543583 RPF2 ribosome production factor 2 homolog 2 4
MIRT544632 CSDE1 cold shock domain containing E1 2 2
MIRT545206 HIST1H2BD histone cluster 1 H2B family member d 2 2
MIRT546299 TMEM200C transmembrane protein 200C 2 4
MIRT546694 RORA RAR related orphan receptor A 2 4
MIRT546827 RAP2C RAP2C, member of RAS oncogene family 2 2
MIRT547085 PLRG1 pleiotropic regulator 1 2 2
MIRT548324 EPHA4 EPH receptor A4 2 2
MIRT548396 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 2 4
MIRT548822 CLIC4 chloride intracellular channel 4 2 4
MIRT548867 CERCAM cerebral endothelial cell adhesion molecule 2 2
MIRT549113 C16orf70 chromosome 16 open reading frame 70 2 4
MIRT549826 LUZP2 leucine zipper protein 2 2 2
MIRT550097 TRAPPC2 trafficking protein particle complex 2 2 2
MIRT550308 ZNF681 zinc finger protein 681 2 2
MIRT551127 ZNF107 zinc finger protein 107 2 2
MIRT551748 FMNL2 formin like 2 2 2
MIRT552208 F2RL3 F2R like thrombin or trypsin receptor 3 2 2
MIRT552689 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 2 4
MIRT552869 WIPF2 WAS/WASL interacting protein family member 2 2 2
MIRT552899 WASL Wiskott-Aldrich syndrome like 2 4
MIRT553034 USP48 ubiquitin specific peptidase 48 2 2
MIRT553579 TMEM100 transmembrane protein 100 2 2
MIRT553705 TCF7L2 transcription factor 7 like 2 2 2
MIRT554416 SCD stearoyl-CoA desaturase 2 2
MIRT554485 SAMD12 sterile alpha motif domain containing 12 2 2
MIRT554558 RRN3 RRN3 homolog, RNA polymerase I transcription factor 2 2
MIRT554751 RHOC ras homolog family member C 2 2
MIRT555468 POLR3A RNA polymerase III subunit A 2 2
MIRT556188 MCC mutated in colorectal cancers 2 2
MIRT556596 LEPROT leptin receptor overlapping transcript 2 2
MIRT556908 ISOC1 isochorismatase domain containing 1 2 2
MIRT557037 HOXD11 homeobox D11 2 2
MIRT557596 GNPTAB N-acetylglucosamine-1-phosphate transferase alpha and beta subunits 2 2
MIRT557768 FRS2 fibroblast growth factor receptor substrate 2 2 2
MIRT557892 FEM1B fem-1 homolog B 2 4
MIRT558341 DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 2 4
MIRT558939 CBX1 chromobox 1 2 2
MIRT559442 ARSJ arylsulfatase family member J 2 2
MIRT561247 ZNF354B zinc finger protein 354B 2 2
MIRT561650 RUNX3 runt related transcription factor 3 2 2
MIRT562219 HMGB2 high mobility group box 2 2 2
MIRT562567 CCDC71L coiled-coil domain containing 71 like 2 4
MIRT562969 LRPAP1 LDL receptor related protein associated protein 1 2 2
MIRT563383 DSPP dentin sialophosphoprotein 2 2
MIRT564687 ZNF35 zinc finger protein 35 2 2
MIRT565704 SESN3 sestrin 3 2 2
MIRT566145 RACGAP1 Rac GTPase activating protein 1 2 2
MIRT566573 OTUD4 OTU deubiquitinase 4 2 2
MIRT566882 LRP12 LDL receptor related protein 12 2 2
MIRT567059 KCNB1 potassium voltage-gated channel subfamily B member 1 2 2
MIRT567117 ITGB1 integrin subunit beta 1 2 2
MIRT567547 FGFR1OP FGFR1 oncogene partner 2 2
MIRT567689 EIF4A2 eukaryotic translation initiation factor 4A2 2 2
MIRT567850 DCAF8 DDB1 and CUL4 associated factor 8 2 2
MIRT567996 COX6B1 cytochrome c oxidase subunit 6B1 2 2
MIRT568184 CCDC6 coiled-coil domain containing 6 2 2
MIRT568274 BICD2 BICD cargo adaptor 2 2 2
MIRT571019 CKAP2 cytoskeleton associated protein 2 2 2
MIRT571682 RRAS2 RAS related 2 2 2
MIRT571698 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 2
MIRT571728 RPL17-C18orf32 RPL17-C18orf32 readthrough 2 2
MIRT571863 NKIRAS1 NFKB inhibitor interacting Ras like 1 2 2
MIRT572213 C18orf32 chromosome 18 open reading frame 32 2 2
MIRT572680 AGMAT agmatinase 2 4
MIRT573920 SNAP47 synaptosome associated protein 47 2 2
MIRT575218 Piwil2 piwi-like RNA-mediated gene silencing 2 2 5
MIRT575993 Fem1a feminization 1 homolog a (C. elegans) 2 4
MIRT608372 PIWIL2 piwi like RNA-mediated gene silencing 2 2 7
MIRT608752 MYH9 myosin heavy chain 9 2 2
MIRT608978 PRKCB protein kinase C beta 2 2
MIRT611003 BRI3BP BRI3 binding protein 2 4
MIRT611840 FEM1A fem-1 homolog A 2 5
MIRT612615 RANGAP1 Ran GTPase activating protein 1 2 2
MIRT614267 WDR53 WD repeat domain 53 2 4
MIRT615180 SPIB Spi-B transcription factor 2 2
MIRT615451 FAXC failed axon connections homolog 2 2
MIRT616176 TCEB1 elongin C 2 2
MIRT619845 POLM DNA polymerase mu 2 4
MIRT620981 TM4SF5 transmembrane 4 L six family member 5 2 2
MIRT624428 CBX8 chromobox 8 2 2
MIRT625084 C15orf41 chromosome 15 open reading frame 41 2 2
MIRT626042 ATAT1 alpha tubulin acetyltransferase 1 2 4
