miRTarBase - #MIRT005589


—
pre-miRNA Information
pre-miRNA hsa-mir-26a-1   
Genomic Coordinates chr3: 37969404 - 37969480
Synonyms MIR26A, MIRN26A1, MIR26A1
Description Homo sapiens miR-26a-1 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-26a-2   
Genomic Coordinates chr12: 57824609 - 57824692
Synonyms MIRN26A2, MIR26A2
Description Homo sapiens miR-26a-2 stem-loop
Comment miR-26a was cloned from HeLa cells .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-26a-5p
Sequence 10| UUCAAGUAAUCCAGGAUAGGCU |31
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
C-to-U 21 3 + 37969433 17604727 MiREDiBase
C-to-U 21 12 - 57824659 17604727 MiREDiBase
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30516844 7 COSMIC
COSN30543820 11 COSMIC
COSN30447912 11 COSMIC
COSN31502139 13 COSMIC
COSN31591664 19 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1323067579 3 dbSNP
rs1315291543 9 dbSNP
rs1249227702 12 dbSNP
rs1348933092 17 dbSNP
rs1012142515 17 dbSNP
rs1445643611 18 dbSNP
rs756293180 19 dbSNP
rs765258989 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B52VKB miR-26a Monitoring Biomarker (MOI) Clinical/Experimental Data Expression Increase Plasma Quantitative real-time PCR
BI82DS miR-26a-5p Predictive Biomarker (PRD) Clinical/Experimental Data Expression High Peripheral blood Quantitative real-time PCR
Gene Information
Gene Symbol CPEB4   
Synonyms CPE-BP4, hCPEB-4
Description cytoplasmic polyadenylation element binding protein 4
Transcript NM_030627   
Expression
Putative miRNA Targets on CPEB4
3'UTR of CPEB4
(miRNA target sites are highlighted)		 
>CPEB4|NM_030627|3'UTR
   1 AGGATAACTGCAGTGCTCATTTTCAGGCCTCAGAATAAGTGCACTCTTCTGTTCATTCTGACCCCTTCCTCAACCTCTTC
  81 ACGCTGGCATGTCCTTTTGTAGCAGTCTGTAACTTAACTATAGTATAATGAAAAGAATGACCTATAATATAGGTGTTTTG
 161 TAGATTCTTGTGTCACTGCAAACAATATGAACTCCTTTTTCGTATTGCCATCGGGTTGCATGGAAGTTTTATTCTCTTGT
 241 TTTGCTGGAAACCAAGAGGATCCAAACTTCCTGCAACATTTTCTTAGAGGAGAGAGAGAAATATTAAAAGAGAAATGAAA
 321 CAATAGAGTATTTTGGGTTTTTAATTAAATTATTGTTAATAATATAACATATAAGAATACTTTTATTAAAATAACCATGC
 401 AACAATAACACTATCGGTCTATCTGACAGTTTTTCCCCCAGGGAAGTGCTTTTGCCTTTTCCTTTCTTTTTTTTTTTTTT
 481 TTCATCTTTTTTGTCTCTCTCTTTTTTCCATCCCTTTTTAATTTTTTTAACAGCAATGGAGGAAGTTAACAATTTTTAAT
 561 GGAAAGAGCATGTTAGAGCAAACAAATGCATAAGCAAGACTGAGCAGCATTATAATTAATTTTCAGGGTTTTGAGGCTGA
