miRTarBase - #MIRT004528


—
pre-miRNA Information
pre-miRNA hsa-mir-7-1   
Genomic Coordinates chr9: 83969748 - 83969857
Synonyms MIRN7-1, hsa-mir-7-1, mir-7-1, MIR7-1
Description Homo sapiens miR-7-1 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-7-2   
Genomic Coordinates chr15: 88611825 - 88611934
Synonyms MIRN7-2, hsa-mir-7-2, mir-7-2, MIR7-2
Description Homo sapiens miR-7-2 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-7-3   
Genomic Coordinates chr19: 4770670 - 4770779
Synonyms MIRN7-3, hsa-mir-7-3, mir-7-3, MIR7-3
Description Homo sapiens miR-7-3 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-7-5p
Sequence 24| UGGAAGACUAGUGAUUUUGUUGU |46
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 10 15 + 88611865 18684997, 27587585, 29233923 MiREDiBase
A-to-I 7 19 + 4770706 29233923 MiREDiBase
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN31601563 9 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs749860296 1 dbSNP
rs766914760 1 dbSNP
rs765815825 9 dbSNP
rs1257397051 9 dbSNP
rs751269230 11 dbSNP
rs1224111752 14 dbSNP
rs762762175 16 dbSNP
rs868026301 19 dbSNP
rs1263337637 21 dbSNP
rs1359474435 22 dbSNP
rs761252497 22 dbSNP
rs1215541761 23 dbSNP
rs1220521500 23 dbSNP
rs1196555927 24 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SLC7A5   
Synonyms 4F2LC, CD98, D16S469E, E16, LAT1, MPE16
Description solute carrier family 7 member 5
Transcript NM_003486   
Expression
Putative miRNA Targets on SLC7A5
3'UTR of SLC7A5
(miRNA target sites are highlighted)		 
>SLC7A5|NM_003486|3'UTR
   1 CCAGGAGGCCGAGTGGCTGCCGGAGGAGCATGCGCAGAGGCCAGTTAAAGTAGATCACCTCCTCGAACCCACTCCGGTTC
  81 CCCGCAACCCACAGCTCAGCTGCCCATCCCAGTCCCTCGCCGTCCCTCCCAGGTCGGGCAGTGGAGGCTGCTGTGAAAAC
 161 TCTGGTACGAATCTCATCCCTCAACTGAGGGCCAGGGACCCAGGTGTGCCTGTGCTCCTGCCCAGGAGCAGCTTTTGGTC
 241 TCCTTGGGCCCTTTTTCCCTTCCCTCCTTTGTTTACTTATATATATATTTTTTTTAAACTTAAATTTTGGGTCAACTTGA
 321 CACCACTAAGATGATTTTTTAAGGAGCTGGGGGAAGGCAGGAGCCTTCCTTTCTCCTGCCCCAAGGGCCCAGACCCTGGG
 401 CAAACAGAGCTACTGAGACTTGGAACCTCATTGCTACCACAGACTTGCACTGAAGCCGGACAGCTGCCCAGACACATGGG
 481 CTTGTGACATTCGTGAAAACCAACCCTGTGGGCTTATGTCTCTGCCTTAGGGTTTGCAGAGTGGAAACTCAGCCGTAGGG
 561 TGGCACTGGGAGGGGGTGGGGGATCTGGGCAAGGTGGGTGATTCCTCCCAGGAGGTGCTTGAGGCCCCGATGGACTCCTG
 641 ACCATAATCCTAGCCCCGAGACACCATCCTGAGCCAGGGAACAGCCCCAGGGTTGGGGGGTGCCGGCATCTCCCCTAGCT
 721 CACCAGGCCTGGCCTCTGGGCAGTGTGGCCTCTTGGCTATTTCTGTGTCCAGTTTTGGAGGCTGAGTTCTGGTTCATGCA
 801 GACAAAGCCCTGTCCTTCAGTCTTCTAGAAACAGAGACAAGAAAGGCAGACACACCGCGGCCAGGCACCCATGTGGGCGC
 881 CCACCCTGGGCTCCACACAGCAGTGTCCCCTGCCCCAGAGGTCGCAGCTACCCTCAGCCTCCAATGCATTGGCCTCTGTA
 961 CCGCCCGGCAGCCCCTTCTGGCCGGTGCTGGGTTCCCACTCCCGGCCTAGGCACCTCCCCGCTCTCCCTGTCACGCTCAT
1041 GTCCTGTCCTGGTCCTGATGCCCGTTGTCTAGGAGACAGAGCCAAGCACTGCTCACGTCTCTGCCGCCTGCGTTTGGAGG
1121 CCCCTGGGCTCTCACCCAGTCCCCACCCGCCTGCAGAGAGGGAACTAGGGCACCCCTTGTTTCTGTTGTTCCCGTGAATT
1201 TTTTTCGCTATGGGAGGCAGCCGAGGCCTGGCCAATGCGGCCCACTTTCCTGAGCTGTCGCTGCCTCCATGGCAGCAGCC
1281 AGGGACCCCCAGAACAAGAAGACCCCGCAGGATCCCTCCTGAGCTCGGGGGGCTCTGCCTTCTCAGGCCCCGGGCTTCCC
1361 TTCTCCCCAGCCAGAGGTGGAGCCAAGTGGTCCAGCGTCACTCCAGTGCTCAGCTGTGGCTGGAGGAGCTGGCCTGTGGC
1441 ACAGCCCTGAGTGTCCCAAGCCGGGAGCCAACGAAGCCGGACACGGCTTCACTGACCAGCGGCTGCTCAAGCCGCAAGCT
1521 CTCAGCAAGTGCCCAGTGGAGCCTGCCGCCCCCGCCTGGGCACCGGGACCCCCTCACCATCCAGTGGGCCCGGAGAAACC
1601 TGATGAACAGTTTGGGGACTCAGGACCAGATGTCCGTCTCTCTTGCTTGAGGAATGAAGACCTTTATTCACCCCTGCCCC
1681 GTTGCTTCCCGCTGCACATGGACAGACTTCACAGCGTCTGCTCATAGGACCTGCATCCTTCCTGGGGACGAATTCCACTC
1761 GTCCAAGGGACAGCCCACGGTCTGGAGGCCGAGGACCACCAGCAGGCAGGTGGACTGACTGTGTTGGGCAAGACCTCTTC
1841 CCTCTGGGCCTGTTCTCTTGGCTGCAAATAAGGACAGCAGCTGGTGCCCCACCTGCCTGGTGCATTGCTGTGTGAATCCA
1921 GGAGGCAGTGGACATCGTAGGCAGCCACGGCCCCGGGTCCAGGAGAAGTGCTCCCTGGAGGCACGCACCACTGCTTCCCA
2001 CTGGGGCCGGCGGGGCCCACGCACGACGTCAGCCTCTTACCTTCCCGCCTCGGCTAGGGGTCCTCGGGATGCCGTTCTGT
2081 TCCAACCTCCTGCTCTGGGACGTGGACATGCCTCAAGGATACAGGGAGCCGGCGGCCTCTCGACGGCACGCACTTGCCTG
2161 TTGGCTGCTGCGGCTGTGGGCGAGCATGGGGGCTGCCAGCGTCTGTTGTGGAAAGTAGCTGCTAGTGAAATGGCTGGGGC
2241 CGCTGGGGTCCGTCTTCACACTGCGCAGGTCTCTTCTGGGCGTCTGAGCTGGGGTGGGAGCTCCTCCGCAGAAGGTTGGT
2321 GGGGGGTCCAGTCTGTGATCCTTGGTGCTGTGTGCCCCACTCCAGCCTGGGGACCCCACTTCAGAAGGTAGGGGCCGTGT
2401 CCCGCGGTGCTGACTGAGGCCTGCTTCCCCCTCCCCCTCCTGCTGTGCTGGAATTCCACAGGGACCAGGGCCACCGCAGG
2481 GGACTGTCTCAGAAGACTTGATTTTTCCGTCCCTTTTTCTCCACACTCCACTGACAAACGTCCCCAGCGGTTTCCACTTG
2561 TGGGCTTCAGGTGTTTTCAAGCACAACCCACCACAACAAGCAAGTGCATTTTCAGTCGTTGTGCTTTTTTGTTTTGTGCT
2641 AACGTCTTACTAATTTAAAGATGCTGTCGGCACCATGTTTATTTATTTCCAGTGGTCATGCTCAGCCTTGCTGCTCTGCG
2721 TGGCGCAGGTGCCATGCCTGCTCCCTGTCTGTGTCCCAGCCACGCAGGGCCATCCACTGTGACGTCGGCCGACCAGGCTG
2801 GACACCCTCTGCCGAGTAATGACGTGTGTGGCTGGGACCTTCTTTATTCTGTGTTAATGGCTAACCTGTTACACTGGGCT
2881 GGGTTGGGTAGGGTGTTCTGGCTTTTTTGTGGGGTTTTTATTTTTAAAGAAACACTCAATCATCCTACCGCTGAAAAAAA
2961 AAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ugUUGUUU-----UAGUGA-UCAGAAGGu 5'
            :|||||     :|| :| |||||||: 
Target 5' caGACAAAGCCCTGTCCTTCAGTCTTCTa 3'
 799 - 827 145.00 -14.11
2 
miRNA  3' uguugUUUUAGUGAUCAGAAGGu 5'
               :||: ||  || ||||| 
Target 5' tggggGAAGGCAGGAGCCTTCCt 3'
 348 - 370 126.00 -11.90
3 
miRNA  3' ugUUGUUUUA---------GUGAU------CAGAAGgu 5'
            |:::||||         |:||:      ||||||  
Target 5' ctAGTGAAATGGCTGGGGCCGCTGGGGTCCGTCTTCac 3'
 2222 - 2259 123.00 -20.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26995521 10 COSMIC
COSN31560337 61 COSMIC
COSN31590226 75 COSMIC
COSN30517228 80 COSMIC
COSN30461435 82 COSMIC
COSN30163593 103 COSMIC
COSN30535564 119 COSMIC
COSN30500683 121 COSMIC
COSN30453121 128 COSMIC
COSN30453141 129 COSMIC
COSN30455814 134 COSMIC
COSN31526268 135 COSMIC
COSN30523267 144 COSMIC
COSN30758257 161 COSMIC
COSN30488986 162 COSMIC
COSN30190323 164 COSMIC
COSN30535874 200 COSMIC
COSN30514604 237 COSMIC
COSN30542081 251 COSMIC
COSN31480108 267 COSMIC
COSN20160565 644 COSMIC
COSN27546079 678 COSMIC
COSN20163598 858 COSMIC
COSN21788444 947 COSMIC
COSN32152255 1252 COSMIC
COSN6648019 1282 COSMIC
COSN20113172 1302 COSMIC
COSN20113171 1451 COSMIC
COSN25589910 1674 COSMIC
COSN8239569 1791 COSMIC
COSN8239568 2082 COSMIC
COSN16090756 2201 COSMIC
COSN24982271 2553 COSMIC
COSN22788595 2597 COSMIC
COSN28383258 2879 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs750806434 1 dbSNP
rs747383028 2 dbSNP
rs778057796 5 dbSNP
rs758680565 8 dbSNP
rs141073967 9 dbSNP
rs1384125567 10 dbSNP
rs199652278 11 dbSNP
rs749900706 20 dbSNP
rs550600125 21 dbSNP
rs756902610 22 dbSNP
rs751411967 23 dbSNP
rs1473695619 31 dbSNP
rs764037421 33 dbSNP
rs369984883 34 dbSNP
rs1358789258 35 dbSNP
rs775549603 36 dbSNP
rs371881159 40 dbSNP
rs1248752446 43 dbSNP
rs776625917 44 dbSNP
rs1369263727 46 dbSNP
rs771159023 47 dbSNP
rs747293022 48 dbSNP
rs1370320146 51 dbSNP
rs1228602711 54 dbSNP
rs1372865734 54 dbSNP
rs1328474376 59 dbSNP
rs371639937 64 dbSNP
rs910813869 65 dbSNP
rs1295239839 74 dbSNP
rs986286333 75 dbSNP
rs532635996 76 dbSNP
rs1395342541 78 dbSNP
rs1327941976 80 dbSNP
rs571653934 83 dbSNP
rs116176256 84 dbSNP
rs1246375247 85 dbSNP
rs1162492907 87 dbSNP
rs962132602 91 dbSNP
rs1016203827 96 dbSNP
rs1449389666 97 dbSNP
rs1169846218 110 dbSNP
rs528287201 111 dbSNP
rs1374475168 112 dbSNP
rs1392390341 118 dbSNP
rs561136237 119 dbSNP
rs1006199232 121 dbSNP
rs1350124649 122 dbSNP
rs1437906043 125 dbSNP
rs1448448211 131 dbSNP
rs187682843 133 dbSNP
rs184153181 135 dbSNP
rs991325468 136 dbSNP
rs1353940103 137 dbSNP
rs958404320 138 dbSNP
rs1214939532 141 dbSNP
rs1035733294 143 dbSNP
rs1289347734 152 dbSNP
rs563272587 153 dbSNP
rs1322554722 163 dbSNP
rs776850971 164 dbSNP
rs1467574483 168 dbSNP
rs1289768306 169 dbSNP
rs1464538065 172 dbSNP
rs967558366 175 dbSNP
rs17782319 177 dbSNP
rs896308666 179 dbSNP
rs1020021141 184 dbSNP
rs1227962514 185 dbSNP
rs1371916544 187 dbSNP
rs1406729377 191 dbSNP
rs1011787659 199 dbSNP
rs113792715 202 dbSNP
rs893307550 205 dbSNP
rs1029252342 217 dbSNP
rs1435231476 220 dbSNP
rs569614757 237 dbSNP
rs996396555 238 dbSNP
rs1338639183 246 dbSNP
rs903629451 253 dbSNP
rs1284562266 261 dbSNP
rs1348100018 262 dbSNP
rs368640237 276 dbSNP
rs901857282 277 dbSNP
rs1040801480 280 dbSNP
rs545027130 282 dbSNP
rs2287119 283 dbSNP
rs2287118 284 dbSNP
rs1328525466 285 dbSNP
rs2287117 286 dbSNP
rs551055261 287 dbSNP
rs910769189 287 dbSNP
rs11117304 289 dbSNP
rs1187535341 289 dbSNP
rs1238392490 289 dbSNP
rs199861158 289 dbSNP
rs1049131374 295 dbSNP
rs565933814 296 dbSNP
rs931149477 296 dbSNP
rs1060252 309 dbSNP
rs1399515302 310 dbSNP
rs919724956 319 dbSNP
rs1334805685 326 dbSNP
rs1342009893 328 dbSNP
rs1407798011 333 dbSNP
rs1165875224 337 dbSNP
rs991376352 340 dbSNP
rs1229316280 341 dbSNP
rs984725093 341 dbSNP
rs1428707160 344 dbSNP
rs969798056 347 dbSNP
rs36027081 354 dbSNP
rs1195013178 355 dbSNP
rs1452003280 358 dbSNP
rs1279995224 366 dbSNP
rs1486832470 367 dbSNP
rs1203467514 369 dbSNP
rs1250521569 375 dbSNP
rs1472710380 377 dbSNP
rs1183605361 378 dbSNP
rs937230091 381 dbSNP
rs1375404917 388 dbSNP
rs1477430906 393 dbSNP
rs771974322 394 dbSNP
rs981544529 402 dbSNP
rs1023677587 405 dbSNP
rs1183198259 412 dbSNP
rs1307174848 415 dbSNP
rs540794282 419 dbSNP
rs1410643790 430 dbSNP
rs1013913884 436 dbSNP
rs967063517 437 dbSNP
rs1060253 438 dbSNP
rs1060254 440 dbSNP
rs1030821999 444 dbSNP
rs1204888108 446 dbSNP
rs989860836 448 dbSNP
rs957533752 457 dbSNP
rs16943310 458 dbSNP
rs996327229 463 dbSNP
rs1232231065 466 dbSNP
rs1483613899 467 dbSNP
rs115661907 469 dbSNP
rs1264866591 475 dbSNP
rs1280160249 485 dbSNP
rs575578649 489 dbSNP
rs1442850071 490 dbSNP
rs770691925 492 dbSNP
rs889446025 493 dbSNP
rs1396431098 495 dbSNP
rs1050816181 497 dbSNP
rs556889016 503 dbSNP
rs1390528625 506 dbSNP
rs1306024818 514 dbSNP
rs1300069046 518 dbSNP
rs1388868331 523 dbSNP
rs933552421 527 dbSNP
rs1005330425 531 dbSNP