MIRT626225 PNRC1 proline rich nuclear receptor coactivator 1 2 4
MIRT626934 HIST1H2BG histone cluster 1 H2B family member g 2 2
MIRT628569 MELK maternal embryonic leucine zipper kinase 2 2
MIRT633126 CBX5 chromobox 5 2 2
MIRT634102 APOH apolipoprotein H 2 2
MIRT634459 PAK6 p21 (RAC1) activated kinase 6 2 2
MIRT634650 HIP1 huntingtin interacting protein 1 2 2
MIRT634959 GTF2H2C GTF2H2 family member C 2 4
MIRT640014 OSTM1 osteopetrosis associated transmembrane protein 1 2 2
MIRT641710 SPCS1 signal peptidase complex subunit 1 2 2
MIRT645219 POLR3F RNA polymerase III subunit F 2 2
MIRT662411 ICA1L islet cell autoantigen 1 like 2 4
MIRT664232 LSM3 LSM3 homolog, U6 small nuclear RNA and mRNA degradation associated 2 2
MIRT664398 CYB5A cytochrome b5 type A 2 2
MIRT664798 LIAS lipoic acid synthetase 2 4
MIRT673138 MFSD2A major facilitator superfamily domain containing 2A 2 2
MIRT675843 DHODH dihydroorotate dehydrogenase (quinone) 2 4
MIRT677159 DEGS1 delta 4-desaturase, sphingolipid 1 2 2
MIRT677265 C15orf40 chromosome 15 open reading frame 40 2 2
MIRT678752 SRCAP Snf2 related CREBBP activator protein 2 2
MIRT680378 GATAD1 GATA zinc finger domain containing 1 2 4
MIRT680705 ZNF785 zinc finger protein 785 2 2
MIRT680783 WDR73 WD repeat domain 73 2 2
MIRT681415 RMND1 required for meiotic nuclear division 1 homolog 2 2
MIRT681709 ABI2 abl interactor 2 2 2
MIRT681845 N4BP2L2 NEDD4 binding protein 2 like 2 2 2
MIRT682336 RAB42 RAB42, member RAS oncogene family 2 2
MIRT683334 C19orf40 Fanconi anemia core complex associated protein 24 1 1
MIRT683404 ESR2 estrogen receptor 2 2 2
MIRT683508 ZNF7 zinc finger protein 7 2 2
MIRT683540 C11orf54 chromosome 11 open reading frame 54 2 2
MIRT683891 OCIAD1 OCIA domain containing 1 2 2
MIRT683964 MYLK3 myosin light chain kinase 3 2 2
MIRT683993 QRFPR pyroglutamylated RFamide peptide receptor 2 2
MIRT684096 TLR7 toll like receptor 7 2 2
MIRT684149 CEP104 centrosomal protein 104 2 2
MIRT684374 BCAS4 breast carcinoma amplified sequence 4 2 2
MIRT684590 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT684633 GTF2IRD2B GTF2I repeat domain containing 2B 2 2
MIRT684664 PDE4C phosphodiesterase 4C 2 2
MIRT684729 LRRD1 leucine rich repeats and death domain containing 1 2 2
MIRT684758 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 2 2
MIRT684803 MYO1F myosin IF 2 2
MIRT684935 CD28 CD28 molecule 2 2
MIRT685211 DCTN5 dynactin subunit 5 2 2
MIRT685264 F2RL1 F2R like trypsin receptor 1 2 2
MIRT685332 ASB16 ankyrin repeat and SOCS box containing 16 2 2
MIRT685367 CCL5 C-C motif chemokine ligand 5 2 2
MIRT685535 MSH3 mutS homolog 3 2 2
MIRT685594 KCNK6 potassium two pore domain channel subfamily K member 6 2 2
MIRT685725 BHMT2 betaine--homocysteine S-methyltransferase 2 2 2
MIRT685758 C12orf65 chromosome 12 open reading frame 65 2 2
MIRT685799 ZNF426 zinc finger protein 426 2 2
MIRT685971 PTGIS prostaglandin I2 synthase 2 2
MIRT686122 TNIP3 TNFAIP3 interacting protein 3 2 2
MIRT686172 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 2 2
MIRT686299 WWC1 WW and C2 domain containing 1 2 2
MIRT686337 VPS53 VPS53, GARP complex subunit 2 2
MIRT686460 LINC00598 long intergenic non-protein coding RNA 598 2 2
MIRT686504 TRIOBP TRIO and F-actin binding protein 2 2
MIRT686543 TRAF3IP2 TRAF3 interacting protein 2 2 2
MIRT686598 TMOD3 tropomodulin 3 2 2
MIRT686843 SLC7A11 solute carrier family 7 member 11 2 2
MIRT686896 SLC1A5 solute carrier family 1 member 5 2 2
MIRT686996 SERINC1 serine incorporator 1 2 2
MIRT687060 RNF115 ring finger protein 115 2 2
MIRT687095 RABGAP1L RAB GTPase activating protein 1 like 2 2
MIRT687270 PDHB pyruvate dehydrogenase E1 beta subunit 2 2
MIRT687666 LRIF1 ligand dependent nuclear receptor interacting factor 1 2 2
MIRT687874 ISCA2 iron-sulfur cluster assembly 2 2 2
MIRT687999 GTF2IRD2 GTF2I repeat domain containing 2 2 2
MIRT688139 GEMIN8 gem nuclear organelle associated protein 8 2 2
MIRT688233 FKBP14 FK506 binding protein 14 2 2
MIRT688291 FAM213A family with sequence similarity 213 member A 2 2
MIRT688473 DNAJB4 DnaJ heat shock protein family (Hsp40) member B4 2 2
MIRT688522 DDI2 DNA damage inducible 1 homolog 2 2 2
MIRT688682 CPT1A carnitine palmitoyltransferase 1A 2 2
MIRT688716 CPS1 carbamoyl-phosphate synthase 1 2 2
MIRT688846 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 2 2
MIRT689128 ZBTB25 zinc finger and BTB domain containing 25 2 2
