miRTarBase - #MIRT004722


—
pre-miRNA Information
pre-miRNA mmu-mir-10b   
Genomic Coordinates chr2: 74726070 - 74726137
Synonyms Mirn10b, mir-10b, mmu-mir-10b, Mir10b
Description Mus musculus miR-10b stem-loop
Comment The sequence of mouse miR-10b, as reported by Lagos-Quintana et al. . The 5' end of the miRNA may be offset with respect to previous annotations.
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-10b-5p
Sequence 5| UACCCUGUAGAACCGAAUUUGUG |27
Evidence Experimental
Experiments Cloned
Putative Targets

Gene Information
Gene Symbol Hoxd10   
Synonyms AI385591, AI874987, Hox-4.5, Hox-5.3
Description homeobox D10
Transcript NM_013554   
Expression
Putative miRNA Targets on Hoxd10
3'UTR of Hoxd10
(miRNA target sites are highlighted)		 
>Hoxd10|NM_013554|3'UTR
   1 GTCTGAGGCCCATGTGAGGCCAGGATCCGAGAGGGGGCACCGAGTTCCAGGCCTGAGTGCTGGAGGACTGGCAAGGCGGA
  81 AACAAACCCTTCATTGCTCTTTGGTTTTTTTGTTTTGTTTTGTTCTGTTCTGTTCTGTTTTCCTGCTAGAATGTGACTTT
 161 GGGGTCATTCTGTTCGTGCTGCAAGTGATCTGTAATCCCTATGAGTATACATATATATATATATTAAAAAAACTTAGCAC
 241 GTGTAATTTATTTTTTTTCATCGTAATGCAGGGTAACTATTACTGCGCATTTTCATTTGGGTCTTAACTTATTGGAACTG
 321 TAGAACATCCATCTAAACGTATCCATCGCATCCCACCCATCTATCCCGCCAGCAATGTGACTTTTCCATGTTTTTCCTAA
 401 CATAAAAGTTCTCTGTGTGTGGTTAGCCCATGAACTCATGGCATTTTGAAAACATCCAGTATTTAAAAAAACAAACAACC
 481 TATATCTATATATATTTCAAAAGATTAAGAAAACCCACAAGCTTTGGGGGGAGGGGGACTTTAAAAAGCACATTACAATG
 561 TATCTTTTCACAAATGAACTTAGCAATTGTCCTTGGTGAAATGGAATATTGATGACTTATGCCTTGTAGCCTTTCCTTGT
 641 GGTGCATCTGTGGTTTGGTAGAAGTACAAGCGCAACCTGTGCTTTTCTGTGCATGTTCTGGTCGCATGTGTAATGCAATA
 721 AACTCTGGAAATGGGTTT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' guguuuAAG--CCAAGAUGUCCCAu 5'
                |||   ||  |:|||||| 
Target 5' ttttttTTCATCGTAATGCAGGGTa 3'
 251 - 275 135.00 -15.70
2 
miRNA  3' guGUUUAAGCCAAGAUGUCCCau 5'
            ||:: ||    | | ||||  
Target 5' gcCAGGATC----CGAGAGGGgg 3'
 19 - 37 95.00 -8.40
3 
miRNA  3' gugUUUAAGCCAAGAUGUCCCAu 5'
             :||| :|   || ::|||| 
Target 5' ctaGAATGTG--ACTTTGGGGTc 3'
 146 - 166 92.00 -7.30
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions 4T1
Disease 15430.0;
Location of target site 3'UTR
Tools used in this research mirVana
Original Description (Extracted from the article) ... "metastasis-suppressing effect of antagomir-10b on 4T1 tumor cell ...

- Ma L; Reinhardt F; Pan E; Soutschek J; Bhat et al., 2010, Nature biotechnology.

Article - Ma L; Reinhardt F; Pan E; Soutschek J; Bhat et al.
- Nature biotechnology, 2010
MicroRNAs (miRNAs) are increasingly implicated in the regulation of metastasis. Despite their potential as targets for anti-metastatic therapy, miRNAs have only been silenced in normal tissues of rodents and nonhuman primates. Therefore, the development of effective approaches for sequence-specific inhibition of miRNAs in tumors remains a scientific and clinical challenge. Here we show that systemic treatment of tumor-bearing mice with miR-10b antagomirs-a class of chemically modified anti-miRNA oligonucleotide-suppresses breast cancer metastasis. Both in vitro and in vivo, silencing of miR-10b with antagomirs significantly decreases miR-10b levels and increases the levels of a functionally important miR-10b target, Hoxd10. Administration of miR-10b antagomirs to mice bearing highly metastatic cells does not reduce primary mammary tumor growth but markedly suppresses formation of lung metastases in a sequence-specific manner. The miR-10b antagomir, which is well tolerated by normal animals, appears to be a promising candidate for the development of new anti-metastasis agents.
