miRTarBase - #MIRT003784


—
pre-miRNA Information
pre-miRNA mmu-let-7b   
Genomic Coordinates chr15: 85707319 - 85707403
Synonyms Mirnlet7b, mmu-let-7b, Mirlet7b
Description Mus musculus let-7b stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-let-7b-5p
Sequence 7| UGAGGUAGUAGGUUGUGUGGUU |28
Evidence Experimental
Experiments Cloned
Putative Targets

Gene Information
Gene Symbol Bsg   
Synonyms AI115436, AI325119, CD147, EMMPRIN, HT-7
Description basigin
Transcript NM_001077184   
Other Transcripts NM_009768   
Expression
Putative miRNA Targets on Bsg
3'UTR of Bsg
(miRNA target sites are highlighted)		 
>Bsg|NM_001077184|3'UTR
   1 GTGGTGGGGCAGGCGGGGGAGGGGAGGTGCCCAGGGTGCCTGACCCCAGGCCAGCGTCTACCTCCACTCCAGTATCCCAT
  81 CCTGTCCCGATTTGAACCTACCCAACCCAACCTATCCCAACCCAAGTGAAGACAGAGCCTTACCTTACAGAAAACCCACC
 161 TGGAAGAAGCAAGCCACTTGCAGCCCCTGTTTCTAATTTAAACTAAATGAGGTTTCTATGCAGACAATCCATTCCTTAGG
 241 GGTTTATGTTTTTATTTTTCCTTCCCTTCTGAAGTGTTGTCACTACAGCCCTGTGGAGTGGGGGAATGGGGCCTTGTCCT
 321 TGGTCAGGAGGGAAGGCCAGTGCATGCTCTGACTTACTGTTGGAGGGGGCTGGGCCTGCTGGAACCCCCCCAAATAAAGA
 401 CCTACCCCACCATGTGTGTGTC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uuGGUGUGUUGGAUGAUGGAGu 5'
            ||| :| | |  ||||||| 
Target 5' ccCCAGGCCAGCGTCTACCTCc 3'
 44 - 65 156.00 -16.50
2 
miRNA  3' uuggUGUGUUGGAUGAUGGAGu 5'
              ||| |:||  :|||||: 
Target 5' gaagACAGAGCC--TTACCTTa 3'
 128 - 147 126.00 -15.50
3 
miRNA  3' uuGGUGUGUUGGAUGAUGGAGu 5'
            ||| |:||    ||||| | 
Target 5' ccCCAAATAAAGACCTACCCCa 3'
 388 - 409 124.00 -11.80
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Chi SW; Zang JB; Mele A; Darnell RB
- Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions B16-F10
Disease melanoma;
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... Let-7b targets the 3'UTR of Bsg ...

- Fu TY; Chang CC; Lin CT; Lai CH; Peng SY; et al., 2011, Experimental cell research.

Article - Fu TY; Chang CC; Lin CT; Lai CH; Peng SY; et al.
- Experimental cell research, 2011
Basigin (Bsg), also called extracellular matrix metalloproteinase inducer (EMMPRIN), is highly expressed on the surface of tumor cells and stimulates adjacent fibroblasts or tumor cells to produce matrix metalloproteinases (mmps). It has been shown that Bsg plays an important role in growth, development, cell differentiation, and tumor progression. MicroRNAs (miRNAs) are a class of short endogenous non-protein coding RNAs of 20-25 nucleotides (nt) that function as post-transcriptional regulators of gene expression by base-pairing to their target mRNAs and thereby mediate cleavage of target mRNAs or translational repression. In this study, let-7b, one of the let-7 family members, was investigated for its effect on the growth and invasiveness of the mouse melanoma cell line B16-F10. We have shown that let-7b can suppress the expression of Bsg in B16-F10 cells and also provided evidence that this suppression could result in the indirect suppression of mmp-9. The ability of B16-F10 cells transfected with let-7b to invade or migrate was significantly reduced. In addition, let-7b transfected B16-F10 cells displayed an inhibition of both cellular proliferation and colony formation. Furthermore, it was shown that the overexpression of let-7b in B16-F10 cells could reduce lung metastasis. Taken together, the present study identifies let-7b as a tumor suppressor that represses cancer cell proliferation and migration as well as tumor metastasis in mouse melanoma cells.