MIRT689190 ZNF665 zinc finger protein 665 2 2
MIRT689815 GTF2H3 general transcription factor IIH subunit 3 2 2
MIRT689860 HIST1H2BJ histone cluster 1 H2B family member j 2 2
MIRT690755 IRAK4 interleukin 1 receptor associated kinase 4 2 2
MIRT691000 ZNF578 zinc finger protein 578 2 2
MIRT691092 NUGGC nuclear GTPase, germinal center associated 2 2
MIRT691349 KIAA1841 KIAA1841 2 2
MIRT691512 FOXRED2 FAD dependent oxidoreductase domain containing 2 2 2
MIRT691594 CCDC125 coiled-coil domain containing 125 2 2
MIRT691630 IPP intracisternal A particle-promoted polypeptide 2 2
MIRT692090 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT692127 CXorf38 chromosome X open reading frame 38 2 4
MIRT692336 RFK riboflavin kinase 2 2
MIRT692398 LY6G5B lymphocyte antigen 6 family member G5B 2 2
MIRT692459 METTL8 methyltransferase like 8 2 2
MIRT692562 PARD3 par-3 family cell polarity regulator 2 2
MIRT692623 GDF5OS growth differentiation factor 5 opposite strand 2 2
MIRT692804 SYNPO2L synaptopodin 2 like 2 2
MIRT692835 C1orf50 chromosome 1 open reading frame 50 2 2
MIRT692897 RBM41 RNA binding motif protein 41 2 2
MIRT693007 LGSN lengsin, lens protein with glutamine synthetase domain 2 2
MIRT693157 THEM4 thioesterase superfamily member 4 2 2
MIRT693368 RNF34 ring finger protein 34 2 2
MIRT694129 ZNF446 zinc finger protein 446 2 2
MIRT694213 ZNF347 zinc finger protein 347 2 2
MIRT694679 C14orf119 chromosome 14 open reading frame 119 2 2
MIRT694833 STX4 syntaxin 4 2 2
MIRT694955 ANKS4B ankyrin repeat and sterile alpha motif domain containing 4B 2 2
MIRT695199 SLC25A33 solute carrier family 25 member 33 2 2
MIRT695681 MAN2B2 mannosidase alpha class 2B member 2 2 2
MIRT695852 ABCG8 ATP binding cassette subfamily G member 8 2 2
MIRT695944 ZNF174 zinc finger protein 174 2 2
MIRT696202 GNB5 G protein subunit beta 5 2 2
MIRT696463 SUGP1 SURP and G-patch domain containing 1 2 2
MIRT696879 UBOX5 U-box domain containing 5 2 2
MIRT696926 C14orf105 coiled-coil domain containing 198 2 2
MIRT697265 ZYG11A zyg-11 family member A, cell cycle regulator 2 2
MIRT697410 ZMAT3 zinc finger matrin-type 3 2 2
MIRT698004 TSPAN6 tetraspanin 6 2 2
MIRT699290 SLC6A4 solute carrier family 6 member 4 2 2
MIRT699653 SH3BP5 SH3 domain binding protein 5 2 2
MIRT699715 SF3B3 splicing factor 3b subunit 3 2 2
MIRT700064 RPL14 ribosomal protein L14 2 2
MIRT700122 RNF19B ring finger protein 19B 2 2
MIRT701130 PAPD5 poly(A) RNA polymerase D5, non-canonical 2 2
MIRT701314 NUDT3 nudix hydrolase 3 2 2
MIRT701596 MYPN myopalladin 2 2
MIRT702396 KLF10 Kruppel like factor 10 2 2
MIRT702545 KCND3 potassium voltage-gated channel subfamily D member 3 2 2
MIRT703111 GPRIN3 GPRIN family member 3 2 2
MIRT704130 DRAXIN dorsal inhibitory axon guidance protein 2 2
MIRT704161 DNAL1 dynein axonemal light chain 1 2 2
MIRT704217 LDHD lactate dehydrogenase D 2 2
MIRT704783 CDKN2AIPNL CDKN2A interacting protein N-terminal like 2 2
MIRT705104 C4orf29 abhydrolase domain containing 18 2 2
MIRT705369 ATP1B3 ATPase Na+/K+ transporting subunit beta 3 2 2
MIRT706125 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 2 2
MIRT706295 SLC35F6 solute carrier family 35 member F6 2 2
MIRT706331 CCDC30 coiled-coil domain containing 30 2 2
MIRT706371 STAC2 SH3 and cysteine rich domain 2 2 2
MIRT706423 HAS2 hyaluronan synthase 2 2 2
MIRT706534 MTMR9 myotubularin related protein 9 2 2
MIRT707608 PCNXL2 pecanex homolog 2 2 2
MIRT707836 TMEM133 transmembrane protein 133 2 2
MIRT708390 CDIPT CDP-diacylglycerol--inositol 3-phosphatidyltransferase 2 2
MIRT708469 MAPKAPK5 mitogen-activated protein kinase-activated protein kinase 5 2 2
MIRT709092 FAHD1 fumarylacetoacetate hydrolase domain containing 1 2 2
MIRT709557 ZBED1 zinc finger BED-type containing 1 2 2
MIRT710425 YTHDC1 YTH domain containing 1 2 2
MIRT711789 RFXAP regulatory factor X associated protein 2 2
MIRT713354 KLRD1 killer cell lectin like receptor D1 2 2
MIRT714326 ZNF454 zinc finger protein 454 2 2
MIRT716560 GOLGA2 golgin A2 2 2
MIRT719091 ACOX1 acyl-CoA oxidase 1 2 2
MIRT725227 PEA15 phosphoprotein enriched in astrocytes 15 2 2
MIRT731268 RB1CC1 RB1 inducible coiled-coil 1 1 1
MIRT731837 NFKBIB NFKB inhibitor beta 3 1
MIRT732249 KIF26B kinesin family member 26B 3 1
MIRT734640 RPE ribulose-5-phosphate-3-epimerase 1 0
MIRT735000 AMER1 APC membrane recruitment protein 1 2 0
MIRT735533 ATG7 autophagy related 7 3 0
MIRT735792 BNIP1 BCL2 interacting protein 1 1 0
