miRTarBase - #MIRT003813


—
pre-miRNA Information
pre-miRNA hsa-mir-29b-1   
Genomic Coordinates chr7: 130877459 - 130877539
Synonyms MIRN29B1, miRNA29B1, MIR29B1
Description Homo sapiens miR-29b-1 stem-loop
Comment Mourelatos et al. identified two copies of this sequence mapping to chromosome 7, and assigned the names mir-102-7.1 and mir-102-7.2 . Subsequent genome assemblies suggest the presence of only one miR-102 locus on chromosome 7. Human miR-102 is a homologue of mouse miR-29b (MIR:MI0000143) and so has been renamed here for consistency.
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-29b-2   
Genomic Coordinates chr1: 207802443 - 207802523
Synonyms MIRN29B2, mir-29b-2, MIR29B2
Description Homo sapiens miR-29b-2 stem-loop
Comment This sequence was named mir-102-1 in reference . Human miR-102 is a homologue of mouse miR-29b (MIR:MI0000143) and so has been renamed here for consistency.
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-29b-3p
Sequence 52| UAGCACCAUUUGAAAUCAGUGUU |74
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 2 7 - 130877488 29233923 MiREDiBase
A-to-I 2 1 - 207802471 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs773555186 20 dbSNP
rs1390817128 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol VEGFA   
Synonyms MVCD1, VEGF, VPF
Description vascular endothelial growth factor A
Transcript NM_001025369   
Other Transcripts NM_001025367 , NM_001025368 , NM_001025366 , NM_001025370 , NM_001033756 , NM_001171622 , NM_001171623 , NM_001171624 , NM_001171625 , NM_001171626 , NM_001171627 , NM_001171628 , NM_001171629 , NM_001171630 , NM_003376   
Expression
Putative miRNA Targets on VEGFA
3'UTR of VEGFA
(miRNA target sites are highlighted)		 
>VEGFA|NM_001025369|3'UTR
   1 CAAGCCGAGGCGGTGAGCCGGGCAGGAGGAAGGAGCCTCCCTCAGGGTTTCGGGAACCAGATCTCTCACCAGGAAAGACT
  81 GATACAGAACGATCGATACAGAAACCACGCTGCCGCCACCACACCATCACCATCGACAGAACAGTCCTTAATCCAGAAAC
 161 CTGAAATGAAGGAAGAGGAGACTCTGCGCAGAGCACTTTGGGTCCGGAGGGCGAGACTCCGGCGGAAGCATTCCCGGGCG
 241 GGTGACCCAGCACGGTCCCTCTTGGAATTGGATTCGCCATTTTATTTTTCTTGCTGCTAAATCACCGAGCCCGGAAGATT
 321 AGAGAGTTTTATTTCTGGGATTCCTGTAGACACACCCACCCACATACATACATTTATATATATATATATTATATATATAT
 401 AAAAATAAATATCTCTATTTTATATATATAAAATATATATATTCTTTTTTTAAATTAACAGTGCTAATGTTATTGGTGTC
 481 TTCACTGGATGTATTTGACTGCTGTGGACTTGAGTTGGGAGGGGAATGTTCCCACTCAGATCCTGACAGGGAAGAGGAGG
 561 AGATGAGAGACTCTGGCATGATCTTTTTTTTGTCCCACTTGGTGGGGCCAGGGTCCTCTCCCCTGCCCAGGAATGTGCAA
 641 GGCCAGGGCATGGGGGCAAATATGACCCAGTTTTGGGAACACCGACAAACCCAGCCCTGGCGCTGAGCCTCTCTACCCCA
 721 GGTCAGACGGACAGAAAGACAGATCACAGGTACAGGGATGAGGACACCGGCTCTGACCAGGAGTTTGGGGAGCTTCAGGA
 801 CATTGCTGTGCTTTGGGGATTCCCTCCACATGCTGCACGCGCATCTCGCCCCCAGGGGCACTGCCTGGAAGATTCAGGAG
 881 CCTGGGCGGCCTTCGCTTACTCTCACCTGCTTCTGAGTTGCCCAGGAGACCACTGGCAGATGTCCCGGCGAAGAGAAGAG
 961 ACACATTGTTGGAAGAAGCAGCCCATGACAGCTCCCCTTCCTGGGACTCGCCCTCATCCTCTTCCTGCTCCCCTTCCTGG
1041 GGTGCAGCCTAAAAGGACCTATGTCCTCACACCATTGAAACCACTAGTTCTGTCCCCCCAGGAGACCTGGTTGTGTGTGT
1121 GTGAGTGGTTGACCTTCCTCCATCCCCTGGTCCTTCCCTTCCCTTCCCGAGGCACAGAGAGACAGGGCAGGATCCACGTG
1201 CCCATTGTGGAGGCAGAGAAAAGAGAAAGTGTTTTATATACGGTACTTATTTAATATCCCTTTTTAATTAGAAATTAAAA
1281 CAGTTAATTTAATTAAAGAGTAGGGTTTTTTTTCAGTATTCTTGGTTAATATTTAATTTCAACTATTTATGAGATGTATC
1361 TTTTGCTCTCTCTTGCTCTCTTATTTGTACCGGTTTTTGTATATAAAATTCATGTTTCCAATCTCTCTCTCCCTGATCGG
1441 TGACAGTCACTAGCTTATCTTGAACAGATATTTAATTTTGCTAACACTCAGCTCTGCCCTCCCCGATCCCCTGGCTCCCC
1521 AGCACACATTCCTTTGAAATAAGGTTTCAATATACATCTACATACTATATATATATTTGGCAACTTGTATTTGTGTGTAT
1601 ATATATATATATATGTTTATGTATATATGTGATTCTGATAAAATAGACATTGCTATTCTGTTTTTTATATGTAAAAACAA
1681 AACAAGAAAAAATAGAGAATTCTACATACTAAATCTCTCTCCTTTTTTAATTTTAATATTTGTTATCATTTATTTATTGG
1761 TGCTACTGTTTATCCGTAATAATTGTGGGGAAAAGATATTAACATCACGTCTTTGTCTCTAGTGCAGTTTTTCGAGATAT
1841 TCCGTAGTACATATTTATTTTTAAACAACGACAAAGAAATACAGATATATCTTAAAAAAAAAAAAGCATTTTGTATTAAA
1921 GAATTTAATTCTGATCTCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uuGUGACUAAAGUUUACCACGAu 5'
            ||:| ||||  | ||||||| 
Target 5' atCATTTATTT--ATTGGTGCTa 3'
 1745 - 1765 165.00 -15.00
2 
miRNA  3' uuGU-GACUAAAGUUUACCACGAu 5'
            || :| ||||:   || |||| 
Target 5' gcCATTTTATTTTTCTTGCTGCTa 3'
 276 - 299 125.00 -7.30
3 
miRNA  3' uuGUGACUAAAGUUUACCAC-GAu 5'
            ::|| || |: | ||||| || 
Target 5' agTGCTAATGTT-ATTGGTGTCTt 3'
 460 - 482 124.00 -8.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM6846710 7 COSMIC
COSM6819794 11 COSMIC
COSM7497899 13 COSMIC
COSM7701081 13 COSMIC
COSM3627761 14 COSMIC
COSM7659088 16 COSMIC
COSN26958505 21 COSMIC
COSN30524014 29 COSMIC
COSN27004587 41 COSMIC
COSM9012089 52 COSMIC
COSM3352182 64 COSMIC
COSM3411133 77 COSMIC
COSM7974398 79 COSMIC
COSN30143001 88 COSMIC
COSN30102404 95 COSMIC
COSN31508134 96 COSMIC
COSN31596624 99 COSMIC
COSN30455964 114 COSMIC
COSN4893933 129 COSMIC
COSN30153771 136 COSMIC
COSN30476233 148 COSMIC
COSN30456378 154 COSMIC
COSN30133882 169 COSMIC
COSN30171185 169 COSMIC
COSN30584487 207 COSMIC
COSN31567017 221 COSMIC
COSN30158763 245 COSMIC
COSN167777 254 COSMIC
COSN30632779 277 COSMIC
COSN31485413 294 COSMIC
COSN31564704 314 COSMIC
COSN30541187 426 COSMIC
COSN31593685 466 COSMIC
COSN31522262 489 COSMIC
COSN31594835 539 COSMIC
COSN20274509 584 COSMIC
COSN21290319 729 COSMIC
COSN28703738 769 COSMIC
COSN30164957 927 COSMIC
COSN31545074 950 COSMIC
COSN2162691 1024 COSMIC
COSN24614414 1129 COSMIC
COSN31533515 1166 COSMIC
COSN31524418 1170 COSMIC
COSN31563310 1188 COSMIC
COSN28249886 1314 COSMIC
COSN31606167 1314 COSMIC
COSN7883560 1375 COSMIC
COSN8514383 1428 COSMIC
COSN31548668 1559 COSMIC
COSN28017862 1576 COSMIC
COSN7883561 1598 COSMIC
COSN23225630 1614 COSMIC
COSN31486284 1638 COSMIC
COSN31530820 1667 COSMIC
COSN31480000 1720 COSMIC
COSN31610033 1741 COSMIC
COSN31516478 1759 COSMIC
COSN30175512 1810 COSMIC
COSN19503017 1819 COSMIC
COSN20213960 1825 COSMIC
COSN31522645 1827 COSMIC
COSN31551365 1870 COSMIC
