pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-19b-1 |
Genomic Coordinates | chr13: 91351192 - 91351278 |
Synonyms | MIRN19B1, miR-19b-1, miRNA19B1, MIR19B1 |
Description | Homo sapiens miR-19b-1 stem-loop |
Comment | None |
RNA Secondary Structure | |
Associated Diseases | |
pre-miRNA | hsa-mir-19b-2 |
Genomic Coordinates | chrX: 134169671 - 134169766 |
Synonyms | MIRN19B2, miR-19b-2, MIR19B2 |
Description | Homo sapiens miR-19b-2 stem-loop |
Comment | None |
RNA Secondary Structure | |
Associated Diseases |
Mature miRNA Information | |||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-19b-3p | ||||||||||||||||||
Sequence | 54| UGUGCAAAUCCAUGCAAAACUGA |76 | ||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||
Experiments | Cloned | ||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | HIPK3 | ||||||||||||||||||||
Synonyms | DYRK6, FIST3, PKY, YAK1 | ||||||||||||||||||||
Description | homeodomain interacting protein kinase 3 | ||||||||||||||||||||
Transcript | NM_001048200 | ||||||||||||||||||||
Other Transcripts | NM_005734 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on HIPK3 | |||||||||||||||||||||
3'UTR of HIPK3 (miRNA target sites are highlighted) |
>HIPK3|NM_001048200|3'UTR 1 AAAACAGTATATTGGGGAAGCTCAATGATACAAACATTTGATTAAAAATAAAAACATGGTATTTAATATTAGCCATGGCA 81 CAAGAAAATTATTTTTGAATCATGTAGACTTGGGTGCAATTTAAACAACTTTGAGCTTTAAAAACTCACTTTTGATGTGT 161 TTTGCACATTTGGTATAACTTGTCTTTGGTCATGTTATCTTCTTATGTAGTAACTCTAGACAGGTGACTTATGGGAGCAG 241 AAGTCCAGTTTTGCTCCTGCTATTTTTTATAAATTGCCTTCTAACTAGTGCAAGACACGTCTACATTTGGGAAGCCATTC 321 TGTGTACAGACTTAGAGCAACAGATGCACATATGTCAGAATTACAGCATACAAGTGAATTGTATTATCCGTGTCTTAGTG 401 TATAAATGTTGGGTCACTTACCTAAGAAATTGAGCTATTGTTCTTTACATTTGCATGTGTCTTTTGCATGGGCAAAATGT 481 TGCCTAGACTTTGCTCTTAAATGTTGTTCTAATAATCTCAGCTGCATTGTAAACCGTTCCTACACATAGTGCCTTAAATA 561 TTTGAGGTTGTTAATGTTATTACCTATATATAAATGTTGAGGACTGCAGCACTTAAAATTCAGACCTACTATTTAGTTTC 641 CTTTTGATAGCGTAATGTTCATTTTTGTTTTTGTGTGGTATGATTTCAGGTAGTAGCTGTTTTTTTCCTTATTAAGAGGG 721 CAGCATGTTTGCTATAGCTGAATTCTGCTGTCTGATTTTTCAGAATGATCTAGCTTCAAGAAAAGCAAGCAGTTAGTAGT 801 GCTTAAGAAAAATTGATTCAGTATCTAATGGATAGTTGATAACTGTCACAGCACAGCATTTTATATACTGTTAAGTGAAA 881 CTGCAATACAATCTAAGTTTATTTTGAGAGTGTTTGCTGTATAATTGGACTTAATAAAATGTTTAGAGGTACAGTAGGCA 961 TGACTTTGGGTAGATAATAAAATGCAAAATGCTCATTGATTCATGATGTGGTTTTATCTTAGCTTGGGCAAACCATGCAG 1041 TATTTAATAAATAGTAGCAGAACTTTTACTATTGAAGCTTGAAAAGATGTGAGTTCTTTGTGTGCAATTTTTGATTTATG 1121 CATGTGAGAGGGTTTTTTTTTTTTTTAAGTATTTTTACATTGCAGTACTTGTTTTGCTTGTTGGTGATGTTTGCTTATTT 1201 AATACATTCCGTCAGGGACAGAAATTACATGCTTTTTTTTCTTTCTAGGAAGTGTGTTGAGTTCCCCCCTTCCCCGACAT 1281 TTTTTTCTTTTTTGGGTGGTGGTGATGGTAGTGGTTATGTCTGTTTAAATGAAGTTGCTTTTACAGCACCAAAGACTTAA 1361 TCATCCATTTCCTATATAAAGGTAGCTACTTTTTGCATAGACCTCAAGTATATTGTAGTGTAAAGGTGGAATTTAAGGAA 1441 AGGTATTAAATTGAGGCTGTGTTTTAGCTTACAGGCAAGTAATAAATTGTATCATTTATCTTGAATGTATCATAGATAAG 1521 CTGCTATATAACGATTGCCACTTCAGATAGCTGTGAAATTAGGTGATTAACTAGTTGTTATTTAGCCTTCTAATTTCTGT 1601 ATAAGTCTAATTACATGAATAGAAATTGGGGTTTTGATTTTTTACTTTGCTTTTCTGTTTGGAGTGTCATTGTAACTACT 1681 GTATTGTAAATGGTGGAAAATAATTGCATTTGTTACTTTGGGGTGTGTTATTTGCATCAGTATTTTATCTCTATTAATGT 1761 TTGTGCTCATCACTGCATATTAAAAAAACTTGGATGTATCAGTGTAACTTAATTTTTTATTTTCATACTGGCATTGTAGA 1841 CACTTGAGAAAGCTGTATCTTGCAGGCTTGACTTAACTTTTTTCCTTAAAAATCTGGAATATAATCTTACAGCATTTACT 1921 GGAATAAACAGTACAAAGCATTGGAGTGTAAAACTCTAGATGTTTTGGATTTACAGCGTTTCTTTGATAAATGAATTGTA 2001 TACCACTAGTACAGCTCTAGTACAGCGTTCACAATAAGCTAATAATGGATAAGTTTTCTTCACTCCATTAACACAAGCAG 2081 TGTTTTATTTAATAATCATCAATGAAATAAATGTGCCTGAAATTGATTTTAAAAATTACAGTATTAGATCATAAAGTAAA 2161 AACCAGCAGTACATTTTTAGTCACACTGAAAATGAAGGACTTAATTTTCCCCACAAGTTTCAGTGTTTTTAGTAATTAAT 2241 TCTATGCATTTTATACAAATAGAAATATATATATATAAAAAATTAAATGTTTAAAAAGGAGTAGCCTAAGATTAATTTAA 2321 AAGATTATTTACAGATGACACATTTATGGGGTCACTATTTAAGTAAATTTGCTGCCCTCCACAGCCTTCTAATTTTATTT 2401 ATATGTTCCAGCAGATTATTAGGATCTGCTTACTTCTTAGGAAAGAATCAATGCTGGCAACACATTGTTTCAGAAACACC 2481 AAGTGCAAAGGATTGATTGTATCACAACAGGTACAAAACTGACAGAGTTTTCTTTTTGTTTAGGGCCATGTTTACTACCC 2561 TGAAATGTTGTATTTTTTGTCTTTAATTTCCAAGACTTAAAGCAGTCTTGTTAAATTGACATAAATGGTAAACTTCAACA 2641 TTTTCATAATACAGTATTAATGTTTGATAAAGGTATATCCCAGTTAACTACACTGCTCTTTAATTGCAATCATGGGCATT 2721 TTAATGTATTTTAAAATAAATTTCAAAATTCTGCTAAATTCTTAATTTAGCATATTGACAAAGTAATCTGGATTTATACC 2801 TTTTAAAAACCATTTTGACCAGTTTTCTTCGGTTTTAATGCTTTCTTAAATAAAACACTGCATGATTTCCAAGTTGCATA 2881 TTTGCATACTATTTTAATTTGCAAAATGTTTTTTAAATCAAATATCCTGATATTTAGTTGTTTTTTTTTTCCTCCAGCGT 2961 GTTTAATTAAATATGTTACTGTATTAGCAAAACATTTTCATTTTTAAAATCTGCTAATTTTAAACTTGGACTGTGTTAAG 3041 TAAAAGTTAAATCATACACTGCAAGGTGTAGGAAGATTTGTTTTAATGAATCCAATGATACAGATTTGATTACTAAGTTT 3121 GAACTGTTAATTGTTTAACAATTTTAGACTTGTGGCTTTCTTTCTTTGGTTTATTTGTTTTTGCTTTTACTCCTATGCTA 3201 CACTAGTTTGCCATGTAGCAATTGCACTGTGCAATATTACAATAAGGACTGGGAAAATTTTATGGATGTAATGTCTATTA 3281 CGGTTTGCGATAGTATTTCTCTCTAGTTCTCAGTGATTTAAATGTGACCAAGCCTTCTGTACTTTGTCACAAAAAGCGGG 3361 TTTTCCAGGTGACTATTTTGGTGAGTGTCAAAATAAGAATTTATGGTGTATTACTGTCGATTCACTTTGAATTAAAATAT 3441 ATATATTGCAGCAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | NIH/3T3 |
Location of target site | 3'UTR |
Article |
- Landais S; Landry S; Legault P; Rassart E - Cancer research, 2007
We previously reported the identification of the Kis2 common retrovirus integration site, located on mouse chromosome X, in radiation leukemia virus-induced T-cell leukemias. Tumors with a provirus at the Kis2 locus overexpressed a novel noncoding RNA (ncRNA) with a complex splicing pattern and no polyA tail. Database upgrade revealed the presence of a microRNA (miRNA) cluster, miR-106-363, just downstream of the Kis2 ncRNAs. We found that Kis2 ncRNAs are the pri-miRNA of miR-106-363, and we present evidence that Kis2 ncRNA overexpression in mouse tumors results in miR-106a, miR-19b-2, miR-92-2, and miR-20b accumulation. We show the oncogenic potential of those miRNAs in anchorage independence assay and confirm pri-miR-106-363 overexpression in 46% of human T-cell leukemias tested. This overexpression contributes in rising miR-92 and miR-19 levels, as this is the case for miR-17-92 cluster overexpression. Furthermore, we identified myosin regulatory light chain-interacting protein, retinoblastoma-binding protein 1-like, and possibly homeodomain-interacting protein kinase 3 as target genes of this miRNA cluster, which establishes a link between these genes and T-cell leukemia for the first time.
LinkOut: [PMID: 17575136]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | Jiyoye |
Tools used in this research | TargetScan |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2.
... - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal. |
Article |
- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al. - The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
|
MiRNA-Target Expression Profile | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
708 hsa-miR-19b-3p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT001164 | NR3C2 | nuclear receptor subfamily 3 group C member 2 | 1 | 1 | ||||||||
MIRT001793 | BACE1 | beta-secretase 1 | 2 | 1 | ||||||||
MIRT003371 | PTEN | phosphatase and tensin homolog | 7 | 7 | ||||||||
MIRT003780 | ATXN1 | ataxin 1 | 5 | 3 | ||||||||
MIRT004064 | HIPK3 | homeodomain interacting protein kinase 3 | 3 | 2 | ||||||||
MIRT004065 | ARID4B | AT-rich interaction domain 4B | 3 | 2 | ||||||||
MIRT004066 | MYLIP | myosin regulatory light chain interacting protein | 2 | 1 | ||||||||
MIRT004309 | ESR1 | estrogen receptor 1 | 4 | 1 | ||||||||
MIRT004310 | NCOA3 | nuclear receptor coactivator 3 | 2 | 1 | ||||||||
MIRT004335 | KAT2B | lysine acetyltransferase 2B | 3 | 1 | ||||||||
MIRT004336 | SOCS1 | suppressor of cytokine signaling 1 | 5 | 6 | ||||||||
MIRT004523 | BCL2L11 | BCL2 like 11 | 2 | 2 | ||||||||
MIRT004594 | TGFBR2 | transforming growth factor beta receptor 2 | 7 | 10 | ||||||||
MIRT004933 | BMPR2 | bone morphogenetic protein receptor type 2 | 5 | 3 | ||||||||
MIRT006476 | CUL5 | cullin 5 | 2 | 1 | ||||||||
MIRT006647 | TLR2 | toll like receptor 2 | 3 | 1 | ||||||||
MIRT006742 | PRKAA1 | protein kinase AMP-activated catalytic subunit alpha 1 | 2 | 3 | ||||||||
MIRT006743 | PPP2R5E | protein phosphatase 2 regulatory subunit B'epsilon | 3 | 3 | ||||||||
MIRT007271 | CYP19A1 | cytochrome P450 family 19 subfamily A member 1 | 1 | 1 | ||||||||
MIRT007272 | GCM1 | glial cells missing homolog 1 | 1 | 1 | ||||||||
MIRT031084 | CTGF | connective tissue growth factor | 1 | 1 | ||||||||
MIRT031085 | HMGCS1 | 3-hydroxy-3-methylglutaryl-CoA synthase 1 | 1 | 1 | ||||||||
MIRT031086 | ZNF417 | zinc finger protein 417 | 1 | 1 | ||||||||
MIRT031087 | ZNF567 | zinc finger protein 567 | 1 | 1 | ||||||||
MIRT031088 | MRPL19 | mitochondrial ribosomal protein L19 | 1 | 1 | ||||||||
MIRT031089 | RPA2 | replication protein A2 | 1 | 1 | ||||||||
MIRT031090 | HOXC8 | homeobox C8 | 1 | 1 | ||||||||
MIRT031091 | KCTD20 | potassium channel tetramerization domain containing 20 | 1 | 1 | ||||||||
MIRT031092 | NDEL1 | nudE neurodevelopment protein 1 like 1 | 1 | 1 | ||||||||
MIRT031093 | THOP1 | thimet oligopeptidase 1 | 1 | 1 | ||||||||
MIRT031094 | SESTD1 | SEC14 and spectrin domain containing 1 | 1 | 1 | ||||||||
MIRT031095 | DYNLL2 | dynein light chain LC8-type 2 | 1 | 1 | ||||||||
MIRT031096 | SMCR8 | Smith-Magenis syndrome chromosome region, candidate 8 | 1 | 1 | ||||||||
MIRT031097 | RASSF1 | Ras association domain family member 1 | 1 | 1 | ||||||||
MIRT031098 | RAB5B | RAB5B, member RAS oncogene family | 2 | 9 | ||||||||
MIRT031099 | HHEX | hematopoietically expressed homeobox | 1 | 1 | ||||||||
MIRT031100 | ELOVL4 | ELOVL fatty acid elongase 4 | 1 | 1 | ||||||||
MIRT031101 | PALLD | palladin, cytoskeletal associated protein | 1 | 1 | ||||||||
MIRT031102 | MOSPD2 | motile sperm domain containing 2 | 1 | 1 | ||||||||
MIRT031103 | ANKRD10 | ankyrin repeat domain 10 | 1 | 1 | ||||||||
MIRT031104 | RAB34 | RAB34, member RAS oncogene family | 2 | 3 | ||||||||
MIRT031105 | YTHDC1 | YTH domain containing 1 | 1 | 1 | ||||||||
MIRT031106 | KATNAL1 | katanin catalytic subunit A1 like 1 | 1 | 2 | ||||||||
MIRT031107 | NACC2 | NACC family member 2 | 2 | 4 | ||||||||
MIRT031108 | ARHGAP12 | Rho GTPase activating protein 12 | 2 | 5 | ||||||||
MIRT031109 | CENPN | centromere protein N | 1 | 1 | ||||||||
MIRT031110 | PRKACB | protein kinase cAMP-activated catalytic subunit beta | 2 | 3 | ||||||||
MIRT031111 | LPGAT1 | lysophosphatidylglycerol acyltransferase 1 | 1 | 1 | ||||||||
MIRT031112 | SIX4 | SIX homeobox 4 | 1 | 1 | ||||||||
MIRT031113 | SLAIN1 | SLAIN motif family member 1 | 1 | 1 | ||||||||
MIRT031114 | HIPK1 | homeodomain interacting protein kinase 1 | 5 | 2 | ||||||||
MIRT031115 | DNAJA2 | DnaJ heat shock protein family (Hsp40) member A2 | 1 | 1 | ||||||||
MIRT031116 | TRIM2 | tripartite motif containing 2 | 1 | 1 | ||||||||
MIRT031117 | DMXL2 | Dmx like 2 | 1 | 2 | ||||||||
MIRT031118 | CCNL1 | cyclin L1 | 2 | 8 | ||||||||
MIRT031119 | SECISBP2L | SECIS binding protein 2 like | 2 | 5 | ||||||||
MIRT031120 | PATL1 | PAT1 homolog 1, processing body mRNA decay factor | 2 | 7 | ||||||||
MIRT031121 | TES | testin LIM domain protein | 1 | 1 | ||||||||
MIRT031122 | ATM | ATM serine/threonine kinase | 1 | 1 | ||||||||
MIRT031123 | ARL6IP1 | ADP ribosylation factor like GTPase 6 interacting protein 1 | 1 | 1 | ||||||||
MIRT031124 | NR3C1 | nuclear receptor subfamily 3 group C member 1 | 1 | 1 | ||||||||
MIRT031125 | LRIG3 | leucine rich repeats and immunoglobulin like domains 3 | 1 | 1 | ||||||||
MIRT031126 | SNAPIN | SNAP associated protein | 1 | 1 | ||||||||
MIRT031127 | LRP8 | LDL receptor related protein 8 | 1 | 1 | ||||||||
MIRT031128 | EGLN3 | egl-9 family hypoxia inducible factor 3 | 1 | 1 | ||||||||
MIRT031129 | XYLT2 | xylosyltransferase 2 | 1 | 1 | ||||||||
MIRT031130 | ADRM1 | adhesion regulating molecule 1 | 2 | 3 | ||||||||
MIRT031131 | NDUFB2 | NADH:ubiquinone oxidoreductase subunit B2 | 1 | 1 | ||||||||
MIRT031132 | TRPC3 | transient receptor potential cation channel subfamily C member 3 | 2 | 4 | ||||||||
MIRT031133 | SLC44A1 | solute carrier family 44 member 1 | 1 | 1 | ||||||||
MIRT031134 | BAHD1 | bromo adjacent homology domain containing 1 | 1 | 1 | ||||||||
MIRT031135 | SGTB | small glutamine rich tetratricopeptide repeat containing beta | 1 | 1 | ||||||||
MIRT031136 | PDZD11 | PDZ domain containing 11 | 1 | 1 | ||||||||
MIRT031137 | SEC23B | Sec23 homolog B, coat complex II component | 1 | 1 | ||||||||
MIRT031138 | TBC1D4 | TBC1 domain family member 4 | 1 | 1 | ||||||||
MIRT031139 | TBC1D25 | TBC1 domain family member 25 | 1 | 1 | ||||||||
MIRT031140 | HARS | histidyl-tRNA synthetase | 1 | 1 | ||||||||
MIRT031141 | COX10 | COX10, heme A:farnesyltransferase cytochrome c oxidase assembly factor | 2 | 8 | ||||||||
MIRT031142 | MAPRE3 | microtubule associated protein RP/EB family member 3 | 1 | 1 | ||||||||
MIRT031143 | SUV420H1 | lysine methyltransferase 5B | 1 | 1 | ||||||||
MIRT031144 | CDK19 | cyclin dependent kinase 19 | 1 | 1 | ||||||||
MIRT031145 | KCTD10 | potassium channel tetramerization domain containing 10 | 2 | 5 | ||||||||
MIRT031146 | PTP4A1 | protein tyrosine phosphatase type IVA, member 1 | 1 | 1 | ||||||||
MIRT031147 | MAP7 | microtubule associated protein 7 | 1 | 1 | ||||||||
MIRT031148 | CSNK1G1 | casein kinase 1 gamma 1 | 1 | 1 | ||||||||
MIRT031149 | WDR33 | WD repeat domain 33 | 1 | 1 | ||||||||
MIRT031150 | PDRG1 | p53 and DNA damage regulated 1 | 2 | 10 | ||||||||
MIRT031151 | PSMD9 | proteasome 26S subunit, non-ATPase 9 | 1 | 1 | ||||||||
MIRT031152 | OTUD4 | OTU deubiquitinase 4 | 1 | 2 | ||||||||
MIRT031153 | ZCCHC14 | zinc finger CCHC-type containing 14 | 1 | 1 | ||||||||
MIRT031154 | DERL1 | derlin 1 | 1 | 1 | ||||||||
MIRT031155 | ATP6V1C1 | ATPase H+ transporting V1 subunit C1 | 1 | 1 | ||||||||
MIRT031156 | SMAD4 | SMAD family member 4 | 3 | 7 | ||||||||
MIRT031157 | TMEM9B | TMEM9 domain family member B | 1 | 2 | ||||||||
MIRT031158 | ZMYM2 | zinc finger MYM-type containing 2 | 1 | 1 | ||||||||