MIRT737333 ERBB3 erb-b2 receptor tyrosine kinase 3 4 0
MIRT737368 PRDM8 PR/SET domain 8 1 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-20a Cocaine NULL 446220 Quantitative real-time PCR monocyte derived dendritic cells 24391808 2014 down-regulated
miR-20a Curcumin NULL 969516 Microarray BxPC-3 human pancreatic carcinoma cell line 18347134 2008 down-regulated
miR-20a 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray Pancreatic Cancer PANC-1 cells 19407485 2009 up-regulated
miR-20a 5-aza-2'-deoxycytidine (5-Aza-CdR) + trichostatin A(TSA) NULL NULL Microarray Pancreatic Cancer PANC-1 cells 19407485 2009 up-regulated
miR-20a Trichostatin A (TSA) NULL 444732 Microarray Pancreatic Cancer PANC-1 cells 19407485 2009 up-regulated
miR-20a Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 down-regulated
miR-20a 5-Fluorouracil approved 3385 Microarray HCT-8 colon cancer cell line 19956872 2010 down-regulated
miR-20a Bisphenol A NULL 6623 Microarray immortalized cytotrophoblast cell lines HTR-8 20417706 2010 up-regulated
miR-20a 5-azacytidine (5-AzaC) approved 9444 Quantitative real-time PCR chronic myeloid leukemia (CML)K562 cell line 21176349 2011 down-regulated
miR-20a Oltipraz NULL 47318 Quantitative real-time PCR Colon cancer 22223846 2012 up-regulated
miR-20a Progesterone approved 5994 Microarray Breast cancer 22330642 2012 down-regulated
miR-20a Tamoxifen approved 2733526 Microarray rat liver 17343880 2007 up-regulated
miR-20a 17beta-estradiol (E2) approved 5757 Microarray rat breast 17700064 2007 up-regulated
miR-20a 17beta-estradiol (E2) approved 5757 Quantitative real-time PCR rat breast 17700064 2007 up-regulated
miR-20a Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse liver 19270793 2009 up-regulated
miR-20a Morphine approved 5288826 Microarray mouse cerebella 19854889 2010 down-regulated
miR-20a Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 down-regulated
miR-20a Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 up-regulated
miR-20a Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 down-regulated
miR-20a Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-20a Trenbolone acetate (TBA) + 17beta-estradiol (E2) NULL NULL Quantitative real-time PCR bovine liver 21212882 2011 down-regulated
miR-20a Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-20a Testosterone + 1,25-Dihydroxyvitamin D3 approved NULL Microarray prostate cancer 21592394 2011 down-regulated
miR-20a Marine fungal metabolite 1386A NULL NULL Microarray MCF-7 breast cancer cells. 22159329 2012 up-regulated
miR-20a Everolimus approved 6442177 Quantitative real-time PCR mouse prostate cancer cell line Myc-CaP 22087262 2011 up-regulated
miR-20a Panobinostat NULL 6918837 Quantitative real-time PCR mouse prostate cancer cell line Myc-CaP 22087262 2011 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-20a Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (BGC823)
hsa-mir-20a Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-miR-20a-5p -d-xylose 24203222 NSC727221 sensitive
hsa-miR-20a-5p (-)-dactylolide 11222845 NSC740028 sensitive
hsa-miR-20a-5p (1'R,3'S,3'aS,8'bS)-1',3'-diphenylspiro[1,3-dihydroindene-2,2'-3,3a,4,8b-tetrahydro-1H-cyclopenta[a]indene]-1,4'-diol 385850 NSC677249 sensitive
hsa-miR-20a-5p (1'S,2'S,11'R)-11'-phenylsulfanylspiro[1,3-dioxolane-2,10'-8-oxa-7-azatricyclo[7.4.0.02,7]tridecane]-13'-one 392646 NSC693225 sensitive
hsa-miR-20a-5p (1'S,8'R)-9',10'-dibromospiro[1,3-dithiolane-2,11'-tricyclo[6.3.1.02,7]dodeca-2,4,6,9-tetraene] 389921 NSC686573 sensitive
hsa-miR-20a-5p (1,1,3-trioxo-1,2-benzothiazol-2-yl)methyl 4-methylpiperazine-1-carbodithioate 16072473 NSC735181 sensitive
hsa-miR-20a-5p (10,13-dimethyl-3-oxo-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-17-yl) 3-methylidene-2-oxo-6-oxabicyclo[3.1.0]hexane-1-carboxylate 495432 NSC654893 sensitive
hsa-miR-20a-5p (10Z)-10-[bromo(iodo)methylidene]phenanthren-9-one 3005079 NSC670789 sensitive
hsa-miR-20a-5p (11E)-11-(3-aminopropylidene)-15,16-dimethoxy-20-methyl-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaen-19-one 9978660 NSC724562 sensitive
hsa-miR-20a-5p (11E)-11-(6-aminohexylidene)-15,16-dimethoxy-20-methyl-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaen-19-one 45027835 NSC727049 sensitive