 641 ACATAATTTCATTATCCCTCAAAAAGTTACCACCACATCAGAAAAAATAAAAAAAAAATAGTAAAGTAGGCAGAGCTAGG
 721 TTTATTTTCTCTTAAACAATTTTTAAAATTCAGAATGTAAAAATTGGGTAAATTTACTACTGAGGGGAGTGCACTTATTT
 801 ATTTAACTTACTTATCTGGTCAAAGCCCCAGGAAACCTACCAAAGCTAGAATTAATGACAACTGGTGGGAAACCTAGCAT
 881 TTCCTCTCCTGAAGAATAAATGTATAAATGTTATTTTTGATGTTTATATATAAACTCTATATCCTAATTTACTAATACTC
 961 ATCAGATGTCAGCCTTTGCTCTCCATTTTGACGTTAAAAAACAACAACAGATCTAGAGATACCTCAAGGATATCATTTTT
1041 GATTTTGTGTTACAGTACACTTGTAGCCAAAACTGGAAGACAAAACCAATATATAATTTGGCTGCTGATTGGCTTACTTT
1121 TAGATTTAAAGTTACTTTGGGTATCCTGTAATTTAGTTGTAACATAGAAAATGAAAAAACAGTTAAAAAAAGTGAAGTAG
1201 TTGCAAAGTGTTTTGCACTGTTGAACTAAGTAACTGTGTAAATCTGTGCAAAGGTACGTATGTTTATCTTACTCTTCCTA
1281 TAAACTAAAATAACATTACAGTTTCCGAATTTAGCATGGGACATAGTCAGTGTTTGAAGTGCCAACTTCATCAAGTAATG
1361 CATGCTTTATTATAAATAAAATTCTAGCTTTGAAAGGCGTTATGTGTTGAACAGTATGCTTCAGGGGTAAATTTAAAATA
1441 GTCTCTTGAAGCCCTAGTCATGGAAGTAACTTTTATTTTAATTGACATTCTCTTATTAAATGCCCTATCCATCATTAAAA
1521 GGTTTATTATCAGTGGGCAAAACATGAAATAATATGATCGAATGGCAATCTTGCTAGTTGCGCTACCTAACAGTACCATC
1601 TTGGATCCTTCAAAACCAAAGACTTGCCCCAGCACTGCTGTGGAACCACCTGGCTTATGACCCCTATGGATGATCTTTAG
1681 GAAAAGCAGCCCTTTACTTTTAATACAGGCTTTAATGAACTATACCTGTTAAGTTCCAAAGGTCAAAATGGAGGCATTTG
1761 CTGTCTAATATTCAAACATAGAAAGGGAGCTGCTTTTAAAGAATTCCCTGCAAATACTGAAAGCAGTCATGCGAATGGAG
1841 GGTGCTCTTGTGTAGCTGGTCAGGGACTTTTTTTTCTTTTCTCCTGAACTACATGATTCTAATTGGAATGTTCATTTGCC
1921 TCTTTTTACTCTTTTAAATGCTTGTAGGTGGCTTGGGGTGTGCTATCGTGCTGTTCCTACTCAGTAAACAGGTGTGATGA
2001 GTTAACAAGAAATAACACTGTTTGAGAACTAGCTTTGAATAATAATTTTTCCCTTTGTACATGACCTGCTGAATTTCGGT
2081 ACAGTGTTTTTGTAGCTAACTTATTTTGTCATGCACATAATGTATATTTGTTATGCACTACTTTTGTATATCTTGTTTTT
2161 CCAACAGTGAACATTTTTAGGCACACTTTTCACTGACGGGATATCTCTTTATGCAATACCTCAATTTTTCATATTGCAAA
2241 GAGTAGCTTTTTGTACTTTTATTACTGAGAGATCTTCATATACTTCATTTTTTAATATAAATAATTTTAATAAATTTTAT
2321 TTTCTTATATTCTGCTTTTTATACATTTCAGTGCTCTGCATACATTTTAAATTATGAATGTCGTGCACTGGCAATGCTAT
2401 TTTAGAGTCTGCAGAGAAGAGAAAGCATGTTGCTTAAACATCCTTCCCCAGCACCAGCTATTGGTGTACCTATAATTTAA
2481 GAAATAGTCTATGTAAAGTCACAAATTAATGAAAAAAATTCGCATGAAAATGACAGATAACACTGTAGTTCCTAAAAAAA
2561 AAATTAAATGCATAAGCATAAGGTAGAAATTAAAATAACAAAATTGTCTACAGCTTCTTACTAAGTTTTTAAAATTATTC
2641 ATAAAATGCAGACATTTTTGGTGAATGTTTAGCCATTTTTAATATTAATAAATTGATGTTAAGTGTTTGATTCAGAGATG
2721 TCTGCTCTTTTAAATTATATATAAGGAAAAAAAATAGCCTGCCTTGGGACAGGTGTGTAATGTTAGTGTGCATGACTAAT