COSN27224860 1906 COSMIC
COSN31568751 1922 COSMIC
rs3025053 1043 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs748984440 1 dbSNP
rs371208770 4 dbSNP
rs1272402969 6 dbSNP
rs768366559 7 dbSNP
rs778358844 8 dbSNP
rs144772480 11 dbSNP
rs771561387 12 dbSNP
rs374253522 13 dbSNP
rs367809801 20 dbSNP
rs201575061 21 dbSNP
rs1159309955 27 dbSNP
rs769516531 28 dbSNP
rs1410335572 29 dbSNP
rs1046219704 37 dbSNP
rs1423738097 39 dbSNP
rs1459938559 39 dbSNP
rs1383348581 40 dbSNP
rs1169570968 41 dbSNP
rs775856114 42 dbSNP
rs1395831641 44 dbSNP
rs775012448 45 dbSNP
rs374044063 52 dbSNP
rs1335475234 56 dbSNP
rs917813568 62 dbSNP
rs202125661 64 dbSNP
rs774432825 65 dbSNP
rs1269130764 67 dbSNP
rs762001063 68 dbSNP
rs767672556 72 dbSNP
rs750489567 75 dbSNP
rs756142052 84 dbSNP
rs1249577551 87 dbSNP
rs1438175455 88 dbSNP
rs201001455 91 dbSNP
rs753667339 92 dbSNP
rs200439877 95 dbSNP
rs201676874 96 dbSNP
rs1418611973 99 dbSNP
rs1404175496 100 dbSNP
rs1347884113 106 dbSNP
rs372384354 108 dbSNP
rs770300127 109 dbSNP
rs775795841 110 dbSNP
rs111933757 112 dbSNP
rs1330516915 113 dbSNP
rs369043844 115 dbSNP
rs1413732811 116 dbSNP
rs1481115447 123 dbSNP
rs1293381502 126 dbSNP
rs1336225539 130 dbSNP
rs1216787567 131 dbSNP
rs774672415 132 dbSNP
rs376707517 135 dbSNP
rs1234890403 136 dbSNP
rs1205870489 140 dbSNP
rs753429817 143 dbSNP
rs931623857 146 dbSNP
rs187429037 156 dbSNP
rs891362263 166 dbSNP
rs1284892129 175 dbSNP
rs987423086 176 dbSNP
rs1222127052 182 dbSNP
rs578148161 186 dbSNP
rs112005313 187 dbSNP
rs1182403544 188 dbSNP
rs1377053612 196 dbSNP
rs1353903332 199 dbSNP
rs965161532 206 dbSNP
rs978846445 207 dbSNP
rs1406104557 209 dbSNP
rs112256643 213 dbSNP
rs936479141 214 dbSNP
rs988080022 218 dbSNP
rs1210630136 219 dbSNP
rs149179279 221 dbSNP
rs913819452 222 dbSNP
rs563703669 224 dbSNP
rs1232786789 225 dbSNP
rs1461834731 234 dbSNP
rs578064053 236 dbSNP
rs543089337 237 dbSNP
rs561490568 239 dbSNP
rs937769907 240 dbSNP
rs529074549 241 dbSNP
rs3025039 254 dbSNP
rs559522706 255 dbSNP
rs963141368 260 dbSNP
rs1382924269 263 dbSNP
rs1335433160 265 dbSNP
rs993623699 269 dbSNP
rs1026557481 276 dbSNP
rs973226910 277 dbSNP
rs1159368851 279 dbSNP
rs1400549113 282 dbSNP
rs1378787222 289 dbSNP
rs1185964647 290 dbSNP
rs778163655 307 dbSNP
rs890715188 308 dbSNP
rs533046584 313 dbSNP
rs551692177 314 dbSNP
rs1479430148 316 dbSNP
rs570044029 318 dbSNP
rs964713658 321 dbSNP
rs1215263426 323 dbSNP
rs537491073 325 dbSNP
rs1042624192 339 dbSNP
rs1033082420 343 dbSNP
rs549490546 345 dbSNP
rs902787596 349 dbSNP
rs1333377740 351 dbSNP
rs936794448 361 dbSNP
rs1363433630 372 dbSNP
rs1053987330 375 dbSNP
rs1289097615 375 dbSNP
rs895212897 375 dbSNP
rs567722917 377 dbSNP
rs1425661285 381 dbSNP
rs368441324 389 dbSNP
rs1186179862 390 dbSNP
rs1262436004 390 dbSNP
rs371875161 390 dbSNP
rs535119313 391 dbSNP
rs553262626 392 dbSNP
rs578135072 400 dbSNP
rs982021226 403 dbSNP
rs538948863 414 dbSNP
rs963275334 416 dbSNP
rs973196202 423 dbSNP
rs1028824123 430 dbSNP
rs1295623940 432 dbSNP
rs1213458290 434 dbSNP
rs1304581618 440 dbSNP
rs937671499 440 dbSNP
rs1238203994 443 dbSNP
rs1467779736 445 dbSNP
rs557256799 445 dbSNP
rs987593914 452 dbSNP
rs1191406667 462 dbSNP
rs1037894818 463 dbSNP
rs757492858 464 dbSNP
rs1169886788 467 dbSNP
rs1476863432 477 dbSNP
rs1378985785 479 dbSNP
rs1478270034 500 dbSNP
rs911648535 502 dbSNP
rs1266320765 506 dbSNP
rs1208019685 510 dbSNP
rs945680828 516 dbSNP
rs1251789402 522 dbSNP
rs1226146309 526 dbSNP
rs1315522300 528 dbSNP
rs929023157 540 dbSNP
rs1047886858 543 dbSNP
rs1299582804 568 dbSNP
rs1401171836 574 dbSNP
rs36001252 575 dbSNP
rs924176625 581 dbSNP
rs1440234937 583 dbSNP
rs1324204022 584 dbSNP
rs890601547 594 dbSNP
rs1333044240 601 dbSNP
rs1009117670 609 dbSNP
rs1437635641 611 dbSNP
rs559477981 617 dbSNP
rs1376875253 626 dbSNP
rs936930305 636 dbSNP
rs1039274565 643 dbSNP
rs560963332 644 dbSNP
rs1420652852 649 dbSNP
rs1251234417 650 dbSNP
rs1053956091 660 dbSNP
rs111590525 661 dbSNP
rs1203931487 663 dbSNP
rs1259234032 665 dbSNP
rs1000200646 684 dbSNP
rs1211266484 700 dbSNP
rs1269022481 702 dbSNP
rs185294556 703 dbSNP
rs956118182 710 dbSNP
rs1385119736 712 dbSNP
rs747321252 723 dbSNP
rs1187263279 728 dbSNP
rs771331791 729 dbSNP
rs906635173 730 dbSNP
rs1240099342 732 dbSNP
rs573628689 735 dbSNP
rs1364096972 742 dbSNP
rs530287018 745 dbSNP
rs1171357298 746 dbSNP
rs1437697716 748 dbSNP
rs1244871227 752 dbSNP
rs541137949 767 dbSNP
rs3025040 769 dbSNP
rs899086791 770 dbSNP
rs1206466612 771 dbSNP
rs1351851092 778 dbSNP
rs926554562 779 dbSNP
rs528762513 795 dbSNP
rs1238634262 803 dbSNP
rs750478984 806 dbSNP
rs959332666 808 dbSNP
rs973099534 816 dbSNP
rs920222087 826 dbSNP
rs1338721383 836 dbSNP
rs533184854 839 dbSNP
rs746442886 840 dbSNP
rs1019082216 841 dbSNP
rs912091383 842 dbSNP
rs769164425 848 dbSNP
rs1417601085 852 dbSNP
rs1039732235 853 dbSNP
rs114607160 855 dbSNP
rs563616137 859 dbSNP
rs1194914456 862 dbSNP
rs1447164963 869 dbSNP
rs1165908869 881 dbSNP
rs530836187 886 dbSNP
rs1054465756 888 dbSNP
rs891771619 889 dbSNP
rs778009175 892 dbSNP
rs1266641860 895 dbSNP
rs1228190758 896 dbSNP
rs1354375361 908 dbSNP
rs958268348 909 dbSNP
rs989696266 915 dbSNP
rs1204225098 920 dbSNP
rs190588351 921 dbSNP
rs1281668721 929 dbSNP
rs10434 930 dbSNP
rs1194111230 933 dbSNP
rs1046569871 935 dbSNP
rs1024374658 939 dbSNP
rs1474152384 947 dbSNP
rs970585789 948 dbSNP
rs1370228735 950 dbSNP
rs762477558 951 dbSNP
rs940800585 956 dbSNP
rs528542280 959 dbSNP
rs1802040 965 dbSNP
rs780389723 965 dbSNP
rs1458449719 966 dbSNP
rs542812735 967 dbSNP
rs1033895355 969 dbSNP
rs1158265666 984 dbSNP
rs959320221 985 dbSNP
rs41430645 994 dbSNP
rs1421982497 996 dbSNP
rs571724503 1010 dbSNP
rs1196527327 1011 dbSNP
rs889053103 1013 dbSNP
rs539264549 1015 dbSNP
rs1375393155 1025 dbSNP
rs950374975 1032 dbSNP
rs983187952 1033 dbSNP
rs911639125 1034 dbSNP
rs1347195644 1042 dbSNP
