pre-miRNA Information
pre-miRNA hsa-mir-29b-1   
Genomic Coordinates chr7: 130877459 - 130877539
Synonyms MIRN29B1, miRNA29B1, MIR29B1
Description Homo sapiens miR-29b-1 stem-loop
Comment Mourelatos et al. identified two copies of this sequence mapping to chromosome 7, and assigned the names mir-102-7.1 and mir-102-7.2 . Subsequent genome assemblies suggest the presence of only one miR-102 locus on chromosome 7. Human miR-102 is a homologue of mouse miR-29b (MIR:MI0000143) and so has been renamed here for consistency.
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-29b-2   
Genomic Coordinates chr1: 207802443 - 207802523
Synonyms MIRN29B2, mir-29b-2, MIR29B2
Description Homo sapiens miR-29b-2 stem-loop
Comment This sequence was named mir-102-1 in reference . Human miR-102 is a homologue of mouse miR-29b (MIR:MI0000143) and so has been renamed here for consistency.
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-29b-3p
Sequence 52| UAGCACCAUUUGAAAUCAGUGUU |74
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 2 7 - 130877488 29233923 MiREDiBase
A-to-I 2 1 - 207802471 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs773555186 20 dbSNP
rs1390817128 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol GRN   
Synonyms CLN11, GEP, GP88, PCDGF, PEPI, PGRN
Description granulin precursor
Transcript NM_002087   
Expression
Putative miRNA Targets on GRN
3'UTR of GRN
(miRNA target sites are highlighted)
>GRN|NM_002087|3'UTR
   1 GGGACAGTACTGAAGACTCTGCAGCCCTCGGGACCCCACTCGGAGGGTGCCCTCTGCTCAGGCCTCCCTAGCACCTCCCC
  81 CTAACCAAATTCTCCCTGGACCCCATTCTGAGCTCCCCATCACCATGGGAGGTGGGGCCTCAATCTAAGGCCTTCCCTGT
 161 CAGAAGGGGGTTGTGGCAAAAGCCACATTACAAGCTGCCATCCCCTCCCCGTTTCAGTGGACCCTGTGGCCAGGTGCTTT
 241 TCCCTATCCACAGGGGTGTTTGTGTGTGTGCGCGTGTGCGTTTCAATAAAGTTTGTACACTTTCTTAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' uugugacuaaaguuuaCCACGAu 5'
                          |||||| 
Target 5' gtggaccctgtggccaGGTGCTt 3'
217 - 239 120.00 -11.10
2
miRNA  3' uugugacuaaAGUUUACCACGau 5'
                    ||::| |||||  
Target 5' gggaccccacTCGGAGGGTGCcc 3'
30 - 52 105.00 -12.00
3
miRNA  3' uuGUGACUA-AAGUUUAC-CACGau 5'
            ||  |:| ||:: :|| ||||  
Target 5' caCAGGGGTGTTTGTGTGTGTGCgc 3'
249 - 273 105.00 -9.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
890446 13 ClinVar
890447 31 ClinVar
29742 79 ClinVar
891013 247 ClinVar
891014 274 ClinVar
323539 281 ClinVar
COSN28860951 8 COSMIC
COSN30130070 9 COSMIC
COSN26604438 13 COSMIC
COSN30472489 30 COSMIC
COSN18740787 79 COSMIC
COSN16053834 246 COSMIC
rs5848 79 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs765679764 2 dbSNP
rs1368598153 3 dbSNP
rs775440171 13 dbSNP
rs996951779 16 dbSNP
rs1026659255 18 dbSNP
rs763051832 19 dbSNP
rs764247201 24 dbSNP
rs563619928 25 dbSNP
rs751858985 30 dbSNP
rs374114836 31 dbSNP
rs1006498105 33 dbSNP
rs750229957 34 dbSNP
rs756125597 35 dbSNP
rs1223140872 36 dbSNP
rs540205220 42 dbSNP
rs529528077 43 dbSNP
rs1209242701 44 dbSNP
rs754564005 48 dbSNP
rs1444763470 51 dbSNP
rs372352654 52 dbSNP
rs747897803 53 dbSNP
rs1466958461 60 dbSNP
rs1250280017 70 dbSNP
rs5848 79 dbSNP
rs1039436822 86 dbSNP
rs1236176987 88 dbSNP
rs550309231 93 dbSNP
rs1212350976 96 dbSNP
rs1451267684 98 dbSNP
rs1059738 109 dbSNP
rs1274271862 118 dbSNP
rs1297901712 121 dbSNP
rs1344106077 127 dbSNP
rs958822615 132 dbSNP
rs1395198034 140 dbSNP
rs1376914640 144 dbSNP
rs1059771 146 dbSNP
rs1304460337 150 dbSNP
rs568615479 153 dbSNP
rs991942915 156 dbSNP
rs914592446 160 dbSNP
rs1166392989 167 dbSNP
rs1363555071 168 dbSNP
rs1431234995 171 dbSNP
rs78994411 178 dbSNP
rs1392465795 188 dbSNP
rs530970175 188 dbSNP
rs1171583702 192 dbSNP
rs1802312 196 dbSNP
rs1423541081 197 dbSNP
rs1412264728 201 dbSNP
rs1184104096 203 dbSNP
rs1483651898 212 dbSNP
rs947360595 216 dbSNP
rs977335906 217 dbSNP
rs900660526 223 dbSNP
rs995055474 228 dbSNP
rs552375884 247 dbSNP
rs780165151 248 dbSNP
rs1243816181 255 dbSNP
rs1319633326 261 dbSNP
rs943909013 262 dbSNP
rs1040876106 263 dbSNP
rs747463602 265 dbSNP
rs1305612202 266 dbSNP
rs144973107 270 dbSNP
rs1005152960 272 dbSNP
rs1024289551 273 dbSNP
rs971394484 274 dbSNP
rs980173072 275 dbSNP
rs1048150609 277 dbSNP
rs927437710 280 dbSNP
rs116547342 281 dbSNP
rs1411821729 292 dbSNP
rs746573188 301 dbSNP
rs990027247 304 dbSNP
rs1003870722 307 dbSNP
rs1251524411 308 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293FT , NIH3T3
Disease Frontotemporal Dementia;
Location of target site 3'UTR
Original Description (Extracted from the article) ... We identified an evolutionarily conserved binding site for microRNA-29b (miR-29b) in the 3' untranslated region (3' UTR) of the human PGRN (hPGRN) mRNA.// ...

