miRTarBase - #MIRT004615


—
pre-miRNA Information
pre-miRNA hsa-mir-26a-1   
Genomic Coordinates chr3: 37969404 - 37969480
Synonyms MIR26A, MIRN26A1, MIR26A1
Description Homo sapiens miR-26a-1 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-26a-2   
Genomic Coordinates chr12: 57824609 - 57824692
Synonyms MIRN26A2, MIR26A2
Description Homo sapiens miR-26a-2 stem-loop
Comment miR-26a was cloned from HeLa cells .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-26a-5p
Sequence 10| UUCAAGUAAUCCAGGAUAGGCU |31
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
C-to-U 21 3 + 37969433 17604727 MiREDiBase
C-to-U 21 12 - 57824659 17604727 MiREDiBase
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30516844 7 COSMIC
COSN30543820 11 COSMIC
COSN30447912 11 COSMIC
COSN31502139 13 COSMIC
COSN31591664 19 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1323067579 3 dbSNP
rs1315291543 9 dbSNP
rs1249227702 12 dbSNP
rs1348933092 17 dbSNP
rs1012142515 17 dbSNP
rs1445643611 18 dbSNP
rs756293180 19 dbSNP
rs765258989 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B52VKB miR-26a Monitoring Biomarker (MOI) Clinical/Experimental Data Expression Increase Plasma Quantitative real-time PCR
BI82DS miR-26a-5p Predictive Biomarker (PRD) Clinical/Experimental Data Expression High Peripheral blood Quantitative real-time PCR
Gene Information
Gene Symbol IFNB1   
Synonyms IFB, IFF, IFN-beta, IFNB
Description interferon beta 1
Transcript NM_002176   
Expression
Putative miRNA Targets on IFNB1
3'UTR of IFNB1
(miRNA target sites are highlighted)		 
>IFNB1|NM_002176|3'UTR
   1 AGATCTCCTAGCCTGTGCCTCTGGGACTGGACAATTGCTTCAAGCATTCTTCAACCAGCAGATGCTGTTTAAGTGACTGA
  81 TGGCTAATGTACTGCATATGAAAGGACACTAGAAGATTTTGAAATTTTTATTAAATTATGAGTTATTTTTATTTATTTAA
 161 ATTTTATTTTGGAAAATAAATTATTTTTGGTGCAAAAGTCA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ucGGAUA---GGACC---UAAUGAACUu 5'
            ||| |    ||||   |||:||| | 
Target 5' tgCCTCTGGGACTGGACAATTGCTTCAa 3'
 16 - 43 112.00 -12.10
2 
miRNA  3' ucGGAUAGGACC-------UAAUGAAcuu 5'
            ::|||::|||       ||||:||   
Target 5' atTTTATTTTGGAAAATAAATTATTTttg 3'
 161 - 189 108.00 -7.26
3 
miRNA  3' ucggaUAGGACCUAAUGAACUu 5'
               || || | |||  ||| 
Target 5' agcagATGCT-GTTTAAGTGAc 3'
 57 - 77 92.00 -9.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30477066 8 COSMIC
COSN29787953 20 COSMIC
COSN30130951 25 COSMIC
COSN30132532 34 COSMIC
COSN30175113 52 COSMIC
COSN30139322 65 COSMIC
COSN30468414 82 COSMIC
COSN30475525 100 COSMIC
COSN31520743 122 COSMIC
COSN30159882 140 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1369019876 2 dbSNP
rs1328872096 4 dbSNP
rs1464773548 5 dbSNP
rs1400833904 8 dbSNP
rs755196848 9 dbSNP
rs1307776829 12 dbSNP
rs947977281 15 dbSNP
rs999640954 18 dbSNP
rs1377036728 20 dbSNP
rs1176644405 24 dbSNP
rs780173713 25 dbSNP
rs1416282901 29 dbSNP
rs1236363087 31 dbSNP
rs1178333273 32 dbSNP
rs756278857 35 dbSNP
rs1197850413 39 dbSNP
rs370990974 43 dbSNP
rs1011342406 45 dbSNP
rs553669069 46 dbSNP
rs757885167 50 dbSNP
rs534033435 54 dbSNP
rs1048270219 58 dbSNP
rs931015952 61 dbSNP
rs1203772360 62 dbSNP
rs1244924001 63 dbSNP
rs1444960123 66 dbSNP
rs1039531821 68 dbSNP
rs750748434 79 dbSNP
rs1339750150 81 dbSNP
rs1463194501 82 dbSNP
rs1276486687 83 dbSNP
rs911971531 88 dbSNP
rs571561257 93 dbSNP
rs143678442 94 dbSNP
rs929107870 96 dbSNP
rs1343139154 97 dbSNP
rs148928350 99 dbSNP
rs1229861351 109 dbSNP
rs1394310133 114 dbSNP
rs920527543 115 dbSNP
rs779270069 119 dbSNP
rs568841821 126 dbSNP
rs1264861480 133 dbSNP
rs912255890 142 dbSNP
rs985658036 143 dbSNP
rs1253801244 146 dbSNP
rs1430136506 150 dbSNP
rs1193410955 151 dbSNP
rs1422510545 157 dbSNP
rs1177974247 160 dbSNP
rs1409766829 160 dbSNP
rs1406258770 166 dbSNP
rs1302828820 167 dbSNP
rs1466996053 167 dbSNP
rs548991736 171 dbSNP
rs184544913 180 dbSNP
rs560236949 181 dbSNP
rs1216798750 182 dbSNP
rs1312907107 189 dbSNP
rs749908813 189 dbSNP
rs1232414179 193 dbSNP
rs1254216478 200 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Beitzinger M; Peters L; Zhu JY; Kremmer E; et al.
- RNA biology, 2007
MicroRNAs (miRNAs) constitute a class of small non-coding RNAs that regulate gene expression on the level of translation and/or mRNA stability. Mammalian miRNAs associate with members of the Argonaute (Ago) protein family and bind to partially complementary sequences in the 3' untranslated region (UTR) of specific target mRNAs. Computer algorithms based on factors such as free binding energy or sequence conservation have been used to predict miRNA target mRNAs. Based on such predictions, up to one third of all mammalian mRNAs seem to be under miRNA regulation. However, due to the low degree of complementarity between the miRNA and its target, such computer programs are often imprecise and therefore not very reliable. Here we report the first biochemical identification approach of miRNA targets from human cells. Using highly specific monoclonal antibodies against members of the Ago protein family, we co-immunoprecipitate Ago-bound mRNAs and identify them by cloning. Interestingly, most of the identified targets are also predicted by different computer programs. Moreover, we randomly analyzed six different target candidates and were able to experimentally validate five as miRNA targets. Our data clearly indicate that miRNA targets can be experimentally identified from Ago complexes and therefore provide a new tool to directly analyze miRNA function.
LinkOut: [PMID: 17637574]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293T
Location of target site 3'UTR
Tools used in this research MicroInspector , miRanda , PITA , RNAhybrid
Original Description (Extracted from the article) ... "In this paper ...

- Witwer KW; Sisk JM; Gama L; Clements JE, 2010, Journal of immunology (Baltimore, Md. : 1950).