rs1373356626 538 dbSNP
rs886401447 539 dbSNP
rs923546799 543 dbSNP
rs1036462736 554 dbSNP
rs1343266783 555 dbSNP
rs1230102370 556 dbSNP
rs1263255318 559 dbSNP
rs1355205296 560 dbSNP
rs368481957 563 dbSNP
rs1375728131 571 dbSNP
rs994850757 576 dbSNP
rs1175162865 577 dbSNP
rs75898183 579 dbSNP
rs546798283 582 dbSNP
rs1423876969 583 dbSNP
rs1055578711 589 dbSNP
rs144295628 594 dbSNP
rs1158573379 596 dbSNP
rs909262736 599 dbSNP
rs928579971 614 dbSNP
rs535145342 615 dbSNP
rs1165982353 617 dbSNP
rs1181969271 618 dbSNP
rs1396747484 620 dbSNP
rs114781228 628 dbSNP
rs550558160 629 dbSNP
rs1320412495 630 dbSNP
rs992196688 652 dbSNP
rs1030936017 654 dbSNP
rs960885051 654 dbSNP
rs912868222 656 dbSNP
rs77384806 657 dbSNP
rs967874558 658 dbSNP
rs563587509 661 dbSNP
rs755764174 679 dbSNP
rs1268615982 682 dbSNP
rs1486802573 683 dbSNP
rs1285045189 685 dbSNP
rs1180100395 688 dbSNP
rs561762733 692 dbSNP
rs1424215286 695 dbSNP
rs1188871691 696 dbSNP
rs1420320098 699 dbSNP
rs1225533348 700 dbSNP
rs113620181 704 dbSNP
rs543091980 705 dbSNP
rs1301650499 706 dbSNP
rs957086326 707 dbSNP
rs148779119 711 dbSNP
rs559329287 713 dbSNP
rs1348251228 714 dbSNP
rs1227479513 715 dbSNP
rs997878508 718 dbSNP
rs902072321 724 dbSNP
rs540754159 726 dbSNP
rs1255370556 727 dbSNP
rs1483426067 728 dbSNP
rs1212771494 731 dbSNP
rs1036577597 736 dbSNP
rs1471726334 741 dbSNP
rs11541879 745 dbSNP
rs1408769539 755 dbSNP
rs1420992152 760 dbSNP
rs190655752 764 dbSNP
rs1358215469 769 dbSNP
rs1318476896 771 dbSNP
rs1315179605 772 dbSNP
rs1369152467 776 dbSNP
rs1401919200 778 dbSNP
rs1298428606 783 dbSNP
rs1019617251 789 dbSNP
rs1216989457 802 dbSNP
rs1300432676 803 dbSNP
rs1481374522 807 dbSNP
rs1410448457 808 dbSNP
rs573735116 819 dbSNP
rs1049259921 822 dbSNP
rs1475791946 839 dbSNP
rs1204654909 845 dbSNP
rs948118167 850 dbSNP
rs1005098766 856 dbSNP
rs950730361 857 dbSNP
rs542815333 858 dbSNP
rs747673296 859 dbSNP
rs1176127220 861 dbSNP
rs978000670 867 dbSNP
rs895265388 872 dbSNP
rs575493117 873 dbSNP
rs1022122424 876 dbSNP
rs1055130024 878 dbSNP
rs1355931073 879 dbSNP
rs557244512 880 dbSNP
rs730214 884 dbSNP
rs1371156689 891 dbSNP
rs758971183 893 dbSNP
rs906997484 895 dbSNP
rs1046068427 900 dbSNP
rs1214958236 902 dbSNP
rs1273900684 903 dbSNP
rs1309483492 907 dbSNP
rs1219721821 908 dbSNP
rs1246176215 910 dbSNP
rs896826224 915 dbSNP
rs1196001463 917 dbSNP
rs1246748053 920 dbSNP
rs1267535425 923 dbSNP
rs537967503 924 dbSNP
rs1187475638 927 dbSNP
rs1015249706 945 dbSNP
rs912921529 946 dbSNP
rs1054150589 947 dbSNP
rs1005078893 949 dbSNP
rs1309675458 953 dbSNP
rs888053517 955 dbSNP
rs1049672812 956 dbSNP
rs935643738 961 dbSNP
rs553364140 962 dbSNP
rs1056553178 963 dbSNP
rs530878276 965 dbSNP
rs966617026 966 dbSNP
rs912033874 967 dbSNP
rs984126687 968 dbSNP
rs923929457 969 dbSNP
rs1385831311 970 dbSNP
rs1319233566 971 dbSNP
rs950989701 974 dbSNP
rs567766105 975 dbSNP
rs1266706888 979 dbSNP
rs1446924005 983 dbSNP
rs748196852 984 dbSNP
rs549160652 999 dbSNP
rs994834287 1001 dbSNP
rs959366222 1002 dbSNP
rs779580881 1003 dbSNP
rs1163186752 1004 dbSNP
rs1418142385 1007 dbSNP
rs80186383 1017 dbSNP
rs1420621422 1018 dbSNP
rs569937824 1019 dbSNP
rs551365734 1020 dbSNP
rs533293683 1021 dbSNP
rs1010055180 1022 dbSNP
rs1357170547 1026 dbSNP
rs1447041011 1029 dbSNP
rs953907232 1034 dbSNP
rs891750533 1035 dbSNP
rs1235441179 1044 dbSNP
rs976465883 1049 dbSNP
rs565527946 1054 dbSNP
rs1350108546 1056 dbSNP
rs961142925 1061 dbSNP
rs1015195744 1063 dbSNP
rs1286983529 1064 dbSNP
rs150027728 1068 dbSNP
rs1258742205 1069 dbSNP
rs952270031 1082 dbSNP
rs528909236 1086 dbSNP
rs1320923355 1088 dbSNP
rs563829290 1096 dbSNP
rs895313817 1099 dbSNP
rs1295965233 1101 dbSNP
rs1215974795 1105 dbSNP
rs1422993289 1106 dbSNP
rs1057068357 1111 dbSNP
rs1039205997 1112 dbSNP
rs1313259076 1112 dbSNP
rs1416832414 1112 dbSNP
rs1003614080 1121 dbSNP
rs186229967 1123 dbSNP
rs1440983043 1126 dbSNP
rs1281713983 1130 dbSNP
rs911611773 1134 dbSNP
rs542776237 1146 dbSNP
rs1373887341 1148 dbSNP
rs1350549122 1149 dbSNP
rs1292258299 1151 dbSNP
rs1249413262 1152 dbSNP
rs915105408 1169 dbSNP
rs531029077 1173 dbSNP
rs563932925 1175 dbSNP
rs1355498481 1176 dbSNP
rs920887078 1181 dbSNP
rs1172907737 1183 dbSNP
rs1453712417 1183 dbSNP
rs752758436 1185 dbSNP
rs545358826 1193 dbSNP
rs1396044842 1194 dbSNP
rs932597971 1202 dbSNP
rs1330957996 1206 dbSNP
rs1428140043 1207 dbSNP
rs1389768626 1210 dbSNP
rs973588578 1211 dbSNP
rs1304845310 1213 dbSNP
rs922450681 1217 dbSNP
rs767648007 1222 dbSNP
rs976578842 1223 dbSNP
rs1339656743 1225 dbSNP
rs959374483 1235 dbSNP
rs1189422813 1238 dbSNP
rs1033657476 1239 dbSNP
rs1194130241 1245 dbSNP
rs1254827370 1248 dbSNP
rs982623876 1251 dbSNP
rs970861279 1257 dbSNP
rs1447364082 1259 dbSNP
rs1251677695 1260 dbSNP
rs1373487727 1265 dbSNP
rs1462665203 1269 dbSNP
rs1169906300 1276 dbSNP
rs1392321117 1280 dbSNP
rs1060257 1282 dbSNP
rs1327099559 1286 dbSNP
rs1010112124 1287 dbSNP
rs1023091465 1288 dbSNP
rs1234432435 1297 dbSNP
rs201848498 1301 dbSNP
rs869243139 1302 dbSNP
rs397811145 1303 dbSNP
rs386385353 1305 dbSNP
rs959918920 1306 dbSNP
rs374667114 1307 dbSNP
rs386385352 1307 dbSNP
rs553239962 1307 dbSNP
rs5818648 1307 dbSNP
rs1195529296 1309 dbSNP
rs1032936774 1318 dbSNP
rs1300328707 1326 dbSNP
rs553047967 1327 dbSNP
rs373243616 1332 dbSNP
rs1452237446 1333 dbSNP
rs1288840193 1336 dbSNP
rs1174533419 1337 dbSNP
rs1038718622 1349 dbSNP
rs1436763821 1350 dbSNP
rs146380761 1351 dbSNP
rs141994153 1352 dbSNP
rs1294568524 1359 dbSNP
rs1432588935 1363 dbSNP
rs55936694 1375 dbSNP
rs893801484 1376 dbSNP
rs376915929 1386 dbSNP
rs920731137 1396 dbSNP
rs1250744824 1397 dbSNP
rs1420076300 1402 dbSNP
rs973639294 1403 dbSNP
rs938242015 1405 dbSNP
rs569850454 1406 dbSNP
rs1455866235 1408 dbSNP
rs1252967448 1424 dbSNP
rs1311427391 1432 dbSNP
rs1414982885 1439 dbSNP
rs1314361131 1442 dbSNP
rs557974979 1445 dbSNP
rs1390323444 1449 dbSNP
rs1307543898 1451 dbSNP
rs34684838 1455 dbSNP
rs796558699 1455 dbSNP
rs971132920 1462 dbSNP
rs113538348 1463 dbSNP
rs539347773 1472 dbSNP
rs1211819741 1473 dbSNP
rs565967507 1478 dbSNP
rs113089978 1479 dbSNP
rs1251407215 1481 dbSNP
rs1421374104 1482 dbSNP
rs1313805453 1483 dbSNP
rs1416857295 1484 dbSNP
rs1032820616 1485 dbSNP
rs1435748581 1486 dbSNP
rs796357152 1488 dbSNP
rs1302394493 1490 dbSNP
rs1454354785 1491 dbSNP
rs1171226094 1494 dbSNP
rs1175062512 1496 dbSNP
rs567627965 1500 dbSNP
rs964686234 1501 dbSNP
rs528874509 1502 dbSNP
rs1161321934 1504 dbSNP
rs1017928698 1508 dbSNP
rs1298240396 1509 dbSNP
rs368908903 1513 dbSNP
rs1410960827 1514 dbSNP
rs548369517 1517 dbSNP
rs1371399701 1522 dbSNP
rs1236239107 1526 dbSNP
rs9921219 1537 dbSNP
rs1305971340 1542 dbSNP
rs1204148749 1545 dbSNP
rs1443844659 1547 dbSNP
rs1047480445 1548 dbSNP
rs1192249429 1550 dbSNP
rs1252930786 1551 dbSNP
rs770805858 1552 dbSNP
rs1060258 1554 dbSNP
rs899358701 1555 dbSNP
rs1037858442 1557 dbSNP
rs1417892327 1560 dbSNP
rs35257784 1561 dbSNP
rs1485928353 1563 dbSNP
rs1028302359 1564 dbSNP
rs35886461 1568 dbSNP
rs997267289 1568 dbSNP
rs901057284 1572 dbSNP
rs1459435905 1573 dbSNP
rs182903836 1575 dbSNP
rs886933049 1580 dbSNP
rs1268172054 1582 dbSNP
rs1328997809 1585 dbSNP
rs1294357451 1588 dbSNP
rs1247417542 1589 dbSNP
rs537667433 1591 dbSNP
rs1047046161 1592 dbSNP
rs949420840 1593 dbSNP
rs769476851 1599 dbSNP
rs545589322 1606 dbSNP
rs1382948874 1608 dbSNP
rs767042312 1609 dbSNP
rs1216153417 1612 dbSNP
rs1240692702 1613 dbSNP
rs1387259288 1617 dbSNP
rs533420288 1626 dbSNP
rs1421222567 1627 dbSNP
rs1473901862 1634 dbSNP
rs1455640219 1635 dbSNP
rs560013529 1636 dbSNP
rs1316169976 1639 dbSNP
rs988240208 1645 dbSNP
rs1344333469 1646 dbSNP
rs958129713 1648 dbSNP
rs1289594758 1652 dbSNP
rs1342604117 1654 dbSNP
rs1165441475 1660 dbSNP
rs1292730144 1661 dbSNP
rs925344126 1672 dbSNP
rs928160820 1673 dbSNP
rs978624201 1678 dbSNP
rs964900663 1680 dbSNP
rs747878745 1681 dbSNP
rs1446727835 1690 dbSNP
rs113627776 1691 dbSNP
rs1484472706 1693 dbSNP
rs1428685997 1694 dbSNP
rs574061095 1699 dbSNP
rs1186828058 1701 dbSNP
rs1021118138 1702 dbSNP
rs954418024 1715 dbSNP
rs529511449 1716 dbSNP
rs1407163555 1723 dbSNP
rs1206274748 1725 dbSNP
rs78174881 1727 dbSNP
rs190296005 1728 dbSNP
rs138809019 1737 dbSNP
rs1274330227 1741 dbSNP
rs1212047775 1749 dbSNP
rs996820894 1750 dbSNP
rs1354724259 1751 dbSNP
rs901180687 1755 dbSNP
rs1350587310 1759 dbSNP
rs1228436194 1760 dbSNP
rs1002377021 1761 dbSNP
rs1288561709 1763 dbSNP
rs905324269 1765 dbSNP
rs1046655707 1768 dbSNP
rs949645916 1773 dbSNP
rs146102397 1774 dbSNP
rs1052462303 1775 dbSNP
rs141881425 1778 dbSNP
rs1255696177 1779 dbSNP
rs1180478128 1780 dbSNP
rs995758103 1783 dbSNP
rs894188352 1790 dbSNP
rs554056017 1791 dbSNP
rs751100968 1794 dbSNP
rs975457575 1796 dbSNP
rs1406972099 1797 dbSNP
rs1326920964 1798 dbSNP
rs1335287509 1799 dbSNP
rs938480875 1806 dbSNP
rs928273873 1809 dbSNP
rs1388329387 1822 dbSNP
rs1369157353 1823 dbSNP
rs1234021046 1824 dbSNP
rs58628744 1825 dbSNP
rs71973446 1825 dbSNP
rs964585511 1827 dbSNP
rs1462233975 1828 dbSNP
rs17175483 1831 dbSNP
rs914170354 1832 dbSNP
rs1180383805 1833 dbSNP
rs910349970 1834 dbSNP
rs987426996 1838 dbSNP
rs1186175489 1842 dbSNP
rs1194026895 1852 dbSNP
rs1379212886 1857 dbSNP
rs11541880 1859 dbSNP
rs1448316857 1861 dbSNP
rs954811490 1863 dbSNP
rs1395801249 1867 dbSNP
rs1201674932 1868 dbSNP
rs958451454 1872 dbSNP
rs1333872910 1873 dbSNP
rs535387532 1874 dbSNP
rs148106276 1880 dbSNP
rs1304593747 1882 dbSNP
rs1333233555 1886 dbSNP
rs1224743672 1893 dbSNP
rs1269256357 1894 dbSNP
rs549405626 1895 dbSNP
rs754205015 1896 dbSNP
rs778056149 1902 dbSNP
rs1270799312 1904 dbSNP
rs1019554145 1908 dbSNP
rs143140219 1910 dbSNP
rs570537685 1922 dbSNP
rs185833084 1930 dbSNP
rs1002331913 1936 dbSNP