- Jiao J; Herl LD; Farese RV; Gao FB, 2010, PloS one.

Article - Jiao J; Herl LD; Farese RV; Gao FB
- PloS one, 2010
Progranulin deficiency is thought to cause some forms of frontotemporal dementia (FTD), a major early-onset age-dependent neurodegenerative disease. How progranulin (PGRN) expression is regulated is largely unknown. We identified an evolutionarily conserved binding site for microRNA-29b (miR-29b) in the 3' untranslated region (3'UTR) of the human PGRN (hPGRN) mRNA. miR-29b downregulates the expression of luciferase through hPGRN or mouse PGRN (mPGRN) 3'UTRs, and the regulation was abolished by mutations in the miR-29b binding site. To examine the direct effect of manipulating endogenous miR-29b on hPGRN expression, we established a stable NIH3T3 cell line that expresses hPGRN under the control of the cytomegalovirus promoter. Ectopic expression of miR-29b decreased hPGRN expression at the both mRNA and protein levels. Conversely, knockdown of endogenous miR-29b with locked nucleic acid increased the production and secretion of hPGRN in NIH3T3 cells. Endogenous hPGRN in HEK 293 cells was also regulated by miR-29b. These findings identify miR-29b as a novel posttranscriptional regulator of PGRN expression, raising the possibility that miR-29b or other miRNAs might be targeted therapeutically to increase hPGRN levels in some FTD patients.
LinkOut: [PMID: 20479936]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.745 8.2e-5 -0.656 8.4e-4 20 Click to see details
GSE42095 Differentiated embryonic stem cells 0.671 2.3e-4 0.483 9.8e-3 23 Click to see details
GSE14794 Lymphoblastoid cells 0.276 4.2e-3 0.270 5.0e-3 90 Click to see details
GSE32688 Pancreatic cancer 0.399 1.2e-2 0.382 1.5e-2 32 Click to see details
GSE17498 Multiple myeloma 0.285 3.7e-2 0.231 7.6e-2 40 Click to see details
GSE27834 Pluripotent stem cells 0.439 4.4e-2 0.409 5.8e-2 16 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.678 6.9e-2 -0.886 9.4e-3 6 Click to see details
GSE21687 Ependynoma primary tumors -0.181 7.6e-2 -0.146 1.2e-1 64 Click to see details
GSE19536 Breast cancer -0.138 8.5e-2 -0.094 1.8e-1 100 Click to see details
GSE38226 Liver fibrosis -0.281 1.1e-1 -0.295 9.7e-2 21 Click to see details
GSE26953 Aortic valvular endothelial cells 0.26 1.1e-1 0.052 4.0e-1 24 Click to see details
GSE21032 Prostate cancer -0.072 2.6e-1 0.071 2.6e-1 83 Click to see details
GSE21849 B cell lymphoma 0.113 2.8e-1 0.193 1.6e-1 29 Click to see details
GSE28260 Renal cortex and medulla 0.138 3.3e-1 0.198 2.6e-1 13 Click to see details
GSE19783 ER- ER- breast cancer -0.044 3.5e-1 0.004 4.9e-1 79 Click to see details
GSE17306 Multiple myeloma 0.045 3.8e-1 0.080 2.9e-1 49 Click to see details
GSE19350 CNS germ cell tumors -0.081 4.0e-1 0.042 4.5e-1 12 Click to see details
GSE28544 Breast cancer 0.046 4.2e-1 -0.090 3.4e-1 24 Click to see details
GSE19783 ER+ ER+ breast cancer 0.046 4.2e-1 0.011 4.8e-1 20 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.039 4.3e-1 0.038 4.3e-1 25 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.032 4.4e-1 -0.106 3.1e-1 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BLCA 0.692 0 0.519 0.01 18 Click to see details
PRAD 0.384 0 0.414 0 50 Click to see details
UCEC -0.341 0.08 -0.356 0.07 19 Click to see details
HNSC 0.21 0.09 0.171 0.14 42 Click to see details
LUSC 0.205 0.11 0.108 0.26 38 Click to see details
THCA -0.162 0.11 -0.173 0.1 59 Click to see details
PCPG 0.911 0.14 1.000 0.5 3 Click to see details
CESC 0.901 0.14 0.500 0.33 3 Click to see details
CHOL 0.366 0.17 0.283 0.23 9 Click to see details
ESCA -0.312 0.18 -0.018 0.48 11 Click to see details
PAAD -0.633 0.18 -0.400 0.3 4 Click to see details
LUAD -0.267 0.2 -0.133 0.34 12 Click to see details
KICH -0.161 0.22 -0.263 0.1 25 Click to see details
BRCA -0.067 0.27 -0.060 0.29 84 Click to see details
STAD 0.107 0.28 0.192 0.15 32 Click to see details
LIHC -0.078 0.3 -0.065 0.33 49 Click to see details
KIRP 0.078 0.34 -0.009 0.48 32 Click to see details
KIRC -0.039 0.38 0.108 0.19 68 Click to see details
COAD 0.106 0.4 -0.024 0.48 8 Click to see details
COAD 0.106 0.4 -0.024 0.48 8 Click to see details
COAD 0.106 0.4 -0.024 0.48 8 Click to see details
248 hsa-miR-29b-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000095 TGFB3 transforming growth factor beta 3 2 1
MIRT000096 HDAC4 histone deacetylase 4 4 4
MIRT000097 CTNNBIP1 catenin beta interacting protein 1 4 4
MIRT000098 COL5A3 collagen type V alpha 3 chain 2 2
MIRT000099 COL4A2 collagen type IV alpha 2 chain 2 2