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ucGGAUA---GGACCUAAUGAACUu 5'
            |||:|   :||||:  ||| || 
Target 5' agCCUGUGCCUCUGGG--ACUGGAc 3'
 		1 - 23
Article - Witwer KW; Sisk JM; Gama L; Clements JE
- Journal of immunology (Baltimore, Md. : 1950), 2010
IFN-beta production is an inaugural event in the innate immune response to viral infections, with relatively small fold changes in IFN-beta expression resulting in the activation of important antiviral signaling cascades. In our rapid SIV/macaque model of HIV encephalitis, the virus enters the CNS within 4 d of infection, accompanied by a marked IFN-beta response that wanes as SIV replication is controlled. The centrality of IFN-beta to the innate antiviral response in the CNS combines with the potential inflammatory damage associated with long-term activation of this pathway to suggest that IFN-beta may be subject to regulatory fine-tuning in addition to well-established transcriptional and message stability mechanisms of regulation. In this paper, we present for the first time evidence that microRNAs (miRNAs), including miR-26a, -34a, -145, and let-7b, may directly regulate IFN-beta in human and macaque cells. In primary primate macrophages, the main cell type implicated in HIV and SIV infection in the CNS, specific miRNAs reduce, whereas miRNA inhibitors enhance, IFN-beta protein production. The potential biologic significance of this regulation is supported by evidence of an apparent negative feedback loop, with increased expression of three IFN-beta-regulating miRNAs by primate macrophages exposed to recombinant IFN-beta or stimulated to produce IFN-beta. Thus, miRNAs may contribute significantly to the regulation of IFN-beta in innate immune responses.
LinkOut: [PMID: 20130213]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE38974 Chronic obstructive pulmonary disease 0.472 8.6e-3 0.483 7.2e-3 25 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.52 9.4e-3 -0.561 5.0e-3 20 Click to see details
GSE19536 Breast cancer -0.227 1.2e-2 -0.164 5.2e-2 100 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.663 2.6e-2 0.400 1.4e-1 9 Click to see details
GSE19783 ER- ER- breast cancer -0.196 4.2e-2 -0.092 2.1e-1 79 Click to see details
GSE26953 Aortic valvular endothelial cells 0.352 4.6e-2 0.434 1.7e-2 24 Click to see details
GSE42095 Differentiated embryonic stem cells 0.303 8.0e-2 0.345 5.3e-2 23 Click to see details
GSE14794 Lymphoblastoid cells -0.132 1.1e-1 -0.122 1.3e-1 90 Click to see details
GSE19350 CNS germ cell tumors 0.377 1.1e-1 0.399 9.9e-2 12 Click to see details
GSE32688 Pancreatic cancer -0.159 1.9e-1 -0.083 3.3e-1 32 Click to see details
GSE27834 Pluripotent stem cells 0.224 2.0e-1 0.162 2.7e-1 16 Click to see details
GSE21849 B cell lymphoma 0.158 2.1e-1 0.404 1.5e-2 29 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.155 2.3e-1 -0.173 2.0e-1 25 Click to see details
GSE28260 Renal cortex and medulla -0.205 2.5e-1 -0.242 2.1e-1 13 Click to see details
GSE28544 Breast cancer -0.13 2.7e-1 -0.228 1.4e-1 24 Click to see details
GSE19783 ER+ ER+ breast cancer -0.127 3.0e-1 -0.197 2.0e-1 20 Click to see details
GSE17306 Multiple myeloma 0.074 3.1e-1 0.086 2.8e-1 49 Click to see details
GSE21687 Ependynoma primary tumors 0.054 3.4e-1 -0.017 4.5e-1 64 Click to see details
GSE21032 Prostate cancer -0.039 3.6e-1 0.002 4.9e-1 83 Click to see details
GSE38226 Liver fibrosis -0.017 4.7e-1 -0.373 4.8e-2 21 Click to see details
GSE17498 Multiple myeloma -0.007 4.8e-1 -0.122 2.3e-1 40 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
COAD 0.497 0.11 0.667 0.04 8 Click to see details
UCEC 0.274 0.13 0.074 0.38 19 Click to see details
PAAD 0.662 0.17 0.800 0.1 4 Click to see details
LIHC 0.109 0.23 0.289 0.02 49 Click to see details
KIRP -0.115 0.27 0.058 0.38 32 Click to see details
STAD 0.091 0.31 0.168 0.18 32 Click to see details
BRCA 0.054 0.31 0.043 0.35 84 Click to see details
KICH 0.099 0.32 0.238 0.13 25 Click to see details
CHOL 0.174 0.33 0.350 0.18 9 Click to see details
HNSC -0.067 0.34 -0.021 0.45 42 Click to see details
PRAD -0.059 0.34 0.276 0.03 50 Click to see details
CESC -0.443 0.35 -0.500 0.33 3 Click to see details
THCA -0.031 0.41 0.125 0.17 59 Click to see details
ESCA 0.055 0.44 0.164 0.31 11 Click to see details
LUAD 0.045 0.44 0.280 0.19 12 Click to see details
BLCA -0.031 0.45 0.168 0.25 18 Click to see details
KIRC 0.014 0.45 0.105 0.2 68 Click to see details
LUSC 0.017 0.46 -0.001 0.5 38 Click to see details
PCPG -0.089 0.47 -0.500 0.33 3 Click to see details
PCPG -0.089 0.47 -0.500 0.33 3 Click to see details
PCPG -0.089 0.47 -0.500 0.33 3 Click to see details
449 hsa-miR-26a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000109 HMGA2 high mobility group AT-hook 2 4 5
MIRT000110 HMGA1 high mobility group AT-hook 1 3 5
MIRT000111 CCNE2 cyclin E2 4 2
MIRT000112 CCND2 cyclin D2 5 10
MIRT001021 CDK8 cyclin dependent kinase 8 2 2
MIRT001022 CDC6 cell division cycle 6 3 3
MIRT001039 LIF LIF, interleukin 6 family cytokine 1 2
MIRT001095 PTEN phosphatase and tensin homolog 4 7
MIRT001771 EZH2 enhancer of zeste 2 polycomb repressive complex 2 subunit 5 11
MIRT001772 PLAG1 PLAG1 zinc finger 3 2
MIRT002315 SERBP1 SERPINE1 mRNA binding protein 1 3 3
MIRT002340 SMAD1 SMAD family member 1 4 6
MIRT003212 MAP3K2 mitogen-activated protein kinase kinase kinase 2 3 2
MIRT003213 RB1 RB transcriptional corepressor 1 5 2
MIRT003803 SMAD4 SMAD family member 4 3 3
MIRT003968 MYC MYC proto-oncogene, bHLH transcription factor 2 2
MIRT004338 CTGF connective tissue growth factor 2 2
MIRT004339 STRADB STE20-related kinase adaptor beta 4 4
MIRT004615 IFNB1 interferon beta 1 3 2
MIRT004676 GSK3B glycogen synthase kinase 3 beta 7 10
MIRT005587 CPEB2 cytoplasmic polyadenylation element binding protein 2 3 2