rs905379104 1944 dbSNP
rs1025585170 1947 dbSNP
rs533595527 1948 dbSNP
rs756353030 1949 dbSNP
rs892755323 1954 dbSNP
rs55952628 1955 dbSNP
rs1461353450 1956 dbSNP
rs1329268513 1960 dbSNP
rs767739545 1965 dbSNP
rs1380902824 1969 dbSNP
rs181397450 1970 dbSNP
rs903824135 1975 dbSNP
rs1326651746 1980 dbSNP
rs536019703 1984 dbSNP
rs562062934 1985 dbSNP
rs543839456 1986 dbSNP
rs912631049 1987 dbSNP
rs1428650039 1988 dbSNP
rs1484731871 1992 dbSNP
rs1204325241 1994 dbSNP
rs1262232822 1999 dbSNP
rs987739325 2005 dbSNP
rs576416974 2008 dbSNP
rs564617634 2009 dbSNP
rs751678536 2012 dbSNP
rs1477360438 2017 dbSNP
rs545649184 2020 dbSNP
rs762915824 2021 dbSNP
rs980444973 2024 dbSNP
rs969570507 2025 dbSNP
rs1452341604 2027 dbSNP
rs1054444210 2028 dbSNP
rs149074946 2032 dbSNP
rs1014208139 2042 dbSNP
rs892597838 2045 dbSNP
rs1250008638 2046 dbSNP
rs565728885 2047 dbSNP
rs1310717200 2049 dbSNP
rs547693507 2051 dbSNP
rs553585014 2052 dbSNP
rs1001090802 2055 dbSNP
rs535352546 2058 dbSNP
rs1217532737 2061 dbSNP
rs1040135652 2065 dbSNP
rs942704072 2066 dbSNP
rs1274142670 2072 dbSNP
rs891240440 2073 dbSNP
rs138206111 2074 dbSNP
rs1352121154 2082 dbSNP
rs568359696 2083 dbSNP
rs919062404 2085 dbSNP
rs1027024868 2089 dbSNP
rs1181769966 2090 dbSNP
rs1381254610 2092 dbSNP
rs74039959 2093 dbSNP
rs35608280 2100 dbSNP
rs1060266 2101 dbSNP
rs909116929 2102 dbSNP
rs1423808988 2108 dbSNP
rs537464607 2109 dbSNP
rs1159680663 2110 dbSNP
rs1370587302 2115 dbSNP
rs1309917210 2123 dbSNP
rs189022360 2124 dbSNP
rs969076908 2129 dbSNP
rs1181907395 2130 dbSNP
rs1475689347 2133 dbSNP
rs1020048609 2134 dbSNP
rs1257804948 2137 dbSNP
rs1010028979 2138 dbSNP
rs892787169 2139 dbSNP
rs1442157769 2140 dbSNP
rs917659178 2141 dbSNP
rs936900372 2142 dbSNP
rs147009012 2144 dbSNP
rs563592783 2145 dbSNP
rs1031154326 2149 dbSNP
rs1001019181 2150 dbSNP
rs968318678 2152 dbSNP
rs11541884 2158 dbSNP
rs982825731 2165 dbSNP
rs1331044301 2171 dbSNP
rs930094921 2172 dbSNP
rs1219996678 2175 dbSNP
rs149804348 2177 dbSNP
rs533687834 2180 dbSNP
rs1218086875 2181 dbSNP
rs1258862899 2182 dbSNP
rs1286291470 2185 dbSNP
rs1459462526 2187 dbSNP
rs138559489 2188 dbSNP
rs1007343235 2189 dbSNP
rs974120862 2190 dbSNP
rs1489022655 2192 dbSNP
rs958845503 2196 dbSNP
rs1285627417 2197 dbSNP
rs746483004 2200 dbSNP
rs566257213 2201 dbSNP
rs548058831 2204 dbSNP
rs994188152 2205 dbSNP
rs1425211493 2207 dbSNP
rs529566759 2209 dbSNP
rs1325176259 2211 dbSNP
rs1387070858 2215 dbSNP
rs1158950995 2217 dbSNP
rs1286968775 2219 dbSNP
rs1036181612 2220 dbSNP
rs11541883 2227 dbSNP
rs892908849 2236 dbSNP
rs1180359416 2237 dbSNP
rs1472558291 2240 dbSNP
rs909159144 2241 dbSNP
rs1242779073 2242 dbSNP
rs1033066728 2245 dbSNP
rs1037511311 2249 dbSNP
rs1044948073 2251 dbSNP
rs116696164 2252 dbSNP
rs1039932612 2259 dbSNP
rs1264659042 2260 dbSNP
rs917563478 2264 dbSNP
rs991928870 2265 dbSNP
rs371258446 2271 dbSNP
rs956469735 2281 dbSNP
rs1047245274 2282 dbSNP
rs1322129849 2284 dbSNP
rs923675710 2293 dbSNP
rs1399585196 2294 dbSNP
rs1291691829 2296 dbSNP
rs979630735 2297 dbSNP
rs111922215 2298 dbSNP
rs771452324 2304 dbSNP
rs16943300 2307 dbSNP
rs1297770676 2308 dbSNP
rs1380518551 2317 dbSNP
rs1230584426 2321 dbSNP
rs551955281 2327 dbSNP
rs1436612932 2334 dbSNP
rs981349668 2341 dbSNP
rs971334078 2342 dbSNP
rs955574978 2344 dbSNP
rs868212111 2345 dbSNP
rs1186206719 2360 dbSNP
rs1020110519 2368 dbSNP
rs1320506138 2372 dbSNP
rs994115168 2379 dbSNP
rs1237598129 2381 dbSNP
rs897277022 2388 dbSNP
rs1473719083 2389 dbSNP
rs1038414471 2391 dbSNP
rs1458819858 2395 dbSNP
rs1006011400 2396 dbSNP
rs887583928 2403 dbSNP
rs1045401929 2404 dbSNP
rs947973839 2405 dbSNP
rs147766951 2406 dbSNP
rs1362691079 2412 dbSNP
rs187044466 2418 dbSNP
rs1359858710 2419 dbSNP
rs1170610614 2425 dbSNP
rs1450765522 2427 dbSNP
rs1278319756 2429 dbSNP
rs996203145 2431 dbSNP
rs1241318883 2433 dbSNP
rs1056171082 2436 dbSNP
rs964404182 2437 dbSNP
rs572487053 2438 dbSNP
rs934978989 2440 dbSNP
rs1278665480 2441 dbSNP
rs1202284332 2445 dbSNP
rs1018598118 2446 dbSNP
rs112381392 2450 dbSNP
rs1185875059 2456 dbSNP
rs979138398 2458 dbSNP
rs1180264590 2462 dbSNP
rs891397910 2471 dbSNP
rs1452776858 2472 dbSNP
rs946883770 2475 dbSNP
rs374132380 2476 dbSNP
rs898537787 2482 dbSNP
rs1248313949 2488 dbSNP
rs574357687 2489 dbSNP
rs11117303 2502 dbSNP
rs1400191375 2506 dbSNP
rs144333921 2508 dbSNP
rs756413254 2509 dbSNP
rs1232014333 2510 dbSNP
rs576760543 2511 dbSNP
rs1339472202 2513 dbSNP
rs1346421370 2514 dbSNP
rs748534290 2527 dbSNP
rs1256933855 2529 dbSNP
rs1458141917 2533 dbSNP
rs1016981477 2537 dbSNP
rs377702112 2540 dbSNP
rs1450847546 2542 dbSNP
rs373357057 2545 dbSNP
rs1387865655 2548 dbSNP
rs1370355450 2549 dbSNP
rs1168591104 2550 dbSNP
rs371057687 2558 dbSNP
rs1292206023 2561 dbSNP
rs558312406 2563 dbSNP
rs1371518259 2568 dbSNP
rs887625934 2573 dbSNP
rs533885645 2574 dbSNP
rs869308876 2574 dbSNP
rs989015436 2578 dbSNP
rs566576928 2580 dbSNP
rs957228350 2582 dbSNP
rs1428275730 2584 dbSNP
rs1276985466 2586 dbSNP
rs1318039127 2589 dbSNP
rs925818422 2594 dbSNP
rs1271215327 2595 dbSNP
rs1803523 2596 dbSNP
rs1355300798 2600 dbSNP
rs1210212285 2604 dbSNP
rs1269256239 2617 dbSNP
rs774359655 2618 dbSNP
rs1012481422 2619 dbSNP
rs1191811358 2620 dbSNP
rs554364978 2622 dbSNP
rs559348048 2623 dbSNP
rs536069933 2624 dbSNP
rs1367229993 2628 dbSNP
rs568739821 2630 dbSNP
rs1427157735 2634 dbSNP
rs1393381998 2635 dbSNP
rs182523553 2636 dbSNP
rs114696078 2643 dbSNP
rs1340539349 2644 dbSNP
rs898658774 2647 dbSNP
rs1252207086 2652 dbSNP
rs1290980173 2655 dbSNP
rs1206865061 2657 dbSNP
rs1481830145 2668 dbSNP
rs574212905 2669 dbSNP
rs1001609700 2674 dbSNP
rs905964377 2675 dbSNP
rs1045731738 2680 dbSNP
rs946509738 2681 dbSNP
rs950037774 2682 dbSNP
rs1423712958 2685 dbSNP
rs1188890998 2687 dbSNP
rs1370514529 2689 dbSNP
rs1438245350 2692 dbSNP
rs1299861554 2693 dbSNP
rs1360766079 2703 dbSNP
rs552334871 2719 dbSNP
rs985678517 2720 dbSNP
rs1310172205 2724 dbSNP
rs934150678 2725 dbSNP
rs1333698952 2727 dbSNP
rs1239152910 2740 dbSNP
rs935949250 2743 dbSNP
rs925794909 2745 dbSNP
rs922858814 2750 dbSNP
rs756680708 2751 dbSNP
rs746210823 2753 dbSNP
rs1173891459 2756 dbSNP
rs1480034126 2757 dbSNP
rs1274706485 2758 dbSNP
rs975004402 2761 dbSNP
rs527737576 2763 dbSNP
rs1173541771 2764 dbSNP
rs1376514666 2765 dbSNP
rs1466107693 2769 dbSNP
rs972925028 2770 dbSNP
rs560229419 2774 dbSNP
rs1249354433 2775 dbSNP
rs1016868786 2777 dbSNP
rs1311613898 2783 dbSNP
rs984511252 2783 dbSNP
rs766437709 2784 dbSNP
rs1198602442 2786 dbSNP
rs1026435912 2787 dbSNP
rs868454198 2790 dbSNP
rs541596804 2791 dbSNP
rs1330427717 2800 dbSNP
rs1177574900 2805 dbSNP
rs1420889221 2809 dbSNP
rs1465002450 2812 dbSNP
rs1012123692 2813 dbSNP
rs1290664479 2814 dbSNP
rs781663047 2822 dbSNP
rs896284172 2823 dbSNP
rs750273857 2824 dbSNP
rs529818513 2826 dbSNP
rs73251309 2836 dbSNP
rs1367157743 2845 dbSNP
rs1387614582 2846 dbSNP
rs1285224065 2858 dbSNP
rs905910672 2877 dbSNP
rs1024395915 2879 dbSNP
rs1313738064 2881 dbSNP
rs756912494 2886 dbSNP
rs1219809265 2890 dbSNP
rs1397951623 2904 dbSNP
rs1488584439 2908 dbSNP
rs1192600276 2909 dbSNP
rs1014385059 2913 dbSNP
rs1260347723 2929 dbSNP
rs891793538 2932 dbSNP
rs1053557365 2939 dbSNP
rs1425688148 2939 dbSNP
rs1302268256 2945 dbSNP
rs761656793 2948 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Caco2-BBE , J774.A1
Disease GAGTTAGTCCCCGCAATCAA;
Location of target site 3'UTR
Tools used in this research miRBase Target Database
Original Description (Extracted from the article) ... "As shown in Fig. 4A ...

- Nguyen HT; Dalmasso G; Yan Y; Laroui H; et al., 2010, The Journal of biological chemistry.

Article - Nguyen HT; Dalmasso G; Yan Y; Laroui H; et al.
- The Journal of biological chemistry, 2010
The transmembrane glycoprotein CD98 regulates multiple cellular functions, including extracellular signaling, epithelial cell adhesion/polarity, amino acid transport, and cell-cell interactions. MicroRNAs post-transcriptionally regulate gene expression, thereby functioning as modulators of numerous cellular processes, such as cell differentiation, proliferation, and apoptosis. Here, we investigated if microRNAs regulate CD98 expression during intestinal epithelial cell differentiation and inflammation. We found that microRNA-7 repressed CD98 expression in Caco2-BBE cells by directly targeting the 3'-untranslated region of human CD98 mRNA. Expression of CD98 was decreased, whereas that of microRNA-7 was increased in well-differentiated Caco2-BBE cells compared with undifferentiated cells. Undifferentiated crypt cells isolated from mouse jejunum showed higher CD98 levels and lower levels of mmu-microRNA-706, a murine original microRNA candidate for CD98, than well-differentiated villus cells. Importantly, microRNA-7 decreased Caco2-BBE cell attachment on laminin-1, and CD98 overexpression recovered this inhibition, suggesting that microRNA-7 modulates epithelial cell adhesion to extracellular matrix, which in turn could affect proliferation and differentiation during the migration of enterocytes across the crypt-villus axis, by regulating CD98 expression. In a pathological context, the pro-inflammatory cytokine interleukin 1-beta increased CD98 expression in Caco2-BBE cells by decreasing microRNA-7 levels. Consistent with the in vitro findings, microRNA-7 levels were decreased in actively inflamed Crohn disease colonic tissues, where CD98 expression was up-regulated, compared with normal tissues. Together, these results reveal a novel mechanism underlying regulation of CD98 expression during patho-physiological states. This study raises microRNAs as a promising target for therapeutic modulations of CD98 expression in intestinal inflammatory disorders.