MIRT000100 COL1A1 collagen type I alpha 1 chain 8 8
MIRT000101 ACVR2A activin A receptor type 2A 1 1
MIRT000445 SP1 Sp1 transcription factor 5 6
MIRT000684 CDK6 cyclin dependent kinase 6 6 5
MIRT000930 BACE1 beta-secretase 1 3 1
MIRT002310 SFPQ splicing factor proline and glutamine rich 3 1
MIRT002316 DNAJB11 DnaJ heat shock protein family (Hsp40) member B11 3 1
MIRT003026 DNMT3B DNA methyltransferase 3 beta 4 7
MIRT003029 DNMT3A DNA methyltransferase 3 alpha 5 9
MIRT003287 MCL1 MCL1, BCL2 family apoptosis regulator 7 20
MIRT003290 BCL2 BCL2, apoptosis regulator 4 3
MIRT003661 DNMT1 DNA methyltransferase 1 4 2
MIRT003736 S100B S100 calcium binding protein B 3 1
MIRT003813 VEGFA vascular endothelial growth factor A 9 9
MIRT004308 ESR1 estrogen receptor 1 2 1
MIRT004312 NCOA3 nuclear receptor coactivator 3 2 1
MIRT004419 TET1 tet methylcytosine dioxygenase 1 4 2
MIRT004510 TCL1A T-cell leukemia/lymphoma 1A 5 4
MIRT005381 Mmp15 matrix metallopeptidase 15 3 1
MIRT005383 MMP15 matrix metallopeptidase 15 2 1
MIRT005385 MMP24 matrix metallopeptidase 24 4 2
MIRT005387 Mmp24 matrix metallopeptidase 24 2 1
MIRT005486 GRN granulin precursor 4 1
MIRT005522 FGG fibrinogen gamma chain 2 1
MIRT005533 FGA fibrinogen alpha chain 2 1
MIRT005534 FGB fibrinogen beta chain 2 1
MIRT005567 COL3A1 collagen type III alpha 1 chain 5 4
MIRT005568 COL4A1 collagen type IV alpha 1 chain 7 9
MIRT005570 MMP2 matrix metallopeptidase 2 5 8
MIRT005614 BBC3 BCL2 binding component 3 2 2
MIRT005667 ADAM12 ADAM metallopeptidase domain 12 5 3
MIRT005669 NID1 nidogen 1 4 1
MIRT006054 HMGA2 high mobility group AT-hook 2 3 1
MIRT006058 TGFB2 transforming growth factor beta 2 3 2
MIRT006059 TGFB1 transforming growth factor beta 1 2 1
MIRT006060 BMP1 bone morphogenetic protein 1 3 2
MIRT006098 PTEN phosphatase and tensin homolog 7 3
MIRT006251 NASP nuclear autoantigenic sperm protein 2 1
MIRT006486 PPP1R13B protein phosphatase 1 regulatory subunit 13B 2 1
MIRT006488 CDC42 cell division cycle 42 4 2
MIRT006753 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT006815 PIK3CG phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma 3 1
MIRT006915 NKIRAS2 NFKB inhibitor interacting Ras like 2 5 3
MIRT007011 RAX retina and anterior neural fold homeobox 2 1
MIRT007033 TBX21 T-box 21 1 1
MIRT007034 IFNG interferon gamma 1 1
MIRT007102 DUSP2 dual specificity phosphatase 2 3 3
MIRT007254 FOS Fos proto-oncogene, AP-1 transcription factor subunit 3 3
MIRT027237 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 2 2
MIRT027238 IMPDH1 inosine monophosphate dehydrogenase 1 2 2
MIRT027239 MYCN MYCN proto-oncogene, bHLH transcription factor 3 3
MIRT048359 SCAF8 SR-related CTD associated factor 8 1 1
MIRT048360 CLDN1 claudin 1 1 1
MIRT048361 MRPS35 mitochondrial ribosomal protein S35 1 1
MIRT048362 RSL24D1 ribosomal L24 domain containing 1 1 1
MIRT048363 LRP10 LDL receptor related protein 10 1 1
MIRT048364 HP1BP3 heterochromatin protein 1 binding protein 3 1 1
MIRT048365 B4GALT5 beta-1,4-galactosyltransferase 5 1 1
MIRT048366 KIAA1671 KIAA1671 1 1
MIRT048367 NNT nicotinamide nucleotide transhydrogenase 1 1
MIRT048368 IFIH1 interferon induced with helicase C domain 1 1 1
MIRT048369 TPT1 tumor protein, translationally-controlled 1 1 1
MIRT048370 RUNDC3B RUN domain containing 3B 1 1
MIRT048371 CECR2 CECR2, histone acetyl-lysine reader 1 1
MIRT048372 TPD52L2 tumor protein D52 like 2 1 1
MIRT048373 NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit 1 1
MIRT048374 CIT citron rho-interacting serine/threonine kinase 1 1
MIRT048375 GNB2L1 receptor for activated C kinase 1 1 1
MIRT048376 SMARCC1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin subfamily c member 1 1 1
MIRT048377 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 1
MIRT048378 PIGN phosphatidylinositol glycan anchor biosynthesis class N 1 1
MIRT048379 RPS4X ribosomal protein S4, X-linked 1 1
MIRT048380 CCSAP centriole, cilia and spindle associated protein 1 1
MIRT048381 CALU calumenin 1 1
MIRT048382 NREP neuronal regeneration related protein 1 1
MIRT048383 MKI67 marker of proliferation Ki-67 1 1
MIRT053293 TDG thymine DNA glycosylase 5 5
MIRT053581 CCND2 cyclin D2 5 3
MIRT053738 COL4A5 collagen type IV alpha 5 chain 1 1
MIRT053739 COL7A1 collagen type VII alpha 1 chain 1 1
MIRT053740 COL15A1 collagen type XV alpha 1 chain 1 1
MIRT053741 COL2A1 collagen type II alpha 1 chain 1 1
MIRT053742 COL4A6 collagen type IV alpha 6 chain 1 1
MIRT053743 CSGALNACT2 chondroitin sulfate N-acetylgalactosaminyltransferase 2 1 1
MIRT053744 SOX12 SRY-box 12 1 1
MIRT053745 MAP2K6 mitogen-activated protein kinase kinase 6 1 1