MIRT005588 CPEB3 cytoplasmic polyadenylation element binding protein 3 4 2
MIRT005589 CPEB4 cytoplasmic polyadenylation element binding protein 4 3 2
MIRT005751 GDAP1 ganglioside induced differentiation associated protein 1 3 1
MIRT005920 MTDH metadherin 5 4
MIRT006306 CDK6 cyclin dependent kinase 6 2 1
MIRT006309 CCNE1 cyclin E1 3 2
MIRT006389 ESR1 estrogen receptor 1 1 1
MIRT006711 ABCA1 ATP binding cassette subfamily A member 1 2 1
MIRT006712 ARL4C ADP ribosylation factor like GTPase 4C 2 1
MIRT007177 E2F7 E2F transcription factor 7 2 7
MIRT007347 NOS2 nitric oxide synthase 2 3 2
MIRT007374 IL6 interleukin 6 2 1
MIRT030358 TGFBR2 transforming growth factor beta receptor 2 3 1
MIRT050053 HIST1H4E histone cluster 1 H4 family member e 1 1
MIRT050054 ZNF814 zinc finger protein 814 1 1
MIRT050055 ZNF233 zinc finger protein 233 1 1
MIRT050056 ABCB7 ATP binding cassette subfamily B member 7 1 1
MIRT050057 SCRN1 secernin 1 1 1
MIRT050058 NABP1 nucleic acid binding protein 1 2 8
MIRT050059 FAM20B FAM20B, glycosaminoglycan xylosylkinase 1 1
MIRT050060 ARCN1 archain 1 1 1
MIRT050061 ANO3 anoctamin 3 1 1
MIRT050062 TFAM transcription factor A, mitochondrial 1 1
MIRT050063 FER FER tyrosine kinase 1 1
MIRT050064 HIAT1 major facilitator superfamily domain containing 14A 1 1
MIRT050065 PPP1CC protein phosphatase 1 catalytic subunit gamma 1 1
MIRT050066 SLC35B4 solute carrier family 35 member B4 1 1
MIRT050067 RASA1 RAS p21 protein activator 1 1 1
MIRT050068 COX1 cytochrome c oxidase subunit I 1 1
MIRT050069 MSL3 MSL complex subunit 3 1 1
MIRT050070 GGA2 golgi associated, gamma adaptin ear containing, ARF binding protein 2 1 1
MIRT050071 GIT2 GIT ArfGAP 2 1 1
MIRT050072 DNMT1 DNA methyltransferase 1 1 1
MIRT050073 MFHAS1 malignant fibrous histiocytoma amplified sequence 1 1 1
MIRT050074 UBA2 ubiquitin like modifier activating enzyme 2 1 1
MIRT050075 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT050076 MTRF1 mitochondrial translation release factor 1 1 1
MIRT050077 WBSCR16 RCC1 like 1 1
MIRT050078 NUAK1 NUAK family kinase 1 1 1
MIRT050079 TUT1 terminal uridylyl transferase 1, U6 snRNA-specific 1 1
MIRT050080 PNMA2 paraneoplastic Ma antigen 2 1 1
MIRT050081 ACTL8 actin like 8 1 1
MIRT050082 HSPA8 heat shock protein family A (Hsp70) member 8 1 1
MIRT050083 DHX15 DEAH-box helicase 15 1 1
MIRT050084 TCP1 t-complex 1 1 1
MIRT050085 SLC25A5 solute carrier family 25 member 5 1 1
MIRT050086 LSM14A LSM14A, mRNA processing body assembly factor 1 1
MIRT050087 CAMKV CaM kinase like vesicle associated 1 1
MIRT050088 ALG10B ALG10B, alpha-1,2-glucosyltransferase 1 1
MIRT050089 TYW1 tRNA-yW synthesizing protein 1 homolog 1 1
MIRT050090 RPL13A ribosomal protein L13a 1 1
MIRT050091 AGO1 argonaute 1, RISC catalytic component 1 1
MIRT050092 TXLNG taxilin gamma 1 1
MIRT050093 RAB18 RAB18, member RAS oncogene family 1 1
MIRT050094 RPS27A ribosomal protein S27a 1 1
MIRT050095 RPS26 ribosomal protein S26 1 1
MIRT050096 PIKFYVE phosphoinositide kinase, FYVE-type zinc finger containing 1 1
MIRT050097 TP53INP1 tumor protein p53 inducible nuclear protein 1 1 1
MIRT050098 ZNF703 zinc finger protein 703 1 1
MIRT050099 MTRF1L mitochondrial translational release factor 1 like 1 1
MIRT050100 ZNF506 zinc finger protein 506 1 1
MIRT050101 KCTD5 potassium channel tetramerization domain containing 5 1 1
MIRT050102 CTC1 CST telomere replication complex component 1 1 1
MIRT050103 TKT transketolase 1 1
MIRT050104 LYST lysosomal trafficking regulator 1 1
MIRT050105 FAM134A reticulophagy regulator family member 2 1 1
MIRT050106 NKX2-5 NK2 homeobox 5 1 1
MIRT050107 AURKAIP1 aurora kinase A interacting protein 1 1 1
MIRT050108 ATP1A1 ATPase Na+/K+ transporting subunit alpha 1 1 1
MIRT050109 COASY Coenzyme A synthase 1 1
MIRT050110 CTR9 CTR9 homolog, Paf1/RNA polymerase II complex component 1 1
MIRT050111 COX3 cytochrome c oxidase III 1 1
MIRT050112 ELOVL6 ELOVL fatty acid elongase 6 1 1
MIRT050113 PIGT phosphatidylinositol glycan anchor biosynthesis class T 1 1
MIRT050114 TMCC3 transmembrane and coiled-coil domain family 3 1 1
MIRT050115 ARHGEF1 Rho guanine nucleotide exchange factor 1 1 1
MIRT050116 SHC2 SHC adaptor protein 2 1 1
MIRT050117 PSMA3 proteasome subunit alpha 3 1 1
MIRT050118 PTTG1 pituitary tumor-transforming 1 1 1
MIRT050119 RPS24 ribosomal protein S24 1 1
MIRT050120 SPTBN1 spectrin beta, non-erythrocytic 1 1 1
MIRT050121 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT050122 BTBD3 BTB domain containing 3 1 1
MIRT050123 AHR aryl hydrocarbon receptor 1 1
MIRT050124 EEF1B2 eukaryotic translation elongation factor 1 beta 2 1 1
MIRT050125 MRPL51 mitochondrial ribosomal protein L51 1 1
MIRT050126 SETD2 SET domain containing 2 1 1
MIRT050127 LRP6 LDL receptor related protein 6 1 1
MIRT050128 RHOBTB1 Rho related BTB domain containing 1 1 1
MIRT050129 HIST1H4J histone cluster 1 H4 family member j 1 1
MIRT050130 MYO10 myosin X 1 1
MIRT050131 ATP7B ATPase copper transporting beta 1 1
MIRT050132 CSRP2BP lysine acetyltransferase 14 1 1
MIRT050133 RBM39 RNA binding motif protein 39 1 1
MIRT050134 C14orf37 chromosome 14 open reading frame 37 2 3
MIRT050135 SFMBT1 Scm like with four mbt domains 1 1 1
MIRT050136 KIAA1704 GPALPP motifs containing 1 1 1
MIRT050137 ABCB9 ATP binding cassette subfamily B member 9 1 1
MIRT050138 ADM adrenomedullin 2 11
MIRT050139 USP7 ubiquitin specific peptidase 7 1 1
MIRT050140 TTN titin 1 1
MIRT050141 HNRNPU heterogeneous nuclear ribonucleoprotein U 1 1
MIRT050142 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon 1 1
MIRT050143 CEPT1 choline/ethanolamine phosphotransferase 1 1 1
MIRT050144 HOXC8 homeobox C8 1 1
MIRT050145 CTBP1 C-terminal binding protein 1 1 1
MIRT050146 SET SET nuclear proto-oncogene 1 1
MIRT050147 MCM3AP minichromosome maintenance complex component 3 associated protein 1 1