2801 GTAAGAAATTGTTATTCTACTAATATTTACTTGTGATTGTGTGACAAGTGTGTTTACAGATTATTGGTTACACTTCAATT
2881 TACAGGGCATAAACAATGATTATCTATTACTCTGAACTTTATGATTACATGTTCTTCAGATTACATGGGATTGTAGTTGG
2961 GAGTTACCATGTAACTCAAACATAATTAACATGTAATTAGTTTACAGATTGTAGGGCATCACTTCAATTCACCAAGCATG
3041 TAGTTCTAGCGCACTAGCATGGCGCCAGCCATGTACTTACAATGTAGTTACAGAGTAATTACATGGTGATTTTTGCAATG
3121 TAAAATAAAGTGTTTCTGATTATTTTCTATGTAAAGGAACCCTCTCCTTTCCCCTTCTGGTCCCTGCGCTTTGGTATAAT
3201 ATATATACTTCTCCATACACAGACCTCTGCAGAATGCAAAATAAAACTTGCAGTGAATGAATTTAGCATTTTATGAGAGT
3281 GCTGTTGGAAAGACTTGATAATTCACCCCTTTTGTTTTGAAGAGTTGAATCTTCTGTTAAAAGGTGATTTAAAACTTGAA
3361 TGTGATGAATTGTGGCAAGTTAACTTCAAGTTATGTGCAATACTTATTTCAAACTTTTGAAAGATCTTTGCAGTGTAATT
3441 CTTTGTTTTTAATTGCAGACATTTAAAAATGTCATTTTCTACTGTTAAGAGTAATCCTCTTTCTTGCTGGTGTTTCTAAA
3521 GAAAAGAATCAGAAATCAATCTTTCTACTAATGTAAATTTGAGATTATTTTTAAAAATGGAATAAAAGAGGTTTTGGTCA
3601 TTTGCTTTATTTTATTATTTTAAAGCTACTGTGATTGATAGCATTGTAAGAATCGGGACAATATTGTATTCAACTGTTTT
3681 ATTTTTTATATTTTTAAAATTTAAAGTATAATTAGTTTTTATAATTTTCATCAGATTTTTGTTATATTTTTTGGAAGTGA
3761 AACTTTTAGCAAGTGGGTGTCTAGTTTTTACTAATCCCTAATTTTTTTTCCAGTGTATTGCTCATATTATCAGAAGGAAA
3841 AGTTATTTAAGTATGTCAGTTAATTGTACTACTTGGCTGAATTTCCATATAGTTTTTACTGTGTATGGGGAGGTTGTAGT
3921 ATTTATTATAGCATTTTAAATAAGGGTAATTCATTTTTTATTAAAGTCATTTTCACGTTAAGTTCCTATTTTTGTATGTT
4001 CTACTCTTAAGTTATATAACACAGTTCCTTTTTTAAAAGAGTTCATTTGTTGAAGTGCTAGTGAAAAATTAATGTTATTA
4081 AATAGTTTGCAAATGACTATTTATACCAGTATGCATATAATTTTTAAATATTTGTAATGTGAGATGTTGAATGAATAAAA
4161 CTTTTAACTCAGATTTCTTTTAATATACTTATTTCTTTTTAACACAAGTAGATGATGCTTTCTTGACTGGGAATGTAACA
4241 TTTTAAAATATTAGGAATATACTGTTCAGCTAATGCAGCACAAACCAATAGGAAAAAATCTTCAGTCATATAAGTACTGT
4321 GGCCAGTGTGCATTCTTATGTAAGCCTATAAGCGTCGGTGGGTGGTTGTGTCTTTGGCCTGTACTGTTAGTTCACCTGCT
4401 GCCTGCCCTGCAGAGTTCTTTTTATTTGTAGCCTTCAATATGTATACAGGGAGTAAGCCCAGGATCTAAGCATTCAGTTA
4481 TCAGTTGAAGGCCAAATGCCCAACAAAAGTGAAAAACCCAATGTTTAGTTAATAATGAAAGTCCGTATCTGGGAGGTTCA
4561 GTTTTGAGTCTTTGTCAATGAATAGTCTTGATTTGTGGCCACACTACCAAAGGGCTTGAAAACAAGTCTCTTTTGACTTC
4641 CAATTCCCAGTTCCTCCATAGACCTTAATGTCATAGGATACGGTGTGTGGGATTATAATCTCTATGGCATGTCAATTGAA
4721 AATATTATCTTTGATTTGATCCATTAATCATGTGGACTACCAAGTGCTGTAATGTGTTAGTATTTATATTTTAAACTGCA
4801 TTCTCAAACTTTTAACATAAGGATTTATTATAACAAAATATAACACTGAGAATA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ucGGAUAGGACCUAAUGAACUu 5'
            ::| ||||| | ||| ||| 
Target 5' ctTTTCTCCTGAACTACATGAt 3'