LinkOut: [PMID: 21087605]
353 mmu-let-7b-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001730 Mtpn myotrophin 3 1
MIRT001731 Rpia ribose 5-phosphate isomerase A 1 1
MIRT001732 Actg1 actin, gamma, cytoplasmic 1 1 1
MIRT003784 Bsg basigin 4 2
MIRT011986 Slc29a3 solute carrier family 29 (nucleoside transporters), member 3 1 1
MIRT011987 Maneal mannosidase, endo-alpha-like 1 1
MIRT011988 Pld3 phospholipase D family, member 3 1 1
MIRT011989 Ddx10 DEAD (Asp-Glu-Ala-Asp) box polypeptide 10 1 1
MIRT011990 Scara3 scavenger receptor class A, member 3 1 1
MIRT011991 Epb4.1l5 erythrocyte membrane protein band 4.1 like 5 1 1
MIRT011992 Zfp109 zinc finger protein 109 1 1
MIRT011993 4933411K20Rik cilia and flagella associated protein 97 1 1
MIRT011994 Slc2a6 solute carrier family 2 (facilitated glucose transporter), member 6 1 1
MIRT011995 Homer1 homer scaffolding protein 1 1 1
MIRT011996 Zfp9 zinc finger protein 9 1 1
MIRT011997 Srcin1 SRC kinase signaling inhibitor 1 1 1
MIRT011998 Lfng LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase 1 1
MIRT011999 4931428F04Rik RIKEN cDNA 4931428F04 gene 1 1
MIRT012000 E2f3 E2F transcription factor 3 1 1
MIRT012001 Tug1 taurine upregulated gene 1 1 1
MIRT012002 Lsamp limbic system-associated membrane protein 1 1
MIRT012003 Cald1 caldesmon 1 1 1
MIRT012004 Eif2ak3 eukaryotic translation initiation factor 2 alpha kinase 3 1 1
MIRT012005 Egln2 egl-9 family hypoxia-inducible factor 2 1 1
MIRT012006 Gtf3c2 general transcription factor IIIC, polypeptide 2, beta 1 1
MIRT012007 Tor1aip2 torsin A interacting protein 2 1 1
MIRT012008 Gad1 glutamate decarboxylase 1 1 1
MIRT012009 Kpna1 karyopherin (importin) alpha 1 1 1
MIRT012010 Prdm1 PR domain containing 1, with ZNF domain 1 1
MIRT012011 Ankrd52 ankyrin repeat domain 52 1 1
MIRT012012 Slc25a18 solute carrier family 25 (mitochondrial carrier), member 18 1 1
MIRT012013 Msi2 musashi RNA-binding protein 2 1 2
MIRT012014 Otud5 OTU domain containing 5 1 1
MIRT012015 Gns glucosamine (N-acetyl)-6-sulfatase 1 1
MIRT012016 Kcnc2 potassium voltage gated channel, Shaw-related subfamily, member 2 1 1
MIRT012017 Slc2a3 solute carrier family 2 (facilitated glucose transporter), member 3 1 1
MIRT012018 Ssh1 slingshot homolog 1 (Drosophila) 1 1
MIRT012019 Nova1 neuro-oncological ventral antigen 1 1 1
MIRT012020 Scn8a sodium channel, voltage-gated, type VIII, alpha 1 1
MIRT012021 Gga3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT012022 Zfp462 zinc finger protein 462 1 1
MIRT012023 Col4a2 collagen, type IV, alpha 2 1 1
MIRT012024 Cpeb4 cytoplasmic polyadenylation element binding protein 4 1 1
MIRT012025 Sema4g sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G 1 1
MIRT012026 Stx17 syntaxin 17 1 1
MIRT012027 Dusp1 dual specificity phosphatase 1 1 1
MIRT012028 Slco5a1 solute carrier organic anion transporter family, member 5A1 1 1
MIRT012029 Fndc3a fibronectin type III domain containing 3A 1 1
MIRT012030 Trim6 tripartite motif-containing 6 1 1
MIRT012031 Igdcc3 immunoglobulin superfamily, DCC subclass, member 3 1 1
MIRT012032 Fras1 Fraser extracellular matrix complex subunit 1 1 1
MIRT012033 Msra methionine sulfoxide reductase A 1 1
MIRT012034 Slitrk5 SLIT and NTRK-like family, member 5 1 1
MIRT012035 Hoxb4 homeobox B4 1 1
