miRTarBase - #MIRT004719


—
pre-miRNA Information
pre-miRNA hsa-mir-196a-1   
Genomic Coordinates chr17: 48632490 - 48632559
Synonyms MIRN196-1, MIRN196A1, MIR196A1
Description Homo sapiens miR-196a-1 stem-loop
Comment Lagos-Quintana et al. .
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-196a-2   
Genomic Coordinates chr12: 53991738 - 53991847
Synonyms MIRN196-2, MIRN196A2, MIR196A2
Description Homo sapiens miR-196a-2 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-196a-5p
Sequence 25| UAGGUAGUUUCAUGUUGUUGGG |46
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 6 17 - 48632548 29233923 MiREDiBase
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30188818 11 COSMIC
COSN30130427 18 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1449318187 1 dbSNP
rs1167097656 4 dbSNP
rs767877229 4 dbSNP
rs750731061 10 dbSNP
rs756640169 12 dbSNP
rs931027203 13 dbSNP
rs185070757 13 dbSNP
rs569910454 16 dbSNP
rs190478598 17 dbSNP
rs755062780 17 dbSNP
rs751887895 18 dbSNP
rs1422312414 20 dbSNP
rs372978481 21 dbSNP
rs1289240119 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol HMOX1   
Synonyms HMOX1D, HO-1, HSP32, bK286B10
Description heme oxygenase 1
Transcript NM_002133   
Expression
Putative miRNA Targets on HMOX1
3'UTR of HMOX1
(miRNA target sites are highlighted)		 
>HMOX1|NM_002133|3'UTR
   1 ATGCAGGCATGCTGGCTCCCAGGGCCATGAACTTTGTCCGGTGGAAGGCCTTCTTTCTAGAGAGGGAATTCTCTTGGCTG
  81 GCTTCCTTACCGTGGGCACTGAAGGCTTTCAGGGCCTCCAGCCCTCTCACTGTGTCCCTCTCTCTGGAAAGGAGGAAGGA
 161 GCCTATGGCATCTTCCCCAACGAAAAGCACATCCAGGCAATGGCCTAAACTTCAGAGGGGGCGAAGGGATCAGCCCTGCC
 241 CTTCAGCATCCTCAGTTCCTGCAGCAGAGCCTGGAAGACACCCTAATGTGGCAGCTGTCTCAAACCTCCAAAAGCCCTGA
 321 GTTTCAAGTATCCTTGTTGACACGGCCATGACCACTTTCCCCGTGGGCCATGGCAATTTTTACACAAACCTGAAAAGATG
 401 TTGTGTCTTGTGTTTTTGTCTTATTTTTGTTGGAGCCACTCTGTTCCTGGCTCAGCCTCAAATGCAGTATTTTTGTTGTG
 481 TTCTGTTGTTTTTATAGCAGGGTTGGGGTGGTTTTTGAGCCATGCGTGGGTGGGGAGGGAGGTGTTTAACGGCACTGTGG
 561 CCTTGGTCTAACTTTTGTGTGAAATAATAAACAACATTGTCTGATAGTAGCTTGAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ggGUUG--UUGUACU-UUGAUGGAu 5'
            || |  ||::||: |:||::|| 
Target 5' gaCACCCTAATGTGGCAGCTGTCTc 3'
 277 - 301 114.00 -13.70
2 
miRNA  3' ggGUUG-UUGUACUUUGAUGGAu 5'
            :||: ||||  | |:|::|| 
Target 5' aaTAATAAACA--ACATTGTCTg 3'
 583 - 603 108.00 -8.60
3 
miRNA  3' ggguUGUU-GUACUUUGAUGGAu 5'
              ||:: ||||  || ||:| 
Target 5' tgacACGGCCATG--ACCACTTt 3'
 338 - 358 106.00 -6.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30472607 20 COSMIC
COSN31572909 30 COSMIC
COSN31491163 41 COSMIC
COSN31581937 48 COSMIC
COSN30114081 54 COSMIC
COSN30494176 55 COSMIC
COSN30105902 84 COSMIC
COSN30473218 92 COSMIC
COSN30100557 147 COSMIC
COSN31589901 204 COSMIC
COSN4785198 311 COSMIC
COSN19382191 374 COSMIC
COSN20783310 393 COSMIC
COSN31538655 452 COSMIC
COSN1261306 468 COSMIC
COSN25669819 468 COSMIC
COSN26551912 531 COSMIC
COSN31490521 551 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs774924065 3 dbSNP
rs1446761731 4 dbSNP
rs748669503 5 dbSNP
rs1314380699 8 dbSNP
rs1279625350 9 dbSNP
rs1190625712 12 dbSNP
rs367987395 13 dbSNP
rs773615991 15 dbSNP
rs1477674942 21 dbSNP
rs1381489947 23 dbSNP
rs530752316 26 dbSNP
rs1198846678 27 dbSNP
rs1239513778 28 dbSNP
rs1456057349 29 dbSNP
rs1178012514 30 dbSNP
rs995042284 36 dbSNP
rs866643988 39 dbSNP
rs201438906 40 dbSNP
rs776640266 41 dbSNP
rs894731419 49 dbSNP
rs760436375 51 dbSNP
rs759671776 52 dbSNP
rs550546401 54 dbSNP
rs1168602266 59 dbSNP
rs989347198 63 dbSNP
rs149739243 65 dbSNP
rs559481884 72 dbSNP
rs1446583871 75 dbSNP
rs539113031 76 dbSNP
rs753850950 82 dbSNP
rs1184856778 87 dbSNP
rs977151022 92 dbSNP
rs906139651 93 dbSNP
rs749455128 94 dbSNP
rs1206028066 96 dbSNP
rs1344383588 97 dbSNP
rs957403922 99 dbSNP
rs1048795422 102 dbSNP
rs1172733959 104 dbSNP
rs990017315 105 dbSNP
rs1314543934 107 dbSNP
rs1412867220 113 dbSNP
rs1354819056 126 dbSNP
rs1308550658 130 dbSNP
rs757798115 133 dbSNP
rs111787422 134 dbSNP
rs779325381 136 dbSNP
rs1337975166 139 dbSNP
rs1408921678 144 dbSNP
rs886147364 145 dbSNP
rs1167633638 146 dbSNP
rs147862586 150 dbSNP
rs1019162710 152 dbSNP
rs1183496131 154 dbSNP
rs566260020 156 dbSNP
rs1286578268 166 dbSNP
rs1484095562 169 dbSNP
rs911889128 173 dbSNP
rs901692220 178 dbSNP
rs944731148 182 dbSNP
rs1036389777 183 dbSNP
rs1297196577 185 dbSNP
rs1231290748 189 dbSNP
rs535207353 191 dbSNP
rs1333838488 202 dbSNP
rs1222661324 205 dbSNP
rs1418000413 212 dbSNP
rs1263756447 214 dbSNP