MIRT050148 TPGS2 tubulin polyglutamylase complex subunit 2 1 1
MIRT050149 CA2 carbonic anhydrase 2 1 1
MIRT050150 PCYT1A phosphate cytidylyltransferase 1, choline, alpha 1 1
MIRT050151 ACTN4 actinin alpha 4 1 1
MIRT050152 EPG5 ectopic P-granules autophagy protein 5 homolog 1 1
MIRT050153 OLA1 Obg like ATPase 1 1 1
MIRT050154 RRM2 ribonucleotide reductase regulatory subunit M2 1 1
MIRT050155 BBX BBX, HMG-box containing 1 1
MIRT050156 NUP205 nucleoporin 205 1 1
MIRT050157 C6orf47 chromosome 6 open reading frame 47 1 1
MIRT050158 CFLAR CASP8 and FADD like apoptosis regulator 1 1
MIRT050159 SEC31A SEC31 homolog A, COPII coat complex component 1 1
MIRT050160 GLG1 golgi glycoprotein 1 1 1
MIRT050161 TBC1D16 TBC1 domain family member 16 1 1
MIRT050162 BTBD9 BTB domain containing 9 1 1
MIRT050163 RND2 Rho family GTPase 2 1 1
MIRT050164 TUBG1 tubulin gamma 1 1 1
MIRT050165 AHRR aryl-hydrocarbon receptor repressor 1 1
MIRT050166 CNTD2 cyclin N-terminal domain containing 2 1 1
MIRT050167 UBE2A ubiquitin conjugating enzyme E2 A 1 1
MIRT050168 CCDC43 coiled-coil domain containing 43 1 1
MIRT050169 MSH6 mutS homolog 6 1 1
MIRT050170 HIST4H4 histone cluster 4 H4 1 1
MIRT050171 C17orf51 chromosome 17 open reading frame 51 1 1
MIRT050172 SLC25A30 solute carrier family 25 member 30 1 1
MIRT050173 USB1 U6 snRNA biogenesis phosphodiesterase 1 1 1
MIRT050174 MYH10 myosin heavy chain 10 1 1
MIRT050175 LINS lines homolog 1 1 1
MIRT050176 UBR4 ubiquitin protein ligase E3 component n-recognin 4 1 2
MIRT050177 ZNF207 zinc finger protein 207 1 1
MIRT050178 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 1
MIRT050179 TXNL1 thioredoxin like 1 1 1
MIRT050180 FOXO3 forkhead box O3 1 1
MIRT050181 COPB1 coatomer protein complex subunit beta 1 1 1
MIRT050182 FASN fatty acid synthase 1 1
MIRT050183 SARS seryl-tRNA synthetase 1 1
MIRT050184 DDB1 damage specific DNA binding protein 1 1 1
MIRT050185 PPIA peptidylprolyl isomerase A 1 1
MIRT050186 SLC35A4 solute carrier family 35 member A4 1 1
MIRT050187 TXNDC11 thioredoxin domain containing 11 1 1
MIRT050188 HIST2H2AA3 histone cluster 2 H2A family member a3 1 1
MIRT050189 TRAP1 TNF receptor associated protein 1 1 1
MIRT050190 SDCBP syndecan binding protein 1 1
MIRT050191 ASCC2 activating signal cointegrator 1 complex subunit 2 1 1
MIRT050192 KDM5C lysine demethylase 5C 1 1
MIRT050193 DST dystonin 1 1
MIRT050194 CLIC4 chloride intracellular channel 4 1 1
MIRT050195 WWP2 WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT050196 ATP5A1 ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle 1 1
MIRT050197 RPL13 ribosomal protein L13 1 1
MIRT050198 CNBP CCHC-type zinc finger nucleic acid binding protein 1 1
MIRT052649 MCL1 MCL1, BCL2 family apoptosis regulator 1 1
MIRT052903 CHD1 chromodomain helicase DNA binding protein 1 2 1
MIRT053077 CKS2 CDC28 protein kinase regulatory subunit 2 4 3
MIRT053097 PRKCD protein kinase C delta 4 2
MIRT053251 BAG4 BCL2 associated athanogene 4 2 1
MIRT053574 FGF9 fibroblast growth factor 9 3 1
MIRT054062 ACVR1 activin A receptor type 1 2 1
MIRT054415 AMACR alpha-methylacyl-CoA racemase 3 1
MIRT054432 ATM ATM serine/threonine kinase 3 1
MIRT054484 RCBTB1 RCC1 and BTB domain containing protein 1 3 1
MIRT054645 HGF hepatocyte growth factor 3 1
MIRT054676 LIN28B lin-28 homolog B 3 1
MIRT054677 ZCCHC11 zinc finger CCHC-type containing 11 3 1
MIRT060004 VANGL2 VANGL planar cell polarity protein 2 2 4
MIRT062177 WNK1 WNK lysine deficient protein kinase 1 2 2
MIRT064905 ZBTB18 zinc finger and BTB domain containing 18 2 6
MIRT066809 ZDHHC18 zinc finger DHHC-type containing 18 2 3
MIRT067540 METAP2 methionyl aminopeptidase 2 1 1
MIRT072092 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 5
MIRT072125 RTF1 RTF1 homolog, Paf1/RNA polymerase II complex component 1 1
MIRT073375 ABHD2 abhydrolase domain containing 2 1 1
MIRT075111 C16ORF70 chromosome 16 open reading frame 70 2 5
MIRT080605 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 2 8
MIRT085205 SLC5A3 solute carrier family 5 member 3 2 2
MIRT086007 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 2 2
MIRT087899 TNRC6B trinucleotide repeat containing 6B 2 5
MIRT089450 TET3 tet methylcytosine dioxygenase 3 2 3
MIRT089599 MAT2A methionine adenosyltransferase 2A 2 11
MIRT090517 SLC25A36 solute carrier family 25 member 36 2 2
MIRT097631 POLR3G RNA polymerase III subunit G 1 1
MIRT118410 DNMT3B DNA methyltransferase 3 beta 4 1
MIRT122040 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 1
MIRT133477 EP400 E1A binding protein p400 1 1
MIRT134087 KLHL42 kelch like family member 42 1 1
MIRT136529 KPNA6 karyopherin subunit alpha 6 1 1
MIRT137414 RLF rearranged L-myc fusion 1 1
MIRT137577 RCOR1 REST corepressor 1 1 1
MIRT137722 EIF5 eukaryotic translation initiation factor 5 1 1
MIRT147274 KPNA2 karyopherin subunit alpha 2 2 10
MIRT151691 CHAF1A chromatin assembly factor 1 subunit A 1 1
MIRT156734 FAM126B family with sequence similarity 126 member B 2 2
MIRT159273 RASGRP3 RAS guanyl releasing protein 3 1 1
MIRT166022 SFXN1 sideroflexin 1 1 1
MIRT166592 ZSWIM6 zinc finger SWIM-type containing 6 1 1
MIRT168865 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT168937 IRF4 interferon regulatory factor 4 1 1
MIRT169515 TTK TTK protein kinase 1 1
MIRT169560 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT170138 KLHDC10 kelch domain containing 10 1 1
MIRT175075 DCAF10 DDB1 and CUL4 associated factor 10 1 1
MIRT183141 WEE1 WEE1 G2 checkpoint kinase 2 1
MIRT187790 ANKRD52 ankyrin repeat domain 52 1 1
MIRT191753 ZNF410 zinc finger protein 410 2 2
MIRT193070 MAPK6 mitogen-activated protein kinase 6 2 2
MIRT193726 USP3 ubiquitin specific peptidase 3 1 1
MIRT203408 DYRK1A dual specificity tyrosine phosphorylation regulated kinase 1A 1 1
MIRT206543 RHOQ ras homolog family member Q 2 2