MIRT012036 Slc35a4 solute carrier family 35, member A4 1 1
MIRT012037 2700081O15Rik RIKEN cDNA 2700081O15 gene 1 1
MIRT012038 Zeb2 zinc finger E-box binding homeobox 2 1 1
MIRT012039 Ylpm1 YLP motif containing 1 1 1
MIRT012040 Unc80 unc-80, NALCN activator 1 1
MIRT012041 Gabrb2 gamma-aminobutyric acid (GABA) A receptor, subunit beta 2 1 1
MIRT012042 Pbrm1 polybromo 1 1 1
MIRT012043 Itsn2 intersectin 2 1 1
MIRT012044 Tbc1d24 TBC1 domain family, member 24 1 1
MIRT012045 Flywch1 FLYWCH-type zinc finger 1 1 1
MIRT012046 Smg1 SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans) 1 1
MIRT012047 Kifc2 kinesin family member C2 1 1
MIRT012048 Elp2 elongator acetyltransferase complex subunit 2 1 1
MIRT012049 Jph4 junctophilin 4 1 1
MIRT012050 Car2 carbonic anhydrase 2 1 1
MIRT012051 Tubb4a tubulin, beta 4A class IVA 1 1
MIRT012052 Eif4ebp2 eukaryotic translation initiation factor 4E binding protein 2 1 1
MIRT012053 Adra2a adrenergic receptor, alpha 2a 1 1
MIRT012054 Reep4 receptor accessory protein 4 1 1
MIRT012055 Cdr2l cerebellar degeneration-related protein 2-like 1 1
MIRT012056 Ikbkg inhibitor of kappaB kinase gamma 1 1
MIRT012057 Cnr1 cannabinoid receptor 1 (brain) 1 1
MIRT012058 Slc9a2 solute carrier family 9 (sodium/hydrogen exchanger), member 2 1 1
MIRT012059 Pigw phosphatidylinositol glycan anchor biosynthesis, class W 1 1
MIRT012060 Slc24a2 solute carrier family 24 (sodium/potassium/calcium exchanger), member 2 1 1
MIRT012061 Zfp12 zinc finger protein 12 1 1
MIRT012062 Rbm33 RNA binding motif protein 33 1 1
MIRT012063 Tbc1d14 TBC1 domain family, member 14 1 1
MIRT012064 Atp2b2 ATPase, Ca++ transporting, plasma membrane 2 1 2
MIRT012065 Slc23a2 solute carrier family 23 (nucleobase transporters), member 2 1 1
MIRT012066 Ppm1e protein phosphatase 1E (PP2C domain containing) 1 1
MIRT012067 Slc15a2 solute carrier family 15 (H+/peptide transporter), member 2 1 1
MIRT012068 1700052N19Rik acidic residue methyltransferase 1 1 1
MIRT012069 Zfp664 zinc finger protein 664 1 1
MIRT012070 Patl1 protein associated with topoisomerase II homolog 1 (yeast) 1 1
MIRT012071 Itga4 integrin alpha 4 1 1
MIRT012072 Jam2 junction adhesion molecule 2 1 1
MIRT012073 Ppp3r1 protein phosphatase 3, regulatory subunit B, alpha isoform (calcineurin B, type I) 1 1
MIRT012074 Ptpru protein tyrosine phosphatase, receptor type, U 1 1
MIRT012075 Acn9 succinate dehydrogenase complex assembly factor 3 1 1
MIRT012076 Mtmr4 myotubularin related protein 4 1 1
MIRT012077 Ephb3 Eph receptor B3 1 1
MIRT012078 Syn3 synapsin III 1 1
MIRT012079 Bahcc1 BAH domain and coiled-coil containing 1 1 1
MIRT012080 Sned1 sushi, nidogen and EGF-like domains 1 1 1
MIRT012081 Fgd4 FYVE, RhoGEF and PH domain containing 4 1 1
MIRT012082 Hdgfrp3 HDGF like 3 1 1
MIRT012083 Crk v-crk avian sarcoma virus CT10 oncogene homolog 1 1
MIRT012084 Chd9 chromodomain helicase DNA binding protein 9 1 1
MIRT012085 Lnp lunapark, ER junction formation factor 1 1
MIRT012086 Tmed5 transmembrane p24 trafficking protein 5 1 1
MIRT012087 Dip2b disco interacting protein 2 homolog B 1 1
MIRT012088 Smcr8 Smith-Magenis syndrome chromosome region, candidate 8 homolog (human) 1 1
MIRT012089 Cd164 CD164 antigen 1 1
MIRT012090 Slc4a7 solute carrier family 4, sodium bicarbonate cotransporter, member 7 1 1