 1876 - 1897 136.00 -8.10
2 
miRNA  3' ucggauagGACCUAAUGAACUu 5'
                  :|| | ||||||: 
Target 5' tcagttaaTTGTACTACTTGGc 3'
 3856 - 3877 134.00 -6.30
3 
miRNA  3' ucgGAUAGGA----CCU-AAUGAACuu 5'
             :|||:||      | |||||||  
Target 5' ttgTTATTCTACTAATATTTACTTGtg 3'
 2809 - 2835 129.00 -8.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN24398003 10 COSMIC
COSN30156848 32 COSMIC
COSN31534109 39 COSMIC
COSN18729958 55 COSMIC
COSN30181323 59 COSMIC
COSN16128087 72 COSMIC
COSN30165218 213 COSMIC
COSN513057 467 COSMIC
COSN7912422 470 COSMIC
COSN20102227 483 COSMIC
COSN20102229 483 COSMIC
COSN16714487 589 COSMIC
COSN27301937 699 COSMIC
COSN31540658 766 COSMIC
COSN6284151 794 COSMIC
COSN2088590 812 COSMIC
COSN31483967 866 COSMIC
COSN8492345 991 COSMIC
COSN31565009 1380 COSMIC
COSN31514016 1412 COSMIC
COSN31578881 1506 COSMIC
COSN28799803 1524 COSMIC
COSN31534793 1560 COSMIC
COSN29612502 1758 COSMIC
COSN17668058 1779 COSMIC
COSN26632964 1877 COSMIC
COSN30542067 1968 COSMIC
COSN31593919 2040 COSMIC
COSN31593957 2046 COSMIC
COSN8209080 2078 COSMIC
COSN21185288 2131 COSMIC
COSN31518919 2139 COSMIC
COSN24301202 2202 COSMIC
COSN31571637 2270 COSMIC
COSN9420803 2479 COSMIC
COSN26568408 2493 COSMIC
COSN31584829 2522 COSMIC
COSN26575481 2523 COSMIC
COSN24301204 2530 COSMIC
COSN20102230 2564 COSMIC
COSN26579859 2565 COSMIC
COSN14783800 2769 COSMIC
COSN31512861 2792 COSMIC
COSN31532063 2823 COSMIC
COSN2088592 2940 COSMIC
COSN31541117 2986 COSMIC
COSN20102234 3017 COSMIC
COSN31962530 3098 COSMIC
COSN20091312 3189 COSMIC
COSN31608604 3233 COSMIC
COSN15904994 3332 COSMIC
COSN22237736 3357 COSMIC
COSN22319385 3366 COSMIC
COSN30543779 3505 COSMIC
COSN31546642 3550 COSMIC
COSN26641898 3797 COSMIC
COSN7912423 3824 COSMIC
COSN6284152 4045 COSMIC
COSN2088593 4083 COSMIC
COSN26641357 4104 COSMIC
COSN2088594 4696 COSMIC
COSN9933923 4798 COSMIC
COSN9933924 4799 COSMIC
COSN18723662 4911 COSMIC
COSN5597488 4996 COSMIC
COSN9012424 5051 COSMIC
COSN22498312 5096 COSMIC
COSN8209081 5116 COSMIC
COSN28237544 5266 COSMIC
COSN8209082 5275 COSMIC
COSN2088595 5278 COSMIC
COSN27350539 5595 COSMIC
COSN29384363 5719 COSMIC
rs72812861 4370 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs921205847 9 dbSNP
rs772930744 11 dbSNP
rs762740247 14 dbSNP
rs200713430 17 dbSNP
rs1337861082 19 dbSNP