LinkOut: [PMID: 19892711]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.631 1.4e-3 -0.824 4.0e-6 20 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.511 4.5e-3 0.582 1.1e-3 25 Click to see details
GSE19783 ER- ER- breast cancer 0.265 9.1e-3 0.302 3.4e-3 79 Click to see details
GSE28260 Renal cortex and medulla 0.626 1.1e-2 0.537 2.9e-2 13 Click to see details
GSE14794 Lymphoblastoid cells 0.233 1.4e-2 0.103 1.7e-1 90 Click to see details
GSE19536 Breast cancer 0.22 1.4e-2 0.236 9.0e-3 100 Click to see details
GSE17306 Multiple myeloma 0.295 2.0e-2 0.312 1.5e-2 49 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.655 2.8e-2 -0.533 7.0e-2 9 Click to see details
GSE17498 Multiple myeloma 0.199 1.1e-1 0.231 7.6e-2 40 Click to see details
GSE21849 B cell lymphoma 0.198 1.5e-1 0.528 1.6e-3 29 Click to see details
GSE38226 Liver fibrosis -0.231 1.6e-1 -0.083 3.6e-1 21 Click to see details
GSE27834 Pluripotent stem cells 0.254 1.7e-1 0.326 1.1e-1 16 Click to see details
GSE21032 Prostate cancer -0.097 1.9e-1 -0.107 1.7e-1 83 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.18 1.9e-1 -0.245 1.2e-1 25 Click to see details
GSE19350 CNS germ cell tumors 0.251 2.2e-1 0.238 2.3e-1 12 Click to see details
GSE21687 Ependynoma primary tumors 0.077 2.7e-1 0.000 5.0e-1 64 Click to see details
GSE19783 ER+ ER+ breast cancer 0.142 2.8e-1 0.137 2.8e-1 20 Click to see details
GSE28544 Breast cancer 0.086 3.4e-1 0.383 3.2e-2 24 Click to see details
GSE32688 Pancreatic cancer -0.062 3.7e-1 -0.070 3.5e-1 32 Click to see details
GSE42095 Differentiated embryonic stem cells -0.069 3.8e-1 -0.144 2.6e-1 23 Click to see details
GSE26953 Aortic valvular endothelial cells -0.016 4.7e-1 -0.104 3.1e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC 0.537 0 0.428 0 39 Click to see details
KIRP 0.645 0 0.393 0.07 15 Click to see details
THCA -0.315 0.01 -0.349 0 59 Click to see details
STAD -0.363 0.03 -0.355 0.03 27 Click to see details
PCPG 0.993 0.04 1.000 0.5 3 Click to see details
CHOL 0.903 0.05 1.000 0.5 4 Click to see details
PRAD 0.209 0.12 0.112 0.27 33 Click to see details
LUSC 0.175 0.17 0.129 0.24 31 Click to see details
LUAD 0.235 0.23 0.357 0.13 12 Click to see details
BRCA 0.113 0.25 0.262 0.05 39 Click to see details
BLCA -0.163 0.27 -0.037 0.44 17 Click to see details
LIHC 0.09 0.3 -0.012 0.47 35 Click to see details
UCEC 0.078 0.38 0.098 0.35 18 Click to see details
ESCA -0.098 0.39 0.030 0.47 10 Click to see details
KIRC -0.045 0.4 -0.058 0.37 36 Click to see details
KICH 0.027 0.47 0.083 0.42 9 Click to see details
PAAD -1 0.5 -1.000 0.5 3 Click to see details
PAAD -1 0.5 -1.000 0.5 3 Click to see details
PAAD -1 0.5 -1.000 0.5 3 Click to see details
PAAD -1 0.5 -1.000 0.5 3 Click to see details
563 hsa-miR-7-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000032 SNCA synuclein alpha 4 2
MIRT000668 PAK1 p21 (RAC1) activated kinase 1 4 3
MIRT002289 EGFR epidermal growth factor receptor 5 15
MIRT003199 ABCC1 ATP binding cassette subfamily C member 1 4 2
MIRT003807 IRS1 insulin receptor substrate 1 2 1
MIRT003808 IRS2 insulin receptor substrate 2 3 1
MIRT004026 RAF1 Raf-1 proto-oncogene, serine/threonine kinase 7 5
MIRT004057 CKAP4 cytoskeleton associated protein 4 6 2
MIRT004058 CNOT8 CCR4-NOT transcription complex subunit 8 3 2
MIRT004059 CNN3 calponin 3 4 3
MIRT004060 CAPZA1 capping actin protein of muscle Z-line alpha subunit 1 4 2
MIRT004061 ARF4 ADP ribosylation factor 4 2 1
MIRT004062 PFN2 profilin 2 2 1
MIRT004063 PSME3 proteasome activator subunit 3 5 4
MIRT004076 PLEC plectin 2 1
MIRT004360 Hells helicase, lymphoid specific 2 1
MIRT004361 HELLS helicase, lymphoid specific 1 1
MIRT004497 SRSF1 serine and arginine rich splicing factor 1 5 1
MIRT004528 SLC7A5 solute carrier family 7 member 5 4 1
MIRT005364 IGF1R insulin like growth factor 1 receptor 4 2
MIRT006777 PIK3CD phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit delta 1 1
MIRT006838 HOXB3 homeobox B3 1 1
MIRT006900 PTK2 protein tyrosine kinase 2 3 2
MIRT006902 HOXB5 homeobox B5 3 1
MIRT006904 BCL2 BCL2, apoptosis regulator 4 1
MIRT025628 SLC25A39 solute carrier family 25 member 39 2 2
MIRT025629 SLC26A3 solute carrier family 26 member 3 1 1
MIRT025630 KCNH2 potassium voltage-gated channel subfamily H member 2 1 1
MIRT025631 TCL1B T-cell leukemia/lymphoma 1B 1 1
MIRT025632 LUC7L2 LUC7 like 2, pre-mRNA splicing factor 1 1
MIRT025633 SNAP29 synaptosome associated protein 29 1 1
MIRT025634 SP7 Sp7 transcription factor 1 1
MIRT025635 MAP1B microtubule associated protein 1B 3 5
MIRT025636 TUSC2 tumor suppressor candidate 2 1 1
MIRT025637 BMPR2 bone morphogenetic protein receptor type 2 1 1
MIRT025638 RPL15 ribosomal protein L15 1 2
MIRT025639 LYPLA2 lysophospholipase II 1 1
MIRT025640 LCE1E late cornified envelope 1E 1 1
MIRT025641 HTRA4 HtrA serine peptidase 4 1 1
MIRT025642 MFSD5 major facilitator superfamily domain containing 5 1 1
MIRT025643 KRT80 keratin 80 1 1
MIRT025644 UHRF1 ubiquitin like with PHD and ring finger domains 1 1 1
MIRT025645 GJC1 gap junction protein gamma 1 1 1
MIRT025646 ARMC10 armadillo repeat containing 10 3 3
MIRT025647 KCNK13 potassium two pore domain channel subfamily K member 13 1 1
MIRT025648 RHBDF2 rhomboid 5 homolog 2 1 1
MIRT025649 TGM2 transglutaminase 2 1 1
MIRT025650 KRTAP4-2 keratin associated protein 4-2 1 1
MIRT025651 SOLH calpain 15 1 1
MIRT025652 C11orf24 chromosome 11 open reading frame 24 1 1
MIRT025653 MS4A4A membrane spanning 4-domains A4A 1 1
MIRT025654 WNT8B Wnt family member 8B 1 1
MIRT025655 HPS6 HPS6, biogenesis of lysosomal organelles complex 2 subunit 3 1 1
MIRT025656 MATR3 matrin 3 1 1
MIRT025657 OR1A1 olfactory receptor family 1 subfamily A member 1 1 1
MIRT025658 PMEPA1 prostate transmembrane protein, androgen induced 1 1 1
MIRT025659 AKR7A2 aldo-keto reductase family 7 member A2 1 1
MIRT025660 GLT8D2 glycosyltransferase 8 domain containing 2 1 1
MIRT025661 PLEKHH1 pleckstrin homology, MyTH4 and FERM domain containing H1 1 1
MIRT025662 TMEM134 transmembrane protein 134 1 1
MIRT025663 SLC52A2 solute carrier family 52 member 2 1 1
MIRT025664 KRTAP11-1 keratin associated protein 11-1 1 1
MIRT025665 TAPBP TAP binding protein 1 1
MIRT025666 FGF1 fibroblast growth factor 1 1 1
MIRT025667 EHD3 EH domain containing 3 1 1
MIRT025668 LAMC2 laminin subunit gamma 2 1 1
MIRT025669 TIMM50 translocase of inner mitochondrial membrane 50 1 1
MIRT025670 CHD9 chromodomain helicase DNA binding protein 9 1 1
MIRT025671 EIF5A2 eukaryotic translation initiation factor 5A2 1 1
MIRT025672 PDGFC platelet derived growth factor C 1 1
MIRT025673 TSN translin 1 1
MIRT025674 ACOT4 acyl-CoA thioesterase 4 1 1
MIRT025675 CYB561A3 cytochrome b561 family member A3 1 1
MIRT025676 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT025677 GALNT2 polypeptide N-acetylgalactosaminyltransferase 2 1 1
MIRT025678 GFRA1 GDNF family receptor alpha 1 1 1
MIRT025679 PLEKHB1 pleckstrin homology domain containing B1 1 1
MIRT025680 TMEM69 transmembrane protein 69 3 3
MIRT025681 ZNF625 zinc finger protein 625 1 1
MIRT025682 PCED1B PC-esterase domain containing 1B 1 1
MIRT025683 HSPBP1 HSPA (Hsp70) binding protein 1 1 1
MIRT025684 ANXA11 annexin A11 1 1
MIRT025685 RCC2 regulator of chromosome condensation 2 1 1
MIRT025686 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT025687 ALG3 ALG3, alpha-1,3- mannosyltransferase 1 1
MIRT025688 PHF16 jade family PHD finger 3 1 1
MIRT025689 CANT1 calcium activated nucleotidase 1 1 1
MIRT025690 IGSF3 immunoglobulin superfamily member 3 1 1
MIRT025691 PPP2R1B protein phosphatase 2 scaffold subunit Abeta 1 1
MIRT025692 NDC1 NDC1 transmembrane nucleoporin 1 1
MIRT025693 EXOSC2 exosome component 2 3 3
MIRT025694 ZNF555 zinc finger protein 555 1 1
MIRT025695 ADCY9 adenylate cyclase 9 1 1
MIRT025696 KIAA0247 sushi domain containing 6 1 1
MIRT025697 C5orf22 chromosome 5 open reading frame 22 1 1
MIRT025698 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 1 1
MIRT025699 HDLBP high density lipoprotein binding protein 1 1
MIRT025700 BCCIP BRCA2 and CDKN1A interacting protein 1 1
MIRT025701 RSPRY1 ring finger and SPRY domain containing 1 1 1
MIRT025702 HMGN4 high mobility group nucleosomal binding domain 4 1 1
MIRT025703 ZFYVE20 rabenosyn, RAB effector 1 1
MIRT025704 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT025705 CHAMP1 chromosome alignment maintaining phosphoprotein 1 1 1
MIRT025706 OSBPL8 oxysterol binding protein like 8 1 1
MIRT025707 TMUB2 transmembrane and ubiquitin like domain containing 2 1 1
MIRT025708 TSC22D4 TSC22 domain family member 4 1 1
MIRT025709 GRB2 growth factor receptor bound protein 2 1 1
MIRT025710 SERTAD2 SERTA domain containing 2 1 1
MIRT025711 DNAJC27 DnaJ heat shock protein family (Hsp40) member C27 1 1
MIRT025712 JPH1 junctophilin 1 1 1
MIRT025713 STK40 serine/threonine kinase 40 1 1
MIRT025714 DCAF12 DDB1 and CUL4 associated factor 12 1 1
MIRT025715 CLK3 CDC like kinase 3 1 1
MIRT025716 SLC6A9 solute carrier family 6 member 9 2 2
MIRT025717 FNDC4 fibronectin type III domain containing 4 1 1
MIRT025718 EHD1 EH domain containing 1 1 2
MIRT025719 SCARB2 scavenger receptor class B member 2 1 2
MIRT025720 IDE insulin degrading enzyme 1 2
MIRT025721 PPIF peptidylprolyl isomerase F 3 5
MIRT025722 RELA RELA proto-oncogene, NF-kB subunit 11 7
MIRT025723 DUS1L dihydrouridine synthase 1 like 1 1
MIRT025724 ATF5 activating transcription factor 5 1 1
MIRT025725 ZNF655 zinc finger protein 655 1 1
MIRT025726 GPR19 G protein-coupled receptor 19 1 1
MIRT025727 RNF114 ring finger protein 114 1 1
MIRT025728 SIGMAR1 sigma non-opioid intracellular receptor 1 1 1
MIRT025729 KRTAP4-7 keratin associated protein 4-7 1 1
MIRT025730 ILF3 interleukin enhancer binding factor 3 1 1
MIRT025731 SLC3A2 solute carrier family 3 member 2 1 1
MIRT025732 IL12RB2 interleukin 12 receptor subunit beta 2 1 1
MIRT025733 ATP1B3 ATPase Na+/K+ transporting subunit beta 3 1 1
MIRT025734 PRDM8 PR/SET domain 8 1 1
MIRT025735 IGFBP4 insulin like growth factor binding protein 4 1 1
MIRT025736 CHRNA2 cholinergic receptor nicotinic alpha 2 subunit 1 1
MIRT025737 PPAP2B phospholipid phosphatase 3 1 1
MIRT025738 UBE3C ubiquitin protein ligase E3C 1 1
MIRT025739 BCKDK branched chain ketoacid dehydrogenase kinase 1 1
MIRT025740 DUSP23 dual specificity phosphatase 23 1 1
MIRT025741 GRAMD1A GRAM domain containing 1A 1 1
MIRT025742 CDC42EP4 CDC42 effector protein 4 1 1
MIRT025743 KRT7 keratin 7 1 1
MIRT025744 CFLAR CASP8 and FADD like apoptosis regulator 1 1
MIRT025745 ADAMTS17 ADAM metallopeptidase with thrombospondin type 1 motif 17 1 1
MIRT025746 ANKRD31 ankyrin repeat domain 31 1 1
MIRT025747 SERTAD4 SERTA domain containing 4 1 1
MIRT025748 TSEN34 tRNA splicing endonuclease subunit 34 1 1
MIRT025749 POLR2E RNA polymerase II subunit E 1 1
MIRT025750 MRPL10 mitochondrial ribosomal protein L10 1 1
MIRT025751 CCDC65 coiled-coil domain containing 65 1 1
MIRT025752 TNFAIP2 TNF alpha induced protein 2 1 1
MIRT025753 HOXC12 homeobox C12 1 1
MIRT025754 WASF2 WAS protein family member 2 2 2