MIRT031159 | GMEB2 | glucocorticoid modulatory element binding protein 2 | 1 | 1 | ||||||||
MIRT031160 | CD46 | CD46 molecule | 4 | 2 | ||||||||
MIRT031161 | AP3S2 | adaptor related protein complex 3 sigma 2 subunit | 2 | 2 | ||||||||
MIRT031162 | CA13 | carbonic anhydrase 13 | 1 | 1 | ||||||||
MIRT031163 | MID1IP1 | MID1 interacting protein 1 | 2 | 8 | ||||||||
MIRT031164 | POGZ | pogo transposable element derived with ZNF domain | 2 | 3 | ||||||||
MIRT031165 | TRIM59 | tripartite motif containing 59 | 1 | 1 | ||||||||
MIRT031166 | ABHD5 | abhydrolase domain containing 5 | 2 | 6 | ||||||||
MIRT031167 | SLC35D1 | solute carrier family 35 member D1 | 1 | 1 | ||||||||
MIRT031168 | PPP6R2 | protein phosphatase 6 regulatory subunit 2 | 1 | 1 | ||||||||
MIRT031169 | PPP1R15B | protein phosphatase 1 regulatory subunit 15B | 2 | 10 | ||||||||
MIRT031170 | ZNF217 | zinc finger protein 217 | 1 | 2 | ||||||||
MIRT031171 | ZNF644 | zinc finger protein 644 | 2 | 3 | ||||||||
MIRT031172 | FBXO28 | F-box protein 28 | 2 | 4 | ||||||||
MIRT031173 | SOGA1 | suppressor of glucose, autophagy associated 1 | 1 | 1 | ||||||||
MIRT031174 | MPHOSPH9 | M-phase phosphoprotein 9 | 1 | 1 | ||||||||
MIRT031175 | ZNF721 | zinc finger protein 721 | 1 | 2 | ||||||||
MIRT031176 | PAPD4 | poly(A) RNA polymerase D4, non-canonical | 2 | 3 | ||||||||
MIRT031177 | ZNF711 | zinc finger protein 711 | 1 | 1 | ||||||||
MIRT031178 | MB21D2 | Mab-21 domain containing 2 | 2 | 3 | ||||||||
MIRT031179 | ROR1 | receptor tyrosine kinase like orphan receptor 1 | 1 | 1 | ||||||||
MIRT031180 | ENPP5 | ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) | 2 | 3 | ||||||||
MIRT031181 | CLIP1 | CAP-Gly domain containing linker protein 1 | 2 | 9 | ||||||||
MIRT031182 | HOXA5 | homeobox A5 | 1 | 1 | ||||||||
MIRT031183 | C16orf70 | chromosome 16 open reading frame 70 | 2 | 5 | ||||||||
MIRT031184 | CYP2U1 | cytochrome P450 family 2 subfamily U member 1 | 2 | 4 | ||||||||
MIRT031185 | CREB3L2 | cAMP responsive element binding protein 3 like 2 | 1 | 2 | ||||||||
MIRT031186 | MTRR | 5-methyltetrahydrofolate-homocysteine methyltransferase reductase | 1 | 1 | ||||||||
MIRT031187 | FAM46A | family with sequence similarity 46 member A | 1 | 1 | ||||||||
MIRT031188 | WBP1L | WW domain binding protein 1 like | 1 | 1 | ||||||||
MIRT031189 | STEAP2 | STEAP2 metalloreductase | 1 | 1 | ||||||||
MIRT031190 | SON | SON DNA binding protein | 1 | 1 | ||||||||
MIRT031191 | AGO1 | argonaute 1, RISC catalytic component | 1 | 2 | ||||||||
MIRT031192 | MBNL1 | muscleblind like splicing regulator 1 | 2 | 5 | ||||||||
MIRT031193 | SLC4A7 | solute carrier family 4 member 7 | 1 | 1 | ||||||||
MIRT031194 | NFIB | nuclear factor I B | 2 | 5 | ||||||||
MIRT031195 | LDLR | low density lipoprotein receptor | 2 | 7 | ||||||||
MIRT031196 | TMEM45A | transmembrane protein 45A | 1 | 1 | ||||||||
MIRT031197 | CEP350 | centrosomal protein 350 | 2 | 6 | ||||||||
MIRT031198 | TRIM33 | tripartite motif containing 33 | 2 | 4 | ||||||||
MIRT031199 | PTPRG | protein tyrosine phosphatase, receptor type G | 2 | 3 | ||||||||
MIRT031200 | FBXO8 | F-box protein 8 | 2 | 3 | ||||||||
MIRT031201 | RNF145 | ring finger protein 145 | 1 | 1 | ||||||||
MIRT031202 | ZER1 | zyg-11 related cell cycle regulator | 1 | 1 | ||||||||
MIRT031203 | ZBTB4 | zinc finger and BTB domain containing 4 | 2 | 7 | ||||||||
MIRT031204 | SYBU | syntabulin | 1 | 1 | ||||||||
MIRT031205 | ARRDC3 | arrestin domain containing 3 | 1 | 2 | ||||||||
MIRT031206 | VPS4B | vacuolar protein sorting 4 homolog B | 1 | 1 | ||||||||
MIRT031207 | C11orf96 | chromosome 11 open reading frame 96 | 1 | 1 | ||||||||
MIRT031208 | SEMA4C | semaphorin 4C | 2 | 8 | ||||||||
MIRT031209 | RAP2C | RAP2C, member of RAS oncogene family | 1 | 2 | ||||||||
MIRT031210 | MYCN | MYCN proto-oncogene, bHLH transcription factor | 1 | 1 | ||||||||
MIRT031211 | SLMAP | sarcolemma associated protein | 1 | 1 | ||||||||
MIRT031212 | SOCS4 | suppressor of cytokine signaling 4 | 1 | 1 | ||||||||
MIRT031213 | RDH11 | retinol dehydrogenase 11 (all-trans/9-cis/11-cis) | 1 | 1 | ||||||||
MIRT031214 | FYCO1 | FYVE and coiled-coil domain containing 1 | 1 | 1 | ||||||||
MIRT031215 | ATMIN | ATM interactor | 2 | 6 | ||||||||
MIRT031216 | C12orf66 | chromosome 12 open reading frame 66 | 1 | 1 | ||||||||
MIRT031217 | NCKAP5 | NCK associated protein 5 | 1 | 1 | ||||||||
MIRT031218 | BTBD3 | BTB domain containing 3 | 1 | 1 | ||||||||
MIRT031219 | SAMD1 | sterile alpha motif domain containing 1 | 1 | 1 | ||||||||
MIRT031220 | WBP2 | WW domain binding protein 2 | 1 | 2 | ||||||||
MIRT031221 | CTR9 | CTR9 homolog, Paf1/RNA polymerase II complex component | 1 | 1 | ||||||||
MIRT031222 | ACPL2 | 2-phosphoxylose phosphatase 1 | 1 | 1 | ||||||||
MIRT031223 | TBC1D13 | TBC1 domain family member 13 | 1 | 1 | ||||||||
MIRT031224 | GPATCH8 | G-patch domain containing 8 | 1 | 1 | ||||||||
MIRT031225 | KIAA1967 | cell cycle and apoptosis regulator 2 | 1 | 1 | ||||||||
MIRT031226 | HNRNPA1 | heterogeneous nuclear ribonucleoprotein A1 | 1 | 1 | ||||||||
MIRT031227 | CD2AP | CD2 associated protein | 1 | 1 | ||||||||
MIRT031228 | SRSF7 | serine and arginine rich splicing factor 7 | 1 | 1 | ||||||||
MIRT031229 | TCF4 | transcription factor 4 | 1 | 1 | ||||||||
MIRT031230 | DAAM2 | dishevelled associated activator of morphogenesis 2 | 1 | 1 | ||||||||
MIRT031231 | HIF1AN | hypoxia inducible factor 1 alpha subunit inhibitor | 1 | 1 | ||||||||
MIRT031232 | HEG1 | heart development protein with EGF like domains 1 | 1 | 1 | ||||||||
MIRT031233 | DCAF8 | DDB1 and CUL4 associated factor 8 | 1 | 1 | ||||||||
MIRT031234 | KLHL21 | kelch like family member 21 | 1 | 1 | ||||||||
MIRT031235 | HABP4 | hyaluronan binding protein 4 | 1 | 1 | ||||||||
MIRT031236 | PDE4D | phosphodiesterase 4D | 1 | 1 | ||||||||
MIRT031237 | SPG20 | spartin | 2 | 6 | ||||||||
MIRT031238 | SAMD8 | sterile alpha motif domain containing 8 | 2 | 3 | ||||||||
MIRT031239 | LTN1 | listerin E3 ubiquitin protein ligase 1 | 1 | 1 | ||||||||
MIRT031240 | MBOAT7 | membrane bound O-acyltransferase domain containing 7 | 1 | 1 | ||||||||
MIRT031241 | RNF41 | ring finger protein 41 | 1 | 1 | ||||||||
MIRT031242 | ARHGAP1 | Rho GTPase activating protein 1 | 2 | 7 | ||||||||
MIRT031243 | ANKRD52 | ankyrin repeat domain 52 | 1 | 1 | ||||||||
MIRT031244 | BTBD10 | BTB domain containing 10 | 1 | 1 | ||||||||
MIRT031245 | ZFAND5 | zinc finger AN1-type containing 5 | 2 | 6 | ||||||||
MIRT031246 | SPTY2D1 | SPT2 chromatin protein domain containing 1 | 1 | 1 | ||||||||
MIRT031247 | LBR | lamin B receptor | 1 | 1 | ||||||||
MIRT031248 | IER3IP1 | immediate early response 3 interacting protein 1 | 1 | 1 | ||||||||
MIRT031249 | WEE1 | WEE1 G2 checkpoint kinase | 1 | 1 | ||||||||
MIRT031250 | TOM1L2 | target of myb1 like 2 membrane trafficking protein | 1 | 1 | ||||||||
MIRT031251 | MEF2D | myocyte enhancer factor 2D | 1 | 1 | ||||||||
MIRT031252 | USP37 | ubiquitin specific peptidase 37 | 2 | 4 | ||||||||
MIRT031253 | ACVR1 | activin A receptor type 1 | 1 | 1 | ||||||||
MIRT031254 | SMYD2 | SET and MYND domain containing 2 | 1 | 1 | ||||||||
MIRT031255 | DCAF7 | DDB1 and CUL4 associated factor 7 | 2 | 4 | ||||||||
MIRT031256 | MREG | melanoregulin | 1 | 1 | ||||||||
MIRT031257 | GFOD1 | glucose-fructose oxidoreductase domain containing 1 | 1 | 1 | ||||||||
MIRT031258 | SEMA6B | semaphorin 6B | 1 | 1 | ||||||||