LinkOut: [PMID: 20351690]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MDA-MB-231 , SUM1315
Disease 15430.0
Location of target site 3'UTR
Tools used in this research unknown
Original Description (Extracted from the article) ... "The present review summarizes evidence for the growing implication of miR-10b miRNA in cancer progression ...

- Ma L, 2010, Breast cancer research : BCR.

Article - Ma L
- Breast cancer research : BCR, 2010
Ninety percent of cancer-related mortality is caused by metastasis. Current cancer treatments can control many primary tumors but rarely stop the metastatic spread. Accumulating evidence demonstrates that miRNAs are involved in cancer initiation and progression. Furthermore, several miRNAs have been found to regulate metastasis. In particular, recent studies provide the first functional evidence that overexpression of a specific miRNA, miR-10b, can contribute to the development of metastasis, which can be exploited therapeutically in treating breast cancer metastasis in mice. Further in-depth analysis should provide more precise evaluation of the roles, mechanisms, and therapeutic utility of this miRNA in breast cancer.
LinkOut: [PMID: 21067538]
231 mmu-miR-10b-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT004722 Hoxd10 homeobox D10 3 2
MIRT006017 Klf4 Kruppel-like factor 4 (gut) 1 1
MIRT006023 Cdkn1a cyclin-dependent kinase inhibitor 1A (P21) 1 1
MIRT577430 Tube1 epsilon-tubulin 1 1 1
MIRT577599 Suv39h2 suppressor of variegation 3-9 homolog 2 (Drosophila) 1 1
MIRT577747 Shroom1 shroom family member 1 1 2
MIRT578003 Pgpep1 pyroglutamyl-peptidase I 1 1
MIRT578625 Hapln4 hyaluronan and proteoglycan link protein 4 1 1
MIRT579103 Cmklr1 chemokine-like receptor 1 1 4
MIRT579662 Lyrm9 LYR motif containing 9 1 1
MIRT579868 Zbtb8b zinc finger and BTB domain containing 8b 1 1
MIRT580500 Tfam transcription factor A, mitochondrial 1 2
MIRT580586 Tbl1xr1 transducin (beta)-like 1X-linked receptor 1 1 2
MIRT581319 Rhbdl3 rhomboid, veinlet-like 3 (Drosophila) 1 5
MIRT581708 Ppara peroxisome proliferator activated receptor alpha 1 1
MIRT582366 Mtf1 metal response element binding transcription factor 1 1 1
MIRT582483 Mdga2 MAM domain containing glycosylphosphatidylinositol anchor 2 1 1
MIRT582499 Mboat1 membrane bound O-acyltransferase domain containing 1 1 1
MIRT582768 Kif3a kinesin family member 3A 1 1
MIRT582993 Iffo2 intermediate filament family orphan 2 1 1
MIRT583065 Hook3 hook microtubule tethering protein 3 1 1
MIRT584125 Crkl v-crk avian sarcoma virus CT10 oncogene homolog-like 1 1
MIRT584351 Cdk8 cyclin-dependent kinase 8 1 1
MIRT585185 Zfp780b zinc finger protein 780B 1 1
MIRT585254 Zfp446 zinc finger protein 446 1 2
MIRT585367 Xrcc2 X-ray repair complementing defective repair in Chinese hamster cells 2 1 2
MIRT585505 Tstd2 thiosulfate sulfurtransferase (rhodanese)-like domain containing 2 1 1
MIRT585618 Tnfrsf10b tumor necrosis factor receptor superfamily, member 10b 1 1
MIRT585804 Smad9 SMAD family member 9 1 2
MIRT585818 Slc6a20b solute carrier family 6 (neurotransmitter transporter), member 20B 1 1
MIRT585860 Slc24a6 solute carrier family 8 (sodium/lithium/calcium exchanger), member B1 1 2
MIRT586086 Rfxank regulatory factor X-associated ankyrin-containing protein 1 2