rs1305590722 215 dbSNP
rs967971070 217 dbSNP
rs1392505172 221 dbSNP
rs978729173 222 dbSNP
rs758713757 223 dbSNP
rs1394156483 224 dbSNP
rs371438796 234 dbSNP
rs930769568 239 dbSNP
rs17880056 245 dbSNP
rs894671137 254 dbSNP
rs1471409631 262 dbSNP
rs1362144986 271 dbSNP
rs1213798868 272 dbSNP
rs1181269260 275 dbSNP
rs11555832 279 dbSNP
rs1212012751 283 dbSNP
rs1467884197 288 dbSNP
rs1268459209 295 dbSNP
rs112611068 312 dbSNP
rs906855760 326 dbSNP
rs1348537073 327 dbSNP
rs1278870084 329 dbSNP
rs1160540251 332 dbSNP
rs1233400308 333 dbSNP
rs769322032 337 dbSNP
rs370298007 344 dbSNP
rs557349117 345 dbSNP
rs1321565482 346 dbSNP
rs1402806625 347 dbSNP
rs577322782 349 dbSNP
rs957145319 363 dbSNP
rs1158477491 364 dbSNP
rs572339648 366 dbSNP
rs1011790497 368 dbSNP
rs1158969918 369 dbSNP
rs1396911516 371 dbSNP
rs1191997199 375 dbSNP
rs930923547 376 dbSNP
rs181746701 381 dbSNP
rs772833576 390 dbSNP
rs954051818 396 dbSNP
rs907546802 402 dbSNP
rs986660564 402 dbSNP
rs1283523306 404 dbSNP
rs1200924451 411 dbSNP
rs559862155 411 dbSNP
rs1343253245 413 dbSNP
rs912505747 421 dbSNP
rs1404155818 436 dbSNP
rs748685954 444 dbSNP
rs186402981 447 dbSNP
rs1277499426 450 dbSNP
rs771027320 454 dbSNP
rs1233115841 459 dbSNP
rs1342521052 470 dbSNP
rs972044433 476 dbSNP
rs565313803 480 dbSNP
rs1040102921 481 dbSNP
rs1325019256 482 dbSNP
rs901617332 486 dbSNP
rs1325352638 495 dbSNP
rs1377354242 496 dbSNP
rs1222034512 501 dbSNP
rs1171920320 508 dbSNP
rs995957879 516 dbSNP
rs1169839115 520 dbSNP
rs530826190 521 dbSNP
rs930738871 524 dbSNP
rs1049653060 526 dbSNP
rs1486574242 527 dbSNP
rs1255317143 529 dbSNP
rs775963356 532 dbSNP
rs916063716 533 dbSNP
rs1342229214 534 dbSNP
rs948896029 536 dbSNP
rs1045987145 545 dbSNP
rs759528071 551 dbSNP
rs192434406 552 dbSNP
rs199990093 557 dbSNP
rs1177150566 560 dbSNP
rs775144949 562 dbSNP
rs971507747 569 dbSNP
rs5755721 578 dbSNP
rs530785590 584 dbSNP
rs1331158003 589 dbSNP
rs1400854196 594 dbSNP
rs1052795368 596 dbSNP
rs892826613 598 dbSNP
rs1163693542 601 dbSNP
rs113172420 605 dbSNP
rs1028512414 609 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Huh7.5 , 9-13 , Con1
Disease AGTGTAAGGACCCATCGGAGAA;
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... "functional miR-196 binding sites in the 3`-UTR of Bach1 ...

- Hou W; Tian Q; Zheng J; Bonkovsky HL, 2010, Hepatology (Baltimore, Md.).

Article - Hou W; Tian Q; Zheng J; Bonkovsky HL
- Hepatology (Baltimore, Md.), 2010
UNLABELLED: Hepatitis C virus (HCV) directly induces oxidative stress and liver injury. Bach1, a basic leucine zipper mammalian transcriptional repressor, negatively regulates heme oxygenase 1 (HMOX1), a key cytoprotective enzyme that has antioxidant and anti-inflammatory activities. microRNAs (miRNAs) are small noncoding RNAs ( approximately 22 nt) that are important regulators of gene expression. Whether and how miRNAs regulate Bach1 or HCV are largely unknown. The aims of this study were to determine whether miR-196 regulates Bach1, HMOX1, and/or HCV gene expression. HCV replicon cell lines (Con1 and 9-13) of the Con1 isolate and J6/JFH1-based HCV cell culture system were used in this study. The effects of miR-196 mimic on Bach1, HMOX1, and HCV RNA, and protein levels were measured by way of quantitative real-time polymerase chain reaction (qRT-PCR) and Western blotting, respectively. The Dual Glo Luciferase Assay System was used to determine reporter activities. miR-196 mimic significantly down-regulated Bach1 and up-regulated HMOX1 gene expression and inhibited HCV expression. Dual luciferase reporter assays demonstrated that transfection of miR-196 mimic resulted in a significant decrease in Bach1 3'-untranslated region (UTR)-dependent luciferase activity but not in mutant Bach1 3'-UTR-dependent luciferase activity. Moreover, there was no detectable effect of mutant miR-196 on Bach1 3'-UTR-dependent luciferase activity. CONCLUSION: miR-196 directly acts on the 3'-UTR of Bach1 messenger RNA and translationally represses the expression of this protein, and up-regulates HMOX1. miR-196 also inhibits HCV expression in HCV replicon cell lines (genotype 1b) and in J6/JFH1 (genotype 2a) HCV cell culture system. Thus, miR-196 plays a role in both HMOX1/Bach1 expression and the regulation of HCV expression in human hepatocytes. Overexpression of miR-196 holds promise as a potential novel strategy to prevent or ameliorate hepatitis C infection, and to protect against liver injury in chronic HCV infection.
