miRTarBase - #MIRT004510


—
pre-miRNA Information
pre-miRNA hsa-mir-29b-1   
Genomic Coordinates chr7: 130877459 - 130877539
Synonyms MIRN29B1, miRNA29B1, MIR29B1
Description Homo sapiens miR-29b-1 stem-loop
Comment Mourelatos et al. identified two copies of this sequence mapping to chromosome 7, and assigned the names mir-102-7.1 and mir-102-7.2 . Subsequent genome assemblies suggest the presence of only one miR-102 locus on chromosome 7. Human miR-102 is a homologue of mouse miR-29b (MIR:MI0000143) and so has been renamed here for consistency.
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-29b-2   
Genomic Coordinates chr1: 207802443 - 207802523
Synonyms MIRN29B2, mir-29b-2, MIR29B2
Description Homo sapiens miR-29b-2 stem-loop
Comment This sequence was named mir-102-1 in reference . Human miR-102 is a homologue of mouse miR-29b (MIR:MI0000143) and so has been renamed here for consistency.
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-29b-3p
Sequence 52| UAGCACCAUUUGAAAUCAGUGUU |74
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 2 7 - 130877488 29233923 MiREDiBase
A-to-I 2 1 - 207802471 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs773555186 20 dbSNP
rs1390817128 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TCL1A   
Synonyms TCL1
Description T-cell leukemia/lymphoma 1A
Transcript NM_021966   
Other Transcripts NM_001098725   
Expression
Putative miRNA Targets on TCL1A
3'UTR of TCL1A
(miRNA target sites are highlighted)		 
>TCL1A|NM_021966|3'UTR
   1 TGTATGGTCTTGGCAGCACCTGTCTCCTTTCACCCCAGGGCCTGAGCCTGGCCAGCCTACAATGGGGATGTTGTGTTTCT
  81 GTTCACCTTCGTTTACTATGCCTGTGTCTTCTCCACCACGCTGGGGTCTGGGAGGAATGGACAGACAGAGGATGAGCTCT
 161 ACCCAGGGCCTGCAGGACCTGCCTGTAGCCCACTCTGCTCGCCTTAGCACTACCACTCCTGCCAAGGAGGATTCCATTTG
 241 GCAGAGCTTCTTCCAGGTGCCCAGCTATACCTGTGCCTCGGCTTTTCTCAGCTGGATGATGGTCTTCAGCCTCTTTCTGT
 321 CCCTTCTGTCCCTCACAGCACTAGTATTTCATGTTGCACACCCACTCAGCTCCGTGAACTTGTGAGAACACAGCCGATTC
 401 ACCTGAGCAGGACCTCTGAAACCCTGGACCAGTGGTCTCACATGGTGCTACGCCTGCATGTAAACACGCCTGCAAACGCT
 481 GCCTGCCGGTAAACACGCCTGCAAACGCTGCCTGCCCGTAAACACGCCTGCAAACGCTGCCTGCCCACACAGGTTCACGT
 561 GCAGCTCAAGGAAAGGCCTGAAAGGAGCCCTTATCTGTGCTCAGGACTCAGAAGCCTCTGGGTCAGTGGTCCACATCCCG
 641 GGACGCAGCAGGAGGCCAGGCCGGCGAGCCCTGTGGATGAGCCCTCAGAACCCTTGGCTTGCCCACGTGGAAAAGGGATA
 721 GAGGTTGGGTTTCCCCCCTTTTATAGATGGTCACGCACCTGGGTGTTACAAAGTTGTATGTGGCATGAATACTTTTTGTA
 801 ATGATTGATTAAATGCAAGATAGTTTATCTAACTTCGTGCGGAATCAGCTTCTATCCTTGACTTAGATTCTGGTGGAGAG
 881 AAGTGAGAATAGGCAGCCCCCAAATAAAAAATATTCATGGAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uuGUGACUAAAGUUUACCACGAu 5'
            || ||:| ||| |||||||| 
Target 5' acCAGTGGTCTCACATGGTGCTa 3'
 428 - 450 177.00 -21.40
2 
miRNA  3' uuGUGA-C-UAAAGUUUACCACGau 5'
            |||| | |||||  ||| |||  
Target 5' agCACTAGTATTTC--ATGTTGCac 3'
 337 - 359 117.00 -9.40
3 
miRNA  3' uuGUGACUAAAGUUU---ACCACgau 5'
            | :||| || |:|   |||||   
Target 5' atCCTTGACTT-AGATTCTGGTGgag 3'
 854 - 878 116.00 -6.92
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN24305069 14 COSMIC
COSN20055909 29 COSMIC
COSN24399676 48 COSMIC
COSN31769826 56 COSMIC
COSN8159874 104 COSMIC
COSN18859970 125 COSMIC
COSN26054954 530 COSMIC
COSN21236679 631 COSMIC
COSN1667153 648 COSMIC
COSN5799661 958 COSMIC
COSN1173433 990 COSMIC
COSN18004398 1044 COSMIC
COSN31769818 1224 COSMIC
COSN21377518 1272 COSMIC
COSN21155723 1318 COSMIC
COSN7034595 1344 COSMIC
COSN20092881 1354 COSMIC
COSN20092880 1355 COSMIC
COSN28954745 1356 COSMIC
COSN24470551 1384 COSMIC
COSN6265205 1495 COSMIC
COSN17037887 1532 COSMIC
COSN5172878 1610 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs746507043 2 dbSNP
rs1243569054 3 dbSNP
rs1256293038 4 dbSNP
rs1185042513 5 dbSNP
rs1462565723 9 dbSNP
rs1459713781 10 dbSNP
rs1262206875 11 dbSNP
rs777477449 14 dbSNP
rs556757039 15 dbSNP
rs747916728 16 dbSNP
rs778722375 19 dbSNP
rs376401914 20 dbSNP
rs1296551965 22 dbSNP
rs973468375 26 dbSNP
rs753729360 27 dbSNP
rs779872846 29 dbSNP
rs373204517 31 dbSNP
rs1469008893 33 dbSNP
rs757350575 34 dbSNP
rs1383315604 35 dbSNP
rs751644622 39 dbSNP
rs940623290 45 dbSNP
rs538535701 47 dbSNP
rs763303471 50 dbSNP
rs1327595877 54 dbSNP
rs1229683652 56 dbSNP
rs1273203503 62 dbSNP
rs992193850 77 dbSNP
rs1224386134 82 dbSNP
rs1263466329 87 dbSNP
rs571055768 91 dbSNP
rs764174825 100 dbSNP
rs992693331 101 dbSNP
rs960113985 103 dbSNP
rs1469010120 104 dbSNP
rs139601629 116 dbSNP
rs1203233715 119 dbSNP
rs1260946530 157 dbSNP
rs1238069593 165 dbSNP
rs923779946 170 dbSNP
rs1266194399 171 dbSNP
rs1034131318 172 dbSNP
rs552192530 176 dbSNP
rs980196369 177 dbSNP
rs968766830 182 dbSNP
rs113327601 183 dbSNP
rs1158407842 193 dbSNP
rs1274103414 196 dbSNP
rs1022385464 197 dbSNP
rs995882378 198 dbSNP
rs1301326809 202 dbSNP
rs1344993103 205 dbSNP
rs1010617246 212 dbSNP
rs1285426800 215 dbSNP
rs868085809 220 dbSNP
rs1236587704 221 dbSNP
rs557441637 222 dbSNP
rs1351264971 224 dbSNP
rs566258193 225 dbSNP
rs547903922 228 dbSNP
rs1008469140 230 dbSNP
rs1008635719 250 dbSNP
rs889980466 257 dbSNP
rs891320648 261 dbSNP
rs1270575778 262 dbSNP
rs1306967784 266 dbSNP
rs1047201833 268 dbSNP
rs1448842687 269 dbSNP
rs1355075955 272 dbSNP
rs1333185886 273 dbSNP
rs1181494969 277 dbSNP
rs994837134 280 dbSNP
rs1455760964 284 dbSNP
rs529706188 287 dbSNP
rs1305960722 288 dbSNP
rs1336137861 288 dbSNP
rs1458754313 288 dbSNP
rs898706501 305 dbSNP
rs1312832290 308 dbSNP
rs760659462 322 dbSNP
rs1358718340 325 dbSNP
rs1222560023 326 dbSNP
rs1039022320 327 dbSNP
rs948088082 328 dbSNP
rs1454746494 336 dbSNP
rs916565120 337 dbSNP
rs185093566 342 dbSNP
rs1421245898 346 dbSNP
rs1471403633 347 dbSNP
rs1385132384 350 dbSNP
rs995959100 361 dbSNP
rs534614475 362 dbSNP
rs1461616456 363 dbSNP
rs1298970402 364 dbSNP
rs923782962 365 dbSNP
rs1398995574 371 dbSNP
rs1448705227 373 dbSNP
rs1037373801 375 dbSNP
rs977916289 392 dbSNP
rs968285077 393 dbSNP
rs1305272937 397 dbSNP
rs940326341 409 dbSNP