rs3025053 1043 dbSNP
rs1315397399 1049 dbSNP
rs1018802888 1052 dbSNP
rs1330804662 1060 dbSNP
rs1465703676 1061 dbSNP
rs1398840917 1066 dbSNP
rs1168139170 1073 dbSNP
rs1340601909 1074 dbSNP
rs1237683119 1076 dbSNP
rs182317842 1082 dbSNP
rs967528845 1082 dbSNP
rs1355323511 1083 dbSNP
rs1235155844 1085 dbSNP
rs974949193 1092 dbSNP
rs780075986 1095 dbSNP
rs536572716 1096 dbSNP
rs936286611 1099 dbSNP
rs1054700031 1101 dbSNP
rs1278142103 1107 dbSNP
rs1218494807 1110 dbSNP
rs747174244 1112 dbSNP
rs750140926 1112 dbSNP
rs891823874 1114 dbSNP
rs554910999 1117 dbSNP
rs946026389 1118 dbSNP
rs1045881192 1129 dbSNP
rs1328747281 1133 dbSNP
rs916787221 1141 dbSNP
rs552833857 1147 dbSNP
rs969693893 1152 dbSNP
rs907293552 1156 dbSNP
rs1424533026 1162 dbSNP
rs1001985161 1167 dbSNP
rs573618781 1169 dbSNP
rs1236857244 1176 dbSNP
rs1185538685 1177 dbSNP
rs767407432 1178 dbSNP
rs1378708490 1181 dbSNP
rs894943055 1191 dbSNP
rs994796268 1198 dbSNP
rs540750016 1199 dbSNP
rs1286032880 1205 dbSNP
rs1027510808 1224 dbSNP
rs950427338 1229 dbSNP
rs1305169953 1237 dbSNP
rs930617155 1239 dbSNP
rs1403528948 1242 dbSNP
rs553079671 1243 dbSNP
rs183460308 1261 dbSNP
rs188186771 1266 dbSNP
rs1301900924 1282 dbSNP
rs563477755 1282 dbSNP
rs1445303928 1284 dbSNP
rs889012828 1288 dbSNP
rs781756914 1289 dbSNP
rs1379071045 1295 dbSNP
rs1419446054 1295 dbSNP
rs1040602724 1306 dbSNP
rs540841861 1306 dbSNP
rs902983990 1306 dbSNP
rs1240373198 1315 dbSNP
rs1302201612 1316 dbSNP
rs1310273438 1317 dbSNP
rs1235131035 1319 dbSNP
rs1256590703 1322 dbSNP
rs1480233272 1325 dbSNP
rs1195320768 1326 dbSNP
rs530796133 1328 dbSNP
rs1242885426 1344 dbSNP
rs1217153992 1362 dbSNP
rs141683858 1366 dbSNP
rs1487833118 1367 dbSNP
rs566144283 1375 dbSNP
rs998690665 1377 dbSNP
rs1236385878 1384 dbSNP
rs561110106 1392 dbSNP
rs1179547642 1393 dbSNP
rs1394687532 1404 dbSNP
rs974876708 1412 dbSNP
rs1012981736 1420 dbSNP
rs1022651742 1422 dbSNP
rs1399841886 1428 dbSNP
rs922150020 1430 dbSNP
rs936146834 1431 dbSNP
rs866177519 1433 dbSNP
rs1035686035 1434 dbSNP
rs990438125 1439 dbSNP
rs41282644 1440 dbSNP
rs1378733321 1447 dbSNP
rs1424680592 1447 dbSNP
rs1461877796 1455 dbSNP
rs373941416 1458 dbSNP
rs1260712972 1495 dbSNP
rs972219770 1500 dbSNP
rs946247119 1502 dbSNP
rs920667200 1505 dbSNP
rs1049160 1506 dbSNP
rs1251883361 1511 dbSNP
rs986535970 1516 dbSNP
rs1217593105 1517 dbSNP
rs1338934938 1522 dbSNP
rs1285640131 1523 dbSNP
rs910587281 1526 dbSNP
rs907173870 1527 dbSNP
rs1390734609 1529 dbSNP
rs1292281454 1532 dbSNP
rs1463605064 1535 dbSNP
rs1401040618 1537 dbSNP
rs944711139 1544 dbSNP
rs181069410 1548 dbSNP
rs796446173 1551 dbSNP
rs895003063 1556 dbSNP
rs934450906 1557 dbSNP
rs1054316295 1563 dbSNP
rs1189338814 1568 dbSNP
rs1458715708 1570 dbSNP
rs1258090828 1590 dbSNP
rs1216761169 1592 dbSNP
rs994627281 1595 dbSNP
rs1259885197 1596 dbSNP
rs34241255 1598 dbSNP
rs370654536 1598 dbSNP
rs532477681 1598 dbSNP
rs147035281 1600 dbSNP
rs1377770130 1608 dbSNP
rs3025054 1613 dbSNP
rs549547019 1616 dbSNP
rs150363719 1618 dbSNP
rs995961655 1628 dbSNP
rs1173361780 1630 dbSNP
rs1466371933 1631 dbSNP
rs1029155433 1634 dbSNP
rs972188375 1639 dbSNP
rs1428258842 1653 dbSNP
rs1441524268 1657 dbSNP
rs553136985 1661 dbSNP
rs952122946 1669 dbSNP
rs1456063452 1670 dbSNP
rs1257856744 1676 dbSNP
rs1426397353 1679 dbSNP
rs1344793774 1681 dbSNP
rs957591908 1684 dbSNP
rs1242737371 1687 dbSNP
rs1355091784 1692 dbSNP
rs1309159530 1705 dbSNP
rs990322138 1707 dbSNP
rs1385009536 1709 dbSNP
rs1335108170 1714 dbSNP
rs1395626761 1715 dbSNP
rs913363312 1729 dbSNP
rs1163501700 1740 dbSNP
rs967640594 1744 dbSNP
rs796725834 1745 dbSNP
rs1380903852 1747 dbSNP
rs910629028 1749 dbSNP
rs1459081462 1766 dbSNP
rs944700713 1769 dbSNP
rs1187844012 1774 dbSNP
rs1293719095 1776 dbSNP
rs1253602433 1777 dbSNP
rs773067982 1786 dbSNP
rs778075982 1796 dbSNP
rs1219330561 1807 dbSNP
rs866951594 1809 dbSNP
rs937321687 1810 dbSNP
rs1280090418 1811 dbSNP
rs934586127 1812 dbSNP
rs1284907566 1818 dbSNP
rs567150308 1824 dbSNP
rs371781236 1834 dbSNP
rs931363788 1835 dbSNP
rs1401635629 1844 dbSNP
rs1048886254 1849 dbSNP
rs1320176024 1855 dbSNP
rs1360859863 1864 dbSNP
rs1297542595 1869 dbSNP
rs1417734801 1870 dbSNP
rs948564402 1871 dbSNP
rs1266240172 1888 dbSNP
rs1044129922 1894 dbSNP
rs1366408341 1894 dbSNP
rs869136464 1894 dbSNP
rs886252251 1895 dbSNP
rs1191952751 1896 dbSNP
rs1004772225 1897 dbSNP
rs1262868047 1899 dbSNP
rs1040674850 1900 dbSNP
rs1215113355 1901 dbSNP
rs901547945 1902 dbSNP
rs76989981 1905 dbSNP
rs534658089 1914 dbSNP
rs1209378776 1921 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Cos-7
Location of target site 3'UTR
Tools used in this research FindTar
Original Description (Extracted from the article) ... {This MTI is shown in Fig. 1 and Fig. 2} ...

- Ye W; Lv Q; Wong CK; Hu S; Fu C; Hua Z; Cai et al., 2008, PloS one.

Article - Ye W; Lv Q; Wong CK; Hu S; Fu C; Hua Z; Cai et al.
- PloS one, 2008
MicroRNAs (miRNAs) guide posttranscriptional repression of mRNAs. Hundreds of miRNAs have been identified but the target identification of mammalian mRNAs is still a difficult task due to a poor understanding of the interaction between miRNAs and the miRNA recognizing element (MRE). In recent research, the importance of the 5' end of the miRNA:MRE duplex has been emphasized and the effect of the tail region addressed, but the role of the central loop has largely remained unexplored. Here we examined the effect of the loop region in miRNA:MRE duplexes and found that the location of the central loop is one of the important factors affecting the efficiency of gene regulation mediated by miRNAs. It was further determined that the addition of a loop score combining both location and size as a new criterion for predicting MREs and their cognate miRNAs significantly decreased the false positive rates and increased the specificity of MRE prediction.