LinkOut: [PMID: 20127796]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE26953 Aortic valvular endothelial cells 0.634 4.4e-4 0.447 1.4e-2 24 Click to see details
GSE27834 Pluripotent stem cells -0.533 1.7e-2 -0.447 4.1e-2 16 Click to see details
GSE42095 Differentiated embryonic stem cells 0.404 2.8e-2 0.144 2.6e-1 23 Click to see details
GSE28544 Breast cancer 0.359 4.2e-2 0.225 1.5e-1 24 Click to see details
GSE19783 ER+ ER+ breast cancer -0.257 1.4e-1 -0.197 2.0e-1 20 Click to see details
GSE17306 Multiple myeloma 0.154 1.5e-1 0.070 3.2e-1 49 Click to see details
GSE32688 Pancreatic cancer -0.186 1.5e-1 -0.117 2.6e-1 32 Click to see details
GSE21849 B cell lymphoma 0.181 1.7e-1 0.143 2.3e-1 29 Click to see details
GSE21032 Prostate cancer 0.097 1.9e-1 0.073 2.6e-1 83 Click to see details
GSE28260 Renal cortex and medulla 0.242 2.1e-1 0.203 2.5e-1 13 Click to see details
GSE14794 Lymphoblastoid cells -0.082 2.2e-1 -0.147 8.3e-2 90 Click to see details
GSE19350 CNS germ cell tumors 0.152 3.2e-1 0.070 4.1e-1 12 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.097 3.2e-1 -0.162 2.2e-1 25 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.17 3.3e-1 0.067 4.3e-1 9 Click to see details
GSE19536 Breast cancer -0.036 3.6e-1 -0.030 3.8e-1 100 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.074 3.8e-1 0.376 5.1e-2 20 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.053 4.0e-1 -0.033 4.4e-1 25 Click to see details
GSE19783 ER- ER- breast cancer -0.023 4.2e-1 -0.062 2.9e-1 79 Click to see details
GSE21687 Ependynoma primary tumors -0.016 4.5e-1 0.035 3.9e-1 64 Click to see details
GSE38226 Liver fibrosis 0.017 4.7e-1 -0.094 3.4e-1 21 Click to see details
GSE17498 Multiple myeloma 0.007 4.8e-1 -0.058 3.6e-1 40 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
UCEC 0.511 0.01 0.604 0 19 Click to see details
LIHC -0.307 0.03 -0.172 0.15 37 Click to see details
LUSC -0.275 0.05 -0.258 0.06 38 Click to see details
ESCA 0.455 0.08 0.527 0.05 11 Click to see details
HNSC 0.166 0.15 0.140 0.19 42 Click to see details
COAD 0.413 0.15 0.000 0.5 8 Click to see details
CESC 0.826 0.19 1.000 0.5 3 Click to see details
KIRC -0.096 0.22 -0.086 0.24 68 Click to see details
BLCA -0.174 0.24 -0.220 0.19 18 Click to see details
PRAD -0.085 0.28 -0.152 0.15 50 Click to see details
STAD -0.105 0.29 -0.167 0.18 31 Click to see details
PCPG -0.581 0.3 -0.500 0.33 3 Click to see details
KIRP -0.085 0.32 -0.068 0.36 32 Click to see details
BRCA -0.042 0.35 0.021 0.42 84 Click to see details
LUAD 0.123 0.36 0.009 0.49 11 Click to see details
CHOL 0.152 0.36 -0.119 0.39 8 Click to see details
PAAD -0.259 0.37 -0.400 0.3 4 Click to see details
KICH 0.048 0.41 0.050 0.41 25 Click to see details
THCA 0.013 0.47 0.012 0.47 47 Click to see details
THCA 0.013 0.47 0.012 0.47 47 Click to see details
THCA 0.013 0.47 0.012 0.47 47 Click to see details
301 hsa-miR-196a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000218 BMP4 bone morphogenetic protein 4 1 1
MIRT000219 SPRR2C small proline rich protein 2C (pseudogene) 3 2
MIRT000220 S100A9 S100 calcium binding protein A9 3 2
MIRT000221 KRT5 keratin 5 3 2
MIRT000709 ANXA1 annexin A1 4 2
MIRT002266 HOXB8 homeobox B8 5 7
MIRT002940 HOXA7 homeobox A7 4 5
MIRT002941 HOXD8 homeobox D8 3 3
MIRT002942 HOXC8 homeobox C8 6 15
MIRT004244 HOXB7 homeobox B7 4 1
MIRT004718 BACH1 BTB domain and CNC homolog 1 6 3
MIRT004719 HMOX1 heme oxygenase 1 4 1
MIRT005065 CDKN1B cyclin dependent kinase inhibitor 1B 6 7
MIRT006802 HMGA1 high mobility group AT-hook 1 5 5
MIRT006803 HMGA2 high mobility group AT-hook 2 5 7
MIRT006906 HOXA5 homeobox A5 5 3
MIRT026026 IKBKB inhibitor of nuclear factor kappa B kinase subunit beta 1 1
MIRT026027 PDCD4 programmed cell death 4 1 1
MIRT026028 SRRT serrate, RNA effector molecule 2 9
MIRT026029 DIEXF digestive organ expansion factor homolog (zebrafish) 1 1
MIRT026030 ZBTB24 zinc finger and BTB domain containing 24 1 1
MIRT026031 NR4A1 nuclear receptor subfamily 4 group A member 1 1 1
MIRT026032 ABT1 activator of basal transcription 1 1 1
MIRT026033 SPATA2 spermatogenesis associated 2 1 1
MIRT026034 NHLRC3 NHL repeat containing 3 1 1
MIRT026035 RPUSD2 RNA pseudouridylate synthase domain containing 2 1 1
MIRT026036 CEP120 centrosomal protein 120 1 1
MIRT026037 PHC3 polyhomeotic homolog 3 1 1
MIRT026038 ZBTB6 zinc finger and BTB domain containing 6 1 1
MIRT026039 C9orf41 carnosine N-methyltransferase 1 1 1
MIRT026040 PNP purine nucleoside phosphorylase 1 1
MIRT026041 COPS3 COP9 signalosome subunit 3 1 1
MIRT026042 NUP50 nucleoporin 50 1 1
MIRT026043 ZNF763 zinc finger protein 763 1 1