rs1281979229 413 dbSNP
rs868005660 414 dbSNP
rs1202133372 415 dbSNP
rs1057427490 416 dbSNP
rs938599484 418 dbSNP
rs1185975388 421 dbSNP
rs1417381776 422 dbSNP
rs927165230 425 dbSNP
rs1224974415 427 dbSNP
rs1468473301 428 dbSNP
rs550313177 428 dbSNP
rs979870927 432 dbSNP
rs968776721 437 dbSNP
rs1453214149 440 dbSNP
rs1445538298 449 dbSNP
rs1342085913 450 dbSNP
rs1313285805 457 dbSNP
rs112533660 458 dbSNP
rs1491407309 459 dbSNP
rs1163643091 460 dbSNP
rs1221324343 460 dbSNP
rs1262843987 460 dbSNP
rs1295721458 460 dbSNP
rs1319508126 460 dbSNP
rs1428259558 460 dbSNP
rs1463895826 460 dbSNP
rs1491340399 460 dbSNP
rs1178025062 461 dbSNP
rs1470113281 461 dbSNP
rs1278063115 465 dbSNP
rs1402580952 468 dbSNP
rs1288890531 472 dbSNP
rs1341845853 473 dbSNP
rs1402638034 473 dbSNP
rs1282232019 477 dbSNP
rs1345819723 479 dbSNP
rs532483398 480 dbSNP
rs1282649332 495 dbSNP
rs1316806168 497 dbSNP
rs1181826757 499 dbSNP
rs190456702 500 dbSNP
rs775614862 503 dbSNP
rs1269842170 505 dbSNP
rs956265139 510 dbSNP
rs1487721318 514 dbSNP
rs1019595225 515 dbSNP
rs1405547102 517 dbSNP
rs1008933234 518 dbSNP
rs1159748373 522 dbSNP
rs954268192 524 dbSNP
rs546212306 525 dbSNP
rs1302045000 527 dbSNP
rs1365781118 529 dbSNP
rs995632471 530 dbSNP
rs1373072570 531 dbSNP
rs950464275 541 dbSNP
rs898934405 558 dbSNP
rs1312091775 563 dbSNP
rs565599302 569 dbSNP
rs1292627326 570 dbSNP
rs1004622618 573 dbSNP
rs560482818 574 dbSNP
rs1202706935 575 dbSNP
rs1056793135 582 dbSNP
rs938609295 583 dbSNP
rs1469430273 589 dbSNP
rs1179080953 591 dbSNP
rs1382075244 616 dbSNP
rs779905440 618 dbSNP
rs1162335102 622 dbSNP
rs1385340915 625 dbSNP
rs1336897379 631 dbSNP
rs1406683947 635 dbSNP
rs75213274 642 dbSNP
rs947195435 643 dbSNP
rs914400127 646 dbSNP
rs1333835773 647 dbSNP
rs1381174405 651 dbSNP
rs989326120 655 dbSNP
rs1012432599 661 dbSNP
rs1358562622 669 dbSNP
rs1212948623 676 dbSNP
rs1272540694 679 dbSNP
rs1438653638 685 dbSNP
rs1464423697 688 dbSNP
rs895169313 709 dbSNP
rs574942855 716 dbSNP
rs1340103076 719 dbSNP
rs1182927739 724 dbSNP
rs74551977 747 dbSNP
rs1368475319 772 dbSNP
rs1473491212 773 dbSNP
rs1165709791 776 dbSNP
rs1418312111 781 dbSNP
rs1465845507 795 dbSNP
rs556844801 797 dbSNP
rs956144717 799 dbSNP
rs912586546 803 dbSNP
rs750199318 804 dbSNP
rs1452459536 805 dbSNP
rs1337955822 806 dbSNP
rs774087873 811 dbSNP
rs1428694124 814 dbSNP
rs939444997 816 dbSNP
rs1432933336 817 dbSNP
rs986762578 821 dbSNP
rs1220721915 822 dbSNP
rs1259690736 830 dbSNP
rs954277941 835 dbSNP
rs1202874879 839 dbSNP
rs1028555470 841 dbSNP
rs946599953 843 dbSNP
rs1404058957 855 dbSNP
rs1190345656 860 dbSNP
rs1241040495 870 dbSNP
rs915041288 873 dbSNP
rs1195401051 874 dbSNP
rs143985445 876 dbSNP
rs1166037834 879 dbSNP
rs868846729 891 dbSNP
rs1404937999 895 dbSNP
rs1260588049 900 dbSNP
rs1015742691 906 dbSNP
rs577502312 908 dbSNP
rs558965307 911 dbSNP
rs534478894 914 dbSNP
rs886156312 927 dbSNP
rs950430153 929 dbSNP
rs1402008665 936 dbSNP
rs1281611167 939 dbSNP
rs566145285 940 dbSNP
rs973546642 946 dbSNP
rs1002470569 949 dbSNP
rs905803731 957 dbSNP
rs757494035 958 dbSNP
rs1203328207 965 dbSNP
rs1044321702 967 dbSNP
rs1336782887 967 dbSNP
rs1012466396 968 dbSNP
rs751789864 976 dbSNP
rs554102531 979 dbSNP
rs367738940 981 dbSNP
rs1479927090 982 dbSNP
rs1199982478 984 dbSNP
rs1052949103 986 dbSNP
rs1034986619 987 dbSNP
rs535944752 992 dbSNP
rs550306005 999 dbSNP
rs867920907 1006 dbSNP
rs550790415 1023 dbSNP
rs1216501676 1024 dbSNP
rs907626244 1028 dbSNP
rs902500626 1029 dbSNP
rs912606720 1034 dbSNP
rs986814923 1035 dbSNP
rs893659598 1038 dbSNP
rs1354382920 1039 dbSNP
rs932610389 1039 dbSNP
rs921252444 1040 dbSNP
rs532190592 1043 dbSNP
rs983518470 1044 dbSNP
rs1038855402 1046 dbSNP
rs974344517 1051 dbSNP
rs776046557 1063 dbSNP
rs1016185206 1067 dbSNP
rs911853600 1068 dbSNP
rs373850844 1083 dbSNP
rs571543617 1085 dbSNP
rs987376628 1095 dbSNP
rs950538592 1097 dbSNP
rs1384699820 1098 dbSNP
rs1397310573 1100 dbSNP
rs1035373827 1114 dbSNP
rs1458544321 1119 dbSNP
rs1295499648 1134 dbSNP
rs546597677 1138 dbSNP
rs796073362 1142 dbSNP
rs905561383 1143 dbSNP
rs1022585675 1146 dbSNP
rs528356309 1147 dbSNP
rs1173028450 1149 dbSNP
rs1242259062 1160 dbSNP
rs765684200 1163 dbSNP
rs866765560 1165 dbSNP
rs1312213154 1167 dbSNP
rs1053362816 1178 dbSNP
rs1428671965 1184 dbSNP
rs1017065004 1185 dbSNP
rs560491904 1199 dbSNP
rs1479482741 1200 dbSNP
rs148367980 1201 dbSNP
rs1188936987 1211 dbSNP
rs1459435363 1213 dbSNP
rs1182290049 1216 dbSNP
rs959529068 1220 dbSNP
rs1035264611 1223 dbSNP
rs1167061365 1227 dbSNP
rs1371518172 1228 dbSNP
rs1461697882 1235 dbSNP
rs934485385 1240 dbSNP
rs74608547 1241 dbSNP
rs370393806 1242 dbSNP
rs1448819464 1243 dbSNP
rs1334608886 1253 dbSNP
rs932703966 1262 dbSNP
rs562955493 1263 dbSNP
rs376585311 1271 dbSNP
rs544819275 1278 dbSNP
rs1320441326 1280 dbSNP
rs1202233468 1284 dbSNP
rs747830369 1290 dbSNP
rs1483885530 1292 dbSNP
rs748907699 1300 dbSNP
rs893857821 1306 dbSNP
rs1259766134 1309 dbSNP
rs941611433 1312 dbSNP
rs111247694 1313 dbSNP
rs1252815366 1317 dbSNP
rs983368656 1318 dbSNP
rs1308244842 1319 dbSNP
rs1300922744 1321 dbSNP
rs1466984337 1321 dbSNP
rs960936421 1322 dbSNP
rs1051706869 1325 dbSNP
rs929188491 1326 dbSNP
rs1304031371 1332 dbSNP
rs928120462 1334 dbSNP
rs981198277 1335 dbSNP
rs374676147 1344 dbSNP
rs185584936 1345 dbSNP
rs1222027393 1349 dbSNP
rs76676116 1353 dbSNP
rs941791657 1354 dbSNP
rs559073952 1355 dbSNP
rs1011199942 1363 dbSNP
rs957532554 1364 dbSNP
rs915699978 1365 dbSNP
rs540579476 1373 dbSNP
rs796807672 1374 dbSNP
rs573153681 1378 dbSNP
rs1309475281 1384 dbSNP
rs3831076 1384 dbSNP
rs996967077 1385 dbSNP
rs1343421354 1392 dbSNP
rs899879508 1393 dbSNP
rs1298318733 1396 dbSNP
rs1362015108 1398 dbSNP
rs1402739264 1402 dbSNP
rs1274568093 1407 dbSNP
rs373333484 1414 dbSNP
rs751141948 1414 dbSNP
rs1038398431 1420 dbSNP
rs769783676 1425 dbSNP
rs535834997 1426 dbSNP
rs1252598763 1431 dbSNP
rs1177560770 1434 dbSNP