hsa-miR-20a-5p (11E)-11-[2-(3-aminopropylamino)ethylidene]-15,16-dimethoxy-20-methyl-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaen-19-one 45027836 NSC727212 sensitive
hsa-miR-20a-5p (11E)-15,16-dimethoxy-20-methyl-11-[3-(methylamino)propylidene]-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaen-19-one 45027834 NSC727048 sensitive
hsa-miR-20a-5p (13r,17r)-13-methyl-17-[(2r)-6-methylheptan-2-yl]-5,6,9,10,11,12,14,15,16,17-decahydrocyclopenta[a]phenanthrene-1,4-dione 54613423 NSC750440 sensitive
hsa-miR-20a-5p (14r,15r)-15-methyl-14-[(2r)-6-methylheptan-2-yl]-2,7-diazatetracyclo[8.7.0.02,7.011,15]heptadeca-4,9-diene-3,6-dione 54613624 NSC750441 sensitive
hsa-miR-20a-5p (1E,3Z)-1-(benzotriazol-1-yl)-3,4-dichloro-N,N'-bis(4-ethoxyphenyl)-2-nitrobuta-1,3-diene-1,4-diamine 5470200 NSC698379 sensitive
hsa-miR-20a-5p (1r)-(-)-3-nitromethine-6-endo-acetoxycamphor 3004516 NSC657829 sensitive
hsa-miR-20a-5p (1R)-4-methyl-7-oxo-1,6-diphenyl-5,6-diazaspiro[2.4]hept-4-ene-2,2-dicarbonitrile 366094 NSC634353 sensitive
hsa-miR-20a-5p (1R,12S)-20-[2-(dimethylamino)ethyl]-15,16-dimethoxy-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-2,4(8),9,13,15,17-hexaene-11,19-dione 45027831 NSC726770 sensitive
hsa-miR-20a-5p (1R,2R,3E,7R,11E,13S,15S)-2,15-dihydroxy-7-(2-phenylmethoxyethyl)-6-oxabicyclo[11.3.0]hexadeca-3,11-dien-5-one 71763192 NSC757949 resistant
hsa-miR-20a-5p (1R,2S,7S,13R,15S)-2,15-bis[[tert-butyl(dimethyl)silyl]oxy]-3,4,11,12-tetrahydroxy-7-methyl-6-oxabicyclo[11.3.0]hexadecan-5-one 24202575 NSC694611 resistant
hsa-miR-20a-5p (1R,4S,5R,8S,12R,13R)-9-[[(E)-4-[[(1R,4S,5R,8S,12R,13R)-1,5-dimethyl-10-(trifluoromethyl)-11,14,15,16-tetraoxatetracyclo[10.3.1.04,13.08,13]hexadec-9-en-9-yl]methoxy]but-2-enoxy]methyl]-1,5-dimethyl-10-(trifluoromethyl)-11,14,15,16-tetraoxatetracyclo[10.3 54612586 NSC724781 sensitive
hsa-miR-20a-5p (1R,4S,5R,8S,12R,13R)-9-[2-[[(1R,4S,5R,8S,12R,13R)-1,5-dimethyl-10-(trifluoromethyl)-11,14,15,16-tetraoxatetracyclo[10.3.1.04,13.08,13]hexadec-9-en-9-yl]methoxy]ethoxymethyl]-1,5-dimethyl-10-(trifluoromethyl)-11,14,15,16-tetraoxatetracyclo[10.3.1.04,13.08 54612640 NSC724780 sensitive
hsa-miR-20a-5p (1R,5S,8E)-8-benzylidene-5-(3-hydroxyphenyl)-2-methyl-2-azabicyclo[3.3.1]nonan-7-one;perchloric acid 45489959 NSC678345 sensitive
hsa-miR-20a-5p (1S,10R,12R,14R,15S)-15-hydroxyspiro[13,16-dioxapentacyclo[8.5.1.01,10.03,8.012,14]hexadeca-3,5,7-triene-11,3'-2,4-dioxatricyclo[7.3.1.05,13]trideca-1(12),5,7,9(13),10-pentaene]-2,9-dione 388424 NSC683332 sensitive
hsa-miR-20a-5p (1s,2s,14r,22r)-23-(cyclopropylmethyl)-17-methyl-15-oxa-12,23-diazaheptacyclo[14.9.1.01,14.02,22.04,13.06,11.020,26]hexacosa-4,6,8,10,12,16,18,20(26)-octaen-2-ol;hydrochloride 5471391 NSC711014 sensitive
hsa-miR-20a-5p (1S,2S,4R,7Z,11S)-4,8-dimethyl-12-methylidene-3,14-dioxatricyclo[9.3.0.02,4]tetradec-7-ene-9,13-dione 5459262 NSC672120 sensitive
hsa-miR-20a-5p (1s,4s,6s,9r,11r,14r,15r)-14-hydroxy-4,9,14-trimethyl-18-methylidene-5,10,16-trioxatetracyclo[13.3.1.04,6.09,11]nonadecan-17-one 24205276 NSC734913 sensitive
hsa-miR-20a-5p (1Z)-2-anilino-N-[(5-carbamoyl-1H-imidazol-4-yl)amino]-2-oxoethanimidoyl cyanide 5466279 NSC683605 sensitive
hsa-miR-20a-5p (1Z)-N-[(5-carbamoyl-1H-imidazol-4-yl)amino]-2-(2-methylanilino)-2-oxoethanimidoyl cyanide 5466280 NSC683608 sensitive
hsa-miR-20a-5p (2-methoxyphenyl) (e)-3-(4-methoxyphenyl)prop-2-enoate 5928358 NSC700136 sensitive
hsa-miR-20a-5p (2-methoxyphenyl)(naphthalen-2-yl)methanone 246624 NSC59937 sensitive
hsa-miR-20a-5p (2-nitrophenyl)methyl (1s,5s,8z,12s,20r)-21-oxa-13-azapentacyclo[10.9.0.01,20.05,20.014,19]henicosa-8,14,16,18-tetraen-6,10-diyne-13-carboxylate 5469103 NSC683252 sensitive
hsa-miR-20a-5p (2,3-dihydroxyphenyl)-[1-[(4-fluorophenyl)methyl]-4-hydroxyindol-3-yl]methanone 42624812 NSC746053 sensitive
hsa-miR-20a-5p (2,4-dinitrophenyl)methyl carbamimidothioate;chloride 24183838 NSC30637 sensitive
hsa-miR-20a-5p (2e)-2-(1,3-benzodioxol-5-ylmethylidene)-5-(morpholin-4-ylmethyl)cyclopentan-1-one;hydrochloride 6516904 NSC639981 sensitive
hsa-miR-20a-5p (2E)-2-[(2-methoxyphenyl)methylidene]-5-(morpholin-4-ylmethyl)cyclopentan-1-one;hydrochloride 6516827 NSC639520 sensitive
hsa-miR-20a-5p (2E)-2-[(3,4-dichlorophenyl)methylidene]-6-[(dimethylamino)methyl]cyclohexan-1-one;hydrochloride 5468455 NSC670688 sensitive
hsa-miR-20a-5p (2E)-2-[(3,4-dimethoxyphenyl)methylidene]-5-[(dimethylamino)methyl]cyclopentan-1-one;hydrochloride 21141940 NSC639516 sensitive