MIRT031259 | SERINC3 | serine incorporator 3 | 2 | 10 | ||||||||
MIRT031260 | RRAS2 | RAS related 2 | 2 | 2 | ||||||||
MIRT031261 | ESYT1 | extended synaptotagmin 1 | 2 | 3 | ||||||||
MIRT031262 | EPC1 | enhancer of polycomb homolog 1 | 1 | 1 | ||||||||
MIRT031263 | WDR26 | WD repeat domain 26 | 2 | 4 | ||||||||
MIRT031264 | PSAP | prosaposin | 1 | 2 | ||||||||
MIRT031265 | SEL1L3 | SEL1L family member 3 | 1 | 1 | ||||||||
MIRT031266 | JARID2 | jumonji and AT-rich interaction domain containing 2 | 1 | 2 | ||||||||
MIRT031267 | RAB1A | RAB1A, member RAS oncogene family | 2 | 3 | ||||||||
MIRT031268 | RHEBL1 | RHEB like 1 | 1 | 1 | ||||||||
MIRT031269 | CREBL2 | cAMP responsive element binding protein like 2 | 2 | 9 | ||||||||
MIRT031270 | CPPED1 | calcineurin like phosphoesterase domain containing 1 | 1 | 1 | ||||||||
MIRT031271 | STK38 | serine/threonine kinase 38 | 2 | 4 | ||||||||
MIRT031272 | DDX6 | DEAD-box helicase 6 | 2 | 5 | ||||||||
MIRT031273 | SPATA2 | spermatogenesis associated 2 | 2 | 4 | ||||||||
MIRT031274 | CCND2 | cyclin D2 | 2 | 9 | ||||||||
MIRT031275 | CNOT6 | CCR4-NOT transcription complex subunit 6 | 1 | 2 | ||||||||
MIRT031276 | ALG2 | ALG2, alpha-1,3/1,6-mannosyltransferase | 1 | 2 | ||||||||
MIRT031277 | BLCAP | bladder cancer associated protein | 2 | 11 | ||||||||
MIRT031278 | CNOT4 | CCR4-NOT transcription complex subunit 4 | 2 | 6 | ||||||||
MIRT031279 | RASSF2 | Ras association domain family member 2 | 1 | 2 | ||||||||
MIRT031280 | ARHGAP11A | Rho GTPase activating protein 11A | 1 | 1 | ||||||||
MIRT031281 | VAMP3 | vesicle associated membrane protein 3 | 1 | 2 | ||||||||
MIRT031282 | PTPN4 | protein tyrosine phosphatase, non-receptor type 4 | 1 | 1 | ||||||||
MIRT031283 | PRUNE2 | prune homolog 2 | 2 | 3 | ||||||||
MIRT031284 | CPD | carboxypeptidase D | 1 | 1 | ||||||||
MIRT031285 | FAT3 | FAT atypical cadherin 3 | 1 | 1 | ||||||||
MIRT031286 | ZNF521 | zinc finger protein 521 | 1 | 1 | ||||||||
MIRT031287 | CAMSAP1 | calmodulin regulated spectrin associated protein 1 | 2 | 3 | ||||||||
MIRT031288 | TNRC6B | trinucleotide repeat containing 6B | 1 | 2 | ||||||||
MIRT031289 | CGN | cingulin | 1 | 1 | ||||||||
MIRT031290 | IMPDH1 | inosine monophosphate dehydrogenase 1 | 1 | 2 | ||||||||
MIRT031291 | SHCBP1 | SHC binding and spindle associated 1 | 1 | 2 | ||||||||
MIRT031292 | OTUD1 | OTU deubiquitinase 1 | 1 | 2 | ||||||||
MIRT031293 | LPHN2 | adhesion G protein-coupled receptor L2 | 1 | 1 | ||||||||
MIRT031294 | E2F8 | E2F transcription factor 8 | 2 | 4 | ||||||||
MIRT031295 | TAF4 | TATA-box binding protein associated factor 4 | 1 | 2 | ||||||||
MIRT031296 | ATXN7L1 | ataxin 7 like 1 | 1 | 1 | ||||||||
MIRT031297 | ATF2 | activating transcription factor 2 | 1 | 1 | ||||||||
MIRT031298 | SMARCA2 | SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 | 1 | 2 | ||||||||
MIRT031299 | RNF11 | ring finger protein 11 | 2 | 7 | ||||||||
MIRT031300 | LONRF1 | LON peptidase N-terminal domain and ring finger 1 | 2 | 4 | ||||||||
MIRT031301 | RNF111 | ring finger protein 111 | 1 | 2 | ||||||||
MIRT031302 | HBP1 | HMG-box transcription factor 1 | 2 | 5 | ||||||||
MIRT031303 | KLF10 | Kruppel like factor 10 | 1 | 1 | ||||||||
MIRT050627 | AP2B1 | adaptor related protein complex 2 beta 1 subunit | 1 | 1 | ||||||||
MIRT050628 | TPGS2 | tubulin polyglutamylase complex subunit 2 | 1 | 1 | ||||||||
MIRT050629 | ZNF507 | zinc finger protein 507 | 1 | 1 | ||||||||
MIRT050630 | NCBP2 | nuclear cap binding protein subunit 2 | 1 | 1 | ||||||||
MIRT050631 | ZFHX4 | zinc finger homeobox 4 | 1 | 1 | ||||||||
MIRT050632 | EIF3L | eukaryotic translation initiation factor 3 subunit L | 1 | 1 | ||||||||
MIRT050633 | ALAD | aminolevulinate dehydratase | 1 | 1 | ||||||||
MIRT050634 | MRPL32 | mitochondrial ribosomal protein L32 | 1 | 1 | ||||||||
MIRT050635 | ELOVL5 | ELOVL fatty acid elongase 5 | 2 | 8 | ||||||||
MIRT050636 | DEGS1 | delta 4-desaturase, sphingolipid 1 | 1 | 1 | ||||||||
MIRT050637 | TSC22D3 | TSC22 domain family member 3 | 1 | 1 | ||||||||
MIRT050638 | TMBIM6 | transmembrane BAX inhibitor motif containing 6 | 2 | 6 | ||||||||
MIRT050639 | NUTF2 | nuclear transport factor 2 | 1 | 1 | ||||||||
MIRT050640 | RAB21 | RAB21, member RAS oncogene family | 1 | 2 | ||||||||
MIRT053763 | MXD1 | MAX dimerization protein 1 | 3 | 1 | ||||||||
MIRT056047 | MLLT10 | MLLT10, histone lysine methyltransferase DOT1L cofactor | 2 | 2 | ||||||||
MIRT056384 | ZMYND11 | zinc finger MYND-type containing 11 | 2 | 3 | ||||||||
MIRT057491 | CEP55 | centrosomal protein 55 | 2 | 4 | ||||||||
MIRT057812 | SLC30A7 | solute carrier family 30 member 7 | 2 | 3 | ||||||||
MIRT060677 | KLHL20 | kelch like family member 20 | 1 | 1 | ||||||||
MIRT062707 | MLEC | malectin | 2 | 5 | ||||||||
MIRT063999 | KLHL42 | kelch like family member 42 | 1 | 1 | ||||||||
MIRT064796 | ZBTB18 | zinc finger and BTB domain containing 18 | 2 | 3 | ||||||||
MIRT065617 | CLIC4 | chloride intracellular channel 4 | 1 | 1 | ||||||||
MIRT066936 | SLC9A1 | solute carrier family 9 member A1 | 1 | 1 | ||||||||
MIRT067194 | STX12 | syntaxin 12 | 1 | 1 | ||||||||
MIRT068829 | FNDC3A | fibronectin type III domain containing 3A | 1 | 1 | ||||||||
MIRT069291 | WDR20 | WD repeat domain 20 | 1 | 1 | ||||||||
MIRT069423 | SIVA1 | SIVA1 apoptosis inducing factor | 2 | 3 | ||||||||
MIRT070994 | SMOC1 | SPARC related modular calcium binding 1 | 2 | 2 | ||||||||
MIRT071087 | RBM25 | RNA binding motif protein 25 | 1 | 1 | ||||||||
MIRT071481 | CALM1 | calmodulin 1 | 2 | 2 | ||||||||
MIRT071902 | ZFYVE9 | zinc finger FYVE-type containing 9 | 2 | 2 | ||||||||
MIRT072479 | RAB8B | RAB8B, member RAS oncogene family | 1 | 1 | ||||||||
MIRT073804 | ERCC4 | ERCC excision repair 4, endonuclease catalytic subunit | 2 | 4 | ||||||||
MIRT074501 | NFATC2IP | nuclear factor of activated T-cells 2 interacting protein | 2 | 4 | ||||||||
MIRT074890 | CHD9 | chromodomain helicase DNA binding protein 9 | 1 | 1 | ||||||||
MIRT075331 | SF3B3 | splicing factor 3b subunit 3 | 2 | 3 | ||||||||
MIRT076584 | NUFIP2 | NUFIP2, FMR1 interacting protein 2 | 1 | 1 | ||||||||
MIRT079343 | CCDC137 | coiled-coil domain containing 137 | 2 | 3 | ||||||||
MIRT079466 | FN3KRP | fructosamine 3 kinase related protein | 1 | 1 | ||||||||
MIRT079745 | RBBP8 | RB binding protein 8, endonuclease | 1 | 1 | ||||||||
MIRT080681 | KIAA1468 | KIAA1468 | 1 | 1 | ||||||||
MIRT082388 | HNRNPUL1 | heterogeneous nuclear ribonucleoprotein U like 1 | 2 | 5 | ||||||||
MIRT083230 | GINS1 | GINS complex subunit 1 | 1 | 1 | ||||||||
MIRT085260 | CCNT2 | cyclin T2 | 1 | 1 | ||||||||
MIRT085516 | SLC37A1 | solute carrier family 37 member 1 | 1 | 1 | ||||||||
MIRT086399 | MFSD6 | major facilitator superfamily domain containing 6 | 1 | 1 | ||||||||
MIRT087603 | ATG16L1 | autophagy related 16 like 1 | 1 | 1 | ||||||||
MIRT087863 | CBY1 | chibby family member 1, beta catenin antagonist | 2 | 4 | ||||||||
MIRT090334 | SEC61A1 | Sec61 translocon alpha 1 subunit | 2 | 9 | ||||||||
MIRT090897 | ARHGEF26 | Rho guanine nucleotide exchange factor 26 | 2 | 2 | ||||||||
MIRT091212 | USP13 | ubiquitin specific peptidase 13 | 2 | 2 | ||||||||
MIRT091232 | FXR1 | FMR1 autosomal homolog 1 | 1 | 1 | ||||||||
MIRT091939 | ZBTB47 | zinc finger and BTB domain containing 47 | 2 | 6 | ||||||||
MIRT093077 | SLC7A11 | solute carrier family 7 member 11 | 2 | 2 | ||||||||
MIRT094088 | PAICS | phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase | 2 | 5 | ||||||||