MIRT586332 Pex13 peroxisomal biogenesis factor 13 1 2
MIRT586368 Pde4c phosphodiesterase 4C, cAMP specific 1 2
MIRT586442 Nsl1 NSL1, MIS12 kinetochore complex component 1 1
MIRT586459 Nosip nitric oxide synthase interacting protein 1 1
MIRT586481 Nkiras1 NFKB inhibitor interacting Ras-like protein 1 1 3
MIRT586572 Mrpl35 mitochondrial ribosomal protein L35 1 1
MIRT586609 Mmachc methylmalonic aciduria cblC type, with homocystinuria 1 1
MIRT587165 Gal3st3 galactose-3-O-sulfotransferase 3 1 1
MIRT587189 Foxl1 forkhead box L1 1 2
MIRT587283 Fadd Fas (TNFRSF6)-associated via death domain 1 1
MIRT587373 E130311K13Rik RIKEN cDNA E130311K13 gene 1 2
MIRT587418 Dnase2a deoxyribonuclease II alpha 1 2
MIRT587454 Dhx37 DEAH (Asp-Glu-Ala-His) box polypeptide 37 1 2
MIRT587563 Cts8 cathepsin 8 1 1
MIRT587673 Cdk7 cyclin-dependent kinase 7 1 2
MIRT587797 Ccl9 chemokine (C-C motif) ligand 9 1 2
MIRT587875 Bpnt1 bisphosphate 3'-nucleotidase 1 1 1
MIRT587920 B4galnt2 beta-1,4-N-acetyl-galactosaminyl transferase 2 1 2
MIRT588215 Timmdc1 translocase of inner mitochondrial membrane domain containing 1 1 2
MIRT588253 Smco1 single-pass membrane protein with coiled-coil domains 1 1 2
MIRT588421 Zbtb6 zinc finger and BTB domain containing 6 1 2
MIRT588467 Xkrx X-linked Kx blood group related, X-linked 1 2
MIRT588529 Usp45 ubiquitin specific petidase 45 1 2
MIRT588787 Stam signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 1 1
MIRT589498 Mzt1 mitotic spindle organizing protein 1 1 1
MIRT589543 Mkl2 MKL/myocardin-like 2 1 1
MIRT589625 Lrrc58 leucine rich repeat containing 58 1 2
MIRT589675 Lats1 large tumor suppressor 1 2
MIRT589749 Ajuba ajuba LIM protein 1 2
MIRT589919 Gmeb1 glucocorticoid modulatory element binding protein 1 1 2
MIRT590375 Cep97 centrosomal protein 97 1 2
MIRT590421 Ccdc127 coiled-coil domain containing 127 1 2
MIRT590648 Arhgap19 Rho GTPase activating protein 19 1 1
MIRT590710 AI597468 transmembrane protein 263 1 2
MIRT590886 Ttyh1 tweety family member 1 1 2
MIRT591083 Polr1b polymerase (RNA) I polypeptide B 1 1
MIRT591534 9330159F19Rik RIKEN cDNA 9330159F19 gene 1 2
MIRT591587 Zbtb44 zinc finger and BTB domain containing 44 1 1
MIRT591693 Sc5d sterol-C5-desaturase 1 1
MIRT591757 Ppm1k protein phosphatase 1K (PP2C domain containing) 1 1
MIRT592097 Slc25a42 solute carrier family 25, member 42 1 1
MIRT592137 Rad1 RAD1 checkpoint DNA exonuclease 1 2
MIRT592197 March2 membrane-associated ring finger (C3HC4) 2 1 2
MIRT592617 Mga MAX gene associated 1 2
MIRT592760 Dusp3 dual specificity phosphatase 3 (vaccinia virus phosphatase VH1-related) 1 2
MIRT592803 Cbln3 cerebellin 3 precursor protein 1 2
MIRT592822 Bach2 BTB and CNC homology, basic leucine zipper transcription factor 2 1 2
MIRT593171 D14Abb1e family with sequence similarity 208, member A 1 2
MIRT593283 C5ar2 complement component 5a receptor 2 1 2
MIRT593472 Il1rl1 interleukin 1 receptor-like 1 1 2
MIRT593491 Gjc3 gap junction protein, gamma 3 1 1
MIRT593498 Fam65b RHO family interacting cell polarization regulator 2 1 2
MIRT593526 Cflar CASP8 and FADD-like apoptosis regulator 1 2
MIRT593534 Cd93 CD93 antigen 1 1
MIRT593569 Fnip2 folliculin interacting protein 2 1 2
MIRT594284 Prf1 perforin 1 (pore forming protein) 1 1
MIRT596573 Zfp799 zinc finger protein 799 1 1