hsa-miR-20a-5p (2E)-2-[(4-chlorophenyl)methylidene]-5-(morpholin-4-ylmethyl)cyclopentan-1-one;hydrochloride 50988453 NSC639517 sensitive
hsa-miR-20a-5p (2E)-2-[(4-hydroxyphenyl)methylidene]-6-(piperidin-1-ylmethyl)cyclohexan-1-one;hydrochloride 5469353 NSC687002 sensitive
hsa-miR-20a-5p (2E)-2-[(4-methoxyphenyl)methylidene]-5-(morpholin-4-ylmethyl)cyclopentan-1-one;hydrochloride 50988775 NSC639512 sensitive
hsa-miR-20a-5p (2E)-2-[(6aS)-11-oxo-7,9-dihydro-6aH-pyrrolo[2,1-c][1,4]benzodiazepin-8-ylidene]-N-[5-[[(2E)-2-[(6aS)-11-oxo-7,9-dihydro-6aH-pyrrolo[2,1-c][1,4]benzodiazepin-8-ylidene]acetyl]amino]pentyl]acetamide 5471190 NSC709362 sensitive
hsa-miR-20a-5p (2E)-2-[2-(4-bromophenyl)-2-oxoethylidene]-5-(2,4-dimethylphenyl)furan-3-one 5468713 NSC674919 sensitive
hsa-miR-20a-5p (2E)-2-[2-[4-(2-methylpropyl)phenyl]propylidene]-5-(morpholin-4-ylmethyl)cyclopentan-1-one;hydrochloride 21141970 NSC639976 sensitive
hsa-miR-20a-5p (2E)-2-[2-[4-(2-methylpropyl)phenyl]propylidene]-5-(piperidin-1-ylmethyl)cyclopentan-1-one;hydrochloride 54605003 NSC639978 sensitive
hsa-miR-20a-5p (2e)-2-[2-[4-(2-methylpropyl)phenyl]propylidene]-5-(pyrrolidin-1-ylmethyl)cyclopentan-1-one;hydrochloride 54608909 NSC639977 sensitive
hsa-miR-20a-5p (2e)-2-butylidene-5-[(dimethylamino)methyl]cyclopentan-1-one;hydrochloride 5467289 NSC649903 sensitive
hsa-miR-20a-5p (2E)-2-hexylidene-5-(morpholin-4-ylmethyl)cyclopentan-1-one;hydrochloride 21141930 NSC639503 sensitive
hsa-miR-20a-5p (2E)-2-pentylidene-5-(piperidin-1-ylmethyl)cyclopentan-1-one;hydrochloride 54608096 NSC639501 sensitive
hsa-miR-20a-5p (2e)-n-propyl-2-[1-(pyridin-2-yl)ethylidene]hydrazine-1-carbothioamide 5371176 NSC317908 sensitive
hsa-miR-20a-5p (2e,4e,6z,8e)-n-(1,3-benzodioxol-5-yl)-3,7-dimethyl-9-(2,6,6-trimethylcyclohexen-1-yl)nona-2,4,6,8-tetraenamide 24202490 NSC672131 sensitive
hsa-miR-20a-5p (2E,6E)-2-[[4-hydroxy-3-(piperidin-1-ylmethyl)phenyl]methylidene]-6-[(4-methoxyphenyl)methylidene]cyclohexan-1-one 5469358 NSC687006 sensitive
hsa-miR-20a-5p (2E,6E)-2-[[4-hydroxy-3-(piperidin-1-ylmethyl)phenyl]methylidene]-6-[(4-methylphenyl)methylidene]cyclohexan-1-one 5469357 NSC687005 sensitive
hsa-miR-20a-5p (2E,6E)-2,6-bis[(4-bromophenyl)methylidene]cyclohexan-1-one 5716584 NSC632831 sensitive
hsa-miR-20a-5p (2r,13r,17s,18s)-7-(4-fluorophenyl)-2,18-dimethyl-6,7,9-triazapentacyclo[11.7.0.02,10.04,8.014,18]icosa-4(8),5-dien-17-ol 376242 NSC656925 sensitive
hsa-miR-20a-5p (2r,6r)-9,11-dibromo-10-thia-3,5-diazatricyclo[6.3.0.02,6]undeca-1(11),8-diene-4,7-dione 400215 NSC711733 sensitive
hsa-miR-20a-5p (2r,6r)-9,11-dibromo-3-oxa-10-thia-5-azatricyclo[6.3.0.02,6]undeca-1(11),8-diene-4,7-dione 399280 NSC709969 sensitive
hsa-miR-20a-5p (2R,6R)-9,11-dibromo-4-sulfanylidene-3-oxa-10-thia-5-azatricyclo[6.3.0.02,6]undeca-1(11),8-dien-7-one 5471246 NSC709971 sensitive
hsa-miR-20a-5p (2R,6R)-9,11-dibromo-5-oxa-10-thia-3-azatricyclo[6.3.0.02,6]undeca-1(11),8-diene-4,7-dione 383027 NSC671009 sensitive
hsa-miR-20a-5p (2R,6R)-9,11-dichloro-3-oxa-10-thia-5-azatricyclo[6.3.0.02,6]undeca-1(11),8-diene-4,7-dione 400219 NSC711737 sensitive
hsa-miR-20a-5p (2s)-1-[(2-phenylmethoxynaphtho[1,2-f][1,3]benzodioxol-5-yl)methyl]piperidine-2-carboxylic acid 24205345 NSC735209 resistant
hsa-miR-20a-5p (2S)-2-[(E,2S)-2-hydroxy-4-oxo-6-phenylhex-5-enyl]-2,3-dihydropyran-6-one 5468230 NSC666388 sensitive
hsa-miR-20a-5p (2s)-2-[2,2-bis(4-chlorophenyl)ethyl]-2-(4-chlorophenyl)-1,3-thiazolidin-4-one 402438 NSC716408 sensitive
hsa-miR-20a-5p (2S,10R,11R,15R)-13-methyl-3-(trifluoromethylsulfonyl)-3,13,23-triazahexacyclo[14.7.0.02,10.04,9.011,15.017,22]tricosa-1(16),4,6,8,17,19,21-heptaene-12,14-dione 392225 NSC692358 sensitive
hsa-miR-20a-5p (2s,3s)-2-hydroxy-2-phenyl-3-p-tolylsulfenylbutanamide 381957 NSC669268 sensitive
hsa-miR-20a-5p (2s,3s,7as)-3-hydroxy-2-[(e)-prop-1-enyl]-2,3,7,7a-tetrahydrofuro[3,4-b]pyran-5-one 24202877 NSC726146 sensitive
hsa-miR-20a-5p (2z)-2-[(4-hydroxyphenyl)methylidene]-5-methoxy-1-benzofuran-3-one 54613041 NSC747169 sensitive
hsa-miR-20a-5p (2z)-2-[(4z)-3-chloro-4-hydroxyiminocyclohexa-2,5-dien-1-ylidene]-2-(4-chlorophenyl)acetonitrile 5715133 NSC102225 sensitive
hsa-miR-20a-5p (2z)-5-methoxy-2-[(3-phenacyloxyphenyl)methylidene]-1-benzofuran-3-one 45028682 NSC743694 sensitive
hsa-miR-20a-5p (2Z,6Z)-2,6-bis[[3-[(dimethylamino)methyl]-4-hydroxyphenyl]methylidene]cyclohexan-1-one 6067712 NSC683834 sensitive