rs191298008 1437 dbSNP
rs1221130265 1441 dbSNP
rs531083620 1443 dbSNP
rs1209060181 1447 dbSNP
rs781117449 1454 dbSNP
rs958018480 1455 dbSNP
rs1227733338 1460 dbSNP
rs556755593 1461 dbSNP
rs939598426 1464 dbSNP
rs538696382 1467 dbSNP
rs1007628582 1476 dbSNP
rs1381636333 1478 dbSNP
rs890309740 1502 dbSNP
rs186505168 1506 dbSNP
rs993436374 1507 dbSNP
rs897697652 1510 dbSNP
rs546729242 1511 dbSNP
rs528444246 1512 dbSNP
rs751777129 1522 dbSNP
rs777910656 1529 dbSNP
rs990234261 1530 dbSNP
rs957088393 1532 dbSNP
rs182680123 1533 dbSNP
rs77989678 1535 dbSNP
rs752679724 1536 dbSNP
rs955265930 1542 dbSNP
rs1236155588 1550 dbSNP
rs1451075667 1553 dbSNP
rs1365463437 1560 dbSNP
rs1182487298 1563 dbSNP
rs1457217800 1566 dbSNP
rs945563581 1570 dbSNP
rs1029505722 1572 dbSNP
rs996659886 1573 dbSNP
rs899931720 1574 dbSNP
rs1414036557 1584 dbSNP
rs1406769181 1586 dbSNP
rs1038482322 1589 dbSNP
rs1253761949 1590 dbSNP
rs989734090 1592 dbSNP
rs958047615 1600 dbSNP
rs1448083747 1601 dbSNP
rs1006033613 1602 dbSNP
rs1017591531 1604 dbSNP
rs986225118 1605 dbSNP
rs1447345792 1609 dbSNP
rs1284888353 1610 dbSNP
rs530095532 1611 dbSNP
rs954743274 1613 dbSNP
rs887157411 1615 dbSNP
rs765305436 1616 dbSNP
rs1255841591 1621 dbSNP
rs1317063093 1622 dbSNP
rs575734004 1623 dbSNP
rs562874493 1625 dbSNP
rs1306309031 1630 dbSNP
rs1259892940 1632 dbSNP
rs1387787487 1637 dbSNP
rs143282939 1638 dbSNP
rs993776083 1653 dbSNP
rs897649753 1658 dbSNP
rs1045226517 1659 dbSNP
rs948192180 1665 dbSNP
rs1473542530 1669 dbSNP
rs1191071381 1670 dbSNP
rs1215980539 1681 dbSNP
rs1173325206 1682 dbSNP
rs140113793 1685 dbSNP
rs796173245 1692 dbSNP
rs1414419056 1694 dbSNP
rs565339302 1703 dbSNP
rs150661254 1704 dbSNP
rs573241286 1707 dbSNP
rs977457491 1708 dbSNP
rs561227835 1712 dbSNP
rs1218984446 1714 dbSNP
rs45509491 1721 dbSNP
rs1199817495 1729 dbSNP
rs1417027392 1730 dbSNP
rs1443640244 1732 dbSNP
rs191670127 1744 dbSNP
rs975315260 1745 dbSNP
rs1261979218 1747 dbSNP
rs1477961199 1751 dbSNP
rs1196237057 1763 dbSNP
rs963897262 1764 dbSNP
rs1017179610 1768 dbSNP
rs374503443 1770 dbSNP
rs1173663693 1775 dbSNP
rs1005671823 1778 dbSNP
rs887158734 1787 dbSNP
rs1297706982 1793 dbSNP
rs1361371228 1794 dbSNP
rs188793291 1799 dbSNP
rs1299748510 1805 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions B-CLL
Disease MIMAT0000100;
Location of target site 3'UTR
Tools used in this research miRBase Target Database , RNAhybrid
Original Description (Extracted from the article) ... "Tcl1expres sion in CLL is ...

- Pekarsky Y; Santanam U; Cimmino A; et al., 2006, Cancer research.

Article - Pekarsky Y; Santanam U; Cimmino A; et al.
- Cancer research, 2006
B-cell chronic lymphocytic leukemia (B-CLL) is the most common human leukemia in the world. Deregulation of the TCL1 oncogene is a causal event in the pathogenesis of the aggressive form of this disease as was verified by using animal models. To study the mechanism of Tcl1 regulation in CLL, we carried out microRNA expression profiling of three types of CLL: indolent CLL, aggressive CLL, and aggressive CLL showing 11q deletion. We identified distinct microRNA signatures corresponding to each group of CLL. We further determined that Tcl1 expression is regulated by miR-29 and miR-181, two microRNAs differentially expressed in CLL. Expression levels of miR-29 and miR-181 generally inversely correlated with Tcl1 expression in the CLL samples we examined. Our results suggest that Tcl1 expression in CLL is, at least in part, regulated by miR-29 and miR-181 and that these microRNAs may be candidates for therapeutic agents in CLLs overexpressing Tcl1.
LinkOut: [PMID: 17178851]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Article - Calin GA; Pekarsky Y; Croce CM
- Best practice & research. Clinical haematology, 2007
New findings support the view that chronic lymphocytic leukemia (CLL) is a genetic disease in which the main alterations occur in a new class of genes named microRNAs (miRNAs). Cases with good prognostic features typically are characterized by miRNA down-regulation of genes miR-15a and miR-16-1, located at 13q14.3. Both microRNAs negatively regulate BCL2 at a post-transcriptional level. On the other hand, in CLL cases that use unmutated immunoglobulin heavy-chain variable-region genes (IgV(H)) or have high-level expression of the 70-kD zeta-associated protein (ZAP-70) have high levels of TCL1 due to low-level expression of miR-29 and miR-181, which directly target this oncogene. Conceivably, these miRNAs might be used to target BCL2 or TCL1 for therapy of this disease.
LinkOut: [PMID: 17707831]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Efanov A; Zanesi N; Nazaryan N; Santanam U; et al.
- Leukemia, 2010
B-cell chronic lymphocytic leukemia (B-CLL) is the most common adult leukemia. Deregulation of the T-cell leukemia/lymphoma 1 (TCL1) oncogene in mouse B cells causes a CD5-positive leukemia similar to aggressive human B-CLLs. We recently reported that levels of TCL1 expression in B-CLL are regulated by miR-29 and miR-181 that target 3' UTR of TCL1. To determine whether treatment with microRNAs targeting TCL1 can inhibit B-CLL in mice, we generated TCL1 transgenic mice using a construct containing the 3' and 5' UTRs of TCL1 under B-cell-specific Emicro promoter (Emicro-TCL1FL). At the age of 16-20 months, these mice showed B-CLL-like disease. Immunophenotyping revealed accumulation of CD5+CD23+B220+ population in spleens and lymph nodes. Our results show that CD5+CD23+ B-cell populations from Emicro-TCL1FL mice actively proliferate and show significantly increased levels of phospho-Akt. Emicro-TCL1FL mice showed immunological abnormalities similar to human B-CLL, including hypoimmunoglobulinemia, abnormal levels of cytokines and impaired immune response. These findings revealed biochemical and immunological similarities between Tcl1-driven B-CLL in mice and human B-CLL.