LinkOut: [PMID: 18320040]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uuGUGACUAAAGUUUACCACGAu 5'
            ||:| ||||  | ||||||| 
Target 5' auCAUUUAUUU--AUUGGUGCUa 3'
 		3 - 23
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 7422.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions 4T1
Disease breast cancer
Location of target site 3'UTR
Tools used in this research previous_study
Original Description (Extracted from the article) ... The miR-29b seed sequence is in red and the complementary binding sites are in green. The mutations generated within the 3' UTRs for c are in purple. The wild-type and mutant 3 ' UTRs of the indicated miR-29b targets were cloned into dual luciferase reporters and co-transfected with miR-29b or cel-67 control mimic. miR-29b is induced by GATA3 ...

- Chou J; Lin JH; Brenot A; Kim JW; Provot S; Werb Z, 2013, Nature cell biology.

Article - Chou J; Lin JH; Brenot A; Kim JW; Provot S; Werb Z
- Nature cell biology, 2013
Despite advances in our understanding of breast cancer, patients with metastatic disease have poor prognoses. GATA3 is a transcription factor that specifies and maintains mammary luminal epithelial cell fate, and its expression is lost in breast cancer, correlating with a worse prognosis in human patients. Here, we show that GATA3 promotes differentiation, suppresses metastasis and alters the tumour microenvironment in breast cancer by inducing microRNA-29b (miR-29b) expression. Accordingly, miR-29b is enriched in luminal breast cancers and loss of miR-29b, even in GATA3-expressing cells, increases metastasis and promotes a mesenchymal phenotype. Mechanistically, miR-29b inhibits metastasis by targeting a network of pro-metastatic regulators involved in angiogenesis, collagen remodelling and proteolysis, including VEGFA, ANGPTL4, PDGF, LOX and MMP9, and targeting ITGA6, ITGB1 and TGFB, thereby indirectly affecting differentiation and epithelial plasticity. The discovery that a GATA3-miR-29b axis regulates the tumour microenvironment and inhibits metastasis opens up possibilities for therapeutic intervention in breast cancer.
LinkOut: [PMID: 23354167]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 6 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions RL-95-2 , HEC-1-B
Disease 0.0
Location of target site 3'UTR
Original Description (Extracted from the article) ... "Compared with the adjacent normal tissues ...

- Chen HX; Xu XX; Tan BZ; Zhang Z; Zhou XD, 2017, Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology.

Article - Chen HX; Xu XX; Tan BZ; Zhang Z; Zhou XD
- Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 2017
OBJECTIVE: The purpose of this study is to explore the effects of microRNA-29b (miR-29b) regulating MAPK/ERK and PI3K/Akt signaling pathways on angiogenesis in endometrial carcinoma (EC) by targeting VEGFA. METHODS: Between February 2013 and April 2015, 126 EC patients admitted to the Second Affiliated Hospital of Nanchang University were randomly selected, with 126 EC tissues and the corresponding adjacent normal tissues collected after surgery. The human EC cell lines RL-95-2 and HEC-1-B and human endometrial cells were assigned to the normal group (human endometrial cells), the blank group (untransfected RL-95-2 or HEC-1-B cells), the pMIR-control group (RL-95-2 or HEC-1-B cells transfected with an empty vector), the pMIR-miR-29b group (RL-95-2 or HEC-1-B cells transfected with the miR-29b plasmid), LNA-control group (RL-95-2 or HEC-1-B cells transfected with an oligonucleotide inhibitors control), the LNA-miR-29b inhibitors group (RL-95-2 or HEC-1-B cells transfected with miRCURY LNATM miR-29b inhibitors), the LNA-miR-29b inhibitors + PD98059 group (RL-95-2 or HEC-1-B cells transfected with miRCURY LNATM miR-29b inhibitors and PD98059, an inhibitor of the MAPK/ERK signaling pathway) and the LNA-miR-29b inhibitors + wortmannin group (RL-95-2 or HEC-1-B cells transfected with miRCURY LNATM miR-29b inhibitors and wortmannin, an inhibitor of the PI3K/Akt signaling pathway). qRT-PCR and Western blotting were conducted to detect the miR-29b expression and the mRNA and protein expressions of VEGFA, ERK, Akt, mTOR and Bcl-2. Immunohistochemistry (IHC) was performed to determine the microvessel density (MVD) expression in the EC tissues, adjacent normal tissues and nude-mice. RESULTS: Compared with the adjacent normal tissues, miR-29b expression was down-regulated, the mRNA and protein expressions of VEGFA, ERK, Akt, mTOR and Bcl-2 were up-regulated, and MVD expression was increased in the EC tissues. Compared with the normal group, miR-29b expression was down-regulated, while the mRNA and protein expressions of VEGFA, ERK, Akt, mTOR and Bcl-2 were up-regulated in the other groups. Compared with the blank, pMIR-control and LNA-control groups, miR-29b expression was increased, while mRNA and protein expressions of VEGFA, ERK, Akt, mTOR and Bcl-2 were decreased in the pMIR-miR-29b group. The LNA-miR-29b inhibitors group exhibited elevated miR-29b expression and decreased mRNA and protein expressions of VEGFA, ERK, Akt, mTOR and Bcl-2 (All P < 0.05). Additionally, miR-29b expression was reduced in the LNA-miR-29b inhibitors + PD98059 and LNA-miR-29b inhibitors + wortmannin groups. In comparison to the normal group, MVD expression was elevated in the other groups. Compared with the blank, pMIR-control, LNA-control, LNA-miR-29b inhibitors + PD98059 and LNA-miR-29b inhibitors + wortmannin groups, MVD expression was decreased in the pMIR-miR-29b group but increased in the LNA-miR-29b inhibitors group. CONCLUSION: Our results indicate that miR-29b negatively modulates the MAPK/ERK and PI3K/Akt signaling pathways to inhibit angiogenesis in EC by targeting VEGFA.
LinkOut: [PMID: 28222438]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000372067.3 | 3UTR | UUAUCAUUUAUUUAUUGGUGCUACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000372067.3 | 3UTR | UUAUCAUUUAUUUAUUGGUGCUACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000372067.3 | 3UTR | UUAUCAUUUAUUUAUUGGUGCUACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000372067.3 | 3UTR | UUAUCAUUUAUUUAUUGGUGCUACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.683 1.6e-4 0.378 3.8e-2 23 Click to see details
GSE38226 Liver fibrosis -0.431 2.6e-2 -0.483 1.3e-2 21 Click to see details
GSE21687 Ependynoma primary tumors -0.243 2.7e-2 -0.230 3.4e-2 64 Click to see details
GSE19536 Breast cancer 0.189 3.0e-2 0.147 7.2e-2 100 Click to see details
GSE17306 Multiple myeloma 0.234 5.3e-2 0.203 8.1e-2 49 Click to see details
GSE19783 ER+ ER+ breast cancer 0.317 8.7e-2 0.272 1.2e-1 20 Click to see details
GSE14794 Lymphoblastoid cells -0.131 1.1e-1 -0.149 8.1e-2 90 Click to see details
GSE19783 ER- ER- breast cancer 0.13 1.3e-1 0.073 2.6e-1 79 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.487 1.6e-1 -0.771 3.6e-2 6 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.2 1.7e-1 -0.057 3.9e-1 25 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.205 1.9e-1 -0.418 3.3e-2 20 Click to see details
GSE21032 Prostate cancer 0.088 2.1e-1 0.130 1.2e-1 83 Click to see details
GSE27834 Pluripotent stem cells -0.197 2.3e-1 -0.085 3.8e-1 16 Click to see details
GSE28260 Renal cortex and medulla 0.214 2.4e-1 0.176 2.8e-1 13 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.139 2.5e-1 0.141 2.5e-1 25 Click to see details