MIRT053746 TGIF2 TGFB induced factor homeobox 2 1 1
MIRT053747 SERPINH1 serpin family H member 1 2 2
MIRT053748 NOTCH2 notch 2 4 1
MIRT053749 PPARD peroxisome proliferator activated receptor delta 1 1
MIRT054045 SNAI3 snail family transcriptional repressor 3 2 1
MIRT054192 AKT2 AKT serine/threonine kinase 2 4 2
MIRT054574 PER1 period circadian clock 1 3 1
MIRT060983 LAMC1 laminin subunit gamma 1 3 1
MIRT061662 BTG2 BTG anti-proliferation factor 2 2 4
MIRT067385 TMTC3 transmembrane and tetratricopeptide repeat containing 3 2 4
MIRT079942 RNF138 ring finger protein 138 2 2
MIRT080798 SH3GLB1 SH3 domain containing GRB2 like, endophilin B1 2 4
MIRT081893 KCTD15 potassium channel tetramerization domain containing 15 2 8
MIRT082515 CALM3 calmodulin 3 2 2
MIRT085293 CCNT2 cyclin T2 2 6
MIRT102856 INSIG1 insulin induced gene 1 2 2
MIRT207249 TET3 tet methylcytosine dioxygenase 3 2 2
MIRT207755 VHL von Hippel-Lindau tumor suppressor 2 4
MIRT210969 TET2 tet methylcytosine dioxygenase 2 1 1
MIRT211650 ABCE1 ATP binding cassette subfamily E member 1 2 2
MIRT213230 REST RE1 silencing transcription factor 2 10
MIRT225103 GOLGA7 golgin A7 2 2
MIRT250481 MAZ MYC associated zinc finger protein 2 2
MIRT264266 FAM102B family with sequence similarity 102 member B 2 2
MIRT267090 ZFP91 ZFP91 zinc finger protein 2 2
MIRT303363 MXD1 MAX dimerization protein 1 2 1
MIRT316344 ULBP2 UL16 binding protein 2 2 2
MIRT401476 AIM1 crystallin beta-gamma domain containing 1 2 1
MIRT437369 LAMC2 laminin subunit gamma 2 3 1
MIRT437372 ITGA6 integrin subunit alpha 6 3 2
MIRT437552 COL5A2 collagen type V alpha 2 chain 1 1
MIRT437553 COL10A1 collagen type X alpha 1 chain 1 1
MIRT437554 SPARC secreted protein acidic and cysteine rich 1 1
MIRT437555 FBN1 fibrillin 1 1 1
MIRT437556 LOX lysyl oxidase 2 2
MIRT437557 PDGFRB platelet derived growth factor receptor beta 2 2
MIRT437710 PHACTR2 phosphatase and actin regulator 2 2 1
MIRT437713 TUBB2A tubulin beta 2A class IIa 2 1
MIRT437716 EMP1 epithelial membrane protein 1 2 1
MIRT437719 SNX24 sorting nexin 24 2 1
MIRT437722 AMFR autocrine motility factor receptor 2 1
MIRT437725 RIOK3 RIO kinase 3 2 1
MIRT437728 WDR26 WD repeat domain 26 4 3
MIRT437731 DSC2 desmocollin 2 2 1
MIRT437870 IL32 interleukin 32 1 1
MIRT438911 GATA3 GATA binding protein 3 2 1
MIRT438912 PDGFRA platelet derived growth factor receptor alpha 2 1
MIRT438913 PDGFC platelet derived growth factor C 2 1
MIRT438914 PDGFB platelet derived growth factor subunit B 2 1
MIRT438915 PDGFA platelet derived growth factor subunit A 2 1
MIRT438916 MMP9 matrix metallopeptidase 9 2 1
MIRT438917 LOXL4 lysyl oxidase like 4 2 1
MIRT438918 LOXL2 lysyl oxidase like 2 2 1
MIRT438919 ITGB1 integrin subunit beta 1 2 1
MIRT438920 ANGPTL4 angiopoietin like 4 2 1
MIRT454812 NEDD9 neural precursor cell expressed, developmentally down-regulated 9 2 2
MIRT456827 MORF4L2 mortality factor 4 like 2 2 8
MIRT462151 RPL22 ribosomal protein L22 2 2
MIRT465314 TRAM2 translocation associated membrane protein 2 2 2
MIRT467808 SLC2A14 solute carrier family 2 member 14 2 2
MIRT467829 SLC29A2 solute carrier family 29 member 2 2 2
MIRT467971 SLC16A1 solute carrier family 16 member 1 2 4
MIRT468225 SGK1 serum/glucocorticoid regulated kinase 1 2 2
MIRT469448 REL REL proto-oncogene, NF-kB subunit 2 2
MIRT469723 RAB40C RAB40C, member RAS oncogene family 2 2
MIRT469841 R3HDM4 R3H domain containing 4 2 2
MIRT472643 NAA40 N(alpha)-acetyltransferase 40, NatD catalytic subunit 2 2
MIRT474209 LEPRE1 prolyl 3-hydroxylase 1 1 1
MIRT474576 KLHDC3 kelch domain containing 3 2 2
MIRT475837 HDGF heparin binding growth factor 2 4
MIRT476721 FRK fyn related Src family tyrosine kinase 2 4
MIRT477473 ELMSAN1 ELM2 and Myb/SANT domain containing 1 2 2
MIRT478668 CTC1 CST telomere replication complex component 1 2 14
MIRT478710 CSRNP2 cysteine and serine rich nuclear protein 2 2 2
MIRT478985 COMMD2 COMM domain containing 2 2 2
MIRT479826 CCNA2 cyclin A2 2 8
MIRT479901 CCDC117 coiled-coil domain containing 117 2 2
MIRT480066 CAND1 cullin associated and neddylation dissociated 1 2 2
MIRT482012 AMER1 APC membrane recruitment protein 1 2 8
MIRT489024 C1QTNF6 C1q and TNF related 6 5 2
MIRT492513 RAET1L retinoic acid early transcript 1L 2 2
MIRT493825 FSCN1 fascin actin-bundling protein 1 2 2
MIRT495936 SLC7A5P2 solute carrier family 7 member 5 pseudogene 2 2 2
MIRT496358 PPY pancreatic polypeptide 2 2
MIRT496662 TMEM237 transmembrane protein 237 2 2
MIRT497644 GLDN gliomedin 2 2
MIRT501878 MORF4L1 mortality factor 4 like 1 2 8
MIRT502932 CDC42SE1 CDC42 small effector 1 2 4