MIRT596640 Zfp354a zinc finger protein 354A 1 1
MIRT596652 Zfp345 zinc finger protein 345 1 1
MIRT596673 Zfp317 zinc finger protein 317 1 1
MIRT596681 Zfp113 zinc finger protein 113 1 1
MIRT596709 Zbtb8a zinc finger and BTB domain containing 8a 1 1
MIRT596856 Ttc26 tetratricopeptide repeat domain 26 1 1
MIRT596868 Ttc23 tetratricopeptide repeat domain 23 1 1
MIRT596916 Trim27 tripartite motif-containing 27 1 1
MIRT596931 Tox4 TOX high mobility group box family member 4 1 1
MIRT597009 Tigd3 tigger transposable element derived 3 1 1
MIRT597048 Tex9 testis expressed gene 9 1 1
MIRT597107 Syt15 synaptotagmin XV 1 1
MIRT597197 Sox7 SRY (sex determining region Y)-box 7 1 1
MIRT597250 Slc35e1 solute carrier family 35, member E1 1 1
MIRT597308 Slc15a1 solute carrier family 15 (oligopeptide transporter), member 1 1 1
MIRT597476 Trmt10a tRNA methyltransferase 10A 1 1
MIRT597488 Rbm8a RNA binding motif protein 8a 1 1
MIRT597509 Rbm11 RNA binding motif protein 11 1 1
MIRT597527 Rbak RB-associated KRAB zinc finger 1 1
MIRT597550 Ranbp3l RAN binding protein 3-like 1 1
MIRT597564 Rab11fip5 RAB11 family interacting protein 5 (class I) 1 1
MIRT597574 Pycr1 pyrroline-5-carboxylate reductase 1 1 1
MIRT597593 Ptpn2 protein tyrosine phosphatase, non-receptor type 2 1 1
MIRT597609 Ptk6 PTK6 protein tyrosine kinase 6 1 1
MIRT597766 Pnpla3 patatin-like phospholipase domain containing 3 1 1
MIRT597789 Plek pleckstrin 1 1
MIRT597907 Paxip1 PAX interacting (with transcription-activation domain) protein 1 1 1
MIRT597913 Parp11 poly (ADP-ribose) polymerase family, member 11 1 1
MIRT597941 Osbpl8 oxysterol binding protein-like 8 1 1
MIRT597957 Ooep oocyte expressed protein 1 1
MIRT598053 Nip7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT598119 Ncan neurocan 1 1
MIRT598263 Mfap1a microfibrillar-associated protein 1A 1 1
MIRT598332 Mbd4 methyl-CpG binding domain protein 4 1 1
MIRT598373 Man2a2 mannosidase 2, alpha 2 1 1
MIRT598418 Lrrn4cl LRRN4 C-terminal like 1 1
MIRT598491 Kdelc2 KDEL (Lys-Asp-Glu-Leu) containing 2 1 1
MIRT598519 Klhl41 kelch-like 41 1 1
MIRT598693 Mroh1 maestro heat-like repeat family member 1 1 1
MIRT598757 Gpr68 G protein-coupled receptor 68 1 1
MIRT598783 Gnl3l guanine nucleotide binding protein-like 3 (nucleolar)-like 1 1
MIRT598818 Gm4925 predicted gene 4925 1 1
MIRT599049 Exosc4 exosome component 4 1 1
MIRT599083 Efr3b EFR3 homolog B 1 1
MIRT599090 Efcab4a calcium release activated channel regulator 2B 1 1
MIRT599108 Ecm2 extracellular matrix protein 2, female organ and adipocyte specific 1 1
MIRT599222 Dclre1c DNA cross-link repair 1C 1 1
MIRT599442 Cercam cerebral endothelial cell adhesion molecule 1 1
MIRT599531 Car8 carbonic anhydrase 8 1 1
MIRT599607 Bloc1s3 biogenesis of lysosomal organelles complex-1, subunit 3 1 1
MIRT599699 Aqp7 aquaporin 7 1 1
MIRT599865 Aco1 aconitase 1 1 1
MIRT599882 Acer1 alkaline ceramidase 1 1 1
MIRT599940 Rmi2 RecQ mediated genome instability 2 1 1
MIRT599978 Tpgs2 tubulin polyglutamylase complex subunit 2 1 1
MIRT600025 2810006K23Rik RIKEN cDNA 2810006K23 gene 1 1
MIRT600078 Knop1 lysine rich nucleolar protein 1 1 1
MIRT600157 Zdhhc3 zinc finger, DHHC domain containing 3 1 1
MIRT600349 Ston2 stonin 2 1 1
MIRT600394 Slc2a4 solute carrier family 2 (facilitated glucose transporter), member 4 1 1