MIRT210981 TET2 tet methylcytosine dioxygenase 2 1 1
MIRT213685 PTPN13 protein tyrosine phosphatase, non-receptor type 13 3 1
MIRT215349 CREBRF CREB3 regulatory factor 2 2
MIRT227685 TBC1D13 TBC1 domain family member 13 2 2
MIRT243962 MAP1B microtubule associated protein 1B 2 2
MIRT250410 TNRC6A trinucleotide repeat containing 6A 2 7
MIRT262152 OTUD1 OTU deubiquitinase 1 1 1
MIRT277212 AKIRIN1 akirin 1 2 2
MIRT286389 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 3
MIRT308147 PDE12 phosphodiesterase 12 2 2
MIRT319694 UBN2 ubinuclein 2 2 3
MIRT327077 KLHL15 kelch like family member 15 2 10
MIRT346489 SSX2IP SSX family member 2 interacting protein 1 1
MIRT438130 ADAM17 ADAM metallopeptidase domain 17 6 3
MIRT438159 PIK3C2A phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha 1 1
MIRT438209 CHEK1 checkpoint kinase 1 2 1
MIRT438638 TDG thymine DNA glycosylase 1 1
MIRT438656 PHB prohibitin 3 1
MIRT444707 ZNF772 zinc finger protein 772 2 2
MIRT448615 OTUD4 OTU deubiquitinase 4 2 2
MIRT451358 UQCR11 ubiquinol-cytochrome c reductase, complex III subunit XI 2 2
MIRT457292 ZBTB45 zinc finger and BTB domain containing 45 2 2
MIRT458763 CES2 carboxylesterase 2 2 2
MIRT458855 CD55 CD55 molecule (Cromer blood group) 2 2
MIRT460261 SLC26A2 solute carrier family 26 member 2 2 2
MIRT461702 ZNF426 zinc finger protein 426 2 2
MIRT465730 TMTC3 transmembrane and tetratricopeptide repeat containing 3 2 2
MIRT466688 TAF13 TATA-box binding protein associated factor 13 2 4
MIRT468541 SERP1 stress associated endoplasmic reticulum protein 1 2 2
MIRT468809 SACS sacsin molecular chaperone 2 11
MIRT470198 PSAT1 phosphoserine aminotransferase 1 2 6
MIRT476009 GTF2A1 general transcription factor IIA subunit 1 2 8
MIRT477228 ETF1 eukaryotic translation termination factor 1 2 4
MIRT477752 EDEM3 ER degradation enhancing alpha-mannosidase like protein 3 2 2
MIRT478346 DDIT4 DNA damage inducible transcript 4 2 2
MIRT478525 CTNS cystinosin, lysosomal cystine transporter 2 2
MIRT480793 BLOC1S2 biogenesis of lysosomal organelles complex 1 subunit 2 2 6
MIRT482242 AGPAT5 1-acylglycerol-3-phosphate O-acyltransferase 5 2 2
MIRT486465 MDM2 MDM2 proto-oncogene 2 10
MIRT487561 LOXL2 lysyl oxidase like 2 2 2
MIRT498663 ZNF664 zinc finger protein 664 2 8
MIRT499509 RNF6 ring finger protein 6 2 6
MIRT502456 FRAT2 FRAT2, WNT signaling pathway regulator 2 6
MIRT502713 CREBZF CREB/ATF bZIP transcription factor 2 6
MIRT502853 CHEK2 checkpoint kinase 2 2 6
MIRT507558 DEPDC1 DEP domain containing 1 2 6
MIRT524742 BRCA1 BRCA1, DNA repair associated 2 2
MIRT527178 LRRTM4 leucine rich repeat transmembrane neuronal 4 2 2
MIRT527909 B3GALT5 beta-1,3-galactosyltransferase 5 2 2
MIRT532895 ZNF451 zinc finger protein 451 2 2
MIRT533588 TOB1 transducer of ERBB2, 1 2 7
MIRT534368 SETD8 lysine methyltransferase 5A 2 4
MIRT535060 PPP2R5D protein phosphatase 2 regulatory subunit B'delta 2 4
MIRT536204 MAD2L1 mitotic arrest deficient 2 like 1 2 2
MIRT537233 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 2 2
MIRT539774 KIAA0408 KIAA0408 2 6
MIRT540867 ZBTB24 zinc finger and BTB domain containing 24 2 2
MIRT541042 SOGA3 SOGA family member 3 2 6
MIRT541350 DDX3X DEAD-box helicase 3, X-linked 2 2
MIRT544949 TUB tubby bipartite transcription factor 2 4
MIRT545809 ZNF608 zinc finger protein 608 2 2
MIRT547008 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 2
MIRT551188 EPB41L3 erythrocyte membrane protein band 4.1 like 3 2 2
MIRT551973 TMEM19 transmembrane protein 19 2 2
MIRT552044 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 2 2
MIRT553325 TSC22D2 TSC22 domain family member 2 2 2
MIRT554367 SFPQ splicing factor proline and glutamine rich 2 2
MIRT555741 PDCD10 programmed cell death 10 2 2
MIRT556346 MAN2A1 mannosidase alpha class 2A member 1 2 3
MIRT560389 TMEM254 transmembrane protein 254 2 2
MIRT560465 SMIM9 small integral membrane protein 9 2 2
MIRT561122 ATP2B1 ATPase plasma membrane Ca2+ transporting 1 2 2
MIRT562626 ARNTL2 aryl hydrocarbon receptor nuclear translocator like 2 2 2
MIRT564084 NSA2 NSA2, ribosome biogenesis homolog 2 2
MIRT564207 SDE2 SDE2 telomere maintenance homolog 2 2
MIRT565191 TSHZ1 teashirt zinc finger homeobox 1 2 2
MIRT567887 CSTF2 cleavage stimulation factor subunit 2 2 2
MIRT568259 BMP2K BMP2 inducible kinase 2 2
MIRT568505 ARF1 ADP ribosylation factor 1 2 2
MIRT572178 CDV3 CDV3 homolog 2 2
MIRT574711 HAUS8 HAUS augmin like complex subunit 8 2 3
MIRT610597 NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit 2 2
MIRT614445 WDR92 WD repeat domain 92 2 2
MIRT615442 FAXC failed axon connections homolog 2 2
MIRT618503 HSPD1 heat shock protein family D (Hsp60) member 1 2 2
MIRT618903 CDK9 cyclin dependent kinase 9 2 2
MIRT620083 TNFAIP8L1 TNF alpha induced protein 8 like 1 2 2
MIRT620286 GLTP glycolipid transfer protein 2 2
MIRT622464 RNF11 ring finger protein 11 2 2
MIRT624644 ASXL3 additional sex combs like 3, transcriptional regulator 2 2
MIRT624697 AQR aquarius intron-binding spliceosomal factor 2 2
MIRT625256 ZNF566 zinc finger protein 566 2 2
MIRT628258 EFCAB14 EF-hand calcium binding domain 14 2 2
MIRT628872 FAM177A1 family with sequence similarity 177 member A1 2 2
MIRT630720 FPR1 formyl peptide receptor 1 2 2
MIRT631887 SLFN13 schlafen family member 13 2 2
MIRT637716 MYOZ3 myozenin 3 2 2
MIRT639892 SSR3 signal sequence receptor subunit 3 2 2
MIRT642506 ORC6 origin recognition complex subunit 6 2 2
MIRT644723 SEPT14 septin 14 2 2
MIRT645341 AGTPBP1 ATP/GTP binding protein 1 2 2
MIRT648886 TUBGCP5 tubulin gamma complex associated protein 5 2 2
MIRT653565 SLC35B3 solute carrier family 35 member B3 2 2
MIRT656095 MTA3 metastasis associated 1 family member 3 2 2
MIRT660204 BMPR1A bone morphogenetic protein receptor type 1A 2 2
MIRT660753 ALDH6A1 aldehyde dehydrogenase 6 family member A1 2 2
MIRT661379 RHCG Rh family C glycoprotein 2 2