MIRT012091 Zc3h11a zinc finger CCCH type containing 11A 1 1
MIRT012092 Srgap3 SLIT-ROBO Rho GTPase activating protein 3 1 1
MIRT012093 Fut9 fucosyltransferase 9 1 1
MIRT012094 Trib2 tribbles pseudokinase 2 1 1
MIRT012095 Apba1 amyloid beta (A4) precursor protein binding, family A, member 1 1 1
MIRT012096 Arl5a ADP-ribosylation factor-like 5A 1 1
MIRT012097 Ttc14 tetratricopeptide repeat domain 14 1 1
MIRT012098 Donson downstream neighbor of SON 1 1
MIRT012099 Slc8a2 solute carrier family 8 (sodium/calcium exchanger), member 2 1 1
MIRT012100 Fam118a family with sequence similarity 118, member A 1 1
MIRT012101 Ddn dendrin 1 1
MIRT012102 Usp32 ubiquitin specific peptidase 32 1 1
MIRT012103 Flna filamin, alpha 1 1
MIRT012104 Pik3ip1 phosphoinositide-3-kinase interacting protein 1 1 1
MIRT012105 Pgrmc1 progesterone receptor membrane component 1 1 1
MIRT012106 Acvr1b activin A receptor, type 1B 1 1
MIRT012107 Fnip2 folliculin interacting protein 2 1 1
MIRT012108 Arpp19 cAMP-regulated phosphoprotein 19 1 1
MIRT012109 1600012H06Rik RIKEN cDNA 1600012H06 gene 1 1
MIRT012110 Adipor2 adiponectin receptor 2 1 1
MIRT012111 Chd7 chromodomain helicase DNA binding protein 7 1 1
MIRT012112 Lcor ligand dependent nuclear receptor corepressor 1 1
MIRT012113 Gabra6 gamma-aminobutyric acid (GABA) A receptor, subunit alpha 6 1 1
MIRT012114 Dnajc1 DnaJ heat shock protein family (Hsp40) member C1 1 1
MIRT012115 Epha4 Eph receptor A4 1 1
MIRT012116 Snx30 sorting nexin family member 30 1 1
MIRT012117 Ptprd protein tyrosine phosphatase, receptor type, D 1 1
MIRT012118 Kctd21 potassium channel tetramerisation domain containing 21 1 1
MIRT012119 Xkr8 X-linked Kx blood group related 8 1 1
MIRT012120 Ppargc1b peroxisome proliferative activated receptor, gamma, coactivator 1 beta 1 1
MIRT012121 Ercc6 excision repair cross-complementing rodent repair deficiency, complementation group 6 1 1
MIRT012122 Greb1l growth regulation by estrogen in breast cancer-like 1 1
MIRT012123 Igdcc4 immunoglobulin superfamily, DCC subclass, member 4 1 1
MIRT012124 Frmd5 FERM domain containing 5 1 1
MIRT012125 1700017B05Rik RIKEN cDNA 1700017B05 gene 1 1
MIRT012126 Sowaha sosondowah ankyrin repeat domain family member A 1 1
MIRT012127 Zfp583 zinc finger protein 583 1 1
MIRT012128 4931406C07Rik RIKEN cDNA 4931406C07 gene 1 1
MIRT012129 Zfp174 zinc finger protein 174 1 1
MIRT012130 Wnk1 WNK lysine deficient protein kinase 1 1 1
MIRT012131 Kctd7 potassium channel tetramerisation domain containing 7 1 1
MIRT012132 Nf2 neurofibromin 2 1 3
MIRT012133 2700089E24Rik small integral membrane protein 10 like 1 1 1
MIRT012134 Celf5 CUGBP, Elav-like family member 5 1 1
MIRT012135 Rffl ring finger and FYVE like domain containing protein 1 1
MIRT012136 Limd1 LIM domains containing 1 1 1
MIRT012137 Akt1 thymoma viral proto-oncogene 1 1 1
MIRT012138 Atp6v1b2 ATPase, H+ transporting, lysosomal V1 subunit B2 1 1
MIRT012139 Ptgds prostaglandin D2 synthase (brain) 1 1
MIRT012140 Ncor1 nuclear receptor co-repressor 1 1 1
MIRT012141 Kif1a kinesin family member 1A 1 1
MIRT012142 Sacm1l SAC1 suppressor of actin mutations 1-like (yeast) 1 1
MIRT012143 Mast2 microtubule associated serine/threonine kinase 2 1 1
MIRT012144 Arrdc3 arrestin domain containing 3 1 1
MIRT012145 Trps1 transcriptional repressor GATA binding 1 1 1