MIRT506750 LDOC1L retrotransposon Gag like 6 2 6
MIRT507168 GAS2L3 growth arrest specific 2 like 3 2 2
MIRT514918 MDM2 MDM2 proto-oncogene 2 6
MIRT523962 DYNLT1 dynein light chain Tctex-type 1 2 4
MIRT527675 CASP8 caspase 8 2 2
MIRT536936 HECW1 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 2 2
MIRT537359 FJX1 four jointed box 1 2 2
MIRT537687 ENPP2 ectonucleotide pyrophosphatase/phosphodiesterase 2 2 2
MIRT538124 DDX6 DEAD-box helicase 6 2 2
MIRT538813 C21orf91 chromosome 21 open reading frame 91 2 2
MIRT546938 PTP4A1 protein tyrosine phosphatase type IVA, member 1 2 2
MIRT547104 PLAG1 PLAG1 zinc finger 2 2
MIRT547823 ISG20L2 interferon stimulated exonuclease gene 20 like 2 2 2
MIRT548237 FEM1B fem-1 homolog B 2 2
MIRT550036 WWTR1 WW domain containing transcription regulator 1 2 2
MIRT552619 ZBTB5 zinc finger and BTB domain containing 5 2 2
MIRT556562 LIMS1 LIM zinc finger domain containing 1 2 2
MIRT558857 CDC23 cell division cycle 23 2 2
MIRT565485 SPRTN SprT-like N-terminal domain 2 2
MIRT568205 CBX6 chromobox 6 2 2
MIRT576774 Tmem127 transmembrane protein 127 2 2
MIRT576958 Pigs phosphatidylinositol glycan anchor biosynthesis, class S 2 3
MIRT610003 PIGS phosphatidylinositol glycan anchor biosynthesis class S 2 3
MIRT616511 COX7A2L cytochrome c oxidase subunit 7A2 like 2 2
MIRT640887 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 2
MIRT641350 RAB11FIP1 RAB11 family interacting protein 1 2 2
MIRT642978 TESPA1 thymocyte expressed, positive selection associated 1 2 2
MIRT643634 YY2 YY2 transcription factor 2 2
MIRT644386 ZNF286A zinc finger protein 286A 2 2
MIRT650749 YAE1D1 Yae1 domain containing 1 2 2
MIRT661585 EPHX2 epoxide hydrolase 2 2 2
MIRT664287 RNMTL1 mitochondrial rRNA methyltransferase 3 2 2
MIRT689393 ZNF850 zinc finger protein 850 2 2
MIRT693815 SEC31A SEC31 homolog A, COPII coat complex component 2 2
MIRT694532 TRIM72 tripartite motif containing 72 2 2
MIRT694628 ZFPM1 zinc finger protein, FOG family member 1 2 2
MIRT695135 PRY2 PTPN13-like, Y-linked 2 2 2
MIRT695152 PRY PTPN13-like, Y-linked 2 2
MIRT703640 FBRS fibrosin 2 2
MIRT704551 CNBP CCHC-type zinc finger nucleic acid binding protein 2 2
MIRT704967 CBX2 chromobox 2 2 2
MIRT705497 ASXL2 additional sex combs like 2, transcriptional regulator 2 2
MIRT707993 OTUD4 OTU deubiquitinase 4 2 2
MIRT708741 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT710621 COLEC10 collectin subfamily member 10 2 2
MIRT713056 IFRD1 interferon related developmental regulator 1 2 2
MIRT715515 MAPKBP1 mitogen-activated protein kinase binding protein 1 2 2
MIRT720770 FAM193A family with sequence similarity 193 member A 2 2
MIRT731925 AQP4 aquaporin 4 3 1
MIRT732673 HMGB1 high mobility group box 1 3 0
MIRT734350 IL6 interleukin 6 1 0
MIRT734351 TP53 tumor protein p53 1 0
MIRT734565 BCL2L11 BCL2 like 11 2 0
MIRT734770 TRIM44 tripartite motif containing 44 2 0
MIRT734771 CCNE1 cyclin E1 2 0
MIRT735260 STAT3 signal transducer and activator of transcription 3 6 1
MIRT735414 HBP1 HMG-box transcription factor 1 3 0
MIRT735537 HIF3A hypoxia inducible factor 3 alpha subunit 3 0
MIRT735639 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 3 0
MIRT735641 AKT3 AKT serine/threonine kinase 3 3 0
MIRT735943 DNM3OS DNM3 opposite strand/antisense RNA 4 0
MIRT737493 SMAD3 SMAD family member 3 1 0
MIRT737577 SNAI1 snail family transcriptional repressor 1 2 0
MIRT755941 SLMAP sarcolemma associated protein 4 1
MIRT755963 ROBO1 roundabout guidance receptor 1 5 1
MIRT755964 SRGAP2 SLIT-ROBO Rho GTPase activating protein 2 5 1
MIRT756271 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon 3 1
MIRT756364 LIN7A lin-7 homolog A, crumbs cell polarity complex component 2 1
MIRT756474 COL5A1 collagen type V alpha 1 chain 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-29b 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray Pancreatic Cancer MiaPACA-2 cells 19407485 2009 up-regulated
miR-29b 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray Pancreatic Cancer PANC-1 cells 19407485 2009 up-regulated
miR-29b 5-aza-2'-deoxycytidine (5-Aza-CdR) + trichostatin A(TSA) NULL NULL Microarray Pancreatic Cancer MiaPACA-2 cells 19407485 2009 up-regulated
miR-29b 5-aza-2'-deoxycytidine (5-Aza-CdR) + trichostatin A(TSA) NULL NULL Microarray Pancreatic Cancer PANC-1 cells 19407485 2009 up-regulated
miR-29b Trichostatin A (TSA) NULL 444732 Microarray Pancreatic Cancer MiaPACA-2 cells 19407485 2009 up-regulated
miR-29b Trichostatin A (TSA) NULL 444732 Microarray Pancreatic Cancer PANC-1 cells 19407485 2009 up-regulated