MIRT600423 Samd8 sterile alpha motif domain containing 8 1 1
MIRT600658 Mcc mutated in colorectal cancers 1 1
MIRT600702 Lpp LIM domain containing preferred translocation partner in lipoma 1 1
MIRT600723 Kif24 kinesin family member 24 1 1
MIRT600761 Isg20l2 interferon stimulated exonuclease gene 20-like 2 1 1
MIRT600996 Cybrd1 cytochrome b reductase 1 1 1
MIRT601015 Csrnp3 cysteine-serine-rich nuclear protein 3 1 1
MIRT601098 Cbfa2t2 core-binding factor, runt domain, alpha subunit 2, translocated to, 2 (human) 1 1
MIRT601226 Adra2b adrenergic receptor, alpha 2b 1 1
MIRT601591 Smtnl2 smoothelin-like 2 1 1
MIRT601646 Siglece sialic acid binding Ig-like lectin E 1 1
MIRT601665 Senp5 SUMO/sentrin specific peptidase 5 1 1
MIRT601782 Rac2 RAS-related C3 botulinum substrate 2 1 1
MIRT602037 Mmp25 matrix metallopeptidase 25 1 1
MIRT602292 Gls glutaminase 1 1
MIRT602338 Gaa glucosidase, alpha, acid 1 1
MIRT602474 Dnajc1 DnaJ heat shock protein family (Hsp40) member C1 1 1
MIRT602514 Decr2 2-4-dienoyl-Coenzyme A reductase 2, peroxisomal 1 1
MIRT602527 Gdpgp1 GDP-D-glucose phosphorylase 1 1 1
MIRT602539 Cyb5d2 cytochrome b5 domain containing 2 1 1
MIRT602663 Car9 carbonic anhydrase 9 1 1
MIRT602819 Akap8 A kinase (PRKA) anchor protein 8 1 1
MIRT602835 Agl amylo-1,6-glucosidase, 4-alpha-glucanotransferase 1 1
MIRT602888 4930519G04Rik RIKEN cDNA 4930519G04 gene 1 1
MIRT602982 Sgms2 sphingomyelin synthase 2 1 1
MIRT603255 Tbc1d24 TBC1 domain family, member 24 1 1
MIRT603297 Spib Spi-B transcription factor (Spi-1/PU.1 related) 1 1
MIRT603481 Rbm34 RNA binding motif protein 34 1 1
MIRT603512 Rab11b RAB11B, member RAS oncogene family 1 1
MIRT603547 Ptchd2 dispatched RND transporter family member 3 1 1
MIRT603554 Psmb11 proteasome (prosome, macropain) subunit, beta type, 11 1 1
MIRT603570 Prdx1 peroxiredoxin 1 1 1
MIRT603657 Oscp1 organic solute carrier partner 1 1 1
MIRT603676 Ogfod1 2-oxoglutarate and iron-dependent oxygenase domain containing 1 1 1
MIRT603763 Med18 mediator complex subunit 18 1 1
MIRT603767 Mdc1 mediator of DNA damage checkpoint 1 1 1
MIRT603839 Kcnk6 potassium inwardly-rectifying channel, subfamily K, member 6 1 1
MIRT603892 Ifnar1 interferon (alpha and beta) receptor 1 1 1
MIRT603926 Hist1h2ac histone cluster 1, H2ac 1 1
MIRT604032 Fam118a family with sequence similarity 118, member A 1 1
MIRT604060 Epb4.2 erythrocyte membrane protein band 4.2 1 1
MIRT604090 Dqx1 DEAQ RNA-dependent ATPase 1 1
MIRT604118 Dhrs7b dehydrogenase/reductase (SDR family) member 7B 1 1
MIRT604133 Ddhd2 DDHD domain containing 2 1 1
MIRT604150 Dars2 aspartyl-tRNA synthetase 2 (mitochondrial) 1 1
MIRT604256 Cenpl centromere protein L 1 1
MIRT604454 Fam227a family with sequence similarity 227, member A 1 1
MIRT604512 2010315B03Rik RIKEN cDNA 2010315B03 gene 1 1
MIRT604528 Zyg11b zyg-ll family member B, cell cycle regulator 1 1
MIRT604554 Vsig10 V-set and immunoglobulin domain containing 10 1 1
MIRT604566 Ube2v2 ubiquitin-conjugating enzyme E2 variant 2 1 1
MIRT604664 Slc35e2 solute carrier family 35, member E2 1 1
MIRT604740 Rnd1 Rho family GTPase 1 1 1
MIRT604807 P2ry4 pyrimidinergic receptor P2Y, G-protein coupled, 4 1 1
MIRT604914 Irak2 interleukin-1 receptor-associated kinase 2 1 1