GSE17498 Multiple myeloma 0.1 2.7e-1 0.045 3.9e-1 40 Click to see details
GSE26953 Aortic valvular endothelial cells 0.117 2.9e-1 -0.005 4.9e-1 24 Click to see details
GSE28544 Breast cancer -0.105 3.1e-1 -0.320 6.4e-2 24 Click to see details
GSE19350 CNS germ cell tumors -0.095 3.8e-1 -0.224 2.4e-1 12 Click to see details
GSE32688 Pancreatic cancer 0.001 5.0e-1 -0.160 1.9e-1 32 Click to see details
GSE32688 Pancreatic cancer 0.001 5.0e-1 -0.160 1.9e-1 32 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
UCEC -0.671 0 -0.714 0 19 Click to see details
STAD 0.504 0 0.467 0 32 Click to see details
CHOL -0.799 0 -0.800 0 9 Click to see details
BLCA 0.52 0.01 0.447 0.03 18 Click to see details
BRCA 0.216 0.02 0.206 0.03 84 Click to see details
KICH -0.382 0.03 0.026 0.45 25 Click to see details
KIRP 0.293 0.05 0.356 0.02 32 Click to see details
ESCA 0.437 0.09 0.227 0.25 11 Click to see details
CESC -0.955 0.1 -0.500 0.33 3 Click to see details
COAD 0.498 0.1 0.429 0.14 8 Click to see details
KIRC 0.125 0.15 0.087 0.24 68 Click to see details
THCA -0.13 0.16 -0.072 0.29 59 Click to see details
LIHC -0.14 0.17 -0.116 0.21 49 Click to see details
PRAD -0.128 0.19 -0.157 0.14 50 Click to see details
PCPG -0.765 0.22 -0.500 0.33 3 Click to see details
LUAD -0.093 0.39 0.028 0.47 12 Click to see details
HNSC -0.045 0.39 -0.074 0.32 42 Click to see details
LUSC -0.02 0.45 -0.007 0.48 38 Click to see details
PAAD 0.087 0.46 0.000 0.5 4 Click to see details
PAAD 0.087 0.46 0.000 0.5 4 Click to see details
PAAD 0.087 0.46 0.000 0.5 4 Click to see details
248 hsa-miR-29b-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000095 TGFB3 transforming growth factor beta 3 2 1
MIRT000096 HDAC4 histone deacetylase 4 4 4
MIRT000097 CTNNBIP1 catenin beta interacting protein 1 4 4
MIRT000098 COL5A3 collagen type V alpha 3 chain 2 2
MIRT000099 COL4A2 collagen type IV alpha 2 chain 2 2
MIRT000100 COL1A1 collagen type I alpha 1 chain 8 8
MIRT000101 ACVR2A activin A receptor type 2A 1 1
MIRT000445 SP1 Sp1 transcription factor 5 6
MIRT000684 CDK6 cyclin dependent kinase 6 6 5
MIRT000930 BACE1 beta-secretase 1 3 1
MIRT002310 SFPQ splicing factor proline and glutamine rich 3 1
MIRT002316 DNAJB11 DnaJ heat shock protein family (Hsp40) member B11 3 1
MIRT003026 DNMT3B DNA methyltransferase 3 beta 4 7
MIRT003029 DNMT3A DNA methyltransferase 3 alpha 5 9
MIRT003287 MCL1 MCL1, BCL2 family apoptosis regulator 7 20
MIRT003290 BCL2 BCL2, apoptosis regulator 4 3
MIRT003661 DNMT1 DNA methyltransferase 1 4 2
MIRT003736 S100B S100 calcium binding protein B 3 1
MIRT003813 VEGFA vascular endothelial growth factor A 9 9
MIRT004308 ESR1 estrogen receptor 1 2 1
MIRT004312 NCOA3 nuclear receptor coactivator 3 2 1
MIRT004419 TET1 tet methylcytosine dioxygenase 1 4 2
MIRT004510 TCL1A T-cell leukemia/lymphoma 1A 5 4
MIRT005381 Mmp15 matrix metallopeptidase 15 3 1
MIRT005383 MMP15 matrix metallopeptidase 15 2 1
MIRT005385 MMP24 matrix metallopeptidase 24 4 2
MIRT005387 Mmp24 matrix metallopeptidase 24 2 1
MIRT005486 GRN granulin precursor 4 1
MIRT005522 FGG fibrinogen gamma chain 2 1
MIRT005533 FGA fibrinogen alpha chain 2 1
MIRT005534 FGB fibrinogen beta chain 2 1
MIRT005567 COL3A1 collagen type III alpha 1 chain 5 4
MIRT005568 COL4A1 collagen type IV alpha 1 chain 7 9
MIRT005570 MMP2 matrix metallopeptidase 2 5 8
MIRT005614 BBC3 BCL2 binding component 3 2 2
MIRT005667 ADAM12 ADAM metallopeptidase domain 12 5 3
MIRT005669 NID1 nidogen 1 4 1
MIRT006054 HMGA2 high mobility group AT-hook 2 3 1
MIRT006058 TGFB2 transforming growth factor beta 2 3 2
MIRT006059 TGFB1 transforming growth factor beta 1 2 1
MIRT006060 BMP1 bone morphogenetic protein 1 3 2
MIRT006098 PTEN phosphatase and tensin homolog 7 3
MIRT006251 NASP nuclear autoantigenic sperm protein 2 1
MIRT006486 PPP1R13B protein phosphatase 1 regulatory subunit 13B 2 1
MIRT006488 CDC42 cell division cycle 42 4 2
MIRT006753 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT006815 PIK3CG phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma 3 1
MIRT006915 NKIRAS2 NFKB inhibitor interacting Ras like 2 5 3
MIRT007011 RAX retina and anterior neural fold homeobox 2 1
MIRT007033 TBX21 T-box 21 1 1
MIRT007034 IFNG interferon gamma 1 1
MIRT007102 DUSP2 dual specificity phosphatase 2 3 3
MIRT007254 FOS Fos proto-oncogene, AP-1 transcription factor subunit 3 3
MIRT027237 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 2 2
MIRT027238 IMPDH1 inosine monophosphate dehydrogenase 1 2 2
MIRT027239 MYCN MYCN proto-oncogene, bHLH transcription factor 3 3
MIRT048359 SCAF8 SR-related CTD associated factor 8 1 1
MIRT048360 CLDN1 claudin 1 1 1
MIRT048361 MRPS35 mitochondrial ribosomal protein S35 1 1
MIRT048362 RSL24D1 ribosomal L24 domain containing 1 1 1
MIRT048363 LRP10 LDL receptor related protein 10 1 1
MIRT048364 HP1BP3 heterochromatin protein 1 binding protein 3 1 1
MIRT048365 B4GALT5 beta-1,4-galactosyltransferase 5 1 1
MIRT048366 KIAA1671 KIAA1671 1 1
MIRT048367 NNT nicotinamide nucleotide transhydrogenase 1 1
MIRT048368 IFIH1 interferon induced with helicase C domain 1 1 1
MIRT048369 TPT1 tumor protein, translationally-controlled 1 1 1
MIRT048370 RUNDC3B RUN domain containing 3B 1 1
MIRT048371 CECR2 CECR2, histone acetyl-lysine reader 1 1
MIRT048372 TPD52L2 tumor protein D52 like 2 1 1
MIRT048373 NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit 1 1
MIRT048374 CIT citron rho-interacting serine/threonine kinase 1 1
MIRT048375 GNB2L1 receptor for activated C kinase 1 1 1
MIRT048376 SMARCC1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin subfamily c member 1 1 1
MIRT048377 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 1
MIRT048378 PIGN phosphatidylinositol glycan anchor biosynthesis class N 1 1
MIRT048379 RPS4X ribosomal protein S4, X-linked 1 1
MIRT048380 CCSAP centriole, cilia and spindle associated protein 1 1
MIRT048381 CALU calumenin 1 1
MIRT048382 NREP neuronal regeneration related protein 1 1
MIRT048383 MKI67 marker of proliferation Ki-67 1 1
MIRT053293 TDG thymine DNA glycosylase 5 5
MIRT053581 CCND2 cyclin D2 5 3
MIRT053738 COL4A5 collagen type IV alpha 5 chain 1 1
MIRT053739 COL7A1 collagen type VII alpha 1 chain 1 1
MIRT053740 COL15A1 collagen type XV alpha 1 chain 1 1
MIRT053741 COL2A1 collagen type II alpha 1 chain 1 1
MIRT053742 COL4A6 collagen type IV alpha 6 chain 1 1
MIRT053743 CSGALNACT2 chondroitin sulfate N-acetylgalactosaminyltransferase 2 1 1
MIRT053744 SOX12 SRY-box 12 1 1
MIRT053745 MAP2K6 mitogen-activated protein kinase kinase 6 1 1
MIRT053746 TGIF2 TGFB induced factor homeobox 2 1 1
MIRT053747 SERPINH1 serpin family H member 1 2 2
MIRT053748 NOTCH2 notch 2 4 1
MIRT053749 PPARD peroxisome proliferator activated receptor delta 1 1
MIRT054045 SNAI3 snail family transcriptional repressor 3 2 1
MIRT054192 AKT2 AKT serine/threonine kinase 2 4 2
MIRT054574 PER1 period circadian clock 1 3 1
MIRT060983 LAMC1 laminin subunit gamma 1 3 1
MIRT061662 BTG2 BTG anti-proliferation factor 2 2 4
MIRT067385 TMTC3 transmembrane and tetratricopeptide repeat containing 3 2 4
MIRT079942 RNF138 ring finger protein 138 2 2
MIRT080798 SH3GLB1 SH3 domain containing GRB2 like, endophilin B1 2 4
MIRT081893 KCTD15 potassium channel tetramerization domain containing 15 2 8
MIRT082515 CALM3 calmodulin 3 2 2
MIRT085293 CCNT2 cyclin T2 2 6