MIRT026044 FOXJ3 forkhead box J3 1 1
MIRT026045 BIN3 bridging integrator 3 1 1
MIRT026046 C12orf4 chromosome 12 open reading frame 4 1 1
MIRT026047 RAD9A RAD9 checkpoint clamp component A 1 1
MIRT026048 PCGF3 polycomb group ring finger 3 1 1
MIRT026049 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT026050 SLC10A7 solute carrier family 10 member 7 1 1
MIRT026051 LBR lamin B receptor 1 1
MIRT026052 BCL11A B-cell CLL/lymphoma 11A 1 1
MIRT026053 GLMN glomulin, FKBP associated protein 1 1
MIRT026054 STK40 serine/threonine kinase 40 1 1
MIRT026055 TMEM135 transmembrane protein 135 1 1
MIRT026056 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 2 3
MIRT026057 POLR2D RNA polymerase II subunit D 2 5
MIRT026058 LGR4 leucine rich repeat containing G protein-coupled receptor 4 1 1
MIRT026059 IGF2BP3 insulin like growth factor 2 mRNA binding protein 3 2 4
MIRT026060 ESPL1 extra spindle pole bodies like 1, separase 1 1
MIRT026061 RFX5 regulatory factor X5 1 1
MIRT026062 SYT9 synaptotagmin 9 1 1
MIRT026063 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT026064 IGF1R insulin like growth factor 1 receptor 1 1
MIRT026065 SMCR7L mitochondrial elongation factor 1 1 4
MIRT026066 SLC30A6 solute carrier family 30 member 6 2 3
MIRT026067 RAB31 RAB31, member RAS oncogene family 1 1
MIRT026068 KPNA5 karyopherin subunit alpha 5 1 1
MIRT026069 SLC20A1 solute carrier family 20 member 1 1 1
MIRT026070 TIMM23 translocase of inner mitochondrial membrane 23 1 1
MIRT026071 IGDCC4 immunoglobulin superfamily DCC subclass member 4 2 6
MIRT026072 SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 1 1
MIRT026073 CCNT2 cyclin T2 1 1
MIRT026074 CCND2 cyclin D2 1 1
MIRT026075 USP24 ubiquitin specific peptidase 24 1 1
MIRT026076 TRPC3 transient receptor potential cation channel subfamily C member 3 2 4
MIRT026077 SMC3 structural maintenance of chromosomes 3 1 1
MIRT026078 TMEM2 transmembrane protein 2 1 1
MIRT026079 RDH10 retinol dehydrogenase 10 1 1
MIRT026080 C11orf57 chromosome 11 open reading frame 57 2 5
MIRT026081 FAM127A retrotransposon Gag like 8C 2 4
MIRT026082 PRUNE2 prune homolog 2 2 3
MIRT026083 SPRYD4 SPRY domain containing 4 1 1
MIRT026084 TMEM161B transmembrane protein 161B 1 1
MIRT026085 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 1
MIRT026086 FAM104A family with sequence similarity 104 member A 2 2
MIRT026087 RAB7L1 RAB29, member RAS oncogene family 1 1
MIRT026088 ITGAV integrin subunit alpha V 1 1
MIRT026089 CPD carboxypeptidase D 1 1
MIRT026090 ZNF354B zinc finger protein 354B 1 1
MIRT026091 TMEM194A nuclear envelope integral membrane protein 1 1 1
MIRT026092 EPHA7 EPH receptor A7 1 1
MIRT026093 KIAA1804 mitogen-activated protein kinase kinase kinase 21 1 1
MIRT026094 DFFA DNA fragmentation factor subunit alpha 2 2
MIRT026095 TSPAN12 tetraspanin 12 1 1
MIRT026096 LIN28B lin-28 homolog B 1 1
MIRT026097 ARHGAP28 Rho GTPase activating protein 28 1 1
MIRT026098 IGF2BP1 insulin like growth factor 2 mRNA binding protein 1 1 1
MIRT026099 CCDC47 coiled-coil domain containing 47 1 1
MIRT026100 HAND1 heart and neural crest derivatives expressed 1 4 2
MIRT026101 LLGL1 LLGL1, scribble cell polarity complex component 1 1
MIRT048150 PGAM1 phosphoglycerate mutase 1 1 1
MIRT048151 PSMC3 proteasome 26S subunit, ATPase 3 1 1
MIRT048152 TMX2 thioredoxin related transmembrane protein 2 1 1
MIRT048153 KLHL7 kelch like family member 7 1 1
MIRT048154 RFC2 replication factor C subunit 2 1 1
MIRT048155 GLUL glutamate-ammonia ligase 1 1
MIRT048156 NRXN1 neurexin 1 1 1
MIRT048157 GSTK1 glutathione S-transferase kappa 1 1 1
MIRT048158 HIST2H4B histone cluster 2 H4 family member b 1 1
MIRT048159 SPEN spen family transcriptional repressor 1 1
MIRT048160 TAF15 TATA-box binding protein associated factor 15 1 1
MIRT048161 SAP18 Sin3A associated protein 18 1 1
MIRT048162 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 1 1
MIRT048163 MSL3 MSL complex subunit 3 1 1
MIRT048164 TSKU tsukushi, small leucine rich proteoglycan 1 1
MIRT048165 KMT2C lysine methyltransferase 2C 1 1
MIRT048166 LYRM2 LYR motif containing 2 1 1
MIRT048167 UBE2Z ubiquitin conjugating enzyme E2 Z 1 1
MIRT048168 C19orf55 proline and serine rich 3 1 1
MIRT048169 LRP2 LDL receptor related protein 2 1 1
MIRT048170 ND4L NADH dehydrogenase, subunit 4L (complex I) 1 1
MIRT048171 NKX6-1 NK6 homeobox 1 1 1
MIRT048172 BRMS1L breast cancer metastasis-suppressor 1 like 1 1
MIRT048173 RPS2 ribosomal protein S2 1 1
MIRT048174 RBMX RNA binding motif protein, X-linked 1 1
MIRT048175 ZFP64 ZFP64 zinc finger protein 1 1
MIRT048176 REEP2 receptor accessory protein 2 1 1
MIRT048177 MED13 mediator complex subunit 13 1 1