MIRT012146 Prickle1 prickle planar cell polarity protein 1 1 1
MIRT012147 Nup35 nucleoporin 35 1 1
MIRT012148 Chd3 chromodomain helicase DNA binding protein 3 1 1
MIRT012149 Wdtc1 WD and tetratricopeptide repeats 1 1 1
MIRT012150 Fmn2 formin 2 1 1
MIRT012151 Sptbn2 spectrin beta, non-erythrocytic 2 1 1
MIRT012152 Rock2 Rho-associated coiled-coil containing protein kinase 2 1 1
MIRT012153 Usp45 ubiquitin specific petidase 45 1 1
MIRT012154 Braf Braf transforming gene 1 1
MIRT012155 Dnhd1 dynein heavy chain domain 1 1 1
MIRT012156 Arpp21 cyclic AMP-regulated phosphoprotein, 21 1 1
MIRT012157 Ccnd1 cyclin D1 1 1
MIRT012158 Slc4a8 solute carrier family 4 (anion exchanger), member 8 1 1
MIRT012159 Stim1 stromal interaction molecule 1 1 1
MIRT012160 Cat catalase 1 1
MIRT012161 Synj1 synaptojanin 1 1 1
MIRT012162 Cadm2 cell adhesion molecule 2 1 1
MIRT012163 Knop1 lysine rich nucleolar protein 1 1 1
MIRT012164 Tram1l1 translocation associated membrane protein 1-like 1 1 1
MIRT012165 Gpr137 G protein-coupled receptor 137 1 1
MIRT012166 Nfxl1 nuclear transcription factor, X-box binding-like 1 1 1
MIRT012167 Csrnp2 cysteine-serine-rich nuclear protein 2 1 1
MIRT012168 Nid1 nidogen 1 1 1
MIRT012169 Gnal guanine nucleotide binding protein, alpha stimulating, olfactory type 1 1
MIRT012170 Slc22a6 solute carrier family 22 (organic anion transporter), member 6 1 1
MIRT012171 Epb4.1l1 erythrocyte membrane protein band 4.1 like 1 1 1
MIRT012172 Ctsb cathepsin B 1 1
MIRT012173 Zfp740 zinc finger protein 740 1 1
MIRT012174 Kcnc1 potassium voltage gated channel, Shaw-related subfamily, member 1 1 1
MIRT012175 Rdh10 retinol dehydrogenase 10 (all-trans) 1 1
MIRT012176 Ubxn4 UBX domain protein 4 1 1
MIRT012177 Rnf213 ring finger protein 213 1 1
MIRT012178 Ppme1 protein phosphatase methylesterase 1 1 1
MIRT012179 Nrp2 neuropilin 2 1 1
MIRT012180 Mnt max binding protein 1 1
MIRT012181 Gramd1b GRAM domain containing 1B 1 1
MIRT012182 Cacna1e calcium channel, voltage-dependent, R type, alpha 1E subunit 1 1
MIRT012183 Mex3a mex3 RNA binding family member A 1 1
MIRT012184 Piga phosphatidylinositol glycan anchor biosynthesis, class A 1 1
MIRT012185 AI464131 expressed sequence AI464131 1 1
MIRT012186 Tenm2 teneurin transmembrane protein 2 1 1
MIRT012187 Nlk nemo like kinase 1 1
MIRT012188 Cep120 centrosomal protein 120 1 1
MIRT012189 Vsnl1 visinin-like 1 1 1
MIRT012190 Kctd12b potassium channel tetramerisation domain containing 12b 1 1
MIRT012191 Igf1r insulin-like growth factor I receptor 1 1
MIRT012192 Grik2 glutamate receptor, ionotropic, kainate 2 (beta 2) 1 1
MIRT012193 Abcg1 ATP-binding cassette, sub-family G (WHITE), member 1 1 1
MIRT012194 Zfp318 zinc finger protein 318 1 1
MIRT012195 Eea1 early endosome antigen 1 1 1
MIRT012196 Rnf167 ring finger protein 167 1 1
MIRT012197 Ccdc127 coiled-coil domain containing 127 1 1
MIRT012198 Zfp248 zinc finger protein 248 1 1
MIRT012199 Dmd dystrophin, muscular dystrophy 1 1
MIRT012200 Srek1 splicing regulatory glutamine/lysine-rich protein 1 1 1
MIRT012201 Agap1 ArfGAP with GTPase domain, ankyrin repeat and PH domain 1 1 1
MIRT012202 Sec14l1 SEC14-like lipid binding 1 1 1
MIRT012203 Cbx5 chromobox 5 1 1
MIRT012204 Serf2 small EDRK-rich factor 2 1 1
MIRT012205 Pxdn peroxidasin 1 1