rs1195534737 20 dbSNP
rs1224033793 20 dbSNP
rs1352212633 28 dbSNP
rs1257293646 30 dbSNP
rs1353039830 31 dbSNP
rs113677486 38 dbSNP
rs1277326522 40 dbSNP
rs1462406591 44 dbSNP
rs752972859 45 dbSNP
rs760785815 47 dbSNP
rs764042134 50 dbSNP
rs1564823 55 dbSNP
rs1285791142 66 dbSNP
rs1193015500 67 dbSNP
rs374791185 78 dbSNP
rs1050432776 83 dbSNP
rs1454226564 84 dbSNP
rs1480821194 89 dbSNP
rs747601587 100 dbSNP
rs1192380345 110 dbSNP
rs1382545583 122 dbSNP
rs147789850 123 dbSNP
rs1001153943 125 dbSNP
rs1159344903 125 dbSNP
rs1245978903 136 dbSNP
rs1216051254 138 dbSNP
rs552152046 143 dbSNP
rs1450932927 147 dbSNP
rs895551745 149 dbSNP
rs1041790233 151 dbSNP
rs1294783079 171 dbSNP
rs903320140 184 dbSNP
rs1371551502 185 dbSNP
rs1285710867 187 dbSNP
rs1013726567 195 dbSNP
rs1367323854 200 dbSNP
rs1026871440 202 dbSNP
rs1003013587 203 dbSNP
rs1320166890 208 dbSNP
rs1035874180 210 dbSNP
rs1470331669 211 dbSNP
rs570422990 213 dbSNP
rs1013609102 214 dbSNP
rs1424394313 216 dbSNP
rs777124685 217 dbSNP
rs952491486 221 dbSNP
rs1476291205 224 dbSNP
rs531451202 233 dbSNP
rs985410620 245 dbSNP
rs1315365269 248 dbSNP
rs908310984 254 dbSNP
rs759883162 263 dbSNP
rs527409387 268 dbSNP
rs187552600 282 dbSNP
rs921123516 285 dbSNP
rs567911173 293 dbSNP
rs974725653 297 dbSNP
rs932584931 313 dbSNP
rs989835318 321 dbSNP
rs796606202 328 dbSNP
rs923371552 329 dbSNP
rs1385069351 335 dbSNP
rs914542209 337 dbSNP
rs1334718584 353 dbSNP
rs1192286433 354 dbSNP
rs947391924 357 dbSNP
rs1358465744 360 dbSNP
rs535306681 362 dbSNP
rs1411430513 364 dbSNP
rs1388158226 367 dbSNP
rs1041759218 376 dbSNP
rs933366991 377 dbSNP
rs903289073 381 dbSNP
rs938797599 383 dbSNP
rs1057281315 398 dbSNP
rs1482655020 406 dbSNP
rs1233943220 412 dbSNP
rs947326707 414 dbSNP
rs141254933 417 dbSNP
rs1013135084 418 dbSNP
rs905771886 418 dbSNP
rs1361779891 421 dbSNP
rs1313232084 435 dbSNP
rs1227766910 438 dbSNP
rs1374213532 441 dbSNP
rs1298671465 443 dbSNP
rs1027654468 447 dbSNP
rs1444359657 462 dbSNP
rs1307103950 463 dbSNP
rs1394557516 463 dbSNP
rs777973103 463 dbSNP
rs1251737025 467 dbSNP
rs1491553327 467 dbSNP
rs371120986 467 dbSNP
rs397934503 467 dbSNP
rs55771761 467 dbSNP
rs879130412 467 dbSNP
rs1223637795 468 dbSNP
rs376926810 468 dbSNP
rs1317575263 469 dbSNP
rs61230068 469 dbSNP
rs1402412063 470 dbSNP
rs1056702040 471 dbSNP
rs1348508799 472 dbSNP