LinkOut: [PMID: 20357824]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Klein U; Dalla-Favera R
- Seminars in cancer biology, 2010
Chronic lymphocytic leukemia (CLL), an incurable disease of the elderly, stands out as unique among the malignancies derived from mature B lymphocytes. The histology, immunophenotype, immunoglobulin variable region (IgV) gene somatic hypermutation status, and the pattern of genetic alterations of the tumor cells are markedly distinct from that of any other B-cell tumor. Most notably, CLL cases can have somatically mutated as well as unmutated IgV genes which largely correlate with a favorable and unfavorable clinical prognosis, respectively. Moreover, recent evidence suggests that 6% of the normal elderly population develops a monoclonal B-cell lymphocytosis (MBL) that appears as the precursor to CLL in 1-2% of cases. Over the last decade, global gene expression profile analysis was instrumental in defining CLL as a malignancy originating from the oncogenic transformation of a common cellular precursor that resembles an antigen-experienced B cell. These findings were complemented by the realization that all CLL, independent of their IgV gene somatic mutation status, express B-cell receptors (BCRs) that show evidence of antigen-experience. Indeed, the BCRs of CLL cases among different individuals can be similar to the extent that one was able to define subsets of stereotyped receptors based on the homology in the antigen-binding regions. Together, these observations strongly support the notion that antigen plays a critical role in CLL pathogenesis. This role is complemented by genetic alterations that, analogous to most cancer types, represent the initiating pathogenetic event. In fact, CLL cases display recurrent genetic aberrations including trisomy 12 and monoallelic or biallelic deletion/inactivation of chromosomal regions 17p, 11q and 13q14. However, virtually all CLL cases lack balanced reciprocal chromosomal translocations, the genetic hallmark of germinal center (GC)-derived lymphomas. The most frequent genetic aberration in CLL, deletion of chromosomal region 13q14, was recently shown to have a specific role in CLL pathogenesis. This region encodes a tumor suppressor locus comprising a microRNA cluster embedded in a long sterile RNA gene, whose deletion in the mouse leads to lymphoproliferative syndromes recapitulating the human CLL-associated spectrum, including MBL, CLL and B-cell non-Hodgkin lymphoma (B-NHL). This review will focus on the cellular origin of CLL, its relationship to the mechanisms of generating CLL-associated genetic lesions and on the role of the 13q14 deletion in CLL pathogenesis as emerging from the analysis of a newly generated mouse model.
LinkOut: [PMID: 21029776]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE35602 Colorectal cancer stromal tissue -0.691 6.6e-5 -0.733 1.5e-5 25 Click to see details
GSE21849 B cell lymphoma -0.442 8.2e-3 -0.324 4.3e-2 29 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.414 3.5e-2 -0.320 8.4e-2 20 Click to see details
GSE21032 Prostate cancer -0.159 7.6e-2 -0.247 1.2e-2 83 Click to see details
GSE28544 Breast cancer -0.297 7.9e-2 -0.178 2.0e-1 24 Click to see details
GSE26953 Aortic valvular endothelial cells 0.278 9.4e-2 0.158 2.3e-1 24 Click to see details
GSE17306 Multiple myeloma -0.157 1.4e-1 -0.020 4.5e-1 49 Click to see details
GSE17498 Multiple myeloma -0.164 1.6e-1 -0.206 1.0e-1 40 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.466 1.8e-1 -0.600 1.0e-1 6 Click to see details
GSE38226 Liver fibrosis 0.205 1.9e-1 -0.063 3.9e-1 21 Click to see details
GSE19783 ER+ ER+ breast cancer 0.164 2.4e-1 0.090 3.5e-1 20 Click to see details
GSE21687 Ependynoma primary tumors -0.063 3.1e-1 -0.117 1.8e-1 64 Click to see details
GSE27834 Pluripotent stem cells 0.115 3.4e-1 0.197 2.3e-1 16 Click to see details
GSE28260 Renal cortex and medulla 0.121 3.5e-1 -0.005 4.9e-1 13 Click to see details
GSE19350 CNS germ cell tumors 0.127 3.5e-1 0.189 2.8e-1 12 Click to see details
GSE19783 ER- ER- breast cancer 0.041 3.6e-1 0.041 3.6e-1 79 Click to see details
GSE14794 Lymphoblastoid cells -0.037 3.6e-1 -0.086 2.1e-1 90 Click to see details
GSE32688 Pancreatic cancer 0.039 4.2e-1 -0.127 2.4e-1 32 Click to see details
GSE19536 Breast cancer 0.02 4.2e-1 0.017 4.3e-1 100 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.011 4.8e-1 -0.010 4.8e-1 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PRAD -0.532 0 -0.309 0.01 50 Click to see details
HNSC 0.53 0 0.557 0 42 Click to see details
STAD 0.456 0 0.335 0.03 32 Click to see details
CESC 0.999 0.01 1.000 0.5 3 Click to see details
THCA 0.224 0.04 0.219 0.05 59 Click to see details
KIRC 0.208 0.04 0.207 0.05 68 Click to see details
LUSC 0.229 0.08 0.185 0.13 38 Click to see details
PCPG -0.955 0.1 -0.500 0.33 3 Click to see details
UCEC -0.285 0.12 -0.265 0.14 19 Click to see details
ESCA 0.367 0.13 0.264 0.22 11 Click to see details
LIHC 0.15 0.15 0.061 0.34 49 Click to see details
COAD 0.37 0.18 0.310 0.23 8 Click to see details
PAAD 0.628 0.19 0.400 0.3 4 Click to see details
BLCA -0.206 0.21 -0.104 0.34 18 Click to see details
KIRP 0.146 0.21 0.171 0.17 32 Click to see details
KICH 0.166 0.21 0.035 0.43 25 Click to see details
CHOL 0.285 0.23 0.617 0.04 9 Click to see details
BRCA 0.064 0.28 0.099 0.19 84 Click to see details
LUAD 0.097 0.38 0.189 0.28 12 Click to see details
LUAD 0.097 0.38 0.189 0.28 12 Click to see details
LUAD 0.097 0.38 0.189 0.28 12 Click to see details
248 hsa-miR-29b-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000095 TGFB3 transforming growth factor beta 3 2 1
MIRT000096 HDAC4 histone deacetylase 4 4 4
MIRT000097 CTNNBIP1 catenin beta interacting protein 1 4 4
MIRT000098 COL5A3 collagen type V alpha 3 chain 2 2
MIRT000099 COL4A2 collagen type IV alpha 2 chain 2 2
MIRT000100 COL1A1 collagen type I alpha 1 chain 8 8
MIRT000101 ACVR2A activin A receptor type 2A 1 1
MIRT000445 SP1 Sp1 transcription factor 5 6
MIRT000684 CDK6 cyclin dependent kinase 6 6 5
MIRT000930 BACE1 beta-secretase 1 3 1
MIRT002310 SFPQ splicing factor proline and glutamine rich 3 1
MIRT002316 DNAJB11 DnaJ heat shock protein family (Hsp40) member B11 3 1
MIRT003026 DNMT3B DNA methyltransferase 3 beta 4 7
MIRT003029 DNMT3A DNA methyltransferase 3 alpha 5 9
MIRT003287 MCL1 MCL1, BCL2 family apoptosis regulator 7 20
MIRT003290 BCL2 BCL2, apoptosis regulator 4 3
MIRT003661 DNMT1 DNA methyltransferase 1 4 2
MIRT003736 S100B S100 calcium binding protein B 3 1
MIRT003813 VEGFA vascular endothelial growth factor A 9 9
MIRT004308 ESR1 estrogen receptor 1 2 1