MIRT048178 MYCBP2 MYC binding protein 2, E3 ubiquitin protein ligase 1 1
MIRT048179 TRAPPC9 trafficking protein particle complex 9 1 1
MIRT048180 DNTTIP2 deoxynucleotidyltransferase terminal interacting protein 2 1 1
MIRT048181 VDAC3 voltage dependent anion channel 3 1 1
MIRT048182 ZNF529 zinc finger protein 529 1 1
MIRT048183 EWSR1 EWS RNA binding protein 1 1 1
MIRT048184 ATP6V1B2 ATPase H+ transporting V1 subunit B2 1 1
MIRT048185 RDH11 retinol dehydrogenase 11 (all-trans/9-cis/11-cis) 1 1
MIRT048186 APP amyloid beta precursor protein 1 1
MIRT048187 PROSER1 proline and serine rich 1 1 1
MIRT048188 HIST1H2BB histone cluster 1 H2B family member b 1 1
MIRT048189 TAB2 TGF-beta activated kinase 1/MAP3K7 binding protein 2 1 1
MIRT048190 TUBA1B tubulin alpha 1b 1 1
MIRT048191 USP19 ubiquitin specific peptidase 19 1 1
MIRT048192 COX3 cytochrome c oxidase III 1 1
MIRT048193 PSMD8 proteasome 26S subunit, non-ATPase 8 1 1
MIRT048194 TRA2B transformer 2 beta homolog 1 1
MIRT048195 MRPL35 mitochondrial ribosomal protein L35 1 1
MIRT048196 KCTD1 potassium channel tetramerization domain containing 1 1 1
MIRT048197 UBE2C ubiquitin conjugating enzyme E2 C 1 1
MIRT048198 ZNF581 zinc finger protein 581 1 1
MIRT048199 CNOT11 CCR4-NOT transcription complex subunit 11 1 1
MIRT048200 POTEG POTE ankyrin domain family member G 1 1
MIRT048201 MTRF1L mitochondrial translational release factor 1 like 1 1
MIRT048202 SRP9 signal recognition particle 9 2 5
MIRT048203 BCORL1 BCL6 corepressor like 1 1 1
MIRT048204 NRBP1 nuclear receptor binding protein 1 1 1
MIRT048205 LRRC41 leucine rich repeat containing 41 1 1
MIRT048206 ATP6 ATP synthase F0 subunit 6 1 1
MIRT048207 FKTN fukutin 1 1
MIRT048208 RANBP9 RAN binding protein 9 1 1
MIRT048209 SYVN1 synoviolin 1 1 1
MIRT048210 NR2F6 nuclear receptor subfamily 2 group F member 6 1 1
MIRT048211 ATG16L1 autophagy related 16 like 1 1 1
MIRT048212 EIF2S3 eukaryotic translation initiation factor 2 subunit gamma 1 1
MIRT048213 ECHDC1 ethylmalonyl-CoA decarboxylase 1 1 1
MIRT048214 HAUS6 HAUS augmin like complex subunit 6 1 1
MIRT048215 CKAP2L cytoskeleton associated protein 2 like 1 1
MIRT048216 IFNGR1 interferon gamma receptor 1 1 1
MIRT048217 ANXA7 annexin A7 1 1
MIRT048218 ENAH ENAH, actin regulator 1 1
MIRT048219 FOXO1 forkhead box O1 9 3
MIRT048220 NDFIP1 Nedd4 family interacting protein 1 1 1
MIRT048221 LSM14A LSM14A, mRNA processing body assembly factor 1 1
MIRT048222 ATP1A1 ATPase Na+/K+ transporting subunit alpha 1 1 1
MIRT048223 SLC25A17 solute carrier family 25 member 17 1 1
MIRT048224 ZNF398 zinc finger protein 398 1 1
MIRT048225 RASSF7 Ras association domain family member 7 1 1
MIRT048226 SBF1 SET binding factor 1 1 1
MIRT048227 TP53RK TP53 regulating kinase 1 1
MIRT048228 MED12 mediator complex subunit 12 1 1
MIRT048229 FLNA filamin A 1 1
MIRT048230 CCNE2 cyclin E2 1 1
MIRT048231 CANX calnexin 1 1
MIRT048232 PRPF8 pre-mRNA processing factor 8 1 1
MIRT048233 FRS2 fibroblast growth factor receptor substrate 2 1 1
MIRT048234 KIF18B kinesin family member 18B 1 1
MIRT048235 U2AF2 U2 small nuclear RNA auxiliary factor 2 1 1
MIRT048236 SH3GL3 SH3 domain containing GRB2 like 3, endophilin A3 1 1
MIRT048237 VCP valosin containing protein 1 1
MIRT048238 ETV3 ETS variant 3 1 1
MIRT048239 BCS1L BCS1 homolog, ubiquinol-cytochrome c reductase complex chaperone 1 1
MIRT048240 ND5 NADH dehydrogenase, subunit 5 (complex I) 1 1
MIRT048241 ZCCHC11 zinc finger CCHC-type containing 11 1 1
MIRT048242 RALGPS2 Ral GEF with PH domain and SH3 binding motif 2 1 1
MIRT048243 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 1 1
MIRT048244 ACTB actin beta 1 1
MIRT048245 UQCRC2 ubiquinol-cytochrome c reductase core protein II 1 1
MIRT048246 EIF2B4 eukaryotic translation initiation factor 2B subunit delta 1 1
MIRT048247 GMFB glia maturation factor beta 1 1
MIRT048248 PALLD palladin, cytoskeletal associated protein 1 1
MIRT048249 CASP3 caspase 3 1 1
MIRT048250 VCL vinculin 1 1
MIRT048251 IPO5 importin 5 1 1
MIRT048252 PATL1 PAT1 homolog 1, processing body mRNA decay factor 1 1
MIRT048253 NAP1L4 nucleosome assembly protein 1 like 4 1 1
MIRT048254 RUFY2 RUN and FYVE domain containing 2 2 1
MIRT048255 TUBB tubulin beta class I 1 1
MIRT048256 CCND1 cyclin D1 1 1
MIRT048257 GID8 GID complex subunit 8 homolog 1 1
MIRT048258 VDAC2 voltage dependent anion channel 2 1 1
MIRT048259 SLC6A8 solute carrier family 6 member 8 1 1
MIRT048260 FXR2 FMR1 autosomal homolog 2 1 1
MIRT048261 SCN11A sodium voltage-gated channel alpha subunit 11 1 1
MIRT048262 AHSA1 activator of HSP90 ATPase activity 1 1 1
MIRT048263 ATG9A autophagy related 9A 1 1