MIRT025755 TMED10 transmembrane p24 trafficking protein 10 3 3
MIRT025756 GIT1 GIT ArfGAP 1 1 1
MIRT025757 VAMP8 vesicle associated membrane protein 8 3 3
MIRT025758 ZNF365 zinc finger protein 365 1 1
MIRT025759 ROR1 receptor tyrosine kinase like orphan receptor 1 1 1
MIRT025760 C10orf105 chromosome 10 open reading frame 105 1 1
MIRT025761 ATF7IP2 activating transcription factor 7 interacting protein 2 1 1
MIRT025762 TCOF1 treacle ribosome biogenesis factor 1 1 1
MIRT025763 CRTAP cartilage associated protein 3 5
MIRT025764 IGSF8 immunoglobulin superfamily member 8 1 1
MIRT025765 CLN3 CLN3, battenin 1 1
MIRT025766 HIATL1 major facilitator superfamily domain containing 14B 3 5
MIRT025767 CASP9 caspase 9 1 1
MIRT025768 MFSD10 major facilitator superfamily domain containing 10 1 1
MIRT025769 MPDU1 mannose-P-dolichol utilization defect 1 1 1
MIRT025770 PHC2 polyhomeotic homolog 2 1 1
MIRT025771 FAM89B family with sequence similarity 89 member B 1 1
MIRT025772 SLC39A11 solute carrier family 39 member 11 1 1
MIRT025773 GINS1 GINS complex subunit 1 1 1
MIRT025774 XPR1 xenotropic and polytropic retrovirus receptor 1 1 1
MIRT025775 DBNL drebrin like 1 1
MIRT025776 MIF4GD MIF4G domain containing 1 1
MIRT025777 FLNA filamin A 1 1
MIRT025778 TGOLN2 trans-golgi network protein 2 1 1
MIRT025779 RSU1 Ras suppressor protein 1 1 1
MIRT025780 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT025781 GLO1 glyoxalase I 1 1
MIRT025782 ZNF264 zinc finger protein 264 1 1
MIRT025783 DOCK5 dedicator of cytokinesis 5 1 1
MIRT025784 RAB11FIP5 RAB11 family interacting protein 5 1 1
MIRT025785 MARCKSL1 MARCKS like 1 1 1
MIRT025786 NXT2 nuclear transport factor 2 like export factor 2 1 1
MIRT025787 LRRC59 leucine rich repeat containing 59 3 3
MIRT025788 NR1H2 nuclear receptor subfamily 1 group H member 2 1 1
MIRT025789 EIF4E eukaryotic translation initiation factor 4E 3 3
MIRT025790 OSBPL11 oxysterol binding protein like 11 4 2
MIRT025791 SETD8 lysine methyltransferase 5A 3 2
MIRT025792 NDUFA4 NDUFA4, mitochondrial complex associated 1 1
MIRT025793 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT025794 KEAP1 kelch like ECH associated protein 1 1 1
MIRT025795 BTG2 BTG anti-proliferation factor 2 4 1
MIRT025796 HOXA3 homeobox A3 1 1
MIRT025797 PRDX1 peroxiredoxin 1 1 1
MIRT025798 ZNF460 zinc finger protein 460 1 1
MIRT025799 ARL15 ADP ribosylation factor like GTPase 15 1 1
MIRT025800 MAPK9 mitogen-activated protein kinase 9 1 1
MIRT025801 PTP4A2 protein tyrosine phosphatase type IVA, member 2 1 1
MIRT025802 PDIA3 protein disulfide isomerase family A member 3 2 3
MIRT025803 ZNF805 zinc finger protein 805 1 1
MIRT025804 CRLS1 cardiolipin synthase 1 1 1
MIRT025805 CPNE2 copine 2 1 2
MIRT025806 APLP2 amyloid beta precursor like protein 2 1 2
MIRT025807 TMEM97 transmembrane protein 97 3 6
MIRT025808 GRINA glutamate ionotropic receptor NMDA type subunit associated protein 1 2 2
MIRT025809 WDR45 WD repeat domain 45 1 1
MIRT025810 RPS19BP1 ribosomal protein S19 binding protein 1 1 1
MIRT025811 ZP3 zona pellucida glycoprotein 3 1 1
MIRT025812 MICALL1 MICAL like 1 1 1
MIRT025813 IL21R interleukin 21 receptor 3 3
MIRT025814 KCNJ14 potassium voltage-gated channel subfamily J member 14 1 1
MIRT025815 SRM spermidine synthase 1 1
MIRT025816 C17orf78 chromosome 17 open reading frame 78 1 1
MIRT025817 ZYX zyxin 1 1
MIRT025818 ALDH3B2 aldehyde dehydrogenase 3 family member B2 1 1
MIRT025819 EXOC3 exocyst complex component 3 1 1
MIRT025820 TMEM38B transmembrane protein 38B 1 1
MIRT025821 TSKU tsukushi, small leucine rich proteoglycan 1 1
MIRT025822 TNP1 transition protein 1 1 1
MIRT025823 RNF128 ring finger protein 128, E3 ubiquitin protein ligase 1 1
MIRT025824 ZDHHC3 zinc finger DHHC-type containing 3 1 1
MIRT025825 MEPCE methylphosphate capping enzyme 1 1
MIRT025826 AUP1 ancient ubiquitous protein 1 1 1
MIRT025827 PRRT3 proline rich transmembrane protein 3 1 1
MIRT025828 CLEC4G C-type lectin domain family 4 member G 1 1
MIRT025829 CXCL5 C-X-C motif chemokine ligand 5 1 1
MIRT025830 BCL9L B-cell CLL/lymphoma 9 like 1 1
MIRT025831 DNAJC5 DnaJ heat shock protein family (Hsp40) member C5 1 1
MIRT025832 GLDN gliomedin 1 1
MIRT025833 TMEM81 transmembrane protein 81 1 1
MIRT025834 GBF1 golgi brefeldin A resistant guanine nucleotide exchange factor 1 1 1
MIRT025835 AGPAT1 1-acylglycerol-3-phosphate O-acyltransferase 1 1 1
MIRT025836 EFHD2 EF-hand domain family member D2 3 3
MIRT025837 PPRC1 peroxisome proliferator-activated receptor gamma, coactivator-related 1 1 1
MIRT025838 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT025839 MYEOV myeloma overexpressed 1 1
MIRT025840 TRIM14 tripartite motif containing 14 1 1
MIRT025841 SDHC succinate dehydrogenase complex subunit C 1 1
MIRT025842 NUDCD3 NudC domain containing 3 1 1
MIRT025843 SH3BP4 SH3 domain binding protein 4 1 1
MIRT025844 MGLL monoglyceride lipase 1 1
MIRT025845 LYPD3 LY6/PLAUR domain containing 3 1 1
MIRT025846 TRPA1 transient receptor potential cation channel subfamily A member 1 1 1
MIRT025847 TAF1 TATA-box binding protein associated factor 1 1 1
MIRT025848 EIF2S3 eukaryotic translation initiation factor 2 subunit gamma 1 1
MIRT025849 NCEH1 neutral cholesterol ester hydrolase 1 1 1
MIRT025850 PRKRIR THAP domain containing 12 1 1
MIRT025851 SQSTM1 sequestosome 1 1 1
MIRT025852 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT025853 SLC35A5 solute carrier family 35 member A5 1 1
MIRT025854 TMEM43 transmembrane protein 43 1 1
MIRT025855 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT025856 RYK receptor-like tyrosine kinase 1 1
MIRT025857 PAPPA pappalysin 1 1 1
MIRT025858 PDE4D phosphodiesterase 4D 1 1
MIRT025859 C1orf21 chromosome 1 open reading frame 21 1 1
MIRT025860 SERP1 stress associated endoplasmic reticulum protein 1 1 1
MIRT025861 PIGH phosphatidylinositol glycan anchor biosynthesis class H 1 1
MIRT025862 TRMT13 tRNA methyltransferase 13 homolog 1 1
MIRT025863 KIF16B kinesin family member 16B 1 1
MIRT025864 FRS2 fibroblast growth factor receptor substrate 2 1 1
MIRT025865 SETD1B SET domain containing 1B 1 1
MIRT025866 C19orf12 chromosome 19 open reading frame 12 1 1
MIRT025867 DNAJC11 DnaJ heat shock protein family (Hsp40) member C11 1 1
MIRT025868 HNRNPU heterogeneous nuclear ribonucleoprotein U 1 1
MIRT025869 FADD Fas associated via death domain 1 1
MIRT025870 MPP5 membrane palmitoylated protein 5 1 1
MIRT025871 SIRT2 sirtuin 2 2 2
MIRT025872 NRSN2 neurensin 2 1 1
MIRT025873 ZNF436 zinc finger protein 436 1 1
MIRT025874 TRAM2 translocation associated membrane protein 2 1 1
MIRT025875 RRAS2 RAS related 2 2 4
MIRT025876 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT025877 NFYA nuclear transcription factor Y subunit alpha 1 1
MIRT025878 SRGAP2 SLIT-ROBO Rho GTPase activating protein 2 1 1
MIRT025879 COLEC12 collectin subfamily member 12 1 1
MIRT025880 LITAF lipopolysaccharide induced TNF factor 1 2
MIRT025881 TPGS2 tubulin polyglutamylase complex subunit 2 1 2
MIRT025882 TFPI tissue factor pathway inhibitor 3 4
MIRT025883 GLS glutaminase 1 2
MIRT025884 AP1M1 adaptor related protein complex 1 mu 1 subunit 2 2
MIRT025885 VPS26A VPS26, retromer complex component A 1 2
MIRT025886 SMARCD1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 3 5
MIRT025887 KIF24 kinesin family member 24 1 1
MIRT025888 PMP2 peripheral myelin protein 2 1 1
MIRT025889 SNAPIN SNAP associated protein 1 1
MIRT025890 AGK acylglycerol kinase 1 1
MIRT025891 TAGLN transgelin 1 1
MIRT025892 ACTN2 actinin alpha 2 1 1
MIRT025893 HPCAL1 hippocalcin like 1 1 1
MIRT025894 CAGE1 cancer antigen 1 1 1
MIRT025895 SSX1 SSX family member 1 1 1
MIRT025896 SULT1C2 sulfotransferase family 1C member 2 1 1
MIRT025897 DSC2 desmocollin 2 1 1
MIRT025898 IFNE interferon epsilon 1 1
MIRT025899 ARG1 arginase 1 1 1
MIRT025900 MAP2K2 mitogen-activated protein kinase kinase 2 1 1
MIRT025901 SHISA5 shisa family member 5 1 1
MIRT025902 ASB2 ankyrin repeat and SOCS box containing 2 1 1
MIRT025903 DEFA5 defensin alpha 5 1 1
MIRT025904 CDC25B cell division cycle 25B 1 1
MIRT025905 TRIM47 tripartite motif containing 47 1 1
MIRT025906 WFS1 wolframin ER transmembrane glycoprotein 1 1
MIRT025907 CDC37 cell division cycle 37 1 1
MIRT025908 MINA ribosomal oxygenase 2 1 1
MIRT025909 RDH16 retinol dehydrogenase 16 (all-trans) 1 1
MIRT025910 CACNG5 calcium voltage-gated channel auxiliary subunit gamma 5 1 1
MIRT025911 GDNF glial cell derived neurotrophic factor 1 1
MIRT025912 MAS1L MAS1 proto-oncogene like, G protein-coupled receptor 1 1
MIRT025913 ZFAND4 zinc finger AN1-type containing 4 1 1
MIRT025914 SAMSN1 SAM domain, SH3 domain and nuclear localization signals 1 1 1
MIRT025915 CORO6 coronin 6 1 1
MIRT025916 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT025917 TRIM8 tripartite motif containing 8 1 1
MIRT025918 LGALS3BP galectin 3 binding protein 1 1
MIRT025919 CRTC3 CREB regulated transcription coactivator 3 1 1
MIRT025920 ACVR1B activin A receptor type 1B 1 1
MIRT025921 SCAMP2 secretory carrier membrane protein 2 1 1
MIRT025922 TTLL12 tubulin tyrosine ligase like 12 1 1
MIRT025923 LANCL1 LanC like 1 1 1
MIRT025924 SUPT4H1 SPT4 homolog, DSIF elongation factor subunit 1 1
MIRT025925 CTDSP1 CTD small phosphatase 1 1 1
MIRT025926 COMMD7 COMM domain containing 7 1 1
MIRT025927 CAMK2D calcium/calmodulin dependent protein kinase II delta 1 1
MIRT025928 VPS4A vacuolar protein sorting 4 homolog A 1 1
MIRT025929 CAV1 caveolin 1 3 3
MIRT025930 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT025931 SGPL1 sphingosine-1-phosphate lyase 1 1 1
MIRT025932 OAS2 2'-5'-oligoadenylate synthetase 2 1 1
MIRT025933 ALDH3A2 aldehyde dehydrogenase 3 family member A2 1 1
MIRT025934 EIF2AK1 eukaryotic translation initiation factor 2 alpha kinase 1 1 1
MIRT025935 PITPNC1 phosphatidylinositol transfer protein, cytoplasmic 1 1 1
MIRT025936 TBC1D2B TBC1 domain family member 2B 1 1
MIRT025937 SZRD1 SUZ RNA binding domain containing 1 1 1
MIRT025938 RFFL ring finger and FYVE like domain containing E3 ubiquitin protein ligase 1 1
MIRT025939 POLE3 DNA polymerase epsilon 3, accessory subunit 1 1
MIRT025940 SOCS2 suppressor of cytokine signaling 2 1 1
MIRT025941 VPS13D vacuolar protein sorting 13 homolog D 1 1
MIRT025942 USP31 ubiquitin specific peptidase 31 1 1
MIRT025943 GPAA1 glycosylphosphatidylinositol anchor attachment 1 1 1
MIRT025944 UBE2R2 ubiquitin conjugating enzyme E2 R2 1 1
MIRT025945 NBL1 neuroblastoma 1, DAN family BMP antagonist 1 1
MIRT025946 CALU calumenin 1 1
MIRT025947 DTYMK deoxythymidylate kinase 1 1
MIRT025948 ALDH1A3 aldehyde dehydrogenase 1 family member A3 1 1
MIRT025949 CALM3 calmodulin 3 3 11
MIRT025950 UBQLN4 ubiquilin 4 1 1
MIRT025951 DAZAP2 DAZ associated protein 2 1 1
MIRT025952 PIK3CB phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta 1 1
MIRT025953 RUSC1 RUN and SH3 domain containing 1 1 1
MIRT025954 GTF3C5 general transcription factor IIIC subunit 5 1 1
MIRT025955 ERI2 ERI1 exoribonuclease family member 2 1 1
MIRT025956 NDFIP2 Nedd4 family interacting protein 2 1 1