MIRT004312 NCOA3 nuclear receptor coactivator 3 2 1
MIRT004419 TET1 tet methylcytosine dioxygenase 1 4 2
MIRT004510 TCL1A T-cell leukemia/lymphoma 1A 5 4
MIRT005381 Mmp15 matrix metallopeptidase 15 3 1
MIRT005383 MMP15 matrix metallopeptidase 15 2 1
MIRT005385 MMP24 matrix metallopeptidase 24 4 2
MIRT005387 Mmp24 matrix metallopeptidase 24 2 1
MIRT005486 GRN granulin precursor 4 1
MIRT005522 FGG fibrinogen gamma chain 2 1
MIRT005533 FGA fibrinogen alpha chain 2 1
MIRT005534 FGB fibrinogen beta chain 2 1
MIRT005567 COL3A1 collagen type III alpha 1 chain 5 4
MIRT005568 COL4A1 collagen type IV alpha 1 chain 7 9
MIRT005570 MMP2 matrix metallopeptidase 2 5 8
MIRT005614 BBC3 BCL2 binding component 3 2 2
MIRT005667 ADAM12 ADAM metallopeptidase domain 12 5 3
MIRT005669 NID1 nidogen 1 4 1
MIRT006054 HMGA2 high mobility group AT-hook 2 3 1
MIRT006058 TGFB2 transforming growth factor beta 2 3 2
MIRT006059 TGFB1 transforming growth factor beta 1 2 1
MIRT006060 BMP1 bone morphogenetic protein 1 3 2
MIRT006098 PTEN phosphatase and tensin homolog 7 3
MIRT006251 NASP nuclear autoantigenic sperm protein 2 1
MIRT006486 PPP1R13B protein phosphatase 1 regulatory subunit 13B 2 1
MIRT006488 CDC42 cell division cycle 42 4 2
MIRT006753 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT006815 PIK3CG phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma 3 1
MIRT006915 NKIRAS2 NFKB inhibitor interacting Ras like 2 5 3
MIRT007011 RAX retina and anterior neural fold homeobox 2 1
MIRT007033 TBX21 T-box 21 1 1
MIRT007034 IFNG interferon gamma 1 1
MIRT007102 DUSP2 dual specificity phosphatase 2 3 3
MIRT007254 FOS Fos proto-oncogene, AP-1 transcription factor subunit 3 3
MIRT027237 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 2 2
MIRT027238 IMPDH1 inosine monophosphate dehydrogenase 1 2 2
MIRT027239 MYCN MYCN proto-oncogene, bHLH transcription factor 3 3
MIRT048359 SCAF8 SR-related CTD associated factor 8 1 1
MIRT048360 CLDN1 claudin 1 1 1
MIRT048361 MRPS35 mitochondrial ribosomal protein S35 1 1
MIRT048362 RSL24D1 ribosomal L24 domain containing 1 1 1
MIRT048363 LRP10 LDL receptor related protein 10 1 1
MIRT048364 HP1BP3 heterochromatin protein 1 binding protein 3 1 1
MIRT048365 B4GALT5 beta-1,4-galactosyltransferase 5 1 1
MIRT048366 KIAA1671 KIAA1671 1 1
MIRT048367 NNT nicotinamide nucleotide transhydrogenase 1 1
MIRT048368 IFIH1 interferon induced with helicase C domain 1 1 1
MIRT048369 TPT1 tumor protein, translationally-controlled 1 1 1
MIRT048370 RUNDC3B RUN domain containing 3B 1 1
MIRT048371 CECR2 CECR2, histone acetyl-lysine reader 1 1
MIRT048372 TPD52L2 tumor protein D52 like 2 1 1
MIRT048373 NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit 1 1
MIRT048374 CIT citron rho-interacting serine/threonine kinase 1 1
MIRT048375 GNB2L1 receptor for activated C kinase 1 1 1
MIRT048376 SMARCC1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin subfamily c member 1 1 1
MIRT048377 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 1
MIRT048378 PIGN phosphatidylinositol glycan anchor biosynthesis class N 1 1
MIRT048379 RPS4X ribosomal protein S4, X-linked 1 1
MIRT048380 CCSAP centriole, cilia and spindle associated protein 1 1
MIRT048381 CALU calumenin 1 1
MIRT048382 NREP neuronal regeneration related protein 1 1
MIRT048383 MKI67 marker of proliferation Ki-67 1 1
MIRT053293 TDG thymine DNA glycosylase 5 5
MIRT053581 CCND2 cyclin D2 5 3
MIRT053738 COL4A5 collagen type IV alpha 5 chain 1 1
MIRT053739 COL7A1 collagen type VII alpha 1 chain 1 1
MIRT053740 COL15A1 collagen type XV alpha 1 chain 1 1
MIRT053741 COL2A1 collagen type II alpha 1 chain 1 1
MIRT053742 COL4A6 collagen type IV alpha 6 chain 1 1
MIRT053743 CSGALNACT2 chondroitin sulfate N-acetylgalactosaminyltransferase 2 1 1
MIRT053744 SOX12 SRY-box 12 1 1
MIRT053745 MAP2K6 mitogen-activated protein kinase kinase 6 1 1
MIRT053746 TGIF2 TGFB induced factor homeobox 2 1 1
MIRT053747 SERPINH1 serpin family H member 1 2 2
MIRT053748 NOTCH2 notch 2 4 1
MIRT053749 PPARD peroxisome proliferator activated receptor delta 1 1
MIRT054045 SNAI3 snail family transcriptional repressor 3 2 1
MIRT054192 AKT2 AKT serine/threonine kinase 2 4 2
MIRT054574 PER1 period circadian clock 1 3 1
MIRT060983 LAMC1 laminin subunit gamma 1 3 1
MIRT061662 BTG2 BTG anti-proliferation factor 2 2 4
MIRT067385 TMTC3 transmembrane and tetratricopeptide repeat containing 3 2 4
MIRT079942 RNF138 ring finger protein 138 2 2
MIRT080798 SH3GLB1 SH3 domain containing GRB2 like, endophilin B1 2 4
MIRT081893 KCTD15 potassium channel tetramerization domain containing 15 2 8
MIRT082515 CALM3 calmodulin 3 2 2
MIRT085293 CCNT2 cyclin T2 2 6
MIRT102856 INSIG1 insulin induced gene 1 2 2
MIRT207249 TET3 tet methylcytosine dioxygenase 3 2 2
MIRT207755 VHL von Hippel-Lindau tumor suppressor 2 4
MIRT210969 TET2 tet methylcytosine dioxygenase 2 1 1
MIRT211650 ABCE1 ATP binding cassette subfamily E member 1 2 2
MIRT213230 REST RE1 silencing transcription factor 2 10
MIRT225103 GOLGA7 golgin A7 2 2
MIRT250481 MAZ MYC associated zinc finger protein 2 2
MIRT264266 FAM102B family with sequence similarity 102 member B 2 2
MIRT267090 ZFP91 ZFP91 zinc finger protein 2 2
MIRT303363 MXD1 MAX dimerization protein 1 2 1
MIRT316344 ULBP2 UL16 binding protein 2 2 2
MIRT401476 AIM1 crystallin beta-gamma domain containing 1 2 1
MIRT437369 LAMC2 laminin subunit gamma 2 3 1
MIRT437372 ITGA6 integrin subunit alpha 6 3 2
MIRT437552 COL5A2 collagen type V alpha 2 chain 1 1
MIRT437553 COL10A1 collagen type X alpha 1 chain 1 1
MIRT437554 SPARC secreted protein acidic and cysteine rich 1 1
MIRT437555 FBN1 fibrillin 1 1 1
MIRT437556 LOX lysyl oxidase 2 2
MIRT437557 PDGFRB platelet derived growth factor receptor beta 2 2
MIRT437710 PHACTR2 phosphatase and actin regulator 2 2 1
MIRT437713 TUBB2A tubulin beta 2A class IIa 2 1
MIRT437716 EMP1 epithelial membrane protein 1 2 1
MIRT437719 SNX24 sorting nexin 24 2 1
MIRT437722 AMFR autocrine motility factor receptor 2 1
MIRT437725 RIOK3 RIO kinase 3 2 1
MIRT437728 WDR26 WD repeat domain 26 4 3
MIRT437731 DSC2 desmocollin 2 2 1
MIRT437870 IL32 interleukin 32 1 1
MIRT438911 GATA3 GATA binding protein 3 2 1
MIRT438912 PDGFRA platelet derived growth factor receptor alpha 2 1
MIRT438913 PDGFC platelet derived growth factor C 2 1
MIRT438914 PDGFB platelet derived growth factor subunit B 2 1
MIRT438915 PDGFA platelet derived growth factor subunit A 2 1
MIRT438916 MMP9 matrix metallopeptidase 9 2 1
MIRT438917 LOXL4 lysyl oxidase like 4 2 1
MIRT438918 LOXL2 lysyl oxidase like 2 2 1
MIRT438919 ITGB1 integrin subunit beta 1 2 1
MIRT438920 ANGPTL4 angiopoietin like 4 2 1
MIRT454812 NEDD9 neural precursor cell expressed, developmentally down-regulated 9 2 2