MIRT662310 ADM2 adrenomedullin 2 2 2
MIRT662628 MCM8 minichromosome maintenance 8 homologous recombination repair factor 2 2
MIRT663688 ZNF347 zinc finger protein 347 2 2
MIRT665109 FKTN fukutin 2 2
MIRT665262 ZKSCAN1 zinc finger with KRAB and SCAN domains 1 2 2
MIRT666273 SLC31A1 solute carrier family 31 member 1 2 2
MIRT666646 RBM48 RNA binding motif protein 48 2 2
MIRT667511 LUC7L2 LUC7 like 2, pre-mRNA splicing factor 2 2
MIRT669228 C7orf55-LUC7L2 C7orf55-LUC7L2 readthrough 2 2
MIRT669271 C1orf50 chromosome 1 open reading frame 50 2 2
MIRT671783 RGS17 regulator of G protein signaling 17 2 2
MIRT672379 RPL37 ribosomal protein L37 2 2
MIRT673464 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 2
MIRT673600 HPSE heparanase 2 4
MIRT676269 NWD1 NACHT and WD repeat domain containing 1 2 2
MIRT676514 RNF216 ring finger protein 216 2 2
MIRT676653 LRRC27 leucine rich repeat containing 27 2 2
MIRT677335 PHAX phosphorylated adaptor for RNA export 2 2
MIRT677523 OCIAD2 OCIA domain containing 2 2 2
MIRT677548 C19orf52 translocase of inner mitochondrial membrane 29 2 2
MIRT677724 SSR1 signal sequence receptor subunit 1 2 2
MIRT677800 PNPLA3 patatin like phospholipase domain containing 3 2 2
MIRT677885 DCP1A decapping mRNA 1A 2 2
MIRT678104 MICA MHC class I polypeptide-related sequence A 2 2
MIRT678431 PDE4C phosphodiesterase 4C 2 2
MIRT678488 ARHGEF39 Rho guanine nucleotide exchange factor 39 2 2
MIRT678898 TTLL12 tubulin tyrosine ligase like 12 2 2
MIRT679296 SSBP2 single stranded DNA binding protein 2 2 2
MIRT679572 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 2 2
MIRT680003 ZNF860 zinc finger protein 860 2 2
MIRT694963 PLAC8 placenta specific 8 2 2
MIRT697861 UBE2H ubiquitin conjugating enzyme E2 H 2 2
MIRT698310 TMEM2 transmembrane protein 2 2 2
MIRT701712 MTMR12 myotubularin related protein 12 2 2
MIRT705964 ACBD5 acyl-CoA binding domain containing 5 2 2
MIRT714342 DIP2A disco interacting protein 2 homolog A 2 2
MIRT715309 POLR2E RNA polymerase II subunit E 2 2
MIRT717477 PDE4DIP phosphodiesterase 4D interacting protein 2 2
MIRT719604 PRKX protein kinase, X-linked 2 2
MIRT724483 CSNK1A1 casein kinase 1 alpha 1 2 2
MIRT726021 ZNF680 zinc finger protein 680 1 1
MIRT726041 ZNF254 zinc finger protein 254 1 1
MIRT726096 WNT5A Wnt family member 5A 1 1
MIRT726288 TMEM30A transmembrane protein 30A 1 1
MIRT726312 TMCC1 transmembrane and coiled-coil domain family 1 1 1
MIRT726446 SSH2 slingshot protein phosphatase 2 1 1
MIRT726486 SMEK1 protein phosphatase 4 regulatory subunit 3A 1 1
MIRT726514 SLC7A1 solute carrier family 7 member 1 1 1
MIRT726535 SLC38A2 solute carrier family 38 member 2 1 1
MIRT726657 SASS6 SAS-6 centriolar assembly protein 1 1
MIRT726778 REEP4 receptor accessory protein 4 1 1
MIRT726937 PIK3R4 phosphoinositide-3-kinase regulatory subunit 4 1 1
MIRT726989 PDE4B phosphodiesterase 4B 1 1
MIRT727060 NUDT19 nudix hydrolase 19 1 1
MIRT727062 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 1
MIRT727485 HSPA13 heat shock protein family A (Hsp70) member 13 1 1
MIRT727488 HNRNPA0 heterogeneous nuclear ribonucleoprotein A0 1 1
MIRT727508 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT727675 FBXO11 F-box protein 11 1 1
MIRT727780 ELAVL2 ELAV like RNA binding protein 2 1 1
MIRT727786 EIF4G2 eukaryotic translation initiation factor 4 gamma 2 1 1
MIRT727793 EHD1 EH domain containing 1 1 1
MIRT727863 DNMBP dynamin binding protein 1 1
MIRT727903 DCTN4 dynactin subunit 4 1 1
MIRT727941 CPSF2 cleavage and polyadenylation specific factor 2 1 1
MIRT727966 COX5A cytochrome c oxidase subunit 5A 1 1
MIRT728000 CHORDC1 cysteine and histidine rich domain containing 1 3 1
MIRT728203 BID BH3 interacting domain death agonist 1 1
MIRT728213 BCL7B BCL tumor suppressor 7B 1 1
MIRT728306 ARPP19 cAMP regulated phosphoprotein 19 1 1
MIRT728331 AP1S3 adaptor related protein complex 1 sigma 3 subunit 1 1
MIRT728396 ACSL3 acyl-CoA synthetase long chain family member 3 1 1
MIRT731168 ITGA5 integrin subunit alpha 5 2 1
MIRT731390 DUSP4 dual specificity phosphatase 4 3 1
MIRT732062 NRAS NRAS proto-oncogene, GTPase 3 1
MIRT732063 E2F2 E2F transcription factor 2 3 1
MIRT732182 PTGS2 prostaglandin-endoperoxide synthase 2 6 2
MIRT732280 JAG1 jagged 1 3 1
MIRT732490 NRP1 neuropilin 1 1 0
MIRT732621 MS multiple sclerosis 1 0
MIRT733344 CREB1 cAMP responsive element binding protein 1 4 0
MIRT733365 ADIPOQ adiponectin, C1Q and collagen domain containing 1 0
MIRT733699 NORAD non-coding RNA activated by DNA damage 2 0
MIRT733700 UBE3A ubiquitin protein ligase E3A 2 0
MIRT733702 CCND1 cyclin D1 2 0
MIRT733703 TGFBR1 transforming growth factor beta receptor 1 2 0
MIRT734551 SHC4 SHC adaptor protein 4 2 0
MIRT734552 PFDN4 prefoldin subunit 4 2 0
MIRT734721 CD38 CD38 molecule 3 0
MIRT736775 MAP2 microtubule associated protein 2 2 0
MIRT736838 USP35 ubiquitin specific peptidase 35 2 0
MIRT736852 EIF2A eukaryotic translation initiation factor 2A 2 0
MIRT737078 ULK1 unc-51 like autophagy activating kinase 1 3 0
MIRT737079 SNHG6 small nucleolar RNA host gene 6 3 0
MIRT737091 ULK2 unc-51 like autophagy activating kinase 2 3 0
MIRT737491 FLI1 Fli-1 proto-oncogene, ETS transcription factor 2 0
MIRT755414 NEK6 NIMA related kinase 6 3 1
MIRT755509 ICAM1 intercellular adhesion molecule 1 1 1
MIRT755687 RUNX2 runt related transcription factor 2 3 1
MIRT755688 SPP1 secreted phosphoprotein 1 3 1
MIRT755689 ALPL alkaline phosphatase, liver/bone/kidney 3 1
MIRT756239 NEAT1 nuclear paraspeckle assembly transcript 1 (non-protein coding) 2 1
MIRT756240 FANCE Fanconi anemia complementation group E 3 1
MIRT756287 ZBTB7C zinc finger and BTB domain containing 7C 3 1
MIRT756352 PLCB1 phospholipase C beta 1 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-26a Hydroxamic acid HDACi LAQ824 NULL NULL Microarray breast cancer cell line SKBr3 16452179 2006 down-regulated