MIRT094222 | G3BP2 | G3BP stress granule assembly factor 2 | 2 | 10 | ||||||||
MIRT094527 | C5ORF30 | chromosome 5 open reading frame 30 | 1 | 1 | ||||||||
MIRT095136 | C5ORF24 | chromosome 5 open reading frame 24 | 1 | 1 | ||||||||
MIRT095199 | SMAD5 | SMAD family member 5 | 1 | 1 | ||||||||
MIRT095996 | ATP6V0E1 | ATPase H+ transporting V0 subunit e1 | 1 | 1 | ||||||||
MIRT097557 | RASA1 | RAS p21 protein activator 1 | 1 | 1 | ||||||||
MIRT099307 | QKI | QKI, KH domain containing RNA binding | 2 | 4 | ||||||||
MIRT099823 | SOX4 | SRY-box 4 | 2 | 10 | ||||||||
MIRT100761 | ENPP4 | ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative) | 2 | 3 | ||||||||
MIRT101802 | PNRC1 | proline rich nuclear receptor coactivator 1 | 1 | 1 | ||||||||
MIRT102615 | UBN2 | ubinuclein 2 | 2 | 8 | ||||||||
MIRT104393 | ANKIB1 | ankyrin repeat and IBR domain containing 1 | 1 | 1 | ||||||||
MIRT105200 | EFR3A | EFR3 homolog A | 1 | 1 | ||||||||
MIRT105303 | VPS37A | VPS37A, ESCRT-I subunit | 2 | 2 | ||||||||
MIRT105430 | ATP6V1B2 | ATPase H+ transporting V1 subunit B2 | 2 | 11 | ||||||||
MIRT106954 | RAB14 | RAB14, member RAS oncogene family | 2 | 3 | ||||||||
MIRT107275 | FAM73B | mitoguardin 2 | 2 | 2 | ||||||||
MIRT108874 | HPRT1 | hypoxanthine phosphoribosyltransferase 1 | 2 | 2 | ||||||||
MIRT112759 | ADIPOR2 | adiponectin receptor 2 | 1 | 1 | ||||||||
MIRT113581 | ZDHHC18 | zinc finger DHHC-type containing 18 | 2 | 2 | ||||||||
MIRT113883 | KPNA6 | karyopherin subunit alpha 6 | 2 | 6 | ||||||||
MIRT117353 | TGIF1 | TGFB induced factor homeobox 1 | 2 | 4 | ||||||||
MIRT125561 | SCD | stearoyl-CoA desaturase | 1 | 1 | ||||||||
MIRT126662 | RAB18 | RAB18, member RAS oncogene family | 1 | 1 | ||||||||
MIRT127083 | REEP3 | receptor accessory protein 3 | 1 | 1 | ||||||||
MIRT127204 | PLAU | plasminogen activator, urokinase | 1 | 1 | ||||||||
MIRT127442 | FAS | Fas cell surface death receptor | 1 | 1 | ||||||||
MIRT129455 | CHEK1 | checkpoint kinase 1 | 1 | 1 | ||||||||
MIRT129780 | FAM46C | family with sequence similarity 46 member C | 1 | 1 | ||||||||
MIRT129959 | TNFRSF1B | TNF receptor superfamily member 1B | 1 | 1 | ||||||||
MIRT130678 | GATAD2B | GATA zinc finger domain containing 2B | 1 | 1 | ||||||||
MIRT130846 | ZBTB7B | zinc finger and BTB domain containing 7B | 1 | 1 | ||||||||
MIRT132677 | RASSF5 | Ras association domain family member 5 | 1 | 1 | ||||||||
MIRT132982 | WNK1 | WNK lysine deficient protein kinase 1 | 1 | 1 | ||||||||
MIRT133162 | GIT2 | GIT ArfGAP 2 | 1 | 1 | ||||||||
MIRT133377 | BCL7A | BCL tumor suppressor 7A | 1 | 1 | ||||||||
MIRT134302 | GPR137B | G protein-coupled receptor 137B | 1 | 1 | ||||||||
MIRT136440 | PLXNC1 | plexin C1 | 1 | 1 | ||||||||
MIRT137290 | MBNL2 | muscleblind like splicing regulator 2 | 1 | 1 | ||||||||
MIRT137384 | MACF1 | microtubule-actin crosslinking factor 1 | 1 | 1 | ||||||||
MIRT137541 | RCOR1 | REST corepressor 1 | 1 | 1 | ||||||||
MIRT138188 | KLHDC2 | kelch domain containing 2 | 1 | 1 | ||||||||
MIRT138347 | FRMD6 | FERM domain containing 6 | 1 | 1 | ||||||||
MIRT139872 | BTF3L4 | basic transcription factor 3 like 4 | 2 | 7 | ||||||||
MIRT139916 | KLF13 | Kruppel like factor 13 | 1 | 1 | ||||||||
MIRT140963 | NPTN | neuroplastin | 1 | 1 | ||||||||
MIRT141351 | ABHD17C | abhydrolase domain containing 17C | 1 | 1 | ||||||||
MIRT141935 | SMG1 | SMG1, nonsense mediated mRNA decay associated PI3K related kinase | 2 | 9 | ||||||||
MIRT142379 | TNRC6A | trinucleotide repeat containing 6A | 2 | 6 | ||||||||
MIRT142989 | TNFRSF12A | TNF receptor superfamily member 12A | 4 | 1 | ||||||||
MIRT144148 | PHF13 | PHD finger protein 13 | 1 | 1 | ||||||||
MIRT144489 | MIER1 | MIER1 transcriptional regulator | 1 | 1 | ||||||||
MIRT144866 | MAP2K3 | mitogen-activated protein kinase kinase 3 | 1 | 1 | ||||||||
MIRT145463 | NF1 | neurofibromin 1 | 1 | 1 | ||||||||
MIRT145511 | SUZ12 | SUZ12 polycomb repressive complex 2 subunit | 1 | 1 | ||||||||
MIRT147075 | DHX40 | DEAH-box helicase 40 | 1 | 1 | ||||||||
MIRT147920 | CAMTA1 | calmodulin binding transcription activator 1 | 1 | 1 | ||||||||
MIRT148867 | ANKRD12 | ankyrin repeat domain 12 | 1 | 1 | ||||||||
MIRT149310 | PDE4A | phosphodiesterase 4A | 1 | 1 | ||||||||
MIRT150381 | CC2D1A | coiled-coil and C2 domain containing 1A | 1 | 1 | ||||||||
MIRT150617 | SLC27A1 | solute carrier family 27 member 1 | 1 | 1 | ||||||||
MIRT151585 | ZNF526 | zinc finger protein 526 | 1 | 1 | ||||||||
MIRT153284 | FAM83D | family with sequence similarity 83 member D | 1 | 1 | ||||||||
MIRT156403 | RAPGEF4 | Rap guanine nucleotide exchange factor 4 | 1 | 1 | ||||||||
MIRT156587 | COQ10B | coenzyme Q10B | 1 | 1 | ||||||||
MIRT157708 | CAB39 | calcium binding protein 39 | 1 | 1 | ||||||||
MIRT158799 | PPARA | peroxisome proliferator activated receptor alpha | 1 | 1 | ||||||||
MIRT159104 | NRBP1 | nuclear receptor binding protein 1 | 1 | 1 | ||||||||
MIRT159678 | AFTPH | aftiphilin | 1 | 1 | ||||||||
MIRT162257 | LMLN | leishmanolysin like peptidase | 2 | 4 | ||||||||
MIRT162698 | ITPR1 | inositol 1,4,5-trisphosphate receptor type 1 | 1 | 1 | ||||||||
MIRT164477 | RAPGEF2 | Rap guanine nucleotide exchange factor 2 | 1 | 1 | ||||||||
MIRT164523 | MSMO1 | methylsterol monooxygenase 1 | 2 | 3 | ||||||||
MIRT166256 | C5ORF51 | chromosome 5 open reading frame 51 | 2 | 3 | ||||||||
MIRT166400 | MAP3K1 | mitogen-activated protein kinase kinase kinase 1 | 1 | 1 | ||||||||
MIRT168651 | MAPK14 | mitogen-activated protein kinase 14 | 1 | 1 | ||||||||
MIRT170952 | IKZF1 | IKAROS family zinc finger 1 | 1 | 1 | ||||||||
MIRT172152 | FZD6 | frizzled class receptor 6 | 2 | 9 | ||||||||
MIRT172596 | CNOT7 | CCR4-NOT transcription complex subunit 7 | 1 | 1 | ||||||||
MIRT173378 | TNKS | tankyrase | 1 | 1 | ||||||||
MIRT175593 | OCRL | OCRL, inositol polyphosphate-5-phosphatase | 1 | 1 | ||||||||
MIRT176284 | DDX3Y | DEAD-box helicase 3, Y-linked | 1 | 1 | ||||||||
MIRT177385 | WAC | WW domain containing adaptor with coiled-coil | 1 | 1 | ||||||||
MIRT178925 | C11ORF57 | chromosome 11 open reading frame 57 | 2 | 3 | ||||||||
MIRT179066 | PAFAH1B2 | platelet activating factor acetylhydrolase 1b catalytic subunit 2 | 2 | 6 | ||||||||
MIRT179424 | TBRG1 | transforming growth factor beta regulator 1 | 2 | 6 | ||||||||
MIRT188210 | RAP1B | RAP1B, member of RAS oncogene family | 4 | 3 | ||||||||
MIRT193022 | TMOD3 | tropomodulin 3 | 2 | 8 | ||||||||
MIRT193530 | RORA | RAR related orphan receptor A | 2 | 4 | ||||||||
MIRT195614 | FAM195A | MAPK regulated corepressor interacting protein 2 | 2 | 6 | ||||||||
MIRT203046 | AMMECR1L | AMMECR1 like | 2 | 3 | ||||||||
MIRT208723 | MED12L | mediator complex subunit 12 like | 2 | 6 | ||||||||
MIRT209478 | EIF4A2 | eukaryotic translation initiation factor 4A2 | 2 | 8 | ||||||||
MIRT211503 | ELMOD2 | ELMO domain containing 2 | 2 | 3 | ||||||||
MIRT213429 | MOB1B | MOB kinase activator 1B | 2 | 6 | ||||||||
MIRT213703 | AFF1 | AF4/FMR2 family member 1 | 1 | 1 | ||||||||
MIRT213974 | DCP2 | decapping mRNA 2 | 1 | 1 | ||||||||
MIRT217600 | NUS1 | NUS1 dehydrodolichyl diphosphate synthase subunit | 2 | 2 | ||||||||
MIRT220280 | TMEM106B | transmembrane protein 106B | 1 | 1 | ||||||||
MIRT230216 | RPS4Y1 | ribosomal protein S4, Y-linked 1 | 1 | 1 | ||||||||
MIRT230964 | PRRG4 | proline rich and Gla domain 4 | 2 | 2 | ||||||||
MIRT243091 | LCLAT1 | lysocardiolipin acyltransferase 1 | 2 | 5 | ||||||||