MIRT456827 MORF4L2 mortality factor 4 like 2 2 8
MIRT462151 RPL22 ribosomal protein L22 2 2
MIRT465314 TRAM2 translocation associated membrane protein 2 2 2
MIRT467808 SLC2A14 solute carrier family 2 member 14 2 2
MIRT467829 SLC29A2 solute carrier family 29 member 2 2 2
MIRT467971 SLC16A1 solute carrier family 16 member 1 2 4
MIRT468225 SGK1 serum/glucocorticoid regulated kinase 1 2 2
MIRT469448 REL REL proto-oncogene, NF-kB subunit 2 2
MIRT469723 RAB40C RAB40C, member RAS oncogene family 2 2
MIRT469841 R3HDM4 R3H domain containing 4 2 2
MIRT472643 NAA40 N(alpha)-acetyltransferase 40, NatD catalytic subunit 2 2
MIRT474209 LEPRE1 prolyl 3-hydroxylase 1 1 1
MIRT474576 KLHDC3 kelch domain containing 3 2 2
MIRT475837 HDGF heparin binding growth factor 2 4
MIRT476721 FRK fyn related Src family tyrosine kinase 2 4
MIRT477473 ELMSAN1 ELM2 and Myb/SANT domain containing 1 2 2
MIRT478668 CTC1 CST telomere replication complex component 1 2 14
MIRT478710 CSRNP2 cysteine and serine rich nuclear protein 2 2 2
MIRT478985 COMMD2 COMM domain containing 2 2 2
MIRT479826 CCNA2 cyclin A2 2 8
MIRT479901 CCDC117 coiled-coil domain containing 117 2 2
MIRT480066 CAND1 cullin associated and neddylation dissociated 1 2 2
MIRT482012 AMER1 APC membrane recruitment protein 1 2 8
MIRT489024 C1QTNF6 C1q and TNF related 6 5 2
MIRT492513 RAET1L retinoic acid early transcript 1L 2 2
MIRT493825 FSCN1 fascin actin-bundling protein 1 2 2
MIRT495936 SLC7A5P2 solute carrier family 7 member 5 pseudogene 2 2 2
MIRT496358 PPY pancreatic polypeptide 2 2
MIRT496662 TMEM237 transmembrane protein 237 2 2
MIRT497644 GLDN gliomedin 2 2
MIRT501878 MORF4L1 mortality factor 4 like 1 2 8
MIRT502932 CDC42SE1 CDC42 small effector 1 2 4
MIRT506750 LDOC1L retrotransposon Gag like 6 2 6
MIRT507168 GAS2L3 growth arrest specific 2 like 3 2 2
MIRT514918 MDM2 MDM2 proto-oncogene 2 6
MIRT523962 DYNLT1 dynein light chain Tctex-type 1 2 4
MIRT527675 CASP8 caspase 8 2 2
MIRT536936 HECW1 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 2 2
MIRT537359 FJX1 four jointed box 1 2 2
MIRT537687 ENPP2 ectonucleotide pyrophosphatase/phosphodiesterase 2 2 2
MIRT538124 DDX6 DEAD-box helicase 6 2 2
MIRT538813 C21orf91 chromosome 21 open reading frame 91 2 2
MIRT546938 PTP4A1 protein tyrosine phosphatase type IVA, member 1 2 2
MIRT547104 PLAG1 PLAG1 zinc finger 2 2
MIRT547823 ISG20L2 interferon stimulated exonuclease gene 20 like 2 2 2
MIRT548237 FEM1B fem-1 homolog B 2 2
MIRT550036 WWTR1 WW domain containing transcription regulator 1 2 2
MIRT552619 ZBTB5 zinc finger and BTB domain containing 5 2 2
MIRT556562 LIMS1 LIM zinc finger domain containing 1 2 2
MIRT558857 CDC23 cell division cycle 23 2 2
MIRT565485 SPRTN SprT-like N-terminal domain 2 2
MIRT568205 CBX6 chromobox 6 2 2
MIRT576774 Tmem127 transmembrane protein 127 2 2
MIRT576958 Pigs phosphatidylinositol glycan anchor biosynthesis, class S 2 3
MIRT610003 PIGS phosphatidylinositol glycan anchor biosynthesis class S 2 3
MIRT616511 COX7A2L cytochrome c oxidase subunit 7A2 like 2 2
MIRT640887 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 2
MIRT641350 RAB11FIP1 RAB11 family interacting protein 1 2 2
MIRT642978 TESPA1 thymocyte expressed, positive selection associated 1 2 2
MIRT643634 YY2 YY2 transcription factor 2 2
MIRT644386 ZNF286A zinc finger protein 286A 2 2
MIRT650749 YAE1D1 Yae1 domain containing 1 2 2
MIRT661585 EPHX2 epoxide hydrolase 2 2 2
MIRT664287 RNMTL1 mitochondrial rRNA methyltransferase 3 2 2
MIRT689393 ZNF850 zinc finger protein 850 2 2
MIRT693815 SEC31A SEC31 homolog A, COPII coat complex component 2 2
MIRT694532 TRIM72 tripartite motif containing 72 2 2
MIRT694628 ZFPM1 zinc finger protein, FOG family member 1 2 2
MIRT695135 PRY2 PTPN13-like, Y-linked 2 2 2
MIRT695152 PRY PTPN13-like, Y-linked 2 2
MIRT703640 FBRS fibrosin 2 2
MIRT704551 CNBP CCHC-type zinc finger nucleic acid binding protein 2 2
MIRT704967 CBX2 chromobox 2 2 2
MIRT705497 ASXL2 additional sex combs like 2, transcriptional regulator 2 2
MIRT707993 OTUD4 OTU deubiquitinase 4 2 2
MIRT708741 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT710621 COLEC10 collectin subfamily member 10 2 2
MIRT713056 IFRD1 interferon related developmental regulator 1 2 2
MIRT715515 MAPKBP1 mitogen-activated protein kinase binding protein 1 2 2
MIRT720770 FAM193A family with sequence similarity 193 member A 2 2
MIRT731925 AQP4 aquaporin 4 3 1
MIRT732673 HMGB1 high mobility group box 1 3 0
MIRT734350 IL6 interleukin 6 1 0
MIRT734351 TP53 tumor protein p53 1 0
MIRT734565 BCL2L11 BCL2 like 11 2 0
MIRT734770 TRIM44 tripartite motif containing 44 2 0
MIRT734771 CCNE1 cyclin E1 2 0
MIRT735260 STAT3 signal transducer and activator of transcription 3 6 1
MIRT735414 HBP1 HMG-box transcription factor 1 3 0
MIRT735537 HIF3A hypoxia inducible factor 3 alpha subunit 3 0
MIRT735639 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 3 0
MIRT735641 AKT3 AKT serine/threonine kinase 3 3 0
MIRT735943 DNM3OS DNM3 opposite strand/antisense RNA 4 0
MIRT737493 SMAD3 SMAD family member 3 1 0
MIRT737577 SNAI1 snail family transcriptional repressor 1 2 0
MIRT755941 SLMAP sarcolemma associated protein 4 1
MIRT755963 ROBO1 roundabout guidance receptor 1 5 1
MIRT755964 SRGAP2 SLIT-ROBO Rho GTPase activating protein 2 5 1
MIRT756271 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon 3 1
MIRT756364 LIN7A lin-7 homolog A, crumbs cell polarity complex component 2 1
MIRT756474 COL5A1 collagen type V alpha 1 chain 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-29b 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray Pancreatic Cancer MiaPACA-2 cells 19407485 2009 up-regulated
miR-29b 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray Pancreatic Cancer PANC-1 cells 19407485 2009 up-regulated
miR-29b 5-aza-2'-deoxycytidine (5-Aza-CdR) + trichostatin A(TSA) NULL NULL Microarray Pancreatic Cancer MiaPACA-2 cells 19407485 2009 up-regulated
miR-29b 5-aza-2'-deoxycytidine (5-Aza-CdR) + trichostatin A(TSA) NULL NULL Microarray Pancreatic Cancer PANC-1 cells 19407485 2009 up-regulated
miR-29b Trichostatin A (TSA) NULL 444732 Microarray Pancreatic Cancer MiaPACA-2 cells 19407485 2009 up-regulated
miR-29b Trichostatin A (TSA) NULL 444732 Microarray Pancreatic Cancer PANC-1 cells 19407485 2009 up-regulated
miR-29b Glucose NULL 5793 Microarray proximal tubule cell line HK-2 20067797 2010 down-regulated
miR-29b Dihydrotestosterone(DHT) NULL 10635 Microarray prostate cancer 20945501 2011 up-regulated
miR-29b Dihydrotestosterone(DHT) NULL 10635 Quantitative real-time PCR prostate cancer 20945501 2011 up-regulated