miR-26a Curcumin NULL 969516 Microarray BxPC-3 human pancreatic carcinoma cell line 18347134 2008 down-regulated
miR-26a Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 down-regulated
miR-26a Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 up-regulated
miR-26a Morphine approved 5288826 Microarray human monocyte-derived macrophages (h-mdms) infection with HIV-1 20564181 2010 down-regulated
miR-26a Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-26a Enoxacin approved 3229 Quantitative real-time PCR HCT-116 and RKO colon cancer cell lines 21368194 2011 up-regulated
miR-26a Metformin approved 4091 Quantitative real-time PCR pancreatic cancer cells 22086681 2012 up-regulated
miR-26a Metformin approved 4091 Quantitative real-time PCR pancreatic cancer cells 22086681 2012 up-regulated
miR-26a Tamoxifen approved 2733526 Quantitative real-time PCR breast cancer 22094936 2012 up-regulated
miR-26a CDF(analogues of curcumin) NULL NULL Quantitative real-time PCR pancreatic cancer cells 22108826 2012 up-regulated
miR-26a Metformin approved 4091 Quantitative real-time PCR Pancreatic Neoplasms 22245693 2012 up-regulated
miR-26a Trastuzumab approved NULL Microarray HER2-positive breast cancer 22384020 2012 up-regulated
miR-26a Trastuzumab approved NULL Quantitative real-time PCR HER2-positive breast cancer 22384020 2012 up-regulated
miR-26a 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-26a 5-aminoimidazole-4-carboxamide-1-β-d-ribofuranoside (AICAR) NULL 16078949 Microarray hepatocytes 23107762 2013 down-regulated
miR-26a Sevoflurane approved 5206 Quantitative real-time PCR lung cell 23124245 2012 down-regulated
miR-26a Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse liver 19270793 2009 up-regulated
miR-26a Budesonide approved 5281004 Microarray neonatal mice liver 20145010 2010 up-regulated
miR-26a Phenethyl isothiocyanate(PEITC) NULL 16741 Microarray neonatal mice liver 20145010 2010 up-regulated
miR-26a Atorvastatin approved 60823 Quantitative real-time PCR Cardiomyocyte 23860036 2013 down-regualted
miR-26a Nicotine approved 89594 Microarray Rat adrenal pheochromocytoma PC12 cell 18845019 2009 up-regulated
miR-26a Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 down-regulated
miR-26a Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-26a Marine fungal metabolite 1386A NULL NULL Microarray MCF-7 breast cancer cells. 22159329 2012 up-regulated
miR-26a Trastuzumab approved NULL Microarray BT474 cells 22384020 2012 up-regulated
miR-26a Trastuzumab approved NULL Microarray SKBR3 cells. 22384020 2012 up-regulated
miR-26a Vitamin D3 approved 5280795 Quantitative real-time PCR Plasma 22594500 2012 up-regulated
miR-26a Vitamin D3 approved 5280795 Quantitative real-time PCR Plasma 22594500 2012 up-regulated
miR-26a Temozolomide approved 5394 Quantitative real-time PCR glioblastoma cells. 22722712 2012 down-regulated
miR-26a Phenethyl isothiocyanate(PEITC) NULL 16741 Microarray neonatal mice liver 20145010 2010 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-26a-5p [(1R,2R,3E,7S,11E,13S,15S)-15-hydroxy-7-methyl-5-oxo-6-oxabicyclo[11.3.0]hexadeca-3,11-dien-2-yl] (2R)-2-(dimethylamino)-3-methylbutanoate;hydrochloride 45028997 NSC745103 resistant
hsa-miR-26a-5p 1-[(E)-[phenyl(pyridin-2-yl)methylidene]amino]-3-(2-pyridin-2-ylethyl)thiourea 9571616 NSC689531 sensitive
hsa-miR-26a-5p 1-[phenyl(2-pyridinyl)methylene]-4-(2-methylphenyl)thiosemicarbazide 6148953 NSC668326 sensitive
hsa-miR-26a-5p 1-cyclohexyl-3-[(e)-[phenyl(2-pyridyl)methylene]amino]urea 6179448 NSC689539 sensitive
hsa-miR-26a-5p 2',6'-dibromospiro[7,8-dihydro-6h-pyrido[2,3-g]quinoline-9,4'-cyclohexa-2,5-diene]-1',5,10-trione 383051 NSC671095 resistant
hsa-miR-26a-5p 2-hydroxy-N-[(E)-1-[6-[(E)-N-[(2-hydroxybenzoyl)amino]-C-methylcarbonimidoyl]pyridin-2-yl]ethylideneamino]benzamide 5779747 NSC617573 sensitive
hsa-miR-26a-5p 2,7-dicyanoxanthone 363841 NSC629107 resistant
hsa-miR-26a-5p 3-[(Z)-[phenyl(pyridin-2-yl)methylidene]amino]-1,1-bis(pyridin-2-ylmethyl)thiourea 5466413 NSC689533 sensitive
hsa-miR-26a-5p 3-imino-n-(4-methylphenyl)-5-(methylthio)-1-phenyl-2,3-dihydro-1h-pyrazole-4-carboxamide 390314 NSC687606 resistant
hsa-miR-26a-5p 3,5,12,14-tetrabutyl-7,10-dithia-8,9-diselena-3,5,12,14-tetrazatricyclo[9.3.0.02,6]tetradeca-1(11),2(6)-diene-4,13-diselone 395765 NSC700584 sensitive
hsa-miR-26a-5p 4-amino-2-(4-chloroanilino)-5-(4-methylbenzoyl)-n-phenyl-1h-pyrrole-3-carbothioamide 5472799 NSC721554 resistant
hsa-miR-26a-5p 4-amino-8-chloro-2-(4-chlorophenyl)iminopyrimido[2,1-b][1,3]benzothiazole-3-carbonitrile 45029233 NSC745678 resistant
hsa-miR-26a-5p 5-chloro-N-[(E)-[phenyl(pyridin-2-yl)methylidene]amino]pyridin-2-amine 6519698 NSC693627 sensitive
hsa-miR-26a-5p 5-chloro-n-[(e)-1-pyridin-2-ylethylideneamino]-1,3-benzothiazol-2-amine 9572096 NSC703111 sensitive
hsa-miR-26a-5p 5-fluoro-n-[(e)-1-pyridin-2-ylethylideneamino]-1,3-benzothiazol-2-amine 9572046 NSC693634 sensitive
hsa-miR-26a-5p 5-nitro-n-[(e)-[phenyl(pyridin-2-yl)methylidene]amino]pyridin-2-amine 6519692 NSC693620 sensitive
hsa-miR-26a-5p 7-[3,4-dihydroxy-5-(hydroxymethyl)tetrahydrofuran-2-yl]-3h-thieno[3,4-d]pyrimidine-4-thione 3005067 NSC670036 sensitive
hsa-miR-26a-5p 9-[(2e)-2-(4-chlorophenyl)-2-hydroxyiminoethoxy]chromeno[3,4-b]chromene-6,12-dione 9572588 NSC721045 resistant
hsa-miR-26a-5p 9-acridinamine, n-(4-ethoxyphenyl)-, monohydrochloride 2788193 NSC165714 resistant
hsa-miR-26a-5p Crambescidin 800 trihydrochloride 400719 NSC713155 resistant
hsa-miR-26a-5p Crotonosid 223996 NSC12161 sensitive
hsa-miR-26a-5p Cryptophycin b 5468424 NSC670038 resistant
hsa-miR-26a-5p Laurusin 135476719 NSC106486 sensitive
hsa-miR-26a-5p N'-(2-hydroxy-5-(hydroxy(oxido)amino)benzylidene)-1-piperidinecarbothiohydrazide 135484941 NSC689530 sensitive