MIRT102856 INSIG1 insulin induced gene 1 2 2
MIRT207249 TET3 tet methylcytosine dioxygenase 3 2 2
MIRT207755 VHL von Hippel-Lindau tumor suppressor 2 4
MIRT210969 TET2 tet methylcytosine dioxygenase 2 1 1
MIRT211650 ABCE1 ATP binding cassette subfamily E member 1 2 2
MIRT213230 REST RE1 silencing transcription factor 2 10
MIRT225103 GOLGA7 golgin A7 2 2
MIRT250481 MAZ MYC associated zinc finger protein 2 2
MIRT264266 FAM102B family with sequence similarity 102 member B 2 2
MIRT267090 ZFP91 ZFP91 zinc finger protein 2 2
MIRT303363 MXD1 MAX dimerization protein 1 2 1
MIRT316344 ULBP2 UL16 binding protein 2 2 2
MIRT401476 AIM1 crystallin beta-gamma domain containing 1 2 1
MIRT437369 LAMC2 laminin subunit gamma 2 3 1
MIRT437372 ITGA6 integrin subunit alpha 6 3 2
MIRT437552 COL5A2 collagen type V alpha 2 chain 1 1
MIRT437553 COL10A1 collagen type X alpha 1 chain 1 1
MIRT437554 SPARC secreted protein acidic and cysteine rich 1 1
MIRT437555 FBN1 fibrillin 1 1 1
MIRT437556 LOX lysyl oxidase 2 2
MIRT437557 PDGFRB platelet derived growth factor receptor beta 2 2
MIRT437710 PHACTR2 phosphatase and actin regulator 2 2 1
MIRT437713 TUBB2A tubulin beta 2A class IIa 2 1
MIRT437716 EMP1 epithelial membrane protein 1 2 1
MIRT437719 SNX24 sorting nexin 24 2 1
MIRT437722 AMFR autocrine motility factor receptor 2 1
MIRT437725 RIOK3 RIO kinase 3 2 1
MIRT437728 WDR26 WD repeat domain 26 4 3
MIRT437731 DSC2 desmocollin 2 2 1
MIRT437870 IL32 interleukin 32 1 1
MIRT438911 GATA3 GATA binding protein 3 2 1
MIRT438912 PDGFRA platelet derived growth factor receptor alpha 2 1
MIRT438913 PDGFC platelet derived growth factor C 2 1
MIRT438914 PDGFB platelet derived growth factor subunit B 2 1
MIRT438915 PDGFA platelet derived growth factor subunit A 2 1
MIRT438916 MMP9 matrix metallopeptidase 9 2 1
MIRT438917 LOXL4 lysyl oxidase like 4 2 1
MIRT438918 LOXL2 lysyl oxidase like 2 2 1
MIRT438919 ITGB1 integrin subunit beta 1 2 1
MIRT438920 ANGPTL4 angiopoietin like 4 2 1
MIRT454812 NEDD9 neural precursor cell expressed, developmentally down-regulated 9 2 2
MIRT456827 MORF4L2 mortality factor 4 like 2 2 8
MIRT462151 RPL22 ribosomal protein L22 2 2
MIRT465314 TRAM2 translocation associated membrane protein 2 2 2
MIRT467808 SLC2A14 solute carrier family 2 member 14 2 2
MIRT467829 SLC29A2 solute carrier family 29 member 2 2 2
MIRT467971 SLC16A1 solute carrier family 16 member 1 2 4
MIRT468225 SGK1 serum/glucocorticoid regulated kinase 1 2 2
MIRT469448 REL REL proto-oncogene, NF-kB subunit 2 2
MIRT469723 RAB40C RAB40C, member RAS oncogene family 2 2
MIRT469841 R3HDM4 R3H domain containing 4 2 2
MIRT472643 NAA40 N(alpha)-acetyltransferase 40, NatD catalytic subunit 2 2
MIRT474209 LEPRE1 prolyl 3-hydroxylase 1 1 1
MIRT474576 KLHDC3 kelch domain containing 3 2 2
MIRT475837 HDGF heparin binding growth factor 2 4
MIRT476721 FRK fyn related Src family tyrosine kinase 2 4
MIRT477473 ELMSAN1 ELM2 and Myb/SANT domain containing 1 2 2
MIRT478668 CTC1 CST telomere replication complex component 1 2 14
MIRT478710 CSRNP2 cysteine and serine rich nuclear protein 2 2 2
MIRT478985 COMMD2 COMM domain containing 2 2 2
MIRT479826 CCNA2 cyclin A2 2 8
MIRT479901 CCDC117 coiled-coil domain containing 117 2 2
MIRT480066 CAND1 cullin associated and neddylation dissociated 1 2 2
MIRT482012 AMER1 APC membrane recruitment protein 1 2 8
MIRT489024 C1QTNF6 C1q and TNF related 6 5 2
MIRT492513 RAET1L retinoic acid early transcript 1L 2 2
MIRT493825 FSCN1 fascin actin-bundling protein 1 2 2
MIRT495936 SLC7A5P2 solute carrier family 7 member 5 pseudogene 2 2 2
MIRT496358 PPY pancreatic polypeptide 2 2
MIRT496662 TMEM237 transmembrane protein 237 2 2
MIRT497644 GLDN gliomedin 2 2
MIRT501878 MORF4L1 mortality factor 4 like 1 2 8
MIRT502932 CDC42SE1 CDC42 small effector 1 2 4
MIRT506750 LDOC1L retrotransposon Gag like 6 2 6
MIRT507168 GAS2L3 growth arrest specific 2 like 3 2 2
MIRT514918 MDM2 MDM2 proto-oncogene 2 6
MIRT523962 DYNLT1 dynein light chain Tctex-type 1 2 4
MIRT527675 CASP8 caspase 8 2 2
MIRT536936 HECW1 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 2 2
MIRT537359 FJX1 four jointed box 1 2 2
MIRT537687 ENPP2 ectonucleotide pyrophosphatase/phosphodiesterase 2 2 2
MIRT538124 DDX6 DEAD-box helicase 6 2 2
MIRT538813 C21orf91 chromosome 21 open reading frame 91 2 2
MIRT546938 PTP4A1 protein tyrosine phosphatase type IVA, member 1 2 2
MIRT547104 PLAG1 PLAG1 zinc finger 2 2
MIRT547823 ISG20L2 interferon stimulated exonuclease gene 20 like 2 2 2
MIRT548237 FEM1B fem-1 homolog B 2 2
MIRT550036 WWTR1 WW domain containing transcription regulator 1 2 2
MIRT552619 ZBTB5 zinc finger and BTB domain containing 5 2 2
MIRT556562 LIMS1 LIM zinc finger domain containing 1 2 2
MIRT558857 CDC23 cell division cycle 23 2 2
MIRT565485 SPRTN SprT-like N-terminal domain 2 2
MIRT568205 CBX6 chromobox 6 2 2
MIRT576774 Tmem127 transmembrane protein 127 2 2
MIRT576958 Pigs phosphatidylinositol glycan anchor biosynthesis, class S 2 3
MIRT610003 PIGS phosphatidylinositol glycan anchor biosynthesis class S 2 3
MIRT616511 COX7A2L cytochrome c oxidase subunit 7A2 like 2 2
MIRT640887 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 2
MIRT641350 RAB11FIP1 RAB11 family interacting protein 1 2 2
MIRT642978 TESPA1 thymocyte expressed, positive selection associated 1 2 2
MIRT643634 YY2 YY2 transcription factor 2 2
MIRT644386 ZNF286A zinc finger protein 286A 2 2
MIRT650749 YAE1D1 Yae1 domain containing 1 2 2
MIRT661585 EPHX2 epoxide hydrolase 2 2 2
MIRT664287 RNMTL1 mitochondrial rRNA methyltransferase 3 2 2
MIRT689393 ZNF850 zinc finger protein 850 2 2
MIRT693815 SEC31A SEC31 homolog A, COPII coat complex component 2 2
MIRT694532 TRIM72 tripartite motif containing 72 2 2
MIRT694628 ZFPM1 zinc finger protein, FOG family member 1 2 2
MIRT695135 PRY2 PTPN13-like, Y-linked 2 2 2
MIRT695152 PRY PTPN13-like, Y-linked 2 2
MIRT703640 FBRS fibrosin 2 2
MIRT704551 CNBP CCHC-type zinc finger nucleic acid binding protein 2 2
MIRT704967 CBX2 chromobox 2 2 2
MIRT705497 ASXL2 additional sex combs like 2, transcriptional regulator 2 2
MIRT707993 OTUD4 OTU deubiquitinase 4 2 2
MIRT708741 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT710621 COLEC10 collectin subfamily member 10 2 2
MIRT713056 IFRD1 interferon related developmental regulator 1 2 2
MIRT715515 MAPKBP1 mitogen-activated protein kinase binding protein 1 2 2
MIRT720770 FAM193A family with sequence similarity 193 member A 2 2
MIRT731925 AQP4 aquaporin 4 3 1
MIRT732673 HMGB1 high mobility group box 1 3 0
MIRT734350 IL6 interleukin 6 1 0
MIRT734351 TP53 tumor protein p53 1 0
MIRT734565 BCL2L11 BCL2 like 11 2 0
MIRT734770 TRIM44 tripartite motif containing 44 2 0
MIRT734771 CCNE1 cyclin E1 2 0
MIRT735260 STAT3 signal transducer and activator of transcription 3 6 1
MIRT735414 HBP1 HMG-box transcription factor 1 3 0
MIRT735537 HIF3A hypoxia inducible factor 3 alpha subunit 3 0
MIRT735639 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 3 0
MIRT735641 AKT3 AKT serine/threonine kinase 3 3 0
MIRT735943 DNM3OS DNM3 opposite strand/antisense RNA 4 0
MIRT737493 SMAD3 SMAD family member 3 1 0
MIRT737577 SNAI1 snail family transcriptional repressor 1 2 0
MIRT755941 SLMAP sarcolemma associated protein 4 1
MIRT755963 ROBO1 roundabout guidance receptor 1 5 1
MIRT755964 SRGAP2 SLIT-ROBO Rho GTPase activating protein 2 5 1