miR-29b Glucose NULL 5793 Microarray proximal tubule cell line HK-2 20067797 2010 down-regulated
miR-29b Dihydrotestosterone(DHT) NULL 10635 Microarray prostate cancer 20945501 2011 up-regulated
miR-29b Dihydrotestosterone(DHT) NULL 10635 Quantitative real-time PCR prostate cancer 20945501 2011 up-regulated
miR-29b Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-29b Enoxacin approved 3229 Quantitative real-time PCR HCT-116 and RKO colon cancer cell lines 21368194 2011 up-regulated
miR-29b Ginsenoside Rh2 NULL 119307 Microarray human glioma cells U251 21372826 2011 up-regulated
miR-29b Testosterone + 1,25-Dihydroxyvitamin D3 approved NULL Microarray prostate cancer 21592394 2011 up-regulated
miR-29b Progesterone approved 5994 Microarray Breast cancer 22330642 2012 down-regulated
miR-29b Progesterone approved 5994 Quantitative real-time PCR Breast cancer 22330642 2012 down-regulated
miR-29b Trastuzumab approved NULL Microarray SKBR3 cells. 22384020 2012 up-regulated
miR-29b Glucocorticoid NULL NULL Quantitative real-time PCR Eosinophilic esophagitis 22815788 2012 up-regulated
miR-29b Glucocorticoid NULL NULL TaqMan low-density array Eosinophilic esophagitis 22815788 2012 up-regulated
miR-29b CCl4 NULL 5943 Quantitative real-time PCR liver 22393047 2012 down-regulated
miR-29b Estrogen NULL NULL Quantitative real-time PCR liver 22393047 2012 up-regulated
miR-29b Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 down-regulated
miR-29b 5-aminoimidazole-4-carboxamide-1-β-d-ribofuranoside (AICAR) NULL 16078949 Microarray hepatocytes 23107762 2013 down-regulated
miR-29b Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-29b Phenethyl isothiocyanate(PEITC) NULL 16741 Microarray neonatal mice liver 20145010 2010 down-regulated
miR-29b Benzo(a)pyrene NULL 2336 Microarray Adult male B6C3F1 mice 21569818 2011 up-regulated
miR-29b Cocaine NULL 446220 Next-generation sequencing ventral striatum 21708909 2011 down-regulated
miR-29b Urethane NULL 5641 Quantitative real-time PCR mouse lung 24361357 2014 down-regulated
miR-29b Ethanol NULL 702 Quantitative real-time PCR Cerebellar Granule Neurons cells 24554719 2014 down-regulated
miR-29b Rapamycin approved 5284616 Quantitative real-time PCR HL-1 cells 25062042 2014 up-regualted
miR-29b Estradiol benzoate (EB) NULL NULL Quantitative real-time PCR adult germ cell 22334722 2012 up-regulated
miR-29b Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 up-regulated
miR-29b-3p Docosahexaenoic acid NULL 445580 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-29b Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (HepG2, SK-HEP-1)
hsa-miR-29b-3p (1S,10R,12R,14R,15S)-15-hydroxyspiro[13,16-dioxapentacyclo[8.5.1.01,10.03,8.012,14]hexadeca-3,5,7-triene-11,3'-2,4-dioxatricyclo[7.3.1.05,13]trideca-1(12),5,7,9(13),10-pentaene]-2,9-dione 388424 NSC683332 resistant
hsa-miR-29b-3p (5Z)-5-[(4-oxothieno[2,3-b]thiochromen-2-yl)methylidene]-2-sulfanylideneimidazolidin-4-one 5468927 NSC679240 resistant
hsa-miR-29b-3p (6aS)-3-[5-[4-(2-diethoxyphosphorylethyl)piperazin-1-yl]pentoxy]-2-methoxy-6a,7,8,9-tetrahydropyrrolo[2,1-c][1,4]benzodiazepin-11-one 25113728 NSC744025 resistant
hsa-miR-29b-3p 1-adamantylmethyl 4-[(2,5-dihydroxyphenyl)methylamino]benzoate 391131 NSC689857 resistant
hsa-miR-29b-3p 2-((5-methyl-3-isoxazolyl)amino)-4-((5-methyl-3-isoxazolyl)imino)-1(4h)-naphthalenone 373420 NSC649750 sensitive
hsa-miR-29b-3p 2-(1-adamantyl)ethyl 4-[(2,5-dihydroxyphenyl)methylamino]benzoate 403758 NSC719177 resistant
hsa-miR-29b-3p 2-(3-(2-methoxy-4-(4-methylene-5-oxotetrahydro-2-furanyl)phenoxy)propyl)-1h-isoindole-1,3(2h)-dione 381521 NSC668277 resistant
hsa-miR-29b-3p 2-[(dimethylamino)methyl]-3-[(Z)-heptadec-10-enyl]-5-methoxybenzene-1,4-diol;hydrochloride 5387959 NSC630004 resistant
hsa-miR-29b-3p 2-[[(E)-3-(2-chlorophenyl)prop-2-enoyl]amino]-5-iodobenzamide 53329762 NSC748148 resistant
hsa-miR-29b-3p 2-acetylimidazo[4,5-b]pyridin 4 tolyl 3 thiosemicarbazone 135440014 NSC674106 resistant
hsa-miR-29b-3p 2-amino-1-N,9-N-bis[10-[(4-hydroxyphenyl)methyl]-7,11,14-trimethyl-2,5,9,12,15-pentaoxo-3-propan-2-yl-8-oxa-1,4,11,14-tetrazabicyclo[14.3.0]nonadecan-6-yl]-4,6-dimethyl-3-oxophenoxazine-1,9-dicarboxamide 16129921 NSC684901 resistant
hsa-miR-29b-3p 2-amino-1-N,9-N-bis[10-[(4-methoxyphenyl)methyl]-7,11,14-trimethyl-2,5,9,12,15-pentaoxo-3-propan-2-yl-8-oxa-1,4,11,14-tetrazabicyclo[14.3.0]nonadecan-6-yl]-4,6-dimethyl-3-oxophenoxazine-1,9-dicarboxamide 16129907 NSC684908 resistant
hsa-miR-29b-3p 2-amino-9-chloro-3,5-bis(4-chlorophenyl)pyrimido[4,5-c]quinolin-1-one 16126264 NSC741296 resistant