MIRT048264 NOTCH2 notch 2 1 1
MIRT048265 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 1 1
MIRT048266 ND4 NADH dehydrogenase, subunit 4 (complex I) 2 1
MIRT048267 OAT ornithine aminotransferase 1 1
MIRT048268 TRAP1 TNF receptor associated protein 1 1 1
MIRT048269 SKI SKI proto-oncogene 1 1
MIRT048270 GLTP glycolipid transfer protein 1 1
MIRT048271 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT048272 LSM3 LSM3 homolog, U6 small nuclear RNA and mRNA degradation associated 1 1
MIRT048273 GRIK4 glutamate ionotropic receptor kainate type subunit 4 1 1
MIRT048274 PDE6D phosphodiesterase 6D 1 1
MIRT048275 MPP2 membrane palmitoylated protein 2 1 1
MIRT048276 SAR1B secretion associated Ras related GTPase 1B 2 3
MIRT048277 MAP4 microtubule associated protein 4 1 1
MIRT048278 RAB21 RAB21, member RAS oncogene family 1 1
MIRT048279 BUB1 BUB1 mitotic checkpoint serine/threonine kinase 1 1
MIRT048280 OGFRL1 opioid growth factor receptor like 1 1 1
MIRT048281 GOT2 glutamic-oxaloacetic transaminase 2 1 1
MIRT048282 NRDE2 NRDE-2, necessary for RNA interference, domain containing 1 1
MIRT048283 SBNO1 strawberry notch homolog 1 1 1
MIRT053067 NTN4 netrin 4 2 1
MIRT054025 RDX radixin 5 5
MIRT056750 ARID5B AT-rich interaction domain 5B 2 2
MIRT057645 LCOR ligand dependent nuclear receptor corepressor 2 4
MIRT076226 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 2 6
MIRT083303 ZCCHC3 zinc finger CCHC-type containing 3 2 2
MIRT095769 GRPEL2 GrpE like 2, mitochondrial 2 10
MIRT187720 SUOX sulfite oxidase 2 2
MIRT191923 CALM1 calmodulin 1 2 2
MIRT205504 SP100 SP100 nuclear antigen 2 2
MIRT209857 ACVR2B activin A receptor type 2B 2 2
MIRT229841 YIPF6 Yip1 domain family member 6 2 2
MIRT230833 TBRG1 transforming growth factor beta regulator 1 2 2
MIRT235376 CALM3 calmodulin 3 2 2
MIRT251626 KCNJ2 potassium voltage-gated channel subfamily J member 2 2 2
MIRT252333 SALL3 spalt like transcription factor 3 2 2
MIRT255317 CDV3 CDV3 homolog 2 2
MIRT324734 ACER2 alkaline ceramidase 2 4 3
MIRT386075 ZNF609 zinc finger protein 609 2 2
MIRT402060 ATP6V1F ATPase H+ transporting V1 subunit F 2 4
MIRT437422 NFKBIA NFKB inhibitor alpha 4 2
MIRT437980 TYMS thymidylate synthetase 1 1
MIRT437981 NRP2 neuropilin 2 1 1
MIRT437982 LSP1 lymphocyte-specific protein 1 1 1
MIRT439104 MYC MYC proto-oncogene, bHLH transcription factor 0 1
MIRT447143 KIF27 kinesin family member 27 2 2
MIRT447559 C14orf37 chromosome 14 open reading frame 37 2 2
MIRT449961 FMNL3 formin like 3 2 2
MIRT465087 TSPAN3 tetraspanin 3 2 2
MIRT470426 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 2
MIRT472726 MTUS1 microtubule associated scaffold protein 1 2 6
MIRT473801 MAP3K2 mitogen-activated protein kinase kinase kinase 2 2 2
MIRT474507 KLHDC8B kelch domain containing 8B 2 2
MIRT474917 KCTD21 potassium channel tetramerization domain containing 21 2 2
MIRT486549 DCTN4 dynactin subunit 4 2 2
MIRT492430 RGL2 ral guanine nucleotide dissociation stimulator like 2 2 2
MIRT493925 FAM127B retrotransposon Gag like 8A 2 4
MIRT500972 SPTSSA serine palmitoyltransferase small subunit A 2 2
MIRT501431 RAB11FIP4 RAB11 family interacting protein 4 2 2
MIRT502410 GATA6 GATA binding protein 6 2 8
MIRT506368 NUP155 nucleoporin 155 2 6
MIRT507497 E2F7 E2F transcription factor 7 2 6
MIRT520041 YOD1 YOD1 deubiquitinase 2 6
MIRT522366 NAP1L1 nucleosome assembly protein 1 like 1 2 4
MIRT531281 SLC7A7 solute carrier family 7 member 7 2 2
MIRT543674 FAM135A family with sequence similarity 135 member A 2 2
MIRT545199 HIST1H2BD histone cluster 1 H2B family member d 2 2
MIRT546336 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT546452 SLC9A7 solute carrier family 9 member A7 2 2
MIRT546787 RCC2 regulator of chromosome condensation 2 2 4
MIRT547253 NXPE3 neurexophilin and PC-esterase domain family member 3 2 2
MIRT547454 MBD4 methyl-CpG binding domain 4, DNA glycosylase 2 2
MIRT547581 LRIG3 leucine rich repeats and immunoglobulin like domains 3 2 4
MIRT547902 HOXA9 homeobox A9 2 4
MIRT549503 ABHD2 abhydrolase domain containing 2 2 2
MIRT549583 ZNF850 zinc finger protein 850 2 2
MIRT551888 MMS22L MMS22 like, DNA repair protein 2 2
MIRT552125 MED10 mediator complex subunit 10 2 2
MIRT554188 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT555552 PLEKHA3 pleckstrin homology domain containing A3 2 2
MIRT556285 MAPK1 mitogen-activated protein kinase 1 2 2
MIRT556980 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT559183 BRAP BRCA1 associated protein 2 2
MIRT561215 ZSWIM1 zinc finger SWIM-type containing 1 2 2
MIRT562352 EXOC8 exocyst complex component 8 2 2