MIRT756271 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon 3 1
MIRT756364 LIN7A lin-7 homolog A, crumbs cell polarity complex component 2 1
MIRT756474 COL5A1 collagen type V alpha 1 chain 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-29b 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray Pancreatic Cancer MiaPACA-2 cells 19407485 2009 up-regulated
miR-29b 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray Pancreatic Cancer PANC-1 cells 19407485 2009 up-regulated
miR-29b 5-aza-2'-deoxycytidine (5-Aza-CdR) + trichostatin A(TSA) NULL NULL Microarray Pancreatic Cancer MiaPACA-2 cells 19407485 2009 up-regulated
miR-29b 5-aza-2'-deoxycytidine (5-Aza-CdR) + trichostatin A(TSA) NULL NULL Microarray Pancreatic Cancer PANC-1 cells 19407485 2009 up-regulated
miR-29b Trichostatin A (TSA) NULL 444732 Microarray Pancreatic Cancer MiaPACA-2 cells 19407485 2009 up-regulated
miR-29b Trichostatin A (TSA) NULL 444732 Microarray Pancreatic Cancer PANC-1 cells 19407485 2009 up-regulated
miR-29b Glucose NULL 5793 Microarray proximal tubule cell line HK-2 20067797 2010 down-regulated
miR-29b Dihydrotestosterone(DHT) NULL 10635 Microarray prostate cancer 20945501 2011 up-regulated
miR-29b Dihydrotestosterone(DHT) NULL 10635 Quantitative real-time PCR prostate cancer 20945501 2011 up-regulated
miR-29b Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-29b Enoxacin approved 3229 Quantitative real-time PCR HCT-116 and RKO colon cancer cell lines 21368194 2011 up-regulated
miR-29b Ginsenoside Rh2 NULL 119307 Microarray human glioma cells U251 21372826 2011 up-regulated
miR-29b Testosterone + 1,25-Dihydroxyvitamin D3 approved NULL Microarray prostate cancer 21592394 2011 up-regulated
miR-29b Progesterone approved 5994 Microarray Breast cancer 22330642 2012 down-regulated
miR-29b Progesterone approved 5994 Quantitative real-time PCR Breast cancer 22330642 2012 down-regulated
miR-29b Trastuzumab approved NULL Microarray SKBR3 cells. 22384020 2012 up-regulated
miR-29b Glucocorticoid NULL NULL Quantitative real-time PCR Eosinophilic esophagitis 22815788 2012 up-regulated
miR-29b Glucocorticoid NULL NULL TaqMan low-density array Eosinophilic esophagitis 22815788 2012 up-regulated
miR-29b CCl4 NULL 5943 Quantitative real-time PCR liver 22393047 2012 down-regulated
miR-29b Estrogen NULL NULL Quantitative real-time PCR liver 22393047 2012 up-regulated
miR-29b Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 down-regulated
miR-29b 5-aminoimidazole-4-carboxamide-1-β-d-ribofuranoside (AICAR) NULL 16078949 Microarray hepatocytes 23107762 2013 down-regulated
miR-29b Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-29b Phenethyl isothiocyanate(PEITC) NULL 16741 Microarray neonatal mice liver 20145010 2010 down-regulated
miR-29b Benzo(a)pyrene NULL 2336 Microarray Adult male B6C3F1 mice 21569818 2011 up-regulated
miR-29b Cocaine NULL 446220 Next-generation sequencing ventral striatum 21708909 2011 down-regulated
miR-29b Urethane NULL 5641 Quantitative real-time PCR mouse lung 24361357 2014 down-regulated
miR-29b Ethanol NULL 702 Quantitative real-time PCR Cerebellar Granule Neurons cells 24554719 2014 down-regulated
miR-29b Rapamycin approved 5284616 Quantitative real-time PCR HL-1 cells 25062042 2014 up-regualted
miR-29b Estradiol benzoate (EB) NULL NULL Quantitative real-time PCR adult germ cell 22334722 2012 up-regulated
miR-29b Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 up-regulated
miR-29b-3p Docosahexaenoic acid NULL 445580 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-29b Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (HepG2, SK-HEP-1)
hsa-miR-29b-3p (1S,10R,12R,14R,15S)-15-hydroxyspiro[13,16-dioxapentacyclo[8.5.1.01,10.03,8.012,14]hexadeca-3,5,7-triene-11,3'-2,4-dioxatricyclo[7.3.1.05,13]trideca-1(12),5,7,9(13),10-pentaene]-2,9-dione 388424 NSC683332 resistant
hsa-miR-29b-3p (5Z)-5-[(4-oxothieno[2,3-b]thiochromen-2-yl)methylidene]-2-sulfanylideneimidazolidin-4-one 5468927 NSC679240 resistant
hsa-miR-29b-3p (6aS)-3-[5-[4-(2-diethoxyphosphorylethyl)piperazin-1-yl]pentoxy]-2-methoxy-6a,7,8,9-tetrahydropyrrolo[2,1-c][1,4]benzodiazepin-11-one 25113728 NSC744025 resistant
hsa-miR-29b-3p 1-adamantylmethyl 4-[(2,5-dihydroxyphenyl)methylamino]benzoate 391131 NSC689857 resistant
hsa-miR-29b-3p 2-((5-methyl-3-isoxazolyl)amino)-4-((5-methyl-3-isoxazolyl)imino)-1(4h)-naphthalenone 373420 NSC649750 sensitive
hsa-miR-29b-3p 2-(1-adamantyl)ethyl 4-[(2,5-dihydroxyphenyl)methylamino]benzoate 403758 NSC719177 resistant
hsa-miR-29b-3p 2-(3-(2-methoxy-4-(4-methylene-5-oxotetrahydro-2-furanyl)phenoxy)propyl)-1h-isoindole-1,3(2h)-dione 381521 NSC668277 resistant
hsa-miR-29b-3p 2-[(dimethylamino)methyl]-3-[(Z)-heptadec-10-enyl]-5-methoxybenzene-1,4-diol;hydrochloride 5387959 NSC630004 resistant
hsa-miR-29b-3p 2-[[(E)-3-(2-chlorophenyl)prop-2-enoyl]amino]-5-iodobenzamide 53329762 NSC748148 resistant
hsa-miR-29b-3p 2-acetylimidazo[4,5-b]pyridin 4 tolyl 3 thiosemicarbazone 135440014 NSC674106 resistant
hsa-miR-29b-3p 2-amino-1-N,9-N-bis[10-[(4-hydroxyphenyl)methyl]-7,11,14-trimethyl-2,5,9,12,15-pentaoxo-3-propan-2-yl-8-oxa-1,4,11,14-tetrazabicyclo[14.3.0]nonadecan-6-yl]-4,6-dimethyl-3-oxophenoxazine-1,9-dicarboxamide 16129921 NSC684901 resistant
hsa-miR-29b-3p 2-amino-1-N,9-N-bis[10-[(4-methoxyphenyl)methyl]-7,11,14-trimethyl-2,5,9,12,15-pentaoxo-3-propan-2-yl-8-oxa-1,4,11,14-tetrazabicyclo[14.3.0]nonadecan-6-yl]-4,6-dimethyl-3-oxophenoxazine-1,9-dicarboxamide 16129907 NSC684908 resistant
hsa-miR-29b-3p 2-amino-9-chloro-3,5-bis(4-chlorophenyl)pyrimido[4,5-c]quinolin-1-one 16126264 NSC741296 resistant
hsa-miR-29b-3p 2,3-bis(4,5-dimethyl-3,6-dioxo-cyclohexa-1,4-dien-1-yl)-5,6-dimethyl-1,4-benzoquinone 394545 NSC698090 sensitive
hsa-miR-29b-3p 3-(4-chlorophenyl)-5-methyl-[1,2]oxazolo[5,4-d]triazin-4-one 399226 NSC709900 resistant
hsa-miR-29b-3p 4-[4-[2,3-bis(hydroxymethyl)pyrrol-1-yl]butanoylamino]-n-[5-[[5-[3-(dimethylamino)propylcarbamoyl]-1-methylpyrrol-3-yl]carbamoyl]-1-methylpyrrol-3-yl]-1-methylpyrrole-2-carboxamide 384021 NSC673131 resistant
hsa-miR-29b-3p 5-(4-methoxyphenyl)-3-(3,4,5-trimethoxyphenyl)-4,5-dihydro-1h-pyrazole 49865894 NSC748404 resistant
hsa-miR-29b-3p 5,11-dimethyl-1h-benzo[a]carbazole-1,4(11h)-dione 372651 NSC648148 resistant
hsa-miR-29b-3p Acetic acid;3-[4-(2-hydroxyethyl)piperidin-1-yl]-N-[6-[3-[4-(2-hydroxyethyl)piperidin-1-yl]propanoylamino]-9,10-dioxoanthracen-2-yl]propanamide 374314 NSC651841 resistant
hsa-miR-29b-3p Beacon red 135421797 NSC12455 resistant
hsa-miR-29b-3p Benzoic acid, 3,4,5-trihydroxy-, phenyl ester 333279 NSC333571 resistant
hsa-miR-29b-3p Csa13 24205348 NSC735211 sensitive
hsa-miR-29b-3p Mefloquine hydrochloride 456309 NSC157387 sensitive
hsa-miR-29b-3p Methyl 3-hydroxy-3-[(15R)-15-tetracyclo[6.6.2.02,7.09,14]hexadeca-2,4,6,9,11,13-hexaenyl]propanedithioate 383730 NSC672159 resistant
hsa-miR-29b-3p Methyl 6-[[(3S,4aR,6aR,6bS,8R,8aR,12aS,14aR,14bR)-8a-[3-[3,4-dihydroxy-6-methyl-5-(3,4,5-trihydroxyoxan-2-yl)oxyoxan-2-yl]oxy-4,5-dihydroxyoxan-2-yl]oxycarbonyl-8-hydroxy-4,4,6a,6b,11,11,14b-heptamethyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropi 385532 NSC676788 sensitive
hsa-miR-29b-3p Naphth[2,3-d]oxazol-9-one, 2-methyl-4-(phenylimino)- 160386 NSC650573 sensitive
hsa-miR-29b-3p NSC148077 NSC148077 resistant
hsa-miR-29b-3p NSC175490 NSC175490 resistant