MIRT243390 | SKIL | SKI like proto-oncogene | 2 | 10 | ||||||||
MIRT245296 | BAMBI | BMP and activin membrane bound inhibitor | 2 | 2 | ||||||||
MIRT248071 | SLC38A2 | solute carrier family 38 member 2 | 2 | 5 | ||||||||
MIRT250719 | DEF8 | differentially expressed in FDCP 8 homolog | 1 | 1 | ||||||||
MIRT251363 | RNF167 | ring finger protein 167 | 1 | 1 | ||||||||
MIRT252921 | BCL3 | B-cell CLL/lymphoma 3 | 1 | 1 | ||||||||
MIRT253411 | EVI5L | ecotropic viral integration site 5 like | 2 | 3 | ||||||||
MIRT259382 | SLC6A8 | solute carrier family 6 member 8 | 2 | 4 | ||||||||
MIRT260200 | KCNJ2 | potassium voltage-gated channel subfamily J member 2 | 2 | 2 | ||||||||
MIRT260228 | ASNA1 | arsA arsenite transporter, ATP-binding, homolog 1 (bacterial) | 1 | 1 | ||||||||
MIRT275174 | BTG1 | BTG anti-proliferation factor 1 | 2 | 2 | ||||||||
MIRT275509 | ZIC5 | Zic family member 5 | 2 | 2 | ||||||||
MIRT278995 | GMFB | glia maturation factor beta | 2 | 11 | ||||||||
MIRT280868 | NIPA1 | non imprinted in Prader-Willi/Angelman syndrome 1 | 2 | 5 | ||||||||
MIRT283022 | NFIA | nuclear factor I A | 2 | 2 | ||||||||
MIRT284269 | ALG1 | ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase | 2 | 2 | ||||||||
MIRT287195 | STAT5B | signal transducer and activator of transcription 5B | 2 | 2 | ||||||||
MIRT290694 | POLI | DNA polymerase iota | 2 | 4 | ||||||||
MIRT291962 | CHERP | calcium homeostasis endoplasmic reticulum protein | 2 | 2 | ||||||||
MIRT295903 | DSN1 | DSN1 homolog, MIS12 kinetochore complex component | 2 | 2 | ||||||||
MIRT296525 | STX16 | syntaxin 16 | 2 | 2 | ||||||||
MIRT298582 | BRWD1 | bromodomain and WD repeat domain containing 1 | 2 | 4 | ||||||||
MIRT313090 | RNF44 | ring finger protein 44 | 2 | 4 | ||||||||
MIRT313687 | ITGA2 | integrin subunit alpha 2 | 2 | 2 | ||||||||
MIRT323127 | AGPAT5 | 1-acylglycerol-3-phosphate O-acyltransferase 5 | 2 | 2 | ||||||||
MIRT323693 | PLEKHF2 | pleckstrin homology and FYVE domain containing 2 | 2 | 4 | ||||||||
MIRT367153 | HIST2H4A | histone cluster 2 H4 family member a | 2 | 6 | ||||||||
MIRT367177 | HIST2H4B | histone cluster 2 H4 family member b | 2 | 6 | ||||||||
MIRT402568 | ARFGEF1 | ADP ribosylation factor guanine nucleotide exchange factor 1 | 1 | 1 | ||||||||
MIRT405627 | WBP4 | WW domain binding protein 4 | 2 | 4 | ||||||||
MIRT437514 | RGNEF | Rho guanine nucleotide exchange factor 28 | 0 | 1 | ||||||||
MIRT437515 | PSG4 | pregnancy specific beta-1-glycoprotein 4 | 0 | 1 | ||||||||
MIRT437516 | PIWIL4 | piwi like RNA-mediated gene silencing 4 | 0 | 1 | ||||||||
MIRT437517 | USP34 | ubiquitin specific peptidase 34 | 0 | 1 | ||||||||
MIRT437518 | TTC9C | tetratricopeptide repeat domain 9C | 0 | 1 | ||||||||
MIRT437520 | ALKBH6 | alkB homolog 6 | 0 | 1 | ||||||||
MIRT437521 | KAT2A | lysine acetyltransferase 2A | 0 | 1 | ||||||||
MIRT437523 | GRK4 | G protein-coupled receptor kinase 4 | 0 | 1 | ||||||||
MIRT437524 | ESRRB | estrogen related receptor beta | 0 | 1 | ||||||||
MIRT437525 | SGSM3 | small G protein signaling modulator 3 | 0 | 1 | ||||||||
MIRT437526 | RNASE1 | ribonuclease A family member 1, pancreatic | 0 | 1 | ||||||||
MIRT437527 | ST13 | ST13, Hsp70 interacting protein | 0 | 1 | ||||||||
MIRT437528 | WDFY2 | WD repeat and FYVE domain containing 2 | 0 | 1 | ||||||||
MIRT437529 | ABCA2 | ATP binding cassette subfamily A member 2 | 0 | 1 | ||||||||
MIRT437530 | BTN2A2 | butyrophilin subfamily 2 member A2 | 0 | 1 | ||||||||
MIRT437533 | REM1 | RRAD and GEM like GTPase 1 | 0 | 1 | ||||||||
MIRT437534 | C1orf26 | SWT1, RNA endoribonuclease homolog | 0 | 1 | ||||||||
MIRT437535 | SIRPB2 | signal regulatory protein beta 2 | 0 | 1 | ||||||||
MIRT437536 | MED28 | mediator complex subunit 28 | 0 | 1 | ||||||||
MIRT437537 | TMEM107 | transmembrane protein 107 | 0 | 1 | ||||||||
MIRT437538 | CASQ1 | calsequestrin 1 | 0 | 1 | ||||||||
MIRT437539 | C4orf39 | family with sequence similarity 218 member A | 0 | 1 | ||||||||
MIRT437540 | ZNF772 | zinc finger protein 772 | 2 | 5 | ||||||||
MIRT437541 | NDFIP1 | Nedd4 family interacting protein 1 | 0 | 1 | ||||||||
MIRT437542 | MYBL2 | MYB proto-oncogene like 2 | 0 | 1 | ||||||||
MIRT437866 | TGFB1 | transforming growth factor beta 1 | 1 | 1 | ||||||||
MIRT437867 | CREB1 | cAMP responsive element binding protein 1 | 1 | 1 | ||||||||
MIRT438624 | TP53 | tumor protein p53 | 3 | 2 | ||||||||
MIRT438807 | DNMT1 | DNA methyltransferase 1 | 1 | 1 | ||||||||
MIRT456094 | MB21D1 | Mab-21 domain containing 1 | 2 | 6 | ||||||||
MIRT457964 | PTPRB | protein tyrosine phosphatase, receptor type B | 2 | 2 | ||||||||
MIRT460411 | TNFRSF10B | TNF receptor superfamily member 10b | 2 | 4 | ||||||||
MIRT462957 | ZNF800 | zinc finger protein 800 | 2 | 13 | ||||||||
MIRT463651 | YY1 | YY1 transcription factor | 2 | 8 | ||||||||
MIRT463908 | WNT7B | Wnt family member 7B | 2 | 2 | ||||||||
MIRT466343 | THBS1 | thrombospondin 1 | 2 | 2 | ||||||||
MIRT466376 | TGOLN2 | trans-golgi network protein 2 | 2 | 5 | ||||||||
MIRT466811 | STX6 | syntaxin 6 | 2 | 7 | ||||||||
MIRT468241 | SGK1 | serum/glucocorticoid regulated kinase 1 | 2 | 3 | ||||||||
MIRT469278 | RHOB | ras homolog family member B | 2 | 8 | ||||||||
MIRT470337 | PPP6R1 | protein phosphatase 6 regulatory subunit 1 | 2 | 2 | ||||||||
MIRT472560 | NACC1 | nucleus accumbens associated 1 | 2 | 4 | ||||||||
MIRT472786 | MTMR6 | myotubularin related protein 6 | 2 | 8 | ||||||||
MIRT473734 | MAP3K9 | mitogen-activated protein kinase kinase kinase 9 | 2 | 2 | ||||||||
MIRT474480 | KLHL11 | kelch like family member 11 | 2 | 8 | ||||||||
MIRT474746 | KIF13A | kinesin family member 13A | 2 | 6 | ||||||||
MIRT475200 | IMPDH1P11 | inosine monophosphate dehydrogenase 1 pseudogene 11 | 2 | 6 | ||||||||
MIRT476914 | FBLIM1 | filamin binding LIM protein 1 | 2 | 4 | ||||||||
MIRT477371 | EOGT | EGF domain specific O-linked N-acetylglucosamine transferase | 2 | 4 | ||||||||
MIRT477478 | ELL2 | elongation factor for RNA polymerase II 2 | 2 | 2 | ||||||||
MIRT478113 | DLG5 | discs large MAGUK scaffold protein 5 | 2 | 6 | ||||||||
MIRT479663 | CD164 | CD164 molecule | 2 | 4 | ||||||||
MIRT479822 | CCNA2 | cyclin A2 | 2 | 7 | ||||||||
MIRT480022 | CAPRIN2 | caprin family member 2 | 2 | 4 | ||||||||
MIRT481863 | ANKRD50 | ankyrin repeat domain 50 | 2 | 2 | ||||||||
MIRT482515 | ACTB | actin beta | 2 | 4 | ||||||||
MIRT482594 | ABHD14B | abhydrolase domain containing 14B | 2 | 2 | ||||||||
MIRT483459 | YTHDF1 | YTH N6-methyladenosine RNA binding protein 1 | 2 | 6 | ||||||||
MIRT484948 | ZFYVE26 | zinc finger FYVE-type containing 26 | 2 | 4 | ||||||||
MIRT485563 | FOXQ1 | forkhead box Q1 | 2 | 2 | ||||||||
MIRT485652 | DICER1 | dicer 1, ribonuclease III | 2 | 4 | ||||||||
MIRT485807 | ARPP19 | cAMP regulated phosphoprotein 19 | 2 | 3 | ||||||||
MIRT491941 | WDR45B | WD repeat domain 45B | 2 | 8 | ||||||||
MIRT492242 | SLC48A1 | solute carrier family 48 member 1 | 2 | 2 | ||||||||
MIRT493099 | MMGT1 | membrane magnesium transporter 1 | 2 | 12 | ||||||||
MIRT494486 | BRWD3 | bromodomain and WD repeat domain containing 3 | 2 | 2 | ||||||||
MIRT495275 | NICN1 | nicolin 1 | 2 | 4 | ||||||||
MIRT498463 | PTBP2 | polypyrimidine tract binding protein 2 | 2 | 10 | ||||||||
MIRT500407 | ZMAT3 | zinc finger matrin-type 3 | 2 | 10 | ||||||||
MIRT500676 | TRIM37 | tripartite motif containing 37 | 2 | 2 | ||||||||
MIRT501661 | PHLDA3 | pleckstrin homology like domain family A member 3 | 2 | 2 | ||||||||