MIRT565603 SLC35G1 solute carrier family 35 member G1 2 2
MIRT575599 Gnl1 guanine nucleotide binding protein-like 1 2 3
MIRT610363 GNL1 G protein nucleolar 1 (putative) 2 3
MIRT617860 FMO4 flavin containing monooxygenase 4 2 2
MIRT698193 TMEM66 store-operated calcium entry associated regulatory factor 1 1
MIRT704411 CTPS1 CTP synthase 1 2 2
MIRT732864 NARS asparaginyl-tRNA synthetase 3 0
MIRT732867 AJAP1 adherens junctions associated protein 1 3 0
MIRT732868 COL24A1 collagen type XXIV alpha 1 chain 3 0
MIRT735738 RASSF4 Ras association domain family member 4 3 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-196a Curcumin NULL 969516 Microarray BxPC-3 human pancreatic carcinoma cell line 18347134 2008 down-regulated
miR-196a Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 down-regulated
miR-196a Polylysine NULL 162282 Quantitative real-time PCR 293T(FLAG AGO2) cells 20529860 2010 down-regulated
miR-196a Trypaflavine NULL NULL Quantitative real-time PCR 293T(FLAG AGO2) cells 20529860 2010 down-regulated
miR-196a Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-196a 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-196a Curcumin NULL 969516 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-196a Narangin NULL 442428 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-196a Proanthocyanin NULL 108065 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-196a (S)-3,5-dihydroxyphenylglycine (DHPG) NULL 443586 Quantitative real-time PCR mouse brain 22309833 2012 up-regulated
miR-196a (S)-3,5-dihydroxyphenylglycine (DHPG) NULL 443586 Quantitative real-time PCR mouse brain 22309833 2012 up-regulated
miR-196a 17beta-estradiol (E2) approved 5757 Microarray rat breast 17700064 2007 down-regulated
miR-196a (S)-3,5-dihydroxyphenylglycine (DHPG) NULL 443586 Quantitative real-time PCR mouse brain 22309833 2012 up-regulated
miR-196a Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-196a-5p (e)-2-methyl-1-[2-(2-methyl-1h-indol-3-yl)indolin-1-yl]but-2-en-1-one 5388204 NSC633484 resistant
hsa-miR-196a-5p (E)-3-[2-(4-methoxyphenyl)imidazo[1,2-a]pyridin-3-yl]-1-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 54613570 NSC750335 sensitive
hsa-miR-196a-5p 1-[4-(5,6-diphenyl-1,2,4-triazin-3-yl)piperazin-1-yl]-2-[4-(4-methoxyphenyl)piperazin-1-yl]ethanone 54612996 NSC749161 sensitive
hsa-miR-196a-5p 2-[(e)-[6-(4-chloro-3-nitrophenyl)-2,3-dihydroimidazo[2,1-b][1,3]thiazol-5-yl]methylideneamino]guanidine;hydrochloride 16099315 NSC728901 resistant
hsa-miR-196a-5p 2-amino-6-(benzylamino)-4-(2-chlorophenyl)pyridine-3,5-dicarbonitrile 24205132 NSC734396 resistant
hsa-miR-196a-5p 7-[(3,4-dimethoxyphenyl)methyl]-6-phenyl-4,5-dihydropyrrolo[3,4-g][1,2]benzoxazole 60148271 NSC754077 sensitive
hsa-miR-196a-5p Bisarylpurine 45028308 NSC742146 resistant
hsa-miR-196a-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-196a-5p Dimethylarsinothious acid, 2,4-pyrimidinediyl ester 294741 NSC163664 resistant
hsa-miR-196a-5p Ethyl 5-(2,4-dichlorobenzoyl)oxy-4-oxo-1,3-diphenyl-2-thioxo-thieno[2,3-d]pyrimidine-6-carboxylate 383097 NSC671141 resistant
hsa-miR-196a-5p Gw620972x 766949 NSC756282 sensitive
hsa-miR-196a-5p Methyl 11h-pyrido[2,3-a]carbazole-5-carboxylate 13776879 NSC740203 sensitive
hsa-miR-196a-5p Methyl 6-[2-(diethylamino)ethoxy]-7-[(E)-3-(4-methoxyphenyl)prop-2-enoyl]-3-methyl-1-benzofuran-2-carboxylate;hydrochloride 24204523 NSC732112 resistant
hsa-miR-196a-5p N'-[2-(1,3-benzoxazol-2-ylamino)-6-methylpyrimidin-4-yl]-2-hydroxybenzohydrazide 24205702 NSC736401 resistant
hsa-miR-196a-5p N-(1,3-benzothiazol-2-yl)-2-[4-[(Z)-(3-oxo-1-benzofuran-2-ylidene)methyl]phenoxy]acetamide 45028625 NSC743506 resistant
hsa-miR-196a-5p N,n'-bis[(z)-(2-hydroxyphenyl)methylideneamino]decanediamide 135408549 NSC49488 resistant
hsa-miR-196a-5p NSC617562 NSC617562 resistant
hsa-miR-196a-5p NSC756998 NSC756998 sensitive
hsa-miR-196a-5p Tellurium, trichloro[1,2-hexanedioato(2-)-o,o']-, ammonium 498945 NSC641009 resistant
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (SKOV3, 2008, OVCAR10, OVCAR3, HeLa, MCF7, MDA-MB-468)
hsa-miR-196a-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-196a-5p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-196a-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (HepG2, Hep-394, Hep-SWX, Huh-7)
hsa-miR-196a-5p Imatinib 5291 NSC743414 approved resistant High Myelogenous Leukemia cell line (MYL)
hsa-miR-196a-5p 10-Hydroxycamptothecin 97226 NSC107124 sensitive High Gastric Cancer cell line (BGC823, SGC-7901, MGC-803, HGC-27, NCI-N87, AGS)
hsa-miR-196a-5p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7, LY2)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780)