MIRT012206 Arid3b AT rich interactive domain 3B (BRIGHT-like) 1 1
MIRT012207 Ago3 argonaute RISC catalytic subunit 3 1 1
MIRT012208 Khsrp KH-type splicing regulatory protein 1 1
MIRT012209 Slc22a23 solute carrier family 22, member 23 1 1
MIRT012210 Atp2a2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1 1
MIRT012211 Tmem194 nuclear envelope integral membrane protein 1 1 1
MIRT012212 Mtf2 metal response element binding transcription factor 2 1 1
MIRT012213 Rdx radixin 1 1
MIRT012214 Abcc5 ATP-binding cassette, sub-family C (CFTR/MRP), member 5 1 1
MIRT012215 Zswim5 zinc finger SWIM-type containing 5 1 1
MIRT012216 Cldn12 claudin 12 1 1
MIRT012217 Fnip1 folliculin interacting protein 1 1 1
MIRT012218 Nras neuroblastoma ras oncogene 1 1
MIRT012219 Tgfbr1 transforming growth factor, beta receptor I 1 1
MIRT012220 Tgfbr3 transforming growth factor, beta receptor III 1 1
MIRT012221 Bach1 BTB and CNC homology 1, basic leucine zipper transcription factor 1 1 1
MIRT012222 Apbb3 amyloid beta (A4) precursor protein-binding, family B, member 3 1 1
MIRT012223 Nr2e1 nuclear receptor subfamily 2, group E, member 1 3 1
MIRT012224 Prrc2c proline-rich coiled-coil 2C 1 1
MIRT012225 Slc6a8 solute carrier family 6 (neurotransmitter transporter, creatine), member 8 1 1
MIRT012226 Pigs phosphatidylinositol glycan anchor biosynthesis, class S 1 1
MIRT012227 Arhgap1 Rho GTPase activating protein 1 1 1
MIRT012228 Gba2 glucosidase beta 2 1 1
MIRT012229 Bmpr1a bone morphogenetic protein receptor, type 1A 1 1
MIRT012230 Gria3 glutamate receptor, ionotropic, AMPA3 (alpha 3) 1 1
MIRT012231 Capns1 calpain, small subunit 1 1 1
MIRT012232 Syt5 synaptotagmin V 1 1
MIRT012233 Gria2 glutamate receptor, ionotropic, AMPA2 (alpha 2) 1 1
MIRT012234 Cnih4 cornichon family AMPA receptor auxiliary protein 4 1 1
MIRT012235 Ubap2 ubiquitin-associated protein 2 1 1
MIRT012236 Zkscan2 zinc finger with KRAB and SCAN domains 2 1 1
MIRT012237 Stat2 signal transducer and activator of transcription 2 1 1
MIRT012238 Dbc1 bone morphogenic protein/retinoic acid inducible neural specific 1 1 1
MIRT012239 Usp22 ubiquitin specific peptidase 22 1 1
MIRT012240 Cnih cornichon family AMPA receptor auxiliary protein 1 1 1
MIRT012241 Fam175b BRISC complex subunit 1 1
MIRT012242 Dnm3 dynamin 3 1 1
MIRT012243 Dync1i2 dynein cytoplasmic 1 intermediate chain 2 1 1
MIRT012244 Cntn2 contactin 2 1 1
MIRT012245 Nol8 nucleolar protein 8 1 1
MIRT012246 Zscan22 zinc finger and SCAN domain containing 22 1 1
MIRT012247 Psme4 proteasome (prosome, macropain) activator subunit 4 1 1
MIRT012248 Kcnj10 potassium inwardly-rectifying channel, subfamily J, member 10 1 1
MIRT012249 Stk35 serine/threonine kinase 35 1 1
MIRT012250 Pdgfrb platelet derived growth factor receptor, beta polypeptide 1 1
MIRT012251 Tub tubby bipartite transcription factor 1 1
MIRT012252 Esam endothelial cell-specific adhesion molecule 1 1
MIRT012253 Gpr63 G protein-coupled receptor 63 1 1
MIRT012254 Naa40 N(alpha)-acetyltransferase 40, NatD catalytic subunit 1 1
MIRT012255 Kcna1 potassium voltage-gated channel, shaker-related subfamily, member 1 1 1
MIRT012256 Dusp6 dual specificity phosphatase 6 1 1
MIRT012257 Dnajc27 DnaJ heat shock protein family (Hsp40) member C27 1 1
MIRT012258 Slc25a23 solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23 1 1