MIRT025957 DCTD dCMP deaminase 1 1
MIRT025958 PTK7 protein tyrosine kinase 7 (inactive) 1 1
MIRT025959 SLC25A37 solute carrier family 25 member 37 1 1
MIRT025960 SLC25A44 solute carrier family 25 member 44 1 1
MIRT025961 SERTAD3 SERTA domain containing 3 2 3
MIRT025962 FAM126B family with sequence similarity 126 member B 1 1
MIRT025963 RNF38 ring finger protein 38 1 1
MIRT025964 RNF41 ring finger protein 41 2 3
MIRT025965 LRP6 LDL receptor related protein 6 1 1
MIRT025966 CAPN2 calpain 2 1 1
MIRT025967 SPATA2 spermatogenesis associated 2 1 1
MIRT025968 SLC25A15 solute carrier family 25 member 15 1 2
MIRT047753 PHF10 PHD finger protein 10 1 1
MIRT047754 DDI2 DNA damage inducible 1 homolog 2 1 1
MIRT047755 PNISR PNN interacting serine and arginine rich protein 1 1
MIRT047756 RPS3A ribosomal protein S3A 1 1
MIRT047757 E2F2 E2F transcription factor 2 1 1
MIRT047758 SNX29 sorting nexin 29 1 1
MIRT047759 UNC119 unc-119 lipid binding chaperone 1 1
MIRT047760 C3orf38 chromosome 3 open reading frame 38 1 1
MIRT047761 EIF3L eukaryotic translation initiation factor 3 subunit L 1 1
MIRT047762 XRCC5 X-ray repair cross complementing 5 1 1
MIRT047763 TAF4 TATA-box binding protein associated factor 4 1 1
MIRT047764 TMED2 transmembrane p24 trafficking protein 2 1 1
MIRT047765 KPNB1 karyopherin subunit beta 1 1 1
MIRT047766 TOP2A DNA topoisomerase II alpha 1 1
MIRT047767 RALA RAS like proto-oncogene A 1 1
MIRT047768 MOCS3 molybdenum cofactor synthesis 3 1 1
MIRT047769 ST3GAL5 ST3 beta-galactoside alpha-2,3-sialyltransferase 5 1 1
MIRT047770 ZNF507 zinc finger protein 507 1 1
MIRT047771 RWDD1 RWD domain containing 1 1 1
MIRT047772 RBM17 RNA binding motif protein 17 1 1
MIRT047773 NAV1 neuron navigator 1 1 1
MIRT053022 YY1 YY1 transcription factor 2 1
MIRT053122 SKP2 S-phase kinase associated protein 2 1 1
MIRT053541 PIK3R3 phosphoinositide-3-kinase regulatory subunit 3 3 1
MIRT054112 TPP1 tripeptidyl peptidase 1 1 1
MIRT054557 XRCC2 X-ray repair cross complementing 2 3 1
MIRT054913 KLF4 Kruppel like factor 4 3 3
MIRT079414 FOXK2 forkhead box K2 2 4
MIRT088063 SEPT2 septin 2 2 6
MIRT108696 XIAP X-linked inhibitor of apoptosis 2 1
MIRT161895 FXR1 FMR1 autosomal homolog 1 2 2
MIRT194948 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT229420 ZNF275 zinc finger protein 275 2 4
MIRT253100 BCL2L12 BCL2 like 12 2 2
MIRT295884 C20ORF24 chromosome 20 open reading frame 24 2 4
MIRT298316 SLC5A3 solute carrier family 5 member 3 2 2
MIRT311376 PRDM6 PR/SET domain 6 2 2
MIRT323055 UBXN2B UBX domain protein 2B 2 2
MIRT352289 CRKL CRK like proto-oncogene, adaptor protein 2 6
MIRT409708 ZNF557 zinc finger protein 557 2 2
MIRT437961 JARID2 jumonji and AT-rich interaction domain containing 2 1 1
MIRT437962 MYC MYC proto-oncogene, bHLH transcription factor 1 1
MIRT437963 GFI1 growth factor independent 1 transcriptional repressor 1 1
MIRT438133 CCNE1 cyclin E1 3 1
MIRT438162 CUL5 cullin 5 3 1
MIRT438195 PAX6 paired box 6 2 3
MIRT438277 PIK3CG phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma 2 1
MIRT438629 TET2 tet methylcytosine dioxygenase 2 1 1
MIRT445017 RBMS3 RNA binding motif single stranded interacting protein 3 2 2
MIRT446603 AKAP1 A-kinase anchoring protein 1 2 2
MIRT449828 TLR4 toll like receptor 4 2 2
MIRT452792 FAM136A family with sequence similarity 136 member A 2 2
MIRT456630 ARMCX6 armadillo repeat containing, X-linked 6 2 2
MIRT457741 NCR3LG1 natural killer cell cytotoxicity receptor 3 ligand 1 2 2
MIRT459770 IDH3A isocitrate dehydrogenase 3 (NAD(+)) alpha 2 2
MIRT460003 DNALI1 dynein axonemal light intermediate chain 1 2 2
MIRT460753 FBLN5 fibulin 5 2 2
MIRT463243 ZIC5 Zic family member 5 2 2
MIRT463785 YOD1 YOD1 deubiquitinase 2 2
MIRT470480 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 2 2
MIRT471934 NRAS NRAS proto-oncogene, GTPase 2 2
MIRT472581 NACC1 nucleus accumbens associated 1 2 2
MIRT475372 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT476470 GATAD2B GATA zinc finger domain containing 2B 2 2
MIRT480029 CANX calnexin 2 6
MIRT480928 BCAT1 branched chain amino acid transaminase 1 2 4
MIRT481416 ASXL1 additional sex combs like 1, transcriptional regulator 2 2
MIRT483435 RHOXF2B Rhox homeobox family member 2B 2 2
MIRT483864 EMID1 EMI domain containing 1 2 2
MIRT485706 CBX7 chromobox 7 2 2
MIRT485879 ALG9 ALG9, alpha-1,2-mannosyltransferase 2 2
MIRT487232 CBS cystathionine-beta-synthase 2 4
MIRT487798 GPR20 G protein-coupled receptor 20 2 4
MIRT489879 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT490927 GRIN2D glutamate ionotropic receptor NMDA type subunit 2D 2 4
MIRT491413 SSPN sarcospan 2 4
MIRT494360 CAPZB capping actin protein of muscle Z-line beta subunit 2 2
MIRT498827 DNTTIP2 deoxynucleotidyltransferase terminal interacting protein 2 2 8
MIRT498931 TMEM106B transmembrane protein 106B 2 8
MIRT499202 TJAP1 tight junction associated protein 1 2 2
MIRT499587 INTU inturned planar cell polarity protein 2 4
MIRT499770 SLC29A2 solute carrier family 29 member 2 2 2
MIRT500044 SDE2 SDE2 telomere maintenance homolog 2 6
MIRT500121 ZNF106 zinc finger protein 106 2 4
MIRT500527 ZBTB22 zinc finger and BTB domain containing 22 2 4
MIRT500960 SPTSSB serine palmitoyltransferase small subunit B 2 2
MIRT501741 NSD1 nuclear receptor binding SET domain protein 1 2 2
MIRT503135 ATG9A autophagy related 9A 2 6
MIRT503317 FICD FIC domain containing 2 4
MIRT503450 PNMA2 paraneoplastic Ma antigen 2 2 6
MIRT509543 BTLA B and T lymphocyte associated 2 8
MIRT513800 NIPAL3 NIPA like domain containing 3 2 4
MIRT524338 CRIM1 cysteine rich transmembrane BMP regulator 1 2 6
MIRT526807 TANGO2 transport and golgi organization 2 homolog 2 2
MIRT528846 RAB32 RAB32, member RAS oncogene family 2 2
MIRT530936 ENPP6 ectonucleotide pyrophosphatase/phosphodiesterase 6 2 2
MIRT533366 UBE2D4 ubiquitin conjugating enzyme E2 D4 (putative) 2 4
MIRT537245 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 2 2
MIRT537472 FAM63B MINDY lysine 48 deubiquitinase 2 2 2
MIRT538697 CASP16 caspase 16, pseudogene 2 4
MIRT543739 DHCR7 7-dehydrocholesterol reductase 2 2
MIRT545633 GGCX gamma-glutamyl carboxylase 2 2
MIRT545927 ZC3H4 zinc finger CCCH-type containing 4 2 2
MIRT547211 PARP1 poly(ADP-ribose) polymerase 1 2 2
MIRT548144 FYCO1 FYVE and coiled-coil domain containing 1 2 2
MIRT548962 CCNT2 cyclin T2 2 2
MIRT549401 AKAP11 A-kinase anchoring protein 11 2 2
MIRT551662 KIAA1143 KIAA1143 2 4
MIRT555107 PURB purine rich element binding protein B 2 2
MIRT557681 GATA6 GATA binding protein 6 2 2
MIRT559823 SLPI secretory leukocyte peptidase inhibitor 2 2
MIRT559845 RBM23 RNA binding motif protein 23 2 2
MIRT559873 ATXN3 ataxin 3 2 2
MIRT559902 CNNM4 cyclin and CBS domain divalent metal cation transport mediator 4 2 2
MIRT559930 SOD2 superoxide dismutase 2 2 2
MIRT560023 TM2D2 TM2 domain containing 2 2 2
MIRT560092 ERCC8 ERCC excision repair 8, CSA ubiquitin ligase complex subunit 2 2
MIRT560193 CACNG7 calcium voltage-gated channel auxiliary subunit gamma 7 2 2
MIRT560262 TMEM236 transmembrane protein 236 2 2
MIRT560278 HRH2 histamine receptor H2 2 2
MIRT560373 TAF8 TATA-box binding protein associated factor 8 2 2
MIRT560426 ANGPTL3 angiopoietin like 3 2 2
MIRT560442 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT560469 SMIM9 small integral membrane protein 9 2 2
MIRT560472 ENSA endosulfine alpha 2 2
MIRT560499 KCNJ10 potassium voltage-gated channel subfamily J member 10 2 2
MIRT560510 POGK pogo transposable element derived with KRAB domain 2 2
MIRT560523 TMEM98 transmembrane protein 98 2 2
MIRT560555 SIGLEC14 sialic acid binding Ig like lectin 14 2 2
MIRT560562 MYLK myosin light chain kinase 2 2
MIRT560585 LCE1B late cornified envelope 1B 2 2
MIRT560595 FAM114A1 family with sequence similarity 114 member A1 2 2
MIRT560616 ANKRD36 ankyrin repeat domain 36 2 2
MIRT560809 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 2 2
MIRT560889 SULT1B1 sulfotransferase family 1B member 1 2 2
MIRT560917 PA2G4 proliferation-associated 2G4 2 2
MIRT560922 KIF5B kinesin family member 5B 2 2
MIRT560950 POTED POTE ankyrin domain family member D 2 2
MIRT561003 C8orf37 chromosome 8 open reading frame 37 2 2
MIRT561082 LLPH LLP homolog, long-term synaptic facilitation 2 2
MIRT561093 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT561105 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT561199 LDHD lactate dehydrogenase D 2 2
MIRT561208 ZXDA zinc finger, X-linked, duplicated A 2 2
MIRT561287 ZCCHC14 zinc finger CCHC-type containing 14 2 2
MIRT561520 SPTY2D1 SPT2 chromatin protein domain containing 1 2 2
MIRT561660 RNF11 ring finger protein 11 2 2
MIRT561670 RBPJ recombination signal binding protein for immunoglobulin kappa J region 2 2
MIRT561684 RAD54L2 RAD54 like 2 2 2
MIRT561761 PLAGL2 PLAG1 like zinc finger 2 2 2
MIRT561843 NREP neuronal regeneration related protein 2 2
MIRT561912 MFSD9 major facilitator superfamily domain containing 9 2 2
MIRT561961 LSM12 LSM12 homolog 2 2
MIRT562055 KPNA6 karyopherin subunit alpha 6 2 2
MIRT562478 CHORDC1 cysteine and histidine rich domain containing 1 2 2
MIRT562676 AKT3 AKT serine/threonine kinase 3 2 2
MIRT563992 SLFN11 schlafen family member 11 2 2
MIRT565595 SLC35G1 solute carrier family 35 member G1 2 2
MIRT565782 SEMA6D semaphorin 6D 2 2
MIRT567201 IGFBP5 insulin like growth factor binding protein 5 2 4
MIRT567412 GOLPH3L golgi phosphoprotein 3 like 2 2
MIRT568379 ATXN1 ataxin 1 2 2
MIRT570514 STK11 serine/threonine kinase 11 2 2
MIRT571259 LSM3 LSM3 homolog, U6 small nuclear RNA and mRNA degradation associated 2 2
MIRT571689 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 2
MIRT572703 SRPK1 SRSF protein kinase 1 2 2
MIRT573932 CNTNAP2 contactin associated protein like 2 2 2
MIRT618155 CHCHD5 coiled-coil-helix-coiled-coil-helix domain containing 5 2 2
MIRT620229 PACS1 phosphofurin acidic cluster sorting protein 1 2 2
MIRT697847 UBE2Z ubiquitin conjugating enzyme E2 Z 2 2
MIRT698528 TFRC transferrin receptor 2 2
MIRT705576 ARHGEF12 Rho guanine nucleotide exchange factor 12 2 2
MIRT708501 FAM9C family with sequence similarity 9 member C 2 2
MIRT713240 HAP1 huntingtin associated protein 1 2 2
MIRT723699 CKS2 CDC28 protein kinase regulatory subunit 2 2 2
MIRT731276 VDAC1 voltage dependent anion channel 1 1 1
MIRT731526 SERPINB5 serpin family B member 5 4 1
MIRT731770 FOS Fos proto-oncogene, AP-1 transcription factor subunit 4 1
MIRT731976 BAX BCL2 associated X, apoptosis regulator 1 1
MIRT732230 REL REL proto-oncogene, NF-kB subunit 3 1
MIRT732384 GDF5 growth differentiation factor 5 3 1
MIRT732952 AR androgen receptor 3 0
MIRT732953 NOTCH4 notch 4 3 0
MIRT733288 PLP2 proteolipid protein 2 3 0
MIRT733394 Sp1 Sp1 transcription factor 4 0
MIRT734401 TGFB2 transforming growth factor beta 2 7 1
MIRT735171 CASP3 caspase 3 2 0
MIRT735271 DIS3L2 DIS3 like 3'-5' exoribonuclease 2 2 0
MIRT735551 LINC00240 long intergenic non-protein coding RNA 240 3 0
MIRT735733 DMPK DM1 protein kinase 2 0
MIRT735923 RAPGEF3 Rap guanine nucleotide exchange factor 3 3 0