MIRT604951 Gng2 guanine nucleotide binding protein (G protein), gamma 2 1 1
MIRT605258 6030458C11Rik RIKEN cDNA 6030458C11 gene 1 1
MIRT605263 2810474O19Rik RIKEN cDNA 2810474O19 gene 1 1
MIRT605269 Fam219b family with sequence similarity 219, member B 1 1
MIRT605372 Vamp3 vesicle-associated membrane protein 3 1 1
MIRT605384 Ube2j2 ubiquitin-conjugating enzyme E2J 2 1 1
MIRT605436 Stom stomatin 1 1
MIRT605576 Ocln occludin 1 1
MIRT605635 Mfn1 mitofusin 1 1 1
MIRT605641 Mcm5 minichromosome maintenance complex component 5 1 1
MIRT605969 Pafah1b2 platelet-activating factor acetylhydrolase, isoform 1b, subunit 2 1 1
MIRT606097 Utp15 UTP15 small subunit processome component 1 1
MIRT606147 Tcf25 transcription factor 25 (basic helix-loop-helix) 1 1
MIRT606229 Ramp1 receptor (calcitonin) activity modifying protein 1 1 1
MIRT606248 Ppih peptidyl prolyl isomerase H 1 1
MIRT606295 Nrcam neuronal cell adhesion molecule 1 1
MIRT606330 Mfsd11 major facilitator superfamily domain containing 11 1 1
MIRT606361 Iws1 IWS1, SUPT6 interacting protein 1 1
MIRT606415 Gfpt1 glutamine fructose-6-phosphate transaminase 1 1 1
MIRT606448 Eno2 enolase 2, gamma neuronal 1 1
MIRT606455 Elmo2 engulfment and cell motility 2 1 1
MIRT606575 Zmat3 zinc finger matrin type 3 1 1
MIRT606590 Wipf2 WAS/WASL interacting protein family, member 2 1 1
MIRT606638 Nufip2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT606677 Ercc6 excision repair cross-complementing rodent repair deficiency, complementation group 6 1 1
MIRT606684 Ddx19b DEAD (Asp-Glu-Ala-Asp) box polypeptide 19b 1 1
MIRT732919 MSN moesin 2 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-10b (S)-3,5-dihydroxyphenylglycine (DHPG) NULL 443586 Quantitative real-time PCR mouse brain 22309833 2012 up-regulated
miR-10b Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-10b Ethanol NULL 702 Microarray fetal mouse brains 19091803 2009 up-regulated
miR-10b Ethanol NULL 702 Northern blot fetal mouse brains 19091803 2009 up-regulated
miR-10b Ethanol NULL 702 Quantitative real-time PCR fetal mouse brains 19091803 2009 up-regulated
miR-10b Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 down-regulated
miR-10b Benzene NULL 241 MiRNA PCR array white blood cell 24780745 2014 up-regulated
miR-10b Benzene NULL 241 MiRNA PCR array blood mononuclear cells 24780745 2014 up-regulated
miR-10b 17beta-estradiol (E2) approved 5757 Microarray MCF-7AKT breast cancer cells 19528081 2009 down-regulated
miR-10b Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-10b Formaldehyde NULL 712 Quantitative real-time PCR Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-10b Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-10b Sulindac sulfide approved 5352624 Quantitative real-time PCR HCT116 colon tumor cells 22286762 2012 down-regulated
miR-10b 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 up-regulated
miR-10b 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-10b Goserelin approved 47725 Microarray prostate 22674191 2012 up-regulated
miR-10b Nicotine approved 89594 Microarray Rat adrenal pheochromocytoma PC12 cell 18845019 2009 down-regulated
miR-10b Aristolochic acid NULL 2236 Microarray kidney 25106556 2014 up-regualted
miR-10b Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 down-regulated

Error report submission