MIRT012259 Tspan2 tetraspanin 2 1 1
MIRT012260 Zdhhc24 zinc finger, DHHC domain containing 24 1 1
MIRT012261 Sh2b3 SH2B adaptor protein 3 1 1
MIRT012262 Slitrk4 SLIT and NTRK-like family, member 4 1 1
MIRT012263 Mtf1 metal response element binding transcription factor 1 1 1
MIRT012264 Srrm4 serine/arginine repetitive matrix 4 1 1
MIRT012265 Crem cAMP responsive element modulator 1 1
MIRT012266 Klf8 Kruppel-like factor 8 1 1
MIRT012267 Syncrip synaptotagmin binding, cytoplasmic RNA interacting protein 1 1
MIRT012268 Tgs1 trimethylguanosine synthase 1 1 1
MIRT012269 Stat3 signal transducer and activator of transcription 3 1 1
MIRT012270 Arc activity regulated cytoskeletal-associated protein 1 1
MIRT012271 Hr hairless 1 1
MIRT012272 Pnkd paroxysmal nonkinesiogenic dyskinesia 1 1
MIRT012273 Zfp641 zinc finger protein 641 1 1
MIRT012274 Slc25a4 solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 4 1 1
MIRT012275 D630045J12Rik RIKEN cDNA D630045J12 gene 1 1
MIRT012276 Fam171a1 family with sequence similarity 171, member A1 1 1
MIRT012277 Vav3 vav 3 oncogene 1 1
MIRT012278 Tmem214 transmembrane protein 214 1 1
MIRT012279 Eif4g2 eukaryotic translation initiation factor 4, gamma 2 1 1
MIRT012280 Rab11fip4 RAB11 family interacting protein 4 (class II) 1 1
MIRT012281 Zfp280b zinc finger protein 280B 1 1
MIRT012282 Csnk2a1 casein kinase 2, alpha 1 polypeptide 1 1
MIRT012283 Kif21b kinesin family member 21B 1 1
MIRT012284 Gpcpd1 glycerophosphocholine phosphodiesterase 1 1 1
MIRT012285 Snx5 sorting nexin 5 1 1
MIRT012286 Thrsp thyroid hormone responsive 1 1
MIRT012287 Usp47 ubiquitin specific peptidase 47 1 1
MIRT012288 Ndst3 N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3 1 1
MIRT012289 Dlc1 deleted in liver cancer 1 1 1
MIRT012290 Syt11 synaptotagmin XI 1 1
MIRT012291 Btbd3 BTB (POZ) domain containing 3 1 1
MIRT012292 Farp1 FERM, RhoGEF (Arhgef) and pleckstrin domain protein 1 (chondrocyte-derived) 1 1
MIRT012293 Slc20a1 solute carrier family 20, member 1 1 1
MIRT012294 Zfp354b zinc finger protein 354B 1 1
MIRT012295 Psd3 pleckstrin and Sec7 domain containing 3 1 1
MIRT012296 Sfmbt1 Scm-like with four mbt domains 1 1 1
MIRT012297 Rnf44 ring finger protein 44 1 1
MIRT012298 March9 membrane-associated ring finger (C3HC4) 9 1 1
MIRT012299 Thbs1 thrombospondin 1 1 1
MIRT012300 Pcgf3 polycomb group ring finger 3 1 1
MIRT012301 Fam135a family with sequence similarity 135, member A 1 1
MIRT012302 Bcl7c B cell CLL/lymphoma 7C 1 1
MIRT012303 Mycbp MYC binding protein 1 1
MIRT012304 Gxylt1 glucoside xylosyltransferase 1 1 1
MIRT012305 Lpgat1 lysophosphatidylglycerol acyltransferase 1 1 1
MIRT012306 Zfp644 zinc finger protein 644 1 1
MIRT012307 Rnf5 ring finger protein 5 1 1
MIRT012308 Hdx highly divergent homeobox 1 1
MIRT012309 Cpeb2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT012310 Pqlc2 PQ loop repeat containing 2 1 1
MIRT012311 Sema4f sema domain, immunoglobulin domain (Ig), TM domain, and short cytoplasmic domain 1 1
MIRT012312 Hic2 hypermethylated in cancer 2 1 1
MIRT012313 Adamts15 a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 15 1 1
MIRT012314 Tmem2 transmembrane protein 2 1 1
MIRT012315 Stx3 syntaxin 3 1 1
MIRT012316 Nr6a1 nuclear receptor subfamily 6, group A, member 1 1 1