rs374552260 483 dbSNP
rs895582991 483 dbSNP
rs186343484 484 dbSNP
rs1230682339 485 dbSNP
rs189227999 487 dbSNP
rs1284781690 488 dbSNP
rs1160570732 494 dbSNP
rs1345433528 494 dbSNP
rs965436984 494 dbSNP
rs1370996899 496 dbSNP
rs1230228611 497 dbSNP
rs1294190154 498 dbSNP
rs1334216658 500 dbSNP
rs1211940122 502 dbSNP
rs1260502600 509 dbSNP
rs1458613557 510 dbSNP
rs1204179650 511 dbSNP
rs1231523702 512 dbSNP
rs1484474799 513 dbSNP
rs374028907 514 dbSNP
rs1418171142 515 dbSNP
rs1481607760 518 dbSNP
rs1474571179 520 dbSNP
rs1301399275 521 dbSNP
rs1209626747 522 dbSNP
rs1486276831 540 dbSNP
rs1262744453 545 dbSNP
rs888096638 549 dbSNP
rs1047895231 551 dbSNP
rs1267392277 553 dbSNP
rs886647759 560 dbSNP
rs1006383492 566 dbSNP
rs565643177 597 dbSNP
rs1298845375 601 dbSNP
rs1016959681 604 dbSNP
rs964938490 613 dbSNP
rs996195367 614 dbSNP
rs1455169061 652 dbSNP
rs1387332403 661 dbSNP
rs1450007061 672 dbSNP
rs1313674858 674 dbSNP
rs1198546077 682 dbSNP
rs1355092362 682 dbSNP
rs1231463266 688 dbSNP
rs1030306583 689 dbSNP
rs59919245 689 dbSNP
rs954782486 689 dbSNP
rs1280172742 697 dbSNP
rs1340226966 700 dbSNP
rs1205662769 701 dbSNP
rs533159907 705 dbSNP
rs989262128 707 dbSNP
rs1254210316 715 dbSNP
rs1271561661 717 dbSNP
rs1307911712 719 dbSNP
rs1003896910 720 dbSNP
rs1432540465 721 dbSNP
rs1444456273 725 dbSNP
rs150345116 727 dbSNP
rs1336736897 728 dbSNP
rs1454144440 737 dbSNP
rs558151381 758 dbSNP
rs965109036 766 dbSNP
rs978600693 769 dbSNP
rs1462785927 780 dbSNP
rs976538847 781 dbSNP
rs1375208817 797 dbSNP
rs1028147180 798 dbSNP
rs1166933227 816 dbSNP
rs927232391 830 dbSNP
rs773951234 840 dbSNP
rs1185437352 866 dbSNP
rs549760497 869 dbSNP
rs1056734558 879 dbSNP
rs989371586 880 dbSNP
rs1457902404 885 dbSNP
rs929657188 887 dbSNP
rs1276587198 888 dbSNP
rs1225902756 896 dbSNP
rs915159393 901 dbSNP
rs1340966128 912 dbSNP
rs947360632 915 dbSNP
rs1246323126 925 dbSNP
rs1338230353 942 dbSNP
rs1334078025 945 dbSNP
rs977378788 951 dbSNP
rs576396504 953 dbSNP
rs145028741 957 dbSNP
rs1174048262 958 dbSNP
rs761330424 960 dbSNP
rs888193278 962 dbSNP
rs1375000911 982 dbSNP
rs573858186 993 dbSNP
rs894603898 994 dbSNP
rs1368041627 996 dbSNP
rs1327075624 1000 dbSNP
rs1419528618 1003 dbSNP
rs1253923767 1008 dbSNP
rs900766290 1023 dbSNP
rs536228047 1028 dbSNP
rs996394862 1035 dbSNP
rs751720147 1042 dbSNP