hsa-miR-29b-3p NSC175493 NSC175493 resistant
hsa-miR-29b-3p NSC85701 NSC85701 resistant
hsa-miR-29b-3p Oxin 1923 NSC2039 approved resistant
hsa-miR-29b-3p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Etoposide 36462 NSC141540 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved resistant High Breast Cancer cell line (MDA-435)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive High Breast Cancer cell line (MDA-MB-435, MDA-MB-436, SKBr3, BT-474, MDA-MB-231, MCF7)
hsa-miR-29b-3p Imatinib 5291 NSC743414 approved resistant High Myelogenous Leukemia cell line (MYL)
hsa-miR-29b-3p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7, LY2)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-miR-29b-3p Cyclopamine 442972 NSC734950 resistant Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved resistant Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-29b-3p Etoposide 36462 NSC141540 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Decitabine 451668 approved sensitive Low Acute Myeloid Leukemia tissue and cell line (Kasumi-1, NB4, FDC-P1-KITmut)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved resistant High Bladder Cancer cell line (RT4, J82,TCCSUP, UM-UC-3,RT112,CUBIII)
hsa-miR-29b-3p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (RKO)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved sensitive Low Cholangiocarcinoma cell line (HuCCT1, HuH28)
hsa-miR-29b-3p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-29b-3p Ethanol 702 NSC85228 approved resistant Low Cerebellum Granule Neuron tissue
hsa-miR-29b-3p Chemotherapy sensitive Low Ovarian Cancer tissue
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive Low Ovarian Cancer cell line (ES2, AMOC2)
hsa-miR-29b-3p Fluorouracil 3385 NSC19893 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-29b-3p Bortezomib 387447 NSC681239 approved sensitive Low Melanoma cell line (RPMI8226)
hsa-miR-29b-3p Carfilzomib 11556711 NSC756640 approved sensitive Low Melanoma cell line (RPMI8226)
hsa-miR-29b-3p Ixazomib 25183872 approved sensitive Low Melanoma cell line (RPMI8226)
hsa-miR-29b-3p Interferon-Gamma sensitive Low Colorectal Cancer cell line (HCT-116, HT-29, LS174T, SW480,SW620, HEK293)
hsa-miR-29b-3p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR200)
hsa-miR-29b-3p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR70)
hsa-miR-29b-3p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Platinum 23939 resistant Low Ovarian Cancer tissue
hsa-miR-29b-3p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-29b-3p Imatinib 5291 NSC743414 approved resistant High Gastrointestinal Stromal Tumor cell line (882R-NC, 882R-OE, 882R-KD)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549, H1299)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive High Gallbladder Cancer cell line (GBC-SD, NOZ)
hsa-miR-29b-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-29b-3p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-29b-3p Curcumin 969516 NSC32982 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved resistant High Cholangiocarcinoma cell line (CCLP-1, MzChA-1)
hsa-miR-29b-3p Oxaliplatin 6857599 NSC266046 approved sensitive Low Colorectal Cancer cell line (SW480)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (PC-3-R)
hsa-miR-29b-3p Methotrexate 126941 NSC740 approved sensitive Low Osteosarcoma tissue and cell line (MG-63, U-2-OS)
hsa-miR-29b-3p Crizotinib 11626560 NSC749005 approved resistant High Non-Small Cell Lung Cancer cell line (NCI-H2228, DFCI032)
hsa-miR-29b-3p Lorlatinib 71731823 NSC780108 approved resistant High Non-Small Cell Lung Cancer cell line (NCI-H2228, DFCI032)
hsa-miR-29b-3p Doxorubicin 31703 NSC123127 approved sensitive Low Osteosarcoma cell line (MG-63)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved sensitive Low Pancreatic Cancer cell line (PANC-1 cell, BXPC-3)
hsa-miR-29b-3p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7, MCF-7-21)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive Low Endometrial Cancer cell line (HEC-1-B)
hsa-miR-29b-3p Fluorouracil 3385 NSC19893 approved sensitive High Colorectal Cancer cell line (HT-29)
hsa-miR-29b-3p Oxaliplatin 6857599 NSC266046 approved sensitive Low Colon Cancer cell line (SW480, SW620)
hsa-miR-29b-3p Temozolomide 5394 NSC362856 approved sensitive Low Glioma cell line (LN229, U87MG, U251)
hsa-miR-29b-3p Temozolomide 5394 NSC362856 approved sensitive Low Glioblastoma cell line (U251, U87MG)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-29b-3p Oxaliplatin 6857599 NSC266046 approved sensitive Low Colorectal Cancer cell line (HT-29, DLD1)
hsa-miR-29b-3p Bortezomib 387447 NSC681239 approved resistant Low Multiple Myeloma tissue
hsa-miR-29b-3p Palbociclib 5330286 NSC758247 approved sensitive High Breast Cancer cell line (MDA-MB-231, Hs578t, SKBR3, MCF-7)
hsa-miR-29b-3p Temozolomide 5394 NSC362856 approved sensitive Low Glioma tissue
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-29b-3p Fluorouracil 3385 NSC19893 approved resistant Low Colorectal Cancer cell line (HT-29, HCT-116, SW480, SW620, LoVo, SW48, DLD-1, Caco-1, HCT-15)
hsa-miR-29b-3p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-29b-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (mitochondrial RNA)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (cytosolic RNA)
hsa-miR-29b-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-29b-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (SKVO3ip1)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved resistant cell line (HeyA8)
hsa-miR-29b-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-29b-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-29b-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-29b-3p Exemestane 60198 NSC713563 approved resistant cell line (MCF-7)
hsa-miR-29b-3p Testosterone 6013 NSC9700 approved resistant cell line (MCF-7)
hsa-miR-29b-3p Testosterone+Anastrozole resistant cell line (MCF-7)
hsa-miR-29b-3p Testosterone+Letrozole resistant cell line (MCF-7)
hsa-miR-29b-3p Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved resistant cell line (MGC-803)
hsa-miR-29b-3p 4-Hydroxytamoxifen+Tamoxifen resistant cell line (LY2)
hsa-miR-29b-3p Ethanol+Tamoxifen resistant cell line (LY2)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-29b-3p Pegylated interferon alpha+Ribavirin sensitive tissue (chronic hepatitis C)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (HuH28)
hsa-miR-29b-3p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-29b-3p Tamoxifen 2733525 NSC180973 approved sensitive cell line (TamR4)
hsa-miR-29b-3p Oxaliplatin 6857599 NSC266046 approved sensitive cell line (IGROV-1)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (IGROV-1)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR200)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR70)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-29b-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-29b-3p Bortezomib 387447 NSC681239 approved resistant cell line (CCRF-CEM) (100 nM)
hsa-miR-29b-3p Bortezomib 387447 NSC681239 approved sensitive cell line (CCRF-CEM) (200 nM)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved resistant cell line (OVCAR3)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (H23)
hsa-miR-29b-3p Cetuximab sensitive tissue (colorectal carcinoma)

Error report submission