MIRT501793 | NRBF2 | nuclear receptor binding factor 2 | 2 | 6 | ||||||||
MIRT501995 | MAPK1 | mitogen-activated protein kinase 1 | 2 | 10 | ||||||||
MIRT503055 | CAMSAP2 | calmodulin regulated spectrin associated protein family member 2 | 2 | 3 | ||||||||
MIRT503466 | ZNF154 | zinc finger protein 154 | 2 | 6 | ||||||||
MIRT503673 | SLC46A1 | solute carrier family 46 member 1 | 2 | 2 | ||||||||
MIRT505252 | UBE2D3 | ubiquitin conjugating enzyme E2 D3 | 2 | 2 | ||||||||
MIRT505699 | SESN3 | sestrin 3 | 2 | 2 | ||||||||
MIRT505789 | SATB1 | SATB homeobox 1 | 2 | 4 | ||||||||
MIRT506350 | NUP54 | nucleoporin 54 | 2 | 7 | ||||||||
MIRT506698 | LZIC | leucine zipper and CTNNBIP1 domain containing | 2 | 4 | ||||||||
MIRT507969 | BEND3 | BEN domain containing 3 | 2 | 7 | ||||||||
MIRT509027 | PALM2-AKAP2 | PALM2-AKAP2 readthrough | 2 | 2 | ||||||||
MIRT509046 | AKAP2 | A-kinase anchoring protein 2 | 2 | 2 | ||||||||
MIRT510564 | USP8 | ubiquitin specific peptidase 8 | 2 | 4 | ||||||||
MIRT510855 | RAN | RAN, member RAS oncogene family | 2 | 9 | ||||||||
MIRT510949 | PPTC7 | PTC7 protein phosphatase homolog | 2 | 8 | ||||||||
MIRT510984 | PFN2 | profilin 2 | 2 | 6 | ||||||||
MIRT511154 | MRPL17 | mitochondrial ribosomal protein L17 | 2 | 6 | ||||||||
MIRT512575 | DCC | DCC netrin 1 receptor | 2 | 4 | ||||||||
MIRT512704 | ZNF134 | zinc finger protein 134 | 2 | 6 | ||||||||
MIRT513626 | VPS37B | VPS37B, ESCRT-I subunit | 2 | 3 | ||||||||
MIRT513719 | RBM20 | RNA binding motif protein 20 | 2 | 4 | ||||||||
MIRT513913 | GRB10 | growth factor receptor bound protein 10 | 2 | 6 | ||||||||
MIRT513949 | DDX3X | DEAD-box helicase 3, X-linked | 2 | 6 | ||||||||
MIRT521317 | RRAGD | Ras related GTP binding D | 2 | 4 | ||||||||
MIRT524509 | CEP170 | centrosomal protein 170 | 2 | 4 | ||||||||
MIRT529429 | MALT1 | MALT1 paracaspase | 2 | 2 | ||||||||
MIRT530120 | HADHB | hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit | 2 | 2 | ||||||||
MIRT533712 | TMEM64 | transmembrane protein 64 | 2 | 4 | ||||||||
MIRT534273 | SLC12A7 | solute carrier family 12 member 7 | 2 | 2 | ||||||||
MIRT535360 | PFN1 | profilin 1 | 2 | 2 | ||||||||
MIRT538083 | DGKH | diacylglycerol kinase eta | 2 | 2 | ||||||||
MIRT538503 | CLOCK | clock circadian regulator | 4 | 3 | ||||||||
MIRT539381 | ADSS | adenylosuccinate synthase | 2 | 7 | ||||||||
MIRT541004 | ZNF367 | zinc finger protein 367 | 2 | 4 | ||||||||
MIRT543096 | TNFRSF11A | TNF receptor superfamily member 11a | 2 | 2 | ||||||||
MIRT543212 | TMEM117 | transmembrane protein 117 | 2 | 2 | ||||||||
MIRT543558 | RPF2 | ribosome production factor 2 homolog | 2 | 4 | ||||||||
MIRT544721 | NDRG1 | N-myc downstream regulated 1 | 2 | 2 | ||||||||
MIRT544976 | MFF | mitochondrial fission factor | 2 | 4 | ||||||||
MIRT546398 | STOX2 | storkhead box 2 | 2 | 4 | ||||||||
MIRT546425 | SNX5 | sorting nexin 5 | 2 | 2 | ||||||||
MIRT546778 | RLIM | ring finger protein, LIM domain interacting | 2 | 2 | ||||||||
MIRT546959 | SFTPA1 | surfactant protein A1 | 2 | 2 | ||||||||
MIRT547497 | MBNL3 | muscleblind like splicing regulator 3 | 2 | 4 | ||||||||
MIRT548084 | GIGYF1 | GRB10 interacting GYF protein 1 | 2 | 3 | ||||||||
MIRT548104 | GFPT1 | glutamine--fructose-6-phosphate transaminase 1 | 2 | 4 | ||||||||
MIRT548606 | DCUN1D3 | defective in cullin neddylation 1 domain containing 3 | 2 | 2 | ||||||||
MIRT548735 | CREBRF | CREB3 regulatory factor | 2 | 2 | ||||||||
MIRT548849 | CERCAM | cerebral endothelial cell adhesion molecule | 2 | 2 | ||||||||
MIRT548923 | CHEK2 | checkpoint kinase 2 | 2 | 4 | ||||||||
MIRT549039 | CASZ1 | castor zinc finger 1 | 2 | 4 | ||||||||
MIRT549184 | BMP3 | bone morphogenetic protein 3 | 2 | 2 | ||||||||
MIRT549356 | ARC | activity regulated cytoskeleton associated protein | 2 | 2 | ||||||||
MIRT549465 | ACSL4 | acyl-CoA synthetase long chain family member 4 | 2 | 3 | ||||||||
MIRT549493 | ACBD5 | acyl-CoA binding domain containing 5 | 2 | 3 | ||||||||
MIRT550131 | ZNF138 | zinc finger protein 138 | 2 | 2 | ||||||||
MIRT550204 | MAVS | mitochondrial antiviral signaling protein | 2 | 4 | ||||||||
MIRT550985 | RBM38 | RNA binding motif protein 38 | 2 | 2 | ||||||||
MIRT551820 | TMEM138 | transmembrane protein 138 | 2 | 2 | ||||||||
MIRT552147 | DAD1 | defender against cell death 1 | 2 | 3 | ||||||||
MIRT552844 | WNK3 | WNK lysine deficient protein kinase 3 | 2 | 2 | ||||||||
MIRT552876 | WASL | Wiskott-Aldrich syndrome like | 2 | 4 | ||||||||
MIRT553208 | UBE2A | ubiquitin conjugating enzyme E2 A | 2 | 2 | ||||||||
MIRT553215 | TXLNG | taxilin gamma | 2 | 2 | ||||||||
MIRT554050 | SOX6 | SRY-box 6 | 2 | 2 | ||||||||
MIRT554948 | RAP1A | RAP1A, member of RAS oncogene family | 2 | 3 | ||||||||
MIRT555085 | PURG | purine rich element binding protein G | 2 | 2 | ||||||||
MIRT555246 | PRICKLE2 | prickle planar cell polarity protein 2 | 2 | 2 | ||||||||
MIRT556081 | MPRIP | myosin phosphatase Rho interacting protein | 2 | 4 | ||||||||
MIRT556166 | MECP2 | methyl-CpG binding protein 2 | 2 | 3 | ||||||||
MIRT556199 | MCC | mutated in colorectal cancers | 2 | 2 | ||||||||
MIRT556866 | JAZF1 | JAZF zinc finger 1 | 2 | 2 | ||||||||
MIRT557213 | HNRNPF | heterogeneous nuclear ribonucleoprotein F | 2 | 4 | ||||||||
MIRT557566 | GNPTAB | N-acetylglucosamine-1-phosphate transferase alpha and beta subunits | 2 | 2 | ||||||||
MIRT557775 | FRS2 | fibroblast growth factor receptor substrate 2 | 2 | 3 | ||||||||
MIRT558268 | DYNC1LI2 | dynein cytoplasmic 1 light intermediate chain 2 | 2 | 2 | ||||||||
MIRT558405 | DEPDC1 | DEP domain containing 1 | 2 | 2 | ||||||||
MIRT558491 | DBN1 | drebrin 1 | 2 | 2 | ||||||||
MIRT558777 | CFL2 | cofilin 2 | 2 | 2 | ||||||||
MIRT559412 | GDNF | glial cell derived neurotrophic factor | 2 | 4 | ||||||||
MIRT559485 | ARL8A | ADP ribosylation factor like GTPase 8A | 2 | 3 | ||||||||
MIRT559689 | AGO3 | argonaute 3, RISC catalytic component | 2 | 2 | ||||||||
MIRT560045 | ZNF680 | zinc finger protein 680 | 2 | 2 | ||||||||
MIRT560640 | ZNF107 | zinc finger protein 107 | 2 | 3 | ||||||||
MIRT563096 | PABPC4L | poly(A) binding protein cytoplasmic 4 like | 2 | 2 | ||||||||
MIRT563188 | C15orf38-AP3S2 | C15orf38-AP3S2 readthrough | 2 | 2 | ||||||||
MIRT564184 | CLVS2 | clavesin 2 | 2 | 2 | ||||||||
MIRT564536 | CCDC80 | coiled-coil domain containing 80 | 2 | 2 | ||||||||
MIRT564640 | ZNF544 | zinc finger protein 544 | 2 | 2 | ||||||||
MIRT564783 | ZDHHC7 | zinc finger DHHC-type containing 7 | 2 | 3 | ||||||||
MIRT566161 | RACGAP1 | Rac GTPase activating protein 1 | 2 | 2 | ||||||||
MIRT567524 | FGFR1OP | FGFR1 oncogene partner | 2 | 2 | ||||||||
MIRT575746 | Zfp618 | zinc finger protein 618 | 1 | 1 | ||||||||
MIRT614960 | HOMER1 | homer scaffolding protein 1 | 2 | 2 | ||||||||
MIRT620044 | ODF4 | outer dense fiber of sperm tails 4 | 2 | 2 | ||||||||
MIRT625043 | MBD3 | methyl-CpG binding domain protein 3 | 2 | 2 | ||||||||
MIRT632671 | MTX3 | metaxin 3 | 2 | 2 | ||||||||
MIRT644932 | PTCD2 | pentatricopeptide repeat domain 2 | 2 | 2 | ||||||||
MIRT668495 | ETV3 | ETS variant 3 | 2 | 2 | ||||||||
MIRT675086 | C6orf132 | chromosome 6 open reading frame 132 | 2 | 2 | ||||||||
MIRT681480 | DIP2A | disco interacting protein 2 homolog A | 2 | 2 | ||||||||
MIRT683139 | MTHFD1 | methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1 | 2 | 2 | ||||||||
MIRT683183 | UBL3 | ubiquitin like 3 | 2 | 2 | ||||||||