hsa-miR-26a-5p N-(2-hydroxy-5-methylphenyl)-4-[[[2-(trifluoromethyl)pyridin-4-yl]amino]methyl]benzamide 54613415 NSC748715 sensitive
hsa-miR-26a-5p N-[(e)-[(4-methoxyphenyl)-pyridin-2-ylmethylidene]amino]pyridin-2-amine 9630043 NSC693622 sensitive
hsa-miR-26a-5p N-[(e)-1-pyrimidin-2-ylethylideneamino]-1,3-benzothiazol-2-amine 9572048 NSC693636 sensitive
hsa-miR-26a-5p N,N'-bis[5-[[5-[(3-amino-3-iminopropyl)carbamoyl]-1-methylpyrrol-3-yl]carbamoyl]-1-methylpyrrol-3-yl]butanediamide;hydrochloride 367397 NSC637124 resistant
hsa-miR-26a-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-26a-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-26a-5p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-26a-5p Docetaxel 148124 NSC628503 approved resistant Low Lung Cancer tissue
hsa-miR-26a-5p Docetaxel 148124 NSC628503 approved resistant Low Gastric Cancer tissue
hsa-miR-26a-5p Fluorouracil 3385 NSC19893 approved resistant High Colon Cancer cell line (KM12C)
hsa-miR-26a-5p Paclitaxel 36314 NSC125973 approved sensitive Low Breast Cancer cell line (MDA-MB-231, MCF-7, MDA-MB-435, MDA-MB-468, MCF-10A, 184A1)
hsa-miR-26a-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (RKO)
hsa-miR-26a-5p Imatinib 5291 NSC743414 approved sensitive High Chronic Myeloid Leukemia tissue
hsa-miR-26a-5p Platinum-based doublet chemotherapy resistant High Lung Adenocarcinoma tissue
hsa-miR-26a-5p Cisplatin 5460033 NSC119875 approved resistant Low Ovarian Cancer tissue
hsa-miR-26a-5p Cetuximab resistant High Colon Cancer cell line
hsa-miR-26a-5p Cisplatin 5460033 NSC119875 approved sensitive Low Gastric Cancer cell line (SGC7901)
hsa-miR-26a-5p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-26a-5p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-26a-5p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-26a-5p Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-26a-5p Mitoxantrone 4212 NSC279836 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-26a-5p Imatinib 5291 NSC743414 approved resistant High Gastrointestinal Stromal Tumor cell line (882R-NC, 882R-OE, 882R-KD)
hsa-miR-26a-5p Gefitinib 123631 NSC715055 approved resistant Low Non-Small Cell Lung Cancer cell line (A549, H520, SW900, H2170, PC-9)
hsa-miR-26a-5p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-miR-26a-5p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (TAMR4)
hsa-miR-26a-5p Doxorubicin 31703 NSC123127 approved sensitive Low Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-26a-5p Trastuzumab sensitive Low HER2-Positive Breast Cancer cell line (BT-474, HCC1954)
hsa-miR-26a-5p Fluorouracil 3385 NSC19893 approved sensitive High Colorectal Cancer cell line (DLD-1)
hsa-miR-26a-5p Docetaxel 148124 NSC628503 approved sensitive Low Lung Adenocarcinoma tissue and cell line (SPC-A1, H1299)
hsa-miR-26a-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-26a-5p Daunorubicin 30323 NSC82151 approved resistant High Acute Promyelocytic Leukemia cell line (HL60)
hsa-miR-26a-5p Tamoxifen 2733525 NSC180973 approved sensitive Low ER-Positive Breast Cancer cell line (MCF-7, T47D)
hsa-miR-26a-5p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (PC-3-R)
hsa-miR-26a-5p Temozolomide 5394 NSC362856 approved resistant Low Glioblastoma cell line (U87MG, HEK293T)
hsa-miR-26a-5p Doxorubicin 31703 NSC123127 approved sensitive Low Hepatocellular Carcinoma cell line (Huh-7, SMMC-7721)
hsa-miR-26a-5p Dabrafenib 44462760 NSC764134 approved sensitive Low Melanoma cell line (A375 , MEL624)
hsa-miR-26a-5p Paclitaxel 36314 NSC125973 approved sensitive Low Osteosarcoma cell line (U-2-OS)
hsa-miR-26a-5p Bortezomib 387447 NSC681239 approved sensitive Low Multiple Myeloma cell line (RPMI8226, MM.1S, H929)
hsa-miR-26a-5p Melphalan 460612 NSC8806 approved sensitive Low Multiple Myeloma cell line (RPMI8226, MM.1S, H929)
hsa-miR-26a-5p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Ductal Adenocarcinoma tissue
hsa-miR-26a-5p Paclitaxel 36314 NSC125973 approved sensitive High Endometrial Serous Carcinoma cell line (USPC1)
hsa-miR-26a-5p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer tissue
hsa-miR-26a-5p Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780CP20)
hsa-miR-26a-5p Cetuximab sensitive Low Endometrial Cancer cell line (HEC-1A, RL-952)
hsa-miR-26a-5p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-miR-26a-5p Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-26a-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-26a-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-26a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-26a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (HeyA8)
hsa-miR-26a-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-26a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (CP20)
hsa-miR-26a-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-26a-5p Ethanol+Tamoxifen sensitive cell line (LY2)
hsa-miR-26a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-26a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-26a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-26a-5p Gemcitabine 60750 NSC613327 approved resistant cell line (HuH28)
hsa-miR-26a-5p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-26a-5p Platinum-based doublet chemotherapy resistant tissue (lung adenocarcinoma)
hsa-miR-26a-5p Bortezomib 387447 NSC681239 approved resistant cell line (CCRF-CEM) (200 nM)
hsa-miR-26a-5p Bortezomib 387447 NSC681239 approved sensitive cell line (CCRF-CEM) (100 nM)
hsa-miR-26a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (H460)
hsa-miR-26a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-26a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (OVSAHO)
hsa-miR-26a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (MDAH-2774)

Error report submission