MIRT012317 Lrig2 leucine-rich repeats and immunoglobulin-like domains 2 1 1
MIRT012318 Skil SKI-like 1 1
MIRT012319 Map4k3 mitogen-activated protein kinase kinase kinase kinase 3 1 1
MIRT053616 ACVR1B activin A receptor type 1B 3 1
MIRT578704 Gnl3l guanine nucleotide binding protein-like 3 (nucleolar)-like 1 2
MIRT579035 Cts8 cathepsin 8 1 2
MIRT579374 Apc2 adenomatosis polyposis coli 2 1 3
MIRT583582 Fbxl14 F-box and leucine-rich repeat protein 14 1 1
MIRT586723 Lins lines homolog 1 1 1
MIRT592560 Mup17 major urinary protein 17 1 1
MIRT592597 Mup11 major urinary protein 11 1 1
MIRT592943 Armc2 armadillo repeat containing 2 1 2
MIRT594647 Meis2 Meis homeobox 2 1 1
MIRT596621 Zfp444 zinc finger protein 444 1 1
MIRT597965 Nup214 nucleoporin 214 1 1
MIRT601462 Tnfrsf26 tumor necrosis factor receptor superfamily, member 26 1 1
MIRT605691 Ifnar1 interferon (alpha and beta) receptor 1 1 1
MIRT756429 Hmga2 high mobility group AT-hook 2 4 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
let-7b Gemcitabine approved 60750 Northern blot Mz-ChA-1 human cholangiocarcinoma cell lines 16762633 2006 down-regulated
let-7b Medpor NULL NULL Microarray osteoblast-like cells line (MG-63) 18408260 2008 up-regulated
let-7b Enoxacin approved 3229 Quantitative real-time PCR HEK293 cells 18641635 2008 up-regulated
let-7b 17beta-estradiol (E2) approved 5757 Microarray MCF-7 breast cancer cells 19528081 2009 up-regulated
let-7b Etoposide approved 36462 Microarray Normal human fibroblasts (AG01522) 19633716 2009 down-regulated
let-7b Etoposide approved 36462 Quantitative real-time PCR Normal human fibroblasts (AG01522) 19633716 2009 down-regulated
let-7b Activin A NULL 229455 Quantitative real-time PCR Human embryonic stem (hES) cells 19885849 2010 down-regulated
let-7b Oxaliplatin (L-OHP) approved 5310940 Microarray HCT-116 colon cancer cell line 19956872 2010 down-regulated
let-7b Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
let-7b Enoxacin approved 3229 Quantitative real-time PCR HCT-116 and RKO colon cancer cell lines 21368194 2011 up-regulated
let-7b Metformin approved 4091 Quantitative real-time PCR pancreatic cancer cells 22086681 2012 up-regulated
let-7b Metformin approved 4091 Quantitative real-time PCR pancreatic cancer cells 22086681 2012 up-regulated
let-7b CDF(analogues of curcumin) NULL NULL Quantitative real-time PCR pancreatic cancer cells 22108826 2012 up-regulated
let-7b Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse liver 19270793 2009 down-regulated
let-7b N-ethyl-N-nitrosourea NULL 12967 Quantitative real-time PCR mouse liver 21029445 2010 up-regulated
let-7b Lithium (Li) approved 3028194 Microarray rat hippocampus 18704095 2009 down-regulated
let-7b Lithium (Li) approved 3028194 Quantitative real-time PCR rat hippocampus 18704095 2009 down-regulated
let-7b Valproate approved 3121 Microarray rat hippocampus 18704095 2009 down-regulated
let-7b Valproate approved 3121 Quantitative real-time PCR rat hippocampus 18704095 2009 down-regulated
let-7b Marine fungal metabolite 1386A NULL NULL Microarray MCF-7 breast cancer cells. 22159329 2012 down-regulated
let-7b 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
let-7b Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated

Error report submission