MIRT693227 | KIAA0907 | KIAA0907 | 2 | 5 | ||||||||
MIRT698244 | TMEM2 | transmembrane protein 2 | 2 | 2 | ||||||||
MIRT702409 | KITLG | KIT ligand | 2 | 2 | ||||||||
MIRT703536 | FKBP15 | FK506 binding protein 15 | 2 | 3 | ||||||||
MIRT715057 | TMTC1 | transmembrane and tetratricopeptide repeat containing 1 | 2 | 2 | ||||||||
MIRT726093 | XIAP | X-linked inhibitor of apoptosis | 1 | 1 | ||||||||
MIRT726097 | WNT10A | Wnt family member 10A | 1 | 1 | ||||||||
MIRT726105 | WDR1 | WD repeat domain 1 | 1 | 1 | ||||||||
MIRT726150 | VAMP1 | vesicle associated membrane protein 1 | 1 | 1 | ||||||||
MIRT726239 | TRAK2 | trafficking kinesin protein 2 | 1 | 1 | ||||||||
MIRT726243 | TP53INP1 | tumor protein p53 inducible nuclear protein 1 | 1 | 1 | ||||||||
MIRT726257 | TNPO2 | transportin 2 | 1 | 1 | ||||||||
MIRT726259 | TNIP1 | TNFAIP3 interacting protein 1 | 1 | 1 | ||||||||
MIRT726265 | TNFAIP3 | TNF alpha induced protein 3 | 1 | 1 | ||||||||
MIRT726334 | TFB1M | transcription factor B1, mitochondrial | 1 | 1 | ||||||||
MIRT726423 | STK4 | serine/threonine kinase 4 | 1 | 1 | ||||||||
MIRT726475 | SOCS3 | suppressor of cytokine signaling 3 | 7 | 2 | ||||||||
MIRT726478 | SNX17 | sorting nexin 17 | 1 | 1 | ||||||||
MIRT726499 | SLC9A6 | solute carrier family 9 member A6 | 1 | 1 | ||||||||
MIRT726552 | SLC25A12 | solute carrier family 25 member 12 | 1 | 1 | ||||||||
MIRT726591 | SH3KBP1 | SH3 domain containing kinase binding protein 1 | 1 | 1 | ||||||||
MIRT726627 | SERBP1 | SERPINE1 mRNA binding protein 1 | 1 | 1 | ||||||||
MIRT726629 | SEPHS2 | selenophosphate synthetase 2 | 1 | 1 | ||||||||
MIRT726637 | SEL1L | SEL1L ERAD E3 ligase adaptor subunit | 1 | 1 | ||||||||
MIRT726639 | SEC63 | SEC63 homolog, protein translocation regulator | 1 | 1 | ||||||||
MIRT726649 | SBF2 | SET binding factor 2 | 1 | 1 | ||||||||
MIRT726671 | S1PR2 | sphingosine-1-phosphate receptor 2 | 1 | 1 | ||||||||
MIRT726723 | RNF216 | ring finger protein 216 | 1 | 1 | ||||||||
MIRT726748 | RGL1 | ral guanine nucleotide dissociation stimulator like 1 | 1 | 1 | ||||||||
MIRT726783 | RAPGEF6 | Rap guanine nucleotide exchange factor 6 | 1 | 1 | ||||||||
MIRT726794 | RAF1 | Raf-1 proto-oncogene, serine/threonine kinase | 1 | 1 | ||||||||
MIRT726817 | RAB2B | RAB2B, member RAS oncogene family | 1 | 1 | ||||||||
MIRT726938 | PIK3R3 | phosphoinositide-3-kinase regulatory subunit 3 | 1 | 1 | ||||||||
MIRT726943 | PIGS | phosphatidylinositol glycan anchor biosynthesis class S | 1 | 1 | ||||||||
MIRT726958 | PGM2L1 | phosphoglucomutase 2 like 1 | 1 | 1 | ||||||||
MIRT726963 | PGK1 | phosphoglycerate kinase 1 | 1 | 1 | ||||||||
MIRT726999 | PCDH10 | protocadherin 10 | 1 | 1 | ||||||||
MIRT727014 | PARK2 | parkin RBR E3 ubiquitin protein ligase | 1 | 1 | ||||||||
MIRT727029 | OTUD7B | OTU deubiquitinase 7B | 1 | 1 | ||||||||
MIRT727113 | NAPB | NSF attachment protein beta | 1 | 1 | ||||||||
MIRT727140 | MTMR12 | myotubularin related protein 12 | 1 | 1 | ||||||||
MIRT727188 | MKL2 | MKL1/myocardin like 2 | 1 | 1 | ||||||||
MIRT727216 | MEF2A | myocyte enhancer factor 2A | 1 | 1 | ||||||||
MIRT727224 | MCM3AP-AS1 | MCM3AP antisense RNA 1 | 1 | 1 | ||||||||
MIRT727237 | MBD4 | methyl-CpG binding domain 4, DNA glycosylase | 1 | 1 | ||||||||
MIRT727251 | MAP3K14 | mitogen-activated protein kinase kinase kinase 14 | 1 | 1 | ||||||||
MIRT727292 | LOC613266 | uncharacterized LOC613266 | 1 | 1 | ||||||||
MIRT727299 | LIN9 | lin-9 DREAM MuvB core complex component | 1 | 1 | ||||||||
MIRT727333 | KLHL3 | kelch like family member 3 | 1 | 1 | ||||||||
MIRT727350 | KIF3A | kinesin family member 3A | 1 | 1 | ||||||||
MIRT727360 | CCSER2 | coiled-coil serine rich protein 2 | 1 | 1 | ||||||||
MIRT727365 | ATG14 | autophagy related 14 | 1 | 1 | ||||||||
MIRT727445 | INO80 | INO80 complex subunit | 1 | 1 | ||||||||
MIRT727486 | HNRNPU | heterogeneous nuclear ribonucleoprotein U | 1 | 1 | ||||||||
MIRT727500 | HIC1 | HIC ZBTB transcriptional repressor 1 | 1 | 1 | ||||||||
MIRT727503 | HECW2 | HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 | 1 | 1 | ||||||||
MIRT727512 | HDAC4 | histone deacetylase 4 | 1 | 1 | ||||||||
MIRT727524 | GRSF1 | G-rich RNA sequence binding factor 1 | 1 | 1 | ||||||||
MIRT727529 | GPAM | glycerol-3-phosphate acyltransferase, mitochondrial | 1 | 1 | ||||||||
MIRT727606 | GAK | cyclin G associated kinase | 1 | 1 | ||||||||
MIRT727649 | FOXP1 | forkhead box P1 | 1 | 1 | ||||||||
MIRT727662 | FBXO48 | F-box protein 48 | 1 | 1 | ||||||||
MIRT727679 | FBXO10 | F-box protein 10 | 1 | 1 | ||||||||
MIRT727696 | FAM73A | mitoguardin 1 | 1 | 1 | ||||||||
MIRT727720 | DENND6A | DENN domain containing 6A | 1 | 1 | ||||||||
MIRT727727 | FAM102A | family with sequence similarity 102 member A | 1 | 1 | ||||||||
MIRT727736 | EXOC7 | exocyst complex component 7 | 1 | 1 | ||||||||
MIRT727752 | EPS15 | epidermal growth factor receptor pathway substrate 15 | 1 | 1 | ||||||||
MIRT727758 | EPN2 | epsin 2 | 1 | 1 | ||||||||
MIRT727789 | EIF4E2 | eukaryotic translation initiation factor 4E family member 2 | 1 | 1 | ||||||||
MIRT727792 | EHD1 | EH domain containing 1 | 1 | 1 | ||||||||
MIRT727837 | DUT | deoxyuridine triphosphatase | 1 | 1 | ||||||||
MIRT727851 | DSCR3 | DSCR3 arrestin fold containing | 1 | 1 | ||||||||
MIRT727985 | CIT | citron rho-interacting serine/threonine kinase | 5 | 1 | ||||||||
MIRT728040 | CBX7 | chromobox 7 | 1 | 1 | ||||||||
MIRT728041 | CBX5 | chromobox 5 | 1 | 1 | ||||||||
MIRT728059 | IDNK | IDNK, gluconokinase | 1 | 1 | ||||||||
MIRT728097 | C2orf42 | chromosome 2 open reading frame 42 | 1 | 1 | ||||||||
MIRT728104 | PRR14L | proline rich 14 like | 1 | 1 | ||||||||
MIRT728122 | SDE2 | SDE2 telomere maintenance homolog | 1 | 1 | ||||||||
MIRT728132 | C15orf38 | actin related protein 2/3 complex inhibitor | 1 | 1 | ||||||||
MIRT728147 | SPTSSA | serine palmitoyltransferase small subunit A | 1 | 1 | ||||||||
MIRT728153 | GSKIP | GSK3B interacting protein | 1 | 1 | ||||||||
MIRT728181 | BTBD7 | BTB domain containing 7 | 1 | 1 | ||||||||
MIRT728196 | BRD9 | bromodomain containing 9 | 1 | 1 | ||||||||
MIRT728215 | BCL7B | BCL tumor suppressor 7B | 1 | 1 | ||||||||
MIRT728234 | B4GALT1 | beta-1,4-galactosyltransferase 1 | 1 | 1 | ||||||||
MIRT728238 | AZIN1 | antizyme inhibitor 1 | 1 | 1 | ||||||||
MIRT728246 | ATXN7 | ataxin 7 | 1 | 1 | ||||||||
MIRT728249 | ATPAF1 | ATP synthase mitochondrial F1 complex assembly factor 1 | 1 | 1 | ||||||||
MIRT728271 | ATG5 | autophagy related 5 | 1 | 1 | ||||||||
MIRT728273 | ATG2B | autophagy related 2B | 1 | 1 | ||||||||
MIRT728307 | ARMC8 | armadillo repeat containing 8 | 1 | 1 | ||||||||
MIRT728317 | ARAP2 | ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 | 1 | 1 | ||||||||
MIRT728353 | ANGEL2 | angel homolog 2 | 1 | 1 | ||||||||
MIRT728369 | AHDC1 | AT-hook DNA binding motif containing 1 | 1 | 1 | ||||||||
MIRT732763 | STAT3 | signal transducer and activator of transcription 3 | 1 | 0 | ||||||||
MIRT732839 | CCL1 | C-C motif chemokine ligand 1 | 3 | 0 | ||||||||
MIRT733218 | HOXA9 | homeobox A9 | 3 | 0 | ||||||||
MIRT734933 | MTOR | mechanistic target of rapamycin kinase | 2 | 0 | ||||||||
MIRT735098 | F8 | coagulation factor VIII | 3 | 0 | ||||||||
MIRT735120 | IGF1 | insulin like growth factor 1 | 1 | 0 | ||||||||
MIRT737185 | AQP5 | aquaporin 5 | 2 | 0 | ||||||||
MIRT756069 | Stk26 | serine/threonine kinase 26 | 3 | 1 |
miRNA-Drug Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|