miR-29b Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-29b Enoxacin approved 3229 Quantitative real-time PCR HCT-116 and RKO colon cancer cell lines 21368194 2011 up-regulated
miR-29b Ginsenoside Rh2 NULL 119307 Microarray human glioma cells U251 21372826 2011 up-regulated
miR-29b Testosterone + 1,25-Dihydroxyvitamin D3 approved NULL Microarray prostate cancer 21592394 2011 up-regulated
miR-29b Progesterone approved 5994 Microarray Breast cancer 22330642 2012 down-regulated
miR-29b Progesterone approved 5994 Quantitative real-time PCR Breast cancer 22330642 2012 down-regulated
miR-29b Trastuzumab approved NULL Microarray SKBR3 cells. 22384020 2012 up-regulated
miR-29b Glucocorticoid NULL NULL Quantitative real-time PCR Eosinophilic esophagitis 22815788 2012 up-regulated
miR-29b Glucocorticoid NULL NULL TaqMan low-density array Eosinophilic esophagitis 22815788 2012 up-regulated
miR-29b CCl4 NULL 5943 Quantitative real-time PCR liver 22393047 2012 down-regulated
miR-29b Estrogen NULL NULL Quantitative real-time PCR liver 22393047 2012 up-regulated
miR-29b Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 down-regulated
miR-29b 5-aminoimidazole-4-carboxamide-1-β-d-ribofuranoside (AICAR) NULL 16078949 Microarray hepatocytes 23107762 2013 down-regulated
miR-29b Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-29b Phenethyl isothiocyanate(PEITC) NULL 16741 Microarray neonatal mice liver 20145010 2010 down-regulated
miR-29b Benzo(a)pyrene NULL 2336 Microarray Adult male B6C3F1 mice 21569818 2011 up-regulated
miR-29b Cocaine NULL 446220 Next-generation sequencing ventral striatum 21708909 2011 down-regulated
miR-29b Urethane NULL 5641 Quantitative real-time PCR mouse lung 24361357 2014 down-regulated
miR-29b Ethanol NULL 702 Quantitative real-time PCR Cerebellar Granule Neurons cells 24554719 2014 down-regulated
miR-29b Rapamycin approved 5284616 Quantitative real-time PCR HL-1 cells 25062042 2014 up-regualted
miR-29b Estradiol benzoate (EB) NULL NULL Quantitative real-time PCR adult germ cell 22334722 2012 up-regulated
miR-29b Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 up-regulated
miR-29b-3p Docosahexaenoic acid NULL 445580 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-29b Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (HepG2, SK-HEP-1)
hsa-miR-29b-3p (1S,10R,12R,14R,15S)-15-hydroxyspiro[13,16-dioxapentacyclo[8.5.1.01,10.03,8.012,14]hexadeca-3,5,7-triene-11,3'-2,4-dioxatricyclo[7.3.1.05,13]trideca-1(12),5,7,9(13),10-pentaene]-2,9-dione 388424 NSC683332 resistant
hsa-miR-29b-3p (5Z)-5-[(4-oxothieno[2,3-b]thiochromen-2-yl)methylidene]-2-sulfanylideneimidazolidin-4-one 5468927 NSC679240 resistant
hsa-miR-29b-3p (6aS)-3-[5-[4-(2-diethoxyphosphorylethyl)piperazin-1-yl]pentoxy]-2-methoxy-6a,7,8,9-tetrahydropyrrolo[2,1-c][1,4]benzodiazepin-11-one 25113728 NSC744025 resistant
hsa-miR-29b-3p 1-adamantylmethyl 4-[(2,5-dihydroxyphenyl)methylamino]benzoate 391131 NSC689857 resistant
hsa-miR-29b-3p 2-((5-methyl-3-isoxazolyl)amino)-4-((5-methyl-3-isoxazolyl)imino)-1(4h)-naphthalenone 373420 NSC649750 sensitive
hsa-miR-29b-3p 2-(1-adamantyl)ethyl 4-[(2,5-dihydroxyphenyl)methylamino]benzoate 403758 NSC719177 resistant
hsa-miR-29b-3p 2-(3-(2-methoxy-4-(4-methylene-5-oxotetrahydro-2-furanyl)phenoxy)propyl)-1h-isoindole-1,3(2h)-dione 381521 NSC668277 resistant
hsa-miR-29b-3p 2-[(dimethylamino)methyl]-3-[(Z)-heptadec-10-enyl]-5-methoxybenzene-1,4-diol;hydrochloride 5387959 NSC630004 resistant
hsa-miR-29b-3p 2-[[(E)-3-(2-chlorophenyl)prop-2-enoyl]amino]-5-iodobenzamide 53329762 NSC748148 resistant
hsa-miR-29b-3p 2-acetylimidazo[4,5-b]pyridin 4 tolyl 3 thiosemicarbazone 135440014 NSC674106 resistant
hsa-miR-29b-3p 2-amino-1-N,9-N-bis[10-[(4-hydroxyphenyl)methyl]-7,11,14-trimethyl-2,5,9,12,15-pentaoxo-3-propan-2-yl-8-oxa-1,4,11,14-tetrazabicyclo[14.3.0]nonadecan-6-yl]-4,6-dimethyl-3-oxophenoxazine-1,9-dicarboxamide 16129921 NSC684901 resistant
hsa-miR-29b-3p 2-amino-1-N,9-N-bis[10-[(4-methoxyphenyl)methyl]-7,11,14-trimethyl-2,5,9,12,15-pentaoxo-3-propan-2-yl-8-oxa-1,4,11,14-tetrazabicyclo[14.3.0]nonadecan-6-yl]-4,6-dimethyl-3-oxophenoxazine-1,9-dicarboxamide 16129907 NSC684908 resistant
hsa-miR-29b-3p 2-amino-9-chloro-3,5-bis(4-chlorophenyl)pyrimido[4,5-c]quinolin-1-one 16126264 NSC741296 resistant
hsa-miR-29b-3p 2,3-bis(4,5-dimethyl-3,6-dioxo-cyclohexa-1,4-dien-1-yl)-5,6-dimethyl-1,4-benzoquinone 394545 NSC698090 sensitive
hsa-miR-29b-3p 3-(4-chlorophenyl)-5-methyl-[1,2]oxazolo[5,4-d]triazin-4-one 399226 NSC709900 resistant
hsa-miR-29b-3p 4-[4-[2,3-bis(hydroxymethyl)pyrrol-1-yl]butanoylamino]-n-[5-[[5-[3-(dimethylamino)propylcarbamoyl]-1-methylpyrrol-3-yl]carbamoyl]-1-methylpyrrol-3-yl]-1-methylpyrrole-2-carboxamide 384021 NSC673131 resistant
hsa-miR-29b-3p 5-(4-methoxyphenyl)-3-(3,4,5-trimethoxyphenyl)-4,5-dihydro-1h-pyrazole 49865894 NSC748404 resistant
hsa-miR-29b-3p 5,11-dimethyl-1h-benzo[a]carbazole-1,4(11h)-dione 372651 NSC648148 resistant
hsa-miR-29b-3p Acetic acid;3-[4-(2-hydroxyethyl)piperidin-1-yl]-N-[6-[3-[4-(2-hydroxyethyl)piperidin-1-yl]propanoylamino]-9,10-dioxoanthracen-2-yl]propanamide 374314 NSC651841 resistant
hsa-miR-29b-3p Beacon red 135421797 NSC12455 resistant
hsa-miR-29b-3p Benzoic acid, 3,4,5-trihydroxy-, phenyl ester 333279 NSC333571 resistant
hsa-miR-29b-3p Csa13 24205348 NSC735211 sensitive
hsa-miR-29b-3p Mefloquine hydrochloride 456309 NSC157387 sensitive
hsa-miR-29b-3p Methyl 3-hydroxy-3-[(15R)-15-tetracyclo[6.6.2.02,7.09,14]hexadeca-2,4,6,9,11,13-hexaenyl]propanedithioate 383730 NSC672159 resistant
hsa-miR-29b-3p Methyl 6-[[(3S,4aR,6aR,6bS,8R,8aR,12aS,14aR,14bR)-8a-[3-[3,4-dihydroxy-6-methyl-5-(3,4,5-trihydroxyoxan-2-yl)oxyoxan-2-yl]oxy-4,5-dihydroxyoxan-2-yl]oxycarbonyl-8-hydroxy-4,4,6a,6b,11,11,14b-heptamethyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropi 385532 NSC676788 sensitive
hsa-miR-29b-3p Naphth[2,3-d]oxazol-9-one, 2-methyl-4-(phenylimino)- 160386 NSC650573 sensitive
hsa-miR-29b-3p NSC148077 NSC148077 resistant
hsa-miR-29b-3p NSC175490 NSC175490 resistant
hsa-miR-29b-3p NSC175493 NSC175493 resistant
hsa-miR-29b-3p NSC85701 NSC85701 resistant
hsa-miR-29b-3p Oxin 1923 NSC2039 approved resistant
hsa-miR-29b-3p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Etoposide 36462 NSC141540 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved resistant High Breast Cancer cell line (MDA-435)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive High Breast Cancer cell line (MDA-MB-435, MDA-MB-436, SKBr3, BT-474, MDA-MB-231, MCF7)
hsa-miR-29b-3p Imatinib 5291 NSC743414 approved resistant High Myelogenous Leukemia cell line (MYL)