hsa-miR-196a-5p Fulvestrant 17756771 NSC719276 approved resistant Low Breast Cancer cell line (MCF-7)
hsa-miR-196a-5p Tamoxifen 2733525 NSC180973 approved resistant Low Breast Cancer cell line (MCF-7)
hsa-miR-196a-5p Doxorubicin 31703 NSC123127 approved resistant High Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-196a-5p Docetaxel 148124 NSC628503 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-196a-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-196a-5p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (RKO)
hsa-miR-196a-5p Docetaxel 148124 NSC628503 approved resistant Low Breast Cancer tissue and cell line (MCF-7)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-196a-5p Tamoxifen 2733525 NSC180973 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-196a-5p Doxorubicin 31703 NSC123127 approved sensitive High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-196a-5p Tamoxifen 2733525 NSC180973 approved sensitive Low Breast Cancer cell line (TAMR1, TAMR4, TAMR8)
hsa-miR-196a-5p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-196a-5p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-196a-5p Cytoxan + Doxorubicin + Fluorouracil resistant High Breast Cancer tissue
hsa-miR-196a-5p Cytoxan + Epirubicin + Fluorouracil resistant High Breast Cancer tissue
hsa-miR-196a-5p Cytoxan + Pirarubicin + Fluorouracil resistant High Breast Cancer tissue
hsa-miR-196a-5p Doxorubicin + Taxol resistant High Breast Cancer tissue
hsa-miR-196a-5p Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-196a-5p Gefitinib 123631 NSC715055 approved resistant High Non-Small Cell Lung Cancer cell line (PC-9)
hsa-miR-196a-5p Yuanhuadine 6440572 resistant High Non-Small Cell Lung Cancer cell line (PC-9)
hsa-miR-196a-5p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (DU-145R)
hsa-miR-196a-5p Paclitaxel + Cisplatin sensitive Low Esophageal Squamous Cell Carcinoma tissue
hsa-miR-196a-5p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (WM266) (2uM)
hsa-miR-196a-5p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (WM266) (1uM)
hsa-miR-196a-5p Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (WM266) (2uM)
hsa-miR-196a-5p Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (WM266) (1uM)
hsa-miR-196a-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-196a-5p Paclitaxel 36314 NSC125973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-196a-5p Trastuzumab resistant High Breast Cancer cell line (MDA‐MB‐231, SKBR3, HEK‐293T)
hsa-miR-196a-5p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CIS)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant High Epithelial Ovarian Cancer cell line (SKOV3)
hsa-miR-196a-5p Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-196a-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-196a-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-196a-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (cytosolic RNA)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (total RNA)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-196a-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-196a-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-196a-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-196a-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-196a-5p Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-196a-5p Tamoxifen 2733525 NSC180973 approved resistant cell line (LCC2)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-196a-5p Testosterone+Exemestane sensitive cell line (MCF-7)
hsa-miR-196a-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-196a-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (MGC-803)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (RPMI2650)
hsa-miR-196a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-196a-5p Tamoxifen 2733525 NSC180973 approved sensitive cell line (TamR8)
hsa-miR-196a-5p Tamoxifen 2733525 NSC180973 approved sensitive cell line (TamR1)
hsa-miR-196a-5p Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (IGROV-1)
hsa-miR-196a-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR70)
hsa-miR-196a-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR200)
hsa-miR-196a-5p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-196a-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR3)
hsa-miR-196a-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)
hsa-miR-196a-5p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (H460)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (OVCAR3)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (TOV-112D)

Error report submission