hsa-miR-29b-3p 2,3-bis(4,5-dimethyl-3,6-dioxo-cyclohexa-1,4-dien-1-yl)-5,6-dimethyl-1,4-benzoquinone 394545 NSC698090 sensitive
hsa-miR-29b-3p 3-(4-chlorophenyl)-5-methyl-[1,2]oxazolo[5,4-d]triazin-4-one 399226 NSC709900 resistant
hsa-miR-29b-3p 4-[4-[2,3-bis(hydroxymethyl)pyrrol-1-yl]butanoylamino]-n-[5-[[5-[3-(dimethylamino)propylcarbamoyl]-1-methylpyrrol-3-yl]carbamoyl]-1-methylpyrrol-3-yl]-1-methylpyrrole-2-carboxamide 384021 NSC673131 resistant
hsa-miR-29b-3p 5-(4-methoxyphenyl)-3-(3,4,5-trimethoxyphenyl)-4,5-dihydro-1h-pyrazole 49865894 NSC748404 resistant
hsa-miR-29b-3p 5,11-dimethyl-1h-benzo[a]carbazole-1,4(11h)-dione 372651 NSC648148 resistant
hsa-miR-29b-3p Acetic acid;3-[4-(2-hydroxyethyl)piperidin-1-yl]-N-[6-[3-[4-(2-hydroxyethyl)piperidin-1-yl]propanoylamino]-9,10-dioxoanthracen-2-yl]propanamide 374314 NSC651841 resistant
hsa-miR-29b-3p Beacon red 135421797 NSC12455 resistant
hsa-miR-29b-3p Benzoic acid, 3,4,5-trihydroxy-, phenyl ester 333279 NSC333571 resistant
hsa-miR-29b-3p Csa13 24205348 NSC735211 sensitive
hsa-miR-29b-3p Mefloquine hydrochloride 456309 NSC157387 sensitive
hsa-miR-29b-3p Methyl 3-hydroxy-3-[(15R)-15-tetracyclo[6.6.2.02,7.09,14]hexadeca-2,4,6,9,11,13-hexaenyl]propanedithioate 383730 NSC672159 resistant
hsa-miR-29b-3p Methyl 6-[[(3S,4aR,6aR,6bS,8R,8aR,12aS,14aR,14bR)-8a-[3-[3,4-dihydroxy-6-methyl-5-(3,4,5-trihydroxyoxan-2-yl)oxyoxan-2-yl]oxy-4,5-dihydroxyoxan-2-yl]oxycarbonyl-8-hydroxy-4,4,6a,6b,11,11,14b-heptamethyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropi 385532 NSC676788 sensitive
hsa-miR-29b-3p Naphth[2,3-d]oxazol-9-one, 2-methyl-4-(phenylimino)- 160386 NSC650573 sensitive
hsa-miR-29b-3p NSC148077 NSC148077 resistant
hsa-miR-29b-3p NSC175490 NSC175490 resistant
hsa-miR-29b-3p NSC175493 NSC175493 resistant
hsa-miR-29b-3p NSC85701 NSC85701 resistant
hsa-miR-29b-3p Oxin 1923 NSC2039 approved resistant
hsa-miR-29b-3p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Etoposide 36462 NSC141540 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved resistant High Breast Cancer cell line (MDA-435)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive High Breast Cancer cell line (MDA-MB-435, MDA-MB-436, SKBr3, BT-474, MDA-MB-231, MCF7)
hsa-miR-29b-3p Imatinib 5291 NSC743414 approved resistant High Myelogenous Leukemia cell line (MYL)
hsa-miR-29b-3p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7, LY2)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-miR-29b-3p Cyclopamine 442972 NSC734950 resistant Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved resistant Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-29b-3p Etoposide 36462 NSC141540 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Decitabine 451668 approved sensitive Low Acute Myeloid Leukemia tissue and cell line (Kasumi-1, NB4, FDC-P1-KITmut)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved resistant High Bladder Cancer cell line (RT4, J82,TCCSUP, UM-UC-3,RT112,CUBIII)
hsa-miR-29b-3p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (RKO)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved sensitive Low Cholangiocarcinoma cell line (HuCCT1, HuH28)
hsa-miR-29b-3p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-29b-3p Ethanol 702 NSC85228 approved resistant Low Cerebellum Granule Neuron tissue
hsa-miR-29b-3p Chemotherapy sensitive Low Ovarian Cancer tissue
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive Low Ovarian Cancer cell line (ES2, AMOC2)
hsa-miR-29b-3p Fluorouracil 3385 NSC19893 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-29b-3p Bortezomib 387447 NSC681239 approved sensitive Low Melanoma cell line (RPMI8226)
hsa-miR-29b-3p Carfilzomib 11556711 NSC756640 approved sensitive Low Melanoma cell line (RPMI8226)
hsa-miR-29b-3p Ixazomib 25183872 approved sensitive Low Melanoma cell line (RPMI8226)
hsa-miR-29b-3p Interferon-Gamma sensitive Low Colorectal Cancer cell line (HCT-116, HT-29, LS174T, SW480,SW620, HEK293)
hsa-miR-29b-3p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR200)
hsa-miR-29b-3p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR70)
hsa-miR-29b-3p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Platinum 23939 resistant Low Ovarian Cancer tissue
hsa-miR-29b-3p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-29b-3p Imatinib 5291 NSC743414 approved resistant High Gastrointestinal Stromal Tumor cell line (882R-NC, 882R-OE, 882R-KD)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549, H1299)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive High Gallbladder Cancer cell line (GBC-SD, NOZ)