hsa-miR-20a-5p (3-hydroxy-4-methoxyphenyl)-(7-methoxy-1,3-benzodioxol-5-yl)methanone 46949031 NSC758027 sensitive
hsa-miR-20a-5p (3,4,4-trichloro-2-nitro-1-phenylsulfanylbuta-1,3-dienyl)sulfanylbenzene 379911 NSC665103 sensitive
hsa-miR-20a-5p (3,7,7-trimethyl-5,14-dioxo-13-propan-2-yl-4-oxatricyclo[9.4.0.03,8]pentadeca-1(15),8,10,12-tetraen-15-yl) acetate 363975 NSC629595 sensitive
hsa-miR-20a-5p (3as,5r,9e,14s,15r,15ar)-5,15-dihydroxy-10,14-dimethyl-3,6-dimethylidene-4,5,7,8,11,12,13,14,15,15a-decahydro-3ah-cyclotetradeca[b]furan-2-one 5469905 NSC694075 sensitive
hsa-miR-20a-5p (3e)-3-[(2-chloro-1-phenylindol-3-yl)methylidene]-5-methoxy-6-methyl-1h-indol-2-one 5471471 NSC711611 sensitive
hsa-miR-20a-5p (3e)-3-[(2,6-dimethylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1-methylindol-2-one 24205817 NSC736793 sensitive
hsa-miR-20a-5p (3e)-3-[(2,6-dimethylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1h-indol-2-one 5471419 NSC711074 sensitive
hsa-miR-20a-5p (3e)-3-[(3,4-dihydroxyphenyl)methylidene]-6-phenylchromen-4-one 45029091 NSC745449 sensitive
hsa-miR-20a-5p (3E)-3-[[3-[1-(4-fluorophenyl)sulfonylpiperidin-4-yl]imidazo[1,5-a]pyridin-1-yl]methylidene]-1H-indol-2-one 54613720 NSC750970 resistant
hsa-miR-20a-5p (3e)-3-[[6-[(e)-(2-oxo-1h-indol-3-ylidene)methyl]pyridin-2-yl]methylidene]-1h-indol-2-one 5473214 NSC724448 sensitive
hsa-miR-20a-5p (3E)-3-[1-(4-chloroanilino)ethylidene]oxolan-2-one 820318 NSC680781 sensitive
hsa-miR-20a-5p (3e)-4-chloro-3-[(6-chloroimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1h-indol-2-one 5471415 NSC711070 resistant
hsa-miR-20a-5p (3e)-5-chloro-3-[(2,6-dimethylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1h-indol-2-one 5473339 NSC725098 sensitive
hsa-miR-20a-5p (3e)-5-methoxy-3-[(6-phenyl-2,3-dihydroimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1h-indol-2-one 5471411 NSC711066 sensitive
hsa-miR-20a-5p (3e)-7-chloro-4-hydroxy-1-oxido-3-(p-tolylimino)quinoxalin-1-ium-2-carbonitrile 135457335 NSC693867 sensitive
hsa-miR-20a-5p (3E,5E)-1-acetyl-3,5-dibenzylidenepiperidin-4-one 5387998 NSC630599 sensitive
hsa-miR-20a-5p (3E,5E)-1-methyl-3,5-bis[(2-nitrophenyl)methylidene]piperidin-4-one;hydrochloride 5468196 NSC666038 sensitive
hsa-miR-20a-5p (3E,5E)-3,5-bis[(3,4-dichlorophenyl)methylidene]-1-[3-(dimethylamino)propanoyl]piperidin-4-one;hydrochloride 5388808 NSC638645 sensitive
hsa-miR-20a-5p (3E,5E)-3,5-bis[[4-(dimethylamino)phenyl]methylidene]-1,1-dimethylpiperidin-1-ium-4-one;iodide 5386914 NSC618757 sensitive
hsa-miR-20a-5p (3E,5Z)-3,5-bis[(3,4-dimethoxyphenyl)methylidene]thian-4-one 6477009 NSC144310 sensitive
hsa-miR-20a-5p (3R,5R,8R,9S,10S,13R,14S,17R)-17-[(2R)-4-(4,5-dihydro-1H-imidazol-2-yl)butan-2-yl]-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-ol 391085 NSC689620 sensitive
hsa-miR-20a-5p (3S)-3-[(5R)-9-bromo-4-methoxy-6-methyl-7,8-dihydro-5H-[1,3]dioxolo[4,5-g]isoquinolin-5-yl]-6,7-dimethoxy-3H-2-benzofuran-1-one 10255081 NSC733397 sensitive
hsa-miR-20a-5p (3s,6s)-3,6-bis(5-bromo-1h-indol-3-yl)piperazine-2,5-dione 6712394 NSC679833 sensitive
hsa-miR-20a-5p (3S,6S,9aS)-3-[(dimethylamino)methyl]-6a-hydroxy-6,9a-dimethyl-3,3a,4,5,6,9b-hexahydroazuleno[8,7-b]furan-2,9-dione 362587 NSC626676 sensitive
hsa-miR-20a-5p (3s,8r,9s,10r,13s,14s,16e)-3-hydroxy-10,13-dimethyl-16-[(4-nitrophenyl)methylidene]-2,3,4,7,8,9,11,12,14,15-decahydro-1h-cyclopenta[a]phenanthren-17-one 5472098 NSC716261 resistant
hsa-miR-20a-5p (3z)-3-[(2-chlorophenyl)methylidene]-1-phenylimidazo[1,5-a]benzimidazole 5472492 NSC719480 resistant
hsa-miR-20a-5p (3z)-3-[(2,6-dimethylimidazo[2,1-b][1,3,4]thiadiazol-5-yl)methylidene]-1h-indol-2-one 24205829 NSC736811 sensitive
hsa-miR-20a-5p (3z)-3-[[3-[2-(4-chlorophenyl)-2-oxoethoxy]phenyl]methylidene]-6-methylthiochromen-4-one 45028771 NSC744076 sensitive
hsa-miR-20a-5p (3z)-3-[[3-[2-(4-methoxyphenyl)-2-oxoethoxy]phenyl]methylidene]-6-methylthiochromen-4-one 45028770 NSC744075 sensitive
hsa-miR-20a-5p (3z)-3-[hydroxy(phenyl)methylidene]-5,7-dimethyl-1,1-dioxo-2-[3-[4-[3-(trifluoromethyl)phenyl]piperazin-1-yl]propyl]pyrido[3,2-e]thiazin-4-one 5471800 NSC713759 sensitive
hsa-miR-20a-5p (3z)-5-chloro-3-[(2,6-dimethylimidazo[2,1-b][1,3,4]thiadiazol-5-yl)methylidene]-1h-indol-2-one 24205825 NSC736807 sensitive