rs954731965 1054 dbSNP
rs1239145066 1058 dbSNP
rs1010230262 1066 dbSNP
rs948919790 1075 dbSNP
rs1287029097 1082 dbSNP
rs767100775 1092 dbSNP
rs1235406645 1094 dbSNP
rs1325771528 1097 dbSNP
rs1366628691 1097 dbSNP
rs1403874638 1098 dbSNP
rs1280060536 1110 dbSNP
rs1346238717 1113 dbSNP
rs1208251894 1132 dbSNP
rs1159175687 1136 dbSNP
rs1048612334 1141 dbSNP
rs888690594 1143 dbSNP
rs1458903573 1145 dbSNP
rs1020817284 1146 dbSNP
rs1285963298 1154 dbSNP
rs749869460 1164 dbSNP
rs1472138884 1179 dbSNP
rs1269405289 1181 dbSNP
rs1015268844 1183 dbSNP
rs1200749991 1185 dbSNP
rs979016023 1186 dbSNP
rs1191879293 1190 dbSNP
rs900875716 1191 dbSNP
rs927096261 1193 dbSNP
rs1240229960 1198 dbSNP
rs1330667090 1200 dbSNP
rs1478968370 1205 dbSNP
rs1194254017 1206 dbSNP
rs1394234067 1209 dbSNP
rs1228394996 1212 dbSNP
rs772372931 1227 dbSNP
rs1432681081 1228 dbSNP
rs1160645490 1235 dbSNP
rs958619830 1254 dbSNP
rs867376351 1258 dbSNP
rs562719433 1259 dbSNP
rs953878155 1274 dbSNP
rs1319281503 1275 dbSNP
rs1458857321 1279 dbSNP
rs541650993 1281 dbSNP
rs1316330766 1289 dbSNP
rs1156839170 1292 dbSNP
rs1046711291 1296 dbSNP
rs1425792177 1300 dbSNP
rs755243833 1307 dbSNP
rs1022156209 1321 dbSNP
rs1332975067 1323 dbSNP
rs149110897 1324 dbSNP
rs760732796 1325 dbSNP
rs941089656 1325 dbSNP
rs578255218 1326 dbSNP
rs867129997 1328 dbSNP
rs924581355 1345 dbSNP
rs960034151 1346 dbSNP
rs545447514 1347 dbSNP
rs1245732595 1352 dbSNP
rs992904009 1356 dbSNP
rs1242885966 1377 dbSNP
rs1324818528 1384 dbSNP
rs1281393709 1393 dbSNP
rs915995144 1395 dbSNP
rs900631817 1399 dbSNP
rs932134650 1400 dbSNP
rs1437631738 1401 dbSNP
rs1363293631 1402 dbSNP
rs117295665 1403 dbSNP
rs192952634 1404 dbSNP
rs1336134561 1405 dbSNP
rs1424271590 1406 dbSNP
rs1168831470 1407 dbSNP
rs890699588 1414 dbSNP
rs753697659 1416 dbSNP
rs1387947874 1418 dbSNP
rs183851101 1423 dbSNP
rs1483316538 1424 dbSNP
rs1281515159 1445 dbSNP
rs1208716577 1446 dbSNP
rs1442205909 1453 dbSNP
rs1274074886 1462 dbSNP
rs1469462101 1472 dbSNP
rs1340243861 1493 dbSNP
rs569658491 1503 dbSNP
rs1297184117 1504 dbSNP
rs754755576 1510 dbSNP
rs1252340338 1522 dbSNP
rs1381491903 1522 dbSNP
rs1976074 1524 dbSNP
rs866864133 1525 dbSNP
rs1183750156 1526 dbSNP
rs1358509089 1528 dbSNP
rs904614435 1532 dbSNP
rs1431418881 1536 dbSNP
rs529008738 1546 dbSNP
rs1368288421 1560 dbSNP
rs753702031 1569 dbSNP