MIRT736327 ARRB1 arrestin beta 1 2 0
MIRT736473 ZSWIM8 zinc finger SWIM-type containing 8 2 0
MIRT755353 SP1 Sp1 transcription factor 1 1
MIRT755644 MTOR mechanistic target of rapamycin kinase 3 1
MIRT755707 BNC2 basonuclin 2 1 1
MIRT756303 AMBRA1 autophagy and beclin 1 regulator 1 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-7 Berbamine derivative(BBMD3) NULL NULL Illumina HiSeq2000 brain 24732116 2014 down-regulated
miR-7 Curcumin NULL 969516 Microarray BxPC-3 human pancreatic carcinoma cell line 18347134 2008 down-regulated
miR-7 Enoxacin approved 3229 Quantitative real-time PCR HCT-116 and RKO colon cancer cell lines 21368194 2011 up-regulated
miR-7 5-Fluorouracil approved 3385 Microarray MCF-7 breast cancer cells 21506117 2011 down-regulated
miR-7 Aidi injection NULL NULL Microarray human breast cancer cells 21563499 2011 up-regulated
miR-7 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-7 Marine fungal metabolite 1386A NULL NULL Microarray MCF-7 breast cancer cells. 22159329 2012 up-regulated
miR-7 Interleukin 13 (IL-13) NULL NULL Quantitative real-time PCR bronchial epithelial cells 22453679 2012 down-regulated
miR-7 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-7 Goserelin approved 47725 Microarray prostate 22674191 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-7-5p (-)-dactylolide 11222845 NSC740028 sensitive
hsa-miR-7-5p (-)-leucascandrolide a 24203380 NSC727719 sensitive
hsa-miR-7-5p (1'R,3'S,3'aS,8'bS)-1',3'-diphenylspiro[1,3-dihydroindene-2,2'-3,3a,4,8b-tetrahydro-1H-cyclopenta[a]indene]-1,4'-diol 385850 NSC677249 sensitive
hsa-miR-7-5p (1'S,8'R)-9',10'-dibromospiro[1,3-dithiolane-2,11'-tricyclo[6.3.1.02,7]dodeca-2,4,6,9-tetraene] 389921 NSC686573 sensitive
hsa-miR-7-5p (1,1,3-trioxo-1,2-benzothiazol-2-yl)methyl 4-methylpiperazine-1-carbodithioate 16072473 NSC735181 sensitive
hsa-miR-7-5p (11E)-11-(2-aminoethylidene)-15,16-dimethoxy-20-methyl-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaen-19-one 11452147 NSC725665 sensitive
hsa-miR-7-5p (11E)-11-(6-aminohexylidene)-15,16-dimethoxy-20-methyl-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaen-19-one 45027835 NSC727049 sensitive
hsa-miR-7-5p (11E)-15,16-dimethoxy-20-methyl-11-[3-(methylamino)propylidene]-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaen-19-one 45027834 NSC727048 sensitive
hsa-miR-7-5p (1E,4E)-1,5-bis(7-methoxy-1,3-benzodioxol-5-yl)penta-1,4-dien-3-one 91973099 NSC758539 sensitive
hsa-miR-7-5p (1R,2S,7S,13R,15S)-2,15-bis[[tert-butyl(dimethyl)silyl]oxy]-3,4,11,12-tetrahydroxy-7-methyl-6-oxabicyclo[11.3.0]hexadecan-5-one 24202575 NSC694611 resistant
hsa-miR-7-5p (1R,4S,5R,8S,12R,13R)-9-[2-[[(1R,4S,5R,8S,12R,13R)-1,5-dimethyl-10-(trifluoromethyl)-11,14,15,16-tetraoxatetracyclo[10.3.1.04,13.08,13]hexadec-9-en-9-yl]methoxy]ethoxymethyl]-1,5-dimethyl-10-(trifluoromethyl)-11,14,15,16-tetraoxatetracyclo[10.3.1.04,13.08 54612640 NSC724780 sensitive
hsa-miR-7-5p (1R,5S,8E)-8-benzylidene-5-(3-hydroxyphenyl)-2-methyl-2-azabicyclo[3.3.1]nonan-7-one;perchloric acid 45489959 NSC678345 sensitive
hsa-miR-7-5p (1s,2s,14r,22r)-23-(cyclopropylmethyl)-17-methyl-15-oxa-12,23-diazaheptacyclo[14.9.1.01,14.02,22.04,13.06,11.020,26]hexacosa-4,6,8,10,12,16,18,20(26)-octaen-2-ol;hydrochloride 5471391 NSC711014 sensitive
hsa-miR-7-5p (2,4-dinitrophenyl)methyl carbamimidothioate;chloride 24183838 NSC30637 sensitive
hsa-miR-7-5p (2e)-2-(1,3-benzodioxol-5-ylmethylidene)-5-(morpholin-4-ylmethyl)cyclopentan-1-one;hydrochloride 6516904 NSC639981 sensitive
hsa-miR-7-5p (2E)-2-[(3,4-dimethoxyphenyl)methylidene]-5-[(dimethylamino)methyl]cyclopentan-1-one;hydrochloride 21141940 NSC639516 sensitive
hsa-miR-7-5p (2E)-2-[(4-hydroxyphenyl)methylidene]-6-(piperidin-1-ylmethyl)cyclohexan-1-one;hydrochloride 5469353 NSC687002 sensitive
hsa-miR-7-5p (2e)-2-[2-[4-(2-methylpropyl)phenyl]propylidene]-5-(pyrrolidin-1-ylmethyl)cyclopentan-1-one;hydrochloride 54608909 NSC639977 sensitive
hsa-miR-7-5p (2E)-2-benzylidene-6-[(dimethylamino)methyl]cyclohexan-1-one;hydrochloride 5468410 NSC669732 sensitive
hsa-miR-7-5p (2e)-n-propyl-2-[1-(pyridin-2-yl)ethylidene]hydrazine-1-carbothioamide 5371176 NSC317908 sensitive
hsa-miR-7-5p (2E,6E)-2-[[4-hydroxy-3-(piperidin-1-ylmethyl)phenyl]methylidene]-6-[(4-methoxyphenyl)methylidene]cyclohexan-1-one 5469358 NSC687006 sensitive
hsa-miR-7-5p (2E,6E)-2-[[4-hydroxy-3-(piperidin-1-ylmethyl)phenyl]methylidene]-6-[(4-methylphenyl)methylidene]cyclohexan-1-one 5469357 NSC687005 sensitive
hsa-miR-7-5p (2E,6E)-2,6-bis[(4-bromophenyl)methylidene]cyclohexan-1-one 5716584 NSC632831 sensitive
hsa-miR-7-5p (2r)-2-[[(2s)-2-[[2-[5-acetamido-3-hydroxy-2-(hydroxymethyl)-6-phenylmethoxyoxan-4-yl]oxyacetyl]amino]propanoyl]amino]-n'-[3-[(1-nitroacridin-9-yl)amino]propyl]pentanediamide 393689 NSC696078 sensitive
hsa-miR-7-5p (2r)-2-[[(2s)-2-[[2-[5-acetamido-3-hydroxy-2-(hydroxymethyl)-6-phenylmethoxyoxan-4-yl]oxyacetyl]amino]propanoyl]amino]-n'-[4-[(1-nitroacridin-9-yl)amino]butyl]pentanediamide 393684 NSC696073 sensitive
hsa-miR-7-5p (2r)-2-[[(2s)-2-[2-[5-acetamido-3-hydroxy-2-(hydroxymethyl)-6-phenylmethoxyoxan-4-yl]oxypropanoylamino]propanoyl]amino]-n'-[2-[2-[(1-nitroacridin-9-yl)amino]ethylamino]ethyl]pentanediamide 393686 NSC696075 sensitive
hsa-miR-7-5p (2R,3R)-4-[tert-butyl(dimethyl)silyl]oxy-7-[[tert-butyl(dimethyl)silyl]oxymethyl]-5-(2,4-dioxopyrimidin-1-yl)-1,6-dioxaspiro[2.4]heptane-2-carboxamide 6712493 NSC693092 sensitive
hsa-miR-7-5p (2R,3R,4R,5R,7R)-4-[tert-butyl(dimethyl)silyl]oxy-7-[[tert-butyl(dimethyl)silyl]oxymethyl]-5-(5-methyl-2,4-dioxopyrimidin-1-yl)-1,6-dioxaspiro[2.4]heptane-2-carbohydrazide 397691 NSC706091 sensitive
hsa-miR-7-5p (2r,6r)-9,11-dibromo-10-thia-3,5-diazatricyclo[6.3.0.02,6]undeca-1(11),8-diene-4,7-dione 400215 NSC711733 sensitive
hsa-miR-7-5p (2S)-2,6-diamino-N-[4-(1,3-benzothiazol-2-yl)-2-chlorophenyl]hexanamide;hydrochloride 396810 NSC703784 sensitive
hsa-miR-7-5p (2z)-5-methoxy-2-[(3-phenacyloxyphenyl)methylidene]-1-benzofuran-3-one 45028682 NSC743694 sensitive
hsa-miR-7-5p (2Z,6Z)-2,6-bis[[3-[(dimethylamino)methyl]-4-hydroxyphenyl]methylidene]cyclohexan-1-one 6067712 NSC683834 sensitive
hsa-miR-7-5p (3e)-3-[(2-chloro-1-methylindol-3-yl)methylidene]-1h-indol-2-one 24203155 NSC726904 sensitive
hsa-miR-7-5p (3e)-3-[(2-chloro-1-phenylindol-3-yl)methylidene]-5-methoxy-6-methyl-1h-indol-2-one 5471471 NSC711611 sensitive
hsa-miR-7-5p (3e)-3-[(2,6-dimethylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1-methylindol-2-one 24205817 NSC736793 sensitive
hsa-miR-7-5p (3e)-3-[(2,6-dimethylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1h-indol-2-one 5471419 NSC711074 sensitive
hsa-miR-7-5p (3e)-3-[(2,6-dimethylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-5-fluoro-1h-indol-2-one NSC737697 sensitive
hsa-miR-7-5p (3e)-3-[(3,4-dihydroxyphenyl)methylidene]-6-phenylchromen-4-one 45029091 NSC745449 sensitive
hsa-miR-7-5p (3e)-3-[(6-methylimidazo[2,1-b]thiazol-5-yl)methylene]-1,3-dihydro-2h-indol-2-one 10755270 NSC726902 sensitive
hsa-miR-7-5p (3E)-3-[[3-[1-(4-fluorophenyl)sulfonylpiperidin-4-yl]imidazo[1,5-a]pyridin-1-yl]methylidene]-1H-indol-2-one 54613720 NSC750970 resistant
hsa-miR-7-5p (3e)-3-[[6-[(e)-(2-oxo-1h-indol-3-ylidene)methyl]pyridin-2-yl]methylidene]-1h-indol-2-one 5473214 NSC724448 sensitive
hsa-miR-7-5p (3e)-4-chloro-3-(pyridin-3-ylmethylidene)-1h-indol-2-one 5473204 NSC724435 sensitive
hsa-miR-7-5p (3e)-4-chloro-3-[(6-chloroimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1h-indol-2-one 5471415 NSC711070 resistant
hsa-miR-7-5p (3e)-5-chloro-3-[(2,6-dimethylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1h-indol-2-one 5473339 NSC725098 sensitive
hsa-miR-7-5p (3e)-5-methoxy-3-[(6-phenyl-2,3-dihydroimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1h-indol-2-one 5471411 NSC711066 sensitive
hsa-miR-7-5p (3E,5E)-1-acetyl-3,5-dibenzylidenepiperidin-4-one 5387998 NSC630599 sensitive
hsa-miR-7-5p (3E,5E)-3,5-bis[(2-fluorophenyl)methylidene]piperidin-4-one 9885748 NSC762346 sensitive
hsa-miR-7-5p (3E,5E)-3,5-bis[(3,4-dichlorophenyl)methylidene]-1-[3-(dimethylamino)propanoyl]piperidin-4-one;hydrochloride 5388808 NSC638645 sensitive
hsa-miR-7-5p (3E,5E)-3,5-bis[[4-(dimethylamino)phenyl]methylidene]-1,1-dimethylpiperidin-1-ium-4-one;iodide 5386914 NSC618757 sensitive
hsa-miR-7-5p (3E,5Z)-3,5-bis[(3,4-dimethoxyphenyl)methylidene]thian-4-one 6477009 NSC144310 sensitive
hsa-miR-7-5p (3S)-3-[(5R)-9-bromo-4-methoxy-6-methyl-7,8-dihydro-5H-[1,3]dioxolo[4,5-g]isoquinolin-5-yl]-6,7-dimethoxy-3H-2-benzofuran-1-one 10255081 NSC733397 sensitive
hsa-miR-7-5p (3s,8r,9s,10r,13s,14s,16e)-3-hydroxy-10,13-dimethyl-16-[(4-nitrophenyl)methylidene]-2,3,4,7,8,9,11,12,14,15-decahydro-1h-cyclopenta[a]phenanthren-17-one 5472098 NSC716261 resistant
hsa-miR-7-5p (3z)-3-[(2,6-dimethylimidazo[2,1-b][1,3,4]thiadiazol-5-yl)methylidene]-1h-indol-2-one 24205829 NSC736811 sensitive
hsa-miR-7-5p (3z)-3-[(5-methoxy-6-methyl-1h-indol-3-yl)methylidene]-1-methylindol-2-one 24205080 NSC734187 sensitive
hsa-miR-7-5p (3z)-3-[[3-[2-(4-chlorophenyl)-2-oxoethoxy]phenyl]methylidene]-6-methylthiochromen-4-one 45028771 NSC744076 sensitive
hsa-miR-7-5p (3z)-3-[[3-[2-(4-methoxyphenyl)-2-oxoethoxy]phenyl]methylidene]-6-methylthiochromen-4-one 45028770 NSC744075 sensitive
hsa-miR-7-5p (3z)-3-benzylidene-6-methylheptane-2,4-dione 54603898 NSC46598 sensitive
hsa-miR-7-5p (3z)-5-chloro-3-[(2,6-dimethylimidazo[2,1-b][1,3,4]thiadiazol-5-yl)methylidene]-1h-indol-2-one 24205825 NSC736807 sensitive
hsa-miR-7-5p (3Z,5E)-3,5-bis[(4-methoxyphenyl)methylidene]piperidin-4-one 6477975 NSC632840 sensitive
hsa-miR-7-5p (3Z,5E)-3,5-dibenzylidene-1-[(E)-3-phenylprop-2-enoyl]piperidin-4-one 5351375 NSC638634 sensitive
hsa-miR-7-5p (3Z,5Z)-3,5-dibenzylidene-1-[3-(diethylamino)propanoyl]piperidin-4-one 6477769 NSC634785 sensitive
hsa-miR-7-5p (3Z,5Z)-3,5-dibenzylidene-1-[3-(dimethylamino)propanoyl]piperidin-4-one 6477768 NSC634784 sensitive
hsa-miR-7-5p (4-chlorophenyl)-[5-(2,4-dichloro-5-fluorophenyl)-5-hydroxy-3-(4-methoxyphenyl)-4h-pyrazol-1-yl]methanone 400818 NSC713324 sensitive
hsa-miR-7-5p (4-methoxyphenyl)-(3,4,5-trimethoxyphenyl)methanol 368140 NSC638483 sensitive
hsa-miR-7-5p (4-methoxyphenyl)(2,3,4-trimethoxyphenyl)methanone 240478 NSC46683 sensitive
hsa-miR-7-5p (4-nitrophenyl) (3E,5E)-3,5-dibenzylidene-4-oxopiperidine-1-carboxylate 5388007 NSC630608 sensitive
hsa-miR-7-5p (4aR,9aR)-9-(4-methylphenyl)sulfonyl-3,4,4a,9a-tetrahydrocarbazole 372866 NSC648556 sensitive
hsa-miR-7-5p (4aS,4bR,10bS,12aS)-2-butyl-12a-methyl-8-(2-pyrrolidin-1-ylethoxy)-4,4a,4b,5,6,10b,11,12-octahydronaphtho[2,1-f]isoquinoline-1,3-dione 383426 NSC671765 sensitive
hsa-miR-7-5p (4e,12z,27z,43z)-hexatetraconta-4,12,27,43-tetraen-1,18,21,45-tetrayne-3,20-diol 5470605 NSC703544 sensitive
hsa-miR-7-5p (4s)-parectadial 23625545 NSC746540 sensitive
hsa-miR-7-5p (4Z)-4-[[1-(3-chlorophenyl)-3-(4-methoxyphenyl)pyrazol-4-yl]methylidene]-5-imino-1-phenylpyrazol-3-amine 135276800 NSC763587 sensitive