hsa-miR-29b-3p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7, LY2)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-miR-29b-3p Cyclopamine 442972 NSC734950 resistant Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved resistant Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-29b-3p Etoposide 36462 NSC141540 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Decitabine 451668 approved sensitive Low Acute Myeloid Leukemia tissue and cell line (Kasumi-1, NB4, FDC-P1-KITmut)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved resistant High Bladder Cancer cell line (RT4, J82,TCCSUP, UM-UC-3,RT112,CUBIII)
hsa-miR-29b-3p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (RKO)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved sensitive Low Cholangiocarcinoma cell line (HuCCT1, HuH28)
hsa-miR-29b-3p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-29b-3p Ethanol 702 NSC85228 approved resistant Low Cerebellum Granule Neuron tissue
hsa-miR-29b-3p Chemotherapy sensitive Low Ovarian Cancer tissue
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive Low Ovarian Cancer cell line (ES2, AMOC2)
hsa-miR-29b-3p Fluorouracil 3385 NSC19893 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-29b-3p Bortezomib 387447 NSC681239 approved sensitive Low Melanoma cell line (RPMI8226)
hsa-miR-29b-3p Carfilzomib 11556711 NSC756640 approved sensitive Low Melanoma cell line (RPMI8226)
hsa-miR-29b-3p Ixazomib 25183872 approved sensitive Low Melanoma cell line (RPMI8226)
hsa-miR-29b-3p Interferon-Gamma sensitive Low Colorectal Cancer cell line (HCT-116, HT-29, LS174T, SW480,SW620, HEK293)
hsa-miR-29b-3p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR200)
hsa-miR-29b-3p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR70)
hsa-miR-29b-3p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Platinum 23939 resistant Low Ovarian Cancer tissue
hsa-miR-29b-3p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-29b-3p Imatinib 5291 NSC743414 approved resistant High Gastrointestinal Stromal Tumor cell line (882R-NC, 882R-OE, 882R-KD)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549, H1299)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive High Gallbladder Cancer cell line (GBC-SD, NOZ)
hsa-miR-29b-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-29b-3p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-29b-3p Curcumin 969516 NSC32982 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved resistant High Cholangiocarcinoma cell line (CCLP-1, MzChA-1)
hsa-miR-29b-3p Oxaliplatin 6857599 NSC266046 approved sensitive Low Colorectal Cancer cell line (SW480)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (PC-3-R)
hsa-miR-29b-3p Methotrexate 126941 NSC740 approved sensitive Low Osteosarcoma tissue and cell line (MG-63, U-2-OS)
hsa-miR-29b-3p Crizotinib 11626560 NSC749005 approved resistant High Non-Small Cell Lung Cancer cell line (NCI-H2228, DFCI032)
hsa-miR-29b-3p Lorlatinib 71731823 NSC780108 approved resistant High Non-Small Cell Lung Cancer cell line (NCI-H2228, DFCI032)
hsa-miR-29b-3p Doxorubicin 31703 NSC123127 approved sensitive Low Osteosarcoma cell line (MG-63)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved sensitive Low Pancreatic Cancer cell line (PANC-1 cell, BXPC-3)
hsa-miR-29b-3p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7, MCF-7-21)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive Low Endometrial Cancer cell line (HEC-1-B)
hsa-miR-29b-3p Fluorouracil 3385 NSC19893 approved sensitive High Colorectal Cancer cell line (HT-29)
hsa-miR-29b-3p Oxaliplatin 6857599 NSC266046 approved sensitive Low Colon Cancer cell line (SW480, SW620)
hsa-miR-29b-3p Temozolomide 5394 NSC362856 approved sensitive Low Glioma cell line (LN229, U87MG, U251)
hsa-miR-29b-3p Temozolomide 5394 NSC362856 approved sensitive Low Glioblastoma cell line (U251, U87MG)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-29b-3p Oxaliplatin 6857599 NSC266046 approved sensitive Low Colorectal Cancer cell line (HT-29, DLD1)
hsa-miR-29b-3p Bortezomib 387447 NSC681239 approved resistant Low Multiple Myeloma tissue
hsa-miR-29b-3p Palbociclib 5330286 NSC758247 approved sensitive High Breast Cancer cell line (MDA-MB-231, Hs578t, SKBR3, MCF-7)
hsa-miR-29b-3p Temozolomide 5394 NSC362856 approved sensitive Low Glioma tissue
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-29b-3p Fluorouracil 3385 NSC19893 approved resistant Low Colorectal Cancer cell line (HT-29, HCT-116, SW480, SW620, LoVo, SW48, DLD-1, Caco-1, HCT-15)
hsa-miR-29b-3p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-29b-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (mitochondrial RNA)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (cytosolic RNA)
hsa-miR-29b-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-29b-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (SKVO3ip1)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved resistant cell line (HeyA8)
hsa-miR-29b-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-29b-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-29b-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-29b-3p Exemestane 60198 NSC713563 approved resistant cell line (MCF-7)
hsa-miR-29b-3p Testosterone 6013 NSC9700 approved resistant cell line (MCF-7)
hsa-miR-29b-3p Testosterone+Anastrozole resistant cell line (MCF-7)
hsa-miR-29b-3p Testosterone+Letrozole resistant cell line (MCF-7)
hsa-miR-29b-3p Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved resistant cell line (MGC-803)
hsa-miR-29b-3p 4-Hydroxytamoxifen+Tamoxifen resistant cell line (LY2)
hsa-miR-29b-3p Ethanol+Tamoxifen resistant cell line (LY2)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-29b-3p Pegylated interferon alpha+Ribavirin sensitive tissue (chronic hepatitis C)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (HuH28)
hsa-miR-29b-3p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-29b-3p Tamoxifen 2733525 NSC180973 approved sensitive cell line (TamR4)
hsa-miR-29b-3p Oxaliplatin 6857599 NSC266046 approved sensitive cell line (IGROV-1)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (IGROV-1)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR200)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR70)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-29b-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-29b-3p Bortezomib 387447 NSC681239 approved resistant cell line (CCRF-CEM) (100 nM)
hsa-miR-29b-3p Bortezomib 387447 NSC681239 approved sensitive cell line (CCRF-CEM) (200 nM)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved resistant cell line (OVCAR3)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (H23)
hsa-miR-29b-3p Cetuximab sensitive tissue (colorectal carcinoma)

Error report submission