hsa-miR-29b-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-29b-3p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-29b-3p Curcumin 969516 NSC32982 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved resistant High Cholangiocarcinoma cell line (CCLP-1, MzChA-1)
hsa-miR-29b-3p Oxaliplatin 6857599 NSC266046 approved sensitive Low Colorectal Cancer cell line (SW480)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (PC-3-R)
hsa-miR-29b-3p Methotrexate 126941 NSC740 approved sensitive Low Osteosarcoma tissue and cell line (MG-63, U-2-OS)
hsa-miR-29b-3p Crizotinib 11626560 NSC749005 approved resistant High Non-Small Cell Lung Cancer cell line (NCI-H2228, DFCI032)
hsa-miR-29b-3p Lorlatinib 71731823 NSC780108 approved resistant High Non-Small Cell Lung Cancer cell line (NCI-H2228, DFCI032)
hsa-miR-29b-3p Doxorubicin 31703 NSC123127 approved sensitive Low Osteosarcoma cell line (MG-63)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved sensitive Low Pancreatic Cancer cell line (PANC-1 cell, BXPC-3)
hsa-miR-29b-3p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7, MCF-7-21)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive Low Endometrial Cancer cell line (HEC-1-B)
hsa-miR-29b-3p Fluorouracil 3385 NSC19893 approved sensitive High Colorectal Cancer cell line (HT-29)
hsa-miR-29b-3p Oxaliplatin 6857599 NSC266046 approved sensitive Low Colon Cancer cell line (SW480, SW620)
hsa-miR-29b-3p Temozolomide 5394 NSC362856 approved sensitive Low Glioma cell line (LN229, U87MG, U251)
hsa-miR-29b-3p Temozolomide 5394 NSC362856 approved sensitive Low Glioblastoma cell line (U251, U87MG)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-29b-3p Oxaliplatin 6857599 NSC266046 approved sensitive Low Colorectal Cancer cell line (HT-29, DLD1)
hsa-miR-29b-3p Bortezomib 387447 NSC681239 approved resistant Low Multiple Myeloma tissue
hsa-miR-29b-3p Palbociclib 5330286 NSC758247 approved sensitive High Breast Cancer cell line (MDA-MB-231, Hs578t, SKBR3, MCF-7)
hsa-miR-29b-3p Temozolomide 5394 NSC362856 approved sensitive Low Glioma tissue
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-29b-3p Fluorouracil 3385 NSC19893 approved resistant Low Colorectal Cancer cell line (HT-29, HCT-116, SW480, SW620, LoVo, SW48, DLD-1, Caco-1, HCT-15)
hsa-miR-29b-3p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-29b-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (mitochondrial RNA)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (cytosolic RNA)
hsa-miR-29b-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-29b-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (SKVO3ip1)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved resistant cell line (HeyA8)
hsa-miR-29b-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-29b-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-29b-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-29b-3p Exemestane 60198 NSC713563 approved resistant cell line (MCF-7)
hsa-miR-29b-3p Testosterone 6013 NSC9700 approved resistant cell line (MCF-7)
hsa-miR-29b-3p Testosterone+Anastrozole resistant cell line (MCF-7)
hsa-miR-29b-3p Testosterone+Letrozole resistant cell line (MCF-7)
hsa-miR-29b-3p Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved resistant cell line (MGC-803)
hsa-miR-29b-3p 4-Hydroxytamoxifen+Tamoxifen resistant cell line (LY2)
hsa-miR-29b-3p Ethanol+Tamoxifen resistant cell line (LY2)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-29b-3p Pegylated interferon alpha+Ribavirin sensitive tissue (chronic hepatitis C)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (HuH28)
hsa-miR-29b-3p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-29b-3p Tamoxifen 2733525 NSC180973 approved sensitive cell line (TamR4)
hsa-miR-29b-3p Oxaliplatin 6857599 NSC266046 approved sensitive cell line (IGROV-1)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (IGROV-1)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR200)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR70)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-29b-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-29b-3p Bortezomib 387447 NSC681239 approved resistant cell line (CCRF-CEM) (100 nM)
hsa-miR-29b-3p Bortezomib 387447 NSC681239 approved sensitive cell line (CCRF-CEM) (200 nM)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved resistant cell line (OVCAR3)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (H23)
hsa-miR-29b-3p Cetuximab sensitive tissue (colorectal carcinoma)

Error report submission