hsa-miR-20a-5p (3z)-5-hydroxy-3-[(3,4,5-trimethoxyphenyl)methylidene]-1h-indol-2-one 24205822 NSC736802 sensitive
hsa-miR-20a-5p (3Z,5E)-3,5-bis[(4-methoxyphenyl)methylidene]piperidin-4-one 6477975 NSC632840 sensitive
hsa-miR-20a-5p (3Z,5E)-3,5-dibenzylidene-1-[(E)-3-phenylprop-2-enoyl]piperidin-4-one 5351375 NSC638634 sensitive
hsa-miR-20a-5p (3Z,5Z)-1,1-dimethyl-3,5-bis[(E)-3-phenylprop-2-enylidene]piperidin-1-ium-4-one 6334460 NSC636679 sensitive
hsa-miR-20a-5p (3z,5z)-3,5-bis[(4-methoxyphenyl)methylidene]-1,1-dimethylpiperidin-1-ium-4-one;iodide 54608638 NSC634792 sensitive
hsa-miR-20a-5p (3Z,5Z)-3,5-dibenzylidene-1-[3-(diethylamino)propanoyl]piperidin-4-one 6477769 NSC634785 sensitive
hsa-miR-20a-5p (3Z,5Z)-3,5-dibenzylidene-1-[3-(dimethylamino)propanoyl]piperidin-4-one 6477768 NSC634784 sensitive
hsa-miR-20a-5p (4-(1,3-dihydro-2h-pyrrolo[3,4-b]quinolin-2-ylcarbonyl)-2-oxotetrahydro-3-furanyl)methyl acetate 283490 NSC138333 sensitive
hsa-miR-20a-5p (4-chlorophenyl)-[5-(2,4-dichloro-5-fluorophenyl)-3-(3,4-dimethoxyphenyl)-5-hydroxy-4h-pyrazol-1-yl]methanone 400820 NSC713326 sensitive
hsa-miR-20a-5p (4-methoxyphenyl)-(3,4,5-trimethoxyphenyl)methanol 368140 NSC638483 sensitive
hsa-miR-20a-5p (4-methoxyphenyl)(2,3,4-trimethoxyphenyl)methanone 240478 NSC46683 sensitive
hsa-miR-20a-5p (4-methylphenyl) (3E,5E)-3,5-dibenzylidene-4-oxopiperidine-1-carboxylate 5388005 NSC630606 sensitive
hsa-miR-20a-5p (4-nitrophenyl) (3E,5E)-3,5-dibenzylidene-4-oxopiperidine-1-carboxylate 5388007 NSC630608 sensitive
hsa-miR-20a-5p (4-oxo-2-phenylchromen-8-yl)methyl carbamimidothioate 431425 NSC293046 sensitive
hsa-miR-20a-5p (4,4,11,11-tetramethyl-3,5,7,10,12-pentaoxatricyclo[7.3.0.02,6]dodecan-8-yl)methyl 2,2-diphenylacetate 359628 NSC620687 sensitive
hsa-miR-20a-5p (4aR,9aR)-9-(4-methylphenyl)sulfonyl-3,4,4a,9a-tetrahydrocarbazole 372866 NSC648556 sensitive
hsa-miR-20a-5p (4aS,4bR,10bS,12aS)-2-butyl-12a-methyl-8-(2-pyrrolidin-1-ylethoxy)-4,4a,4b,5,6,10b,11,12-octahydronaphtho[2,1-f]isoquinoline-1,3-dione 383426 NSC671765 sensitive
hsa-miR-20a-5p (4bS,9bS)-4b,9b-dimethyl-[1]benzoselenolo[3,2-b][1]benzoselenole 370235 NSC643004 sensitive
hsa-miR-20a-5p (4e)-2-hydroxy-4-[hydroxy(phenyl)methylidene]-1,5-bis(4-methoxyphenyl)-2-phenacylpyrrolidin-3-one 5471002 NSC707085 sensitive
hsa-miR-20a-5p (4e)-4-(3h-1,3-benzothiazol-2-ylidene)-1-[4-(difluoromethylsulfanyl)phenyl]-5-iminopyrrolidin-2-one 135543874 NSC744116 sensitive
hsa-miR-20a-5p (4e)-4-(3h-1,3-benzothiazol-2-ylidene)-5-imino-1-(3-methoxyphenyl)pyrrolidin-2-one 135892287 NSC744115 sensitive
hsa-miR-20a-5p (4r)-4-[(1r,4z,8e,10z,12s,15r,17r)-5,12-dimethyl-3-oxo-17-(2-phenylethoxy)-2,16-dioxabicyclo[13.3.1]nonadeca-4,8,10-trien-17-yl]-1,3-thiazolidin-2-one 46239554 NSC751494 resistant
hsa-miR-20a-5p (4s)-parectadial 23625545 NSC746540 sensitive
hsa-miR-20a-5p (4S,4aS,5aS,6S,12aR)-4-(dimethylamino)-1,6,10,11,12a-pentahydroxy-6-methyl-3,12-dioxo-N-[(6-sulfanylidene-3,7-dihydropurin-8-yl)methyl]-4,4a,5,5a-tetrahydrotetracene-2-carboxamide 54706004 NSC67588 sensitive
hsa-miR-20a-5p (4S,5R)-4-(2-methylpropyl)-3-[(1R)-1-phenylethyl]-5-phenylmethoxyoxathiazinane 2,2-dioxide 390837 NSC688895 sensitive
hsa-miR-20a-5p (4s,8s,12s,16s)-4,8,12,16-tetrabenzyl-1,9-bis(prop-2-enyl)-1,5,9,13-tetrazacyclohexadecane-2,6,10,14-tetrone 403842 NSC719376 sensitive
hsa-miR-20a-5p (4S,9aR)-4-(4-fluoroanilino)-9-(4-hydroxy-3,5-dimethoxyphenyl)-6,7-dimethoxy-3a,4,9,9a-tetrahydro-3H-benzo[f][2]benzofuran-1-one 369962 NSC642329 sensitive
hsa-miR-20a-5p (4z)-4-[(4-nitrophenyl)hydrazinylidene]pentanoic acid 6369925 NSC23936 sensitive
hsa-miR-20a-5p (4Z)-4-[[1-(3-chlorophenyl)-3-(4-methoxyphenyl)pyrazol-4-yl]methylidene]-5-imino-1-phenylpyrazol-3-amine 135276800 NSC763587 sensitive
hsa-miR-20a-5p (4z,5z)-1-[(e)-(2-hydroxyphenyl)methyleneamino]-3-phenyl-4,5-bis(phenylimino)imidazolidine-2-thione 135509182 NSC671409 resistant
hsa-miR-20a-5p (4Z,9Z,14Z)-2,2,7,7,12,12,17,17-octamethyl-21-oxabicyclo[16.2.1]henicosa-1(20),4,9,14,18-pentaene-3,6,8,11,13,16-hexone 5387611 NSC625154 sensitive
hsa-miR-20a-5p (5,11,12-triacetyloxy-1,8-dimethyl-4-tetracyclo[6.6.2.02,7.09,14]hexadeca-2,4,6,9,11,13-hexaenyl) acetate 361632 NSC624849 sensitive
hsa-miR-20a-5p (5,7-dibromo-8-hydroxy-3-methyl-2-quinolinyl)(phenyl)methanone 370210 NSC642954 sensitive
hsa-miR-20a-5p (5ar,6r,8ar)-6-(1,5-dimethylhexyl)-5a-methyl-2,3,4,5,6,7,8,8a-octahydro-1h-cyclopenta[b]azepine 403828