rs1167632722 1576 dbSNP
rs1423879089 1577 dbSNP
rs1037292422 1582 dbSNP
rs1415418929 1590 dbSNP
rs900797246 1597 dbSNP
rs1000247852 1601 dbSNP
rs1472724722 1602 dbSNP
rs1253196892 1603 dbSNP
rs1207692340 1604 dbSNP
rs867347581 1606 dbSNP
rs1157108305 1614 dbSNP
rs1049461536 1620 dbSNP
rs1034396031 1624 dbSNP
rs1274161776 1629 dbSNP
rs1223575740 1633 dbSNP
rs1323574388 1637 dbSNP
rs555372668 1641 dbSNP
rs1227819574 1649 dbSNP
rs1045745 1650 dbSNP
rs369935440 1657 dbSNP
rs1022081908 1662 dbSNP
rs758673340 1666 dbSNP
rs1411407064 1667 dbSNP
rs547214358 1675 dbSNP
rs373164609 1679 dbSNP
rs565606808 1680 dbSNP
rs539708201 1681 dbSNP
rs1034919554 1686 dbSNP
rs960041061 1690 dbSNP
rs1308170544 1693 dbSNP
rs1404275879 1695 dbSNP
rs1413303370 1701 dbSNP
rs551417070 1720 dbSNP
rs570027500 1724 dbSNP
rs1335608557 1734 dbSNP
rs982867043 1742 dbSNP
rs537088865 1743 dbSNP
rs1192142136 1755 dbSNP
rs555788317 1761 dbSNP
rs574182508 1762 dbSNP
rs1489553465 1766 dbSNP
rs909513564 1786 dbSNP
rs1277458094 1788 dbSNP
rs1336254105 1798 dbSNP
rs1329987017 1800 dbSNP
rs941108887 1805 dbSNP
rs1230226986 1810 dbSNP
rs1348564565 1816 dbSNP
rs1287425612 1832 dbSNP
rs535200610 1833 dbSNP
rs1291471326 1834 dbSNP
rs143159425 1840 dbSNP
rs993225444 1853 dbSNP
rs915939168 1862 dbSNP
rs1411889299 1868 dbSNP
rs932166024 1868 dbSNP
rs1177175238 1869 dbSNP
rs970546696 1870 dbSNP
rs187399191 1877 dbSNP
rs1437065008 1878 dbSNP
rs946286206 1891 dbSNP
rs1179883111 1892 dbSNP
rs1326931445 1894 dbSNP
rs1042114760 1900 dbSNP
rs1233664821 1902 dbSNP
rs910019973 1904 dbSNP
rs207466630 1911 dbSNP
rs1420332348 1916 dbSNP
rs904563308 1919 dbSNP
rs1233197369 1920 dbSNP
rs138763680 1941 dbSNP
rs534774483 1944 dbSNP
rs1037261191 1945 dbSNP
rs771529662 1949 dbSNP
rs1467892138 1968 dbSNP
rs922860070 1969 dbSNP
rs1175806625 1970 dbSNP
rs934288773 1970 dbSNP
rs781496940 1975 dbSNP
rs1392281766 1985 dbSNP
rs894549100 1991 dbSNP
rs1464533408 1997 dbSNP
rs1014063261 2002 dbSNP
rs1201022771 2007 dbSNP
rs889499594 2009 dbSNP
rs1253954068 2011 dbSNP
rs1233308188 2047 dbSNP
rs1011064481 2061 dbSNP
rs1043459052 2062 dbSNP
rs1325393391 2066 dbSNP
rs1396201540 2070 dbSNP
rs902332839 2075 dbSNP
rs999328661 2078 dbSNP
rs1390071693 2079 dbSNP
rs1034846179 2080 dbSNP
rs960891438 2082 dbSNP
rs951384879 2101 dbSNP
rs982683322 2102 dbSNP
rs1167002213 