hsa-miR-7-5p (5E)-2-(morpholin-4-ylmethyl)-5-nonylidenecyclopentan-1-one;hydrochloride 54612513 NSC639505 sensitive
hsa-miR-7-5p (5E)-2-[(4-chloroanilino)methyl]-5-[(4-hydroxyphenyl)methylidene]cyclopentan-1-one 5930524 NSC639541 sensitive
hsa-miR-7-5p (5e)-2-[(4-ethoxyanilino)methyl]-5-[(2-methoxyphenyl)methylidene]cyclopentan-1-one 5915890 NSC639539 sensitive
hsa-miR-7-5p (5E)-2-[(dimethylamino)methyl]-5-(2-methylpropylidene)cyclopentan-1-one;hydrochloride 21141929 NSC639498 sensitive
hsa-miR-7-5p (5E)-2-[(dimethylamino)methyl]-5-[(2-methoxyphenyl)methylidene]cyclopentan-1-one;hydrochloride 5387758 NSC626874 sensitive
hsa-miR-7-5p (5E)-2-[(dimethylamino)methyl]-5-[(4-hydroxyphenyl)methylidene]cyclopentan-1-one;hydrochloride 5387766 NSC626880 sensitive
hsa-miR-7-5p (5E)-2-[(dimethylamino)methyl]-5-[(4-methoxyphenyl)methylidene]cyclopentan-1-one;hydrochloride 21141935 NSC639511 sensitive
hsa-miR-7-5p (5E)-2-[(dimethylamino)methyl]-5-heptylidenecyclopentan-1-one;hydrochloride 5387764 NSC626879 sensitive
hsa-miR-7-5p (5E)-2-[(dimethylamino)methyl]-5-octylidenecyclopentan-1-one;hydrochloride 6516817 NSC639504 sensitive
hsa-miR-7-5p (5E)-2-benzyl-2-[(dimethylamino)methyl]-5-[(2-methoxyphenyl)methylidene]cyclopentan-1-one;hydrochloride 6516829 NSC639521 sensitive
hsa-miR-7-5p (5e)-5-[(3,4-dimethoxyphenyl)methylidene]-3-phenyl-2-propylimino-1,3-thiazolidin-4-one 5471348 NSC710598 resistant
hsa-miR-7-5p (5Z)-2-[(dimethylamino)methyl]-5-pentylidenecyclopentan-1-one;hydrochloride 5387762 NSC626878 sensitive
hsa-miR-7-5p (6aS,10aS)-6-(1H-indol-3-yl)-9-methyl-5,6,6a,7,8,10a-hexahydroindeno[2,1-b]indole 362974 NSC627506 sensitive
hsa-miR-7-5p (6E)-2-[(dimethylamino)methyl]-6-[(4-methoxyphenyl)methylidene]cyclohexan-1-one;hydrochloride 5468453 NSC670687 sensitive
hsa-miR-7-5p (6Z,10E)-5-hydroxy-6-methyl-3-methylidene-2-oxo-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-10-carbaldehyde 6477353 NSC645998 sensitive
hsa-miR-7-5p (7ar)-1,6-bis(4-methoxyphenyl)-7a-phenyltetrahydroimidazo[1,5-b][1,2,4]oxadiazol-2(1h)-one 402882 NSC717189 sensitive
hsa-miR-7-5p (7e)-5-methyl-2-phenyl-3-thiophen-2-yl-7-(thiophen-2-ylmethylidene)-3,3a,4,6-tetrahydropyrazolo[4,3-c]pyridine 5470914 NSC706211 sensitive
hsa-miR-7-5p (7E)-6-(methoxymethoxy)-2-methylcyclododec-7-en-3-yn-1-one 5467712 NSC658114 sensitive
hsa-miR-7-5p (8E)-4-(4-chlorophenyl)-8-[(4-chlorophenyl)methylidene]-4,5,6,7-tetrahydro-1H-quinazolin-2-amine 13170777 NSC763275 sensitive
hsa-miR-7-5p (8S,9S,13S,14S)-17-(furan-2-yl)-3-methoxy-13-methyl-6,7,8,9,11,12,14,15-octahydrocyclopenta[a]phenanthrene-16-carbaldehyde 24204972 NSC733795 sensitive
hsa-miR-7-5p (9-methoxy-5,11-dimethyl-6H-pyrido[4,3-b]carbazol-2-ium-2-yl)methyl benzoate;iodide 365242 NSC632620 sensitive
hsa-miR-7-5p (9,10-dioxoanthracen-2-yl)methyl 3-benzamido-2-hydroxy-3-phenylpropanoate 361915 NSC625350 resistant
hsa-miR-7-5p (E)-1-(3,4-dimethoxyphenyl)-3-[2-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl]prop-2-en-1-one 54599698 NSC750746 sensitive
hsa-miR-7-5p (E)-1-(7-methoxy-3-methyl-4-oxido-1-oxoquinoxalin-1-ium-2-yl)-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 54612660 NSC741738 resistant
hsa-miR-7-5p (e)-1-(benzenesulfonyl)-3-(2-phenyl-1h-indol-3-yl)prop-2-en-1-one 54613416 NSC749193 sensitive
hsa-miR-7-5p (E)-1-[1-ethyl-4-hydroxy-1-methyl-4-[(E)-2-phenylethenyl]piperidin-1-ium-3-yl]-3-phenylprop-2-en-1-one;bromide 5386939 NSC618770 sensitive
hsa-miR-7-5p (e)-1-[3-[(4,6-dianilino-1,3,5-triazin-2-yl)amino]phenyl]-3-(3-methoxyphenyl)prop-2-en-1-one 45028634 NSC743528 sensitive
hsa-miR-7-5p (e)-1-[4-(1h-benzimidazol-2-ylmethylamino)phenyl]-3-(4-bromophenyl)prop-2-en-1-one 5839697 NSC645070 sensitive
hsa-miR-7-5p (e)-1-[4-[(7-chloroquinolin-4-yl)amino]phenyl]-3-(furan-2-yl)prop-2-en-1-one 42631501 NSC743864 sensitive
hsa-miR-7-5p (E)-1-[4-[(E)-4,4-dimethyl-3-oxo-5-piperidin-1-ylpent-1-enyl]phenyl]-4,4-dimethyl-5-piperidin-1-ylpent-1-en-3-one;hydrobromide 5386918 NSC618759 sensitive
hsa-miR-7-5p (e)-1-[4-[[4,6-bis(4-fluoroanilino)-1,3,5-triazin-2-yl]amino]phenyl]-3-(2-methoxyphenyl)prop-2-en-1-one 24205906 NSC737225 sensitive
hsa-miR-7-5p (e)-1-[4-[[4,6-bis(4-fluoroanilino)-1,3,5-triazin-2-yl]amino]phenyl]-3-(furan-2-yl)prop-2-en-1-one 24205907 NSC737226 sensitive
hsa-miR-7-5p (e)-1,3-diphenyl-2-(piperidin-1-ylmethyl)prop-2-en-1-one 6147837 NSC109154 sensitive
hsa-miR-7-5p (e)-2-(benzenesulfonyl)-3-[5-methoxy-2-(4-methoxyphenyl)-1h-indol-3-yl]prop-2-enenitrile 54612754 NSC748873 sensitive
hsa-miR-7-5p (e)-3-(2-chloro-5-nitrophenyl)-1-phenylprop-2-en-1-one 5349234 NSC93287 sensitive
hsa-miR-7-5p (E)-3-(2-nitrophenyl)-1-(3,6,7-trimethyl-4-oxido-1-oxoquinoxalin-1-ium-2-yl)prop-2-en-1-one 5351352 NSC621486 resistant
hsa-miR-7-5p (e)-3-(2,3-dichlorophenyl)-1-(6-methoxynaphthalen-2-yl)prop-2-en-1-one 5992706 NSC729529 sensitive
hsa-miR-7-5p (E)-3-(3-chlorophenyl)-N-[2-[(1,1-dioxothian-4-yl)-methylamino]-2-oxoethyl]prop-2-enamide 51003603 NSC761184 sensitive
hsa-miR-7-5p (e)-3-(3,4-dimethoxyphenyl)-1-(6-methoxynaphthalen-2-yl)prop-2-en-1-one 8857297 NSC729531 sensitive
hsa-miR-7-5p (E)-3-(3,5-dimethoxyphenyl)-1-[4-(quinazolin-4-ylamino)phenyl]prop-2-en-1-one 155808311 NSC760016 sensitive
hsa-miR-7-5p (e)-3-(4-chlorophenyl)-1-[4-[(7-chloroquinolin-4-yl)amino]phenyl]prop-2-en-1-one 25113941 NSC743862 sensitive
hsa-miR-7-5p (e)-3-(4-hydroxyphenyl)-1-[5-methyl-1-[8-(trifluoromethyl)quinolin-4-yl]triazol-4-yl]prop-2-en-1-one NSC736153 sensitive
hsa-miR-7-5p (E)-3-(4-phenylphenyl)-1-thiophen-2-ylprop-2-en-1-one 5782484 NSC700125 sensitive
hsa-miR-7-5p (E)-3-(7-methoxy-3-methyl-4-oxido-1-oxoquinoxalin-1-ium-2-yl)-1-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 53362835 NSC749076 sensitive
hsa-miR-7-5p (e)-4-(3-thionitrosophenyl)but-3-en-2-one 5388423 NSC635958 sensitive
hsa-miR-7-5p (E)-5-(diethylamino)-1-[4-[(E)-5-(diethylamino)-4,4-dimethyl-3-oxopent-1-enyl]phenyl]-4,4-dimethylpent-1-en-3-one 5916501 NSC602066 sensitive
hsa-miR-7-5p (e)-but-2-enedioic acid;1-(7,8,9,10-tetrahydrophenanthridin-6-yl)piperidin-4-amine 5471308 NSC710333 sensitive
hsa-miR-7-5p (E)-but-2-enedioic acid;1-[[3-(diethylamino)-2-hydroxypropyl]amino]-4-(oxiran-2-ylmethylamino)anthracene-9,10-dione 5388837 NSC639366 sensitive
hsa-miR-7-5p (E)-N-[(3S,10R,13S,17S)-17-[1-(dimethylamino)ethyl]-2,4-dihydroxy-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl]-2-methylbut-2-enamide 54612851 NSC748903 sensitive
hsa-miR-7-5p (NE)-N-(1-benzyl-4-morpholin-4-yl-2-bicyclo[2.2.2]octanylidene)hydroxylamine 5831070 NSC666707 resistant
hsa-miR-7-5p (ne)-n-[1-[4-(furo[3,2-c]quinolin-4-ylamino)phenyl]ethylidene]hydroxylamine 9572572 NSC720561 sensitive
hsa-miR-7-5p (Z)-(2,4-dinitrophenoxy)imino-(4-ethoxycarbonyl-1,4-diazepan-1-yl)-oxidoazanium 11567470 NSC731704 sensitive
hsa-miR-7-5p (Z)-3-(4-methoxy-1,3-benzodioxol-5-yl)-2-(7-methoxy-1,3-benzodioxol-5-yl)prop-2-enenitrile 155811231 NSC758535 sensitive
hsa-miR-7-5p (z)-3-[[(4z)-4-(5,5-dimethyl-4-methyliminofuran-2-yl)imino-5,5-dimethylfuran-2-yl]amino]-4-hydroxy-4-methylpent-2-enenitrile NSC670995 sensitive
hsa-miR-7-5p (Z)-but-2-enedioic acid;4-(dimethylamino)-1-[6-[4-(dimethylamino)butanoyl]-9-ethylcarbazol-3-yl]butan-1-one 6450892 NSC292816 sensitive
hsa-miR-7-5p (z) 2',3,4,5-tetramethoxystilbene 5388740 NSC638390 sensitive
hsa-miR-7-5p .alpha.-sarcin NSC46401 resistant
hsa-miR-7-5p [(1r)-5-amino-1-(chloromethyl)-1,2-dihydrobenzo[e]indol-3-yl]-(5,6,7-trimethoxy-1h-indol-2-yl)methanone 6712547 NSC696127 sensitive
hsa-miR-7-5p [(1s,2r)-1-benzamido-3-[[(1s,2s,3r,4s,7r,9s,10s,12r,15s)-4,12-diacetyloxy-2-benzoyloxy-1,9-dihydroxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10.04,7]heptadec-13-en-15-yl]oxy]-3-oxo-1- 16129931 NSC705435 sensitive
hsa-miR-7-5p [(1s,2s,3r,4s,7r,9s,10s,12r,15s)-4,12-diacetyloxy-1,9-dihydroxy-15-[(2r,3s)-2-hydroxy-3-(3-methylbutanoylamino)-3-phenylpropanoyl]oxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10.04,7]h 6712271 NSC664404 sensitive
hsa-miR-7-5p [(1s,2s,3r,4s,7r,9s,10s,12r,15s)-4,12-diacetyloxy-15-[(2r,3r)-3-(decanoylamino)-3-(furan-2-yl)-2-hydroxypropanoyl]oxy-1,9-dihydroxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10.04,7]hep 383473 NSC671865 sensitive
hsa-miR-7-5p [(1s,2s,3r,4s,7r,9s,10s,12r,15s)-4,12-diacetyloxy-15-[(2r,3s)-3-benzamido-2-hydroxy-3-(2-methylphenyl)propanoyl]oxy-1,9-dihydroxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10.04,7]hepta 383478 NSC671870 sensitive
hsa-miR-7-5p [(1s,2s,3r,4s,7r,9s,10s,12r,15s)-4,12-diacetyloxy-15-[(2r,3s)-3-benzamido-2-hydroxy-3-phenylpropanoyl]oxy-1,9-dihydroxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10.04,7]heptadec-13-en- 384061 NSC673186 sensitive
hsa-miR-7-5p [(1s,4s,7r,9s,10s,12r)-4,12-diacetyloxy-15-[3-[(3-chlorobenzoyl)amino]-2-hydroxy-3-phenylpropanoyl]oxy-1,9-dihydroxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10.04,7]heptadec-13-en-2-y 6712240 NSC662158 sensitive
hsa-miR-7-5p [(3aR,8S)-8-acetyloxy-6-methyl-3,9-dimethylidene-2-oxo-4,6a,7,8,9a,9b-hexahydro-3aH-azuleno[4,5-b]furan-4-yl] 3-acetyloxy-2-hydroxy-2-methylbutanoate 380982 NSC666858 sensitive
hsa-miR-7-5p [(3S,10R,13S,16E)-16-[[3-methoxy-4-(2-piperidin-1-ylethoxy)phenyl]methylidene]-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 24203176 NSC727082 sensitive
hsa-miR-7-5p [(3S,10R,13S,16E,17S)-16-[[4-(3-imidazol-1-ylpropoxy)-3-methoxyphenyl]methylidene]-10,13-dimethyl-3-pyrrolidin-1-yl-1,2,3,4,7,8,9,11,12,14,15,17-dodecahydrocyclopenta[a]phenanthren-17-yl] acetate 24204019 NSC730460 sensitive
hsa-miR-7-5p [(3s,8r,9s,10r,13s,14s,16e)-16-(1-acetyloxy-2,2,2-trifluoroethylidene)-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1h-cyclopenta[a]phenanthren-3-yl] acetate 5351782 NSC45238 sensitive
hsa-miR-7-5p [(4e)-4-[2-(3,3,6a,10b-tetramethyl-8-methylidene-1,4a,5,6,7,9,10,10a-octahydronaphtho[2,1-d][1,3]dioxin-7-yl)ethylidene]-5-oxooxolan-3-yl] acetate 25121273 NSC750035 sensitive
hsa-miR-7-5p [(4E,6Z,8R,9R,10E,12R,13R,14R,16R)-9-carbamoyloxy-8,14-dimethoxy-4,10,12,16-tetramethyl-3,20,22-trioxo-19-(prop-2-enylamino)-2-azabicyclo[16.3.1]docosa-1(21),4,6,10,18-pentaen-13-yl] 2-(dimethylamino)acetate;hydrochloride 5469147 NSC683662 sensitive
hsa-miR-7-5p [(4E,6Z,8R,9R,10E,12R,13R,14R,16R)-9-carbamoyloxy-8,14-dimethoxy-4,10,12,16-tetramethyl-3,20,22-trioxo-19-(prop-2-enylamino)-2-azabicyclo[16.3.1]docosa-1(21),4,6,10,18-pentaen-13-yl] 2-aminoacetate;hydrochloride 5469145 NSC683661 sensitive
hsa-miR-7-5p [(4E,6Z,8R,9R,10E,12R,14R,16R)-9-carbamoyloxy-8,14-dimethoxy-4,10,12,16-tetramethyl-3,20,22-trioxo-19-(prop-2-enylamino)-2-azabicyclo[16.3.1]docosa-1(21),4,6,10,18-pentaen-13-yl] 4-(dimethylamino)butanoate 5470131 NSC697886 sensitive
hsa-miR-7-5p [(4S,5R,6S)-4-[(3,4-dimethoxyphenyl)methyl]-6-(2,2-diphenylcyclopentyl)oxy-4-ethyl-2-oxido-5,6-dihydrooxazin-2-ium-5-yl] benzoate 395287 NSC699767 sensitive
hsa-miR-7-5p [(6aS)-2-methoxy-11-oxo-6a,7,8,9-tetrahydropyrrolo[2,1-c][1,4]benzodiazepin-3-yl] 1H-indole-2-carboxylate 396302 NSC702015 sensitive
hsa-miR-7-5p [(z)-[2-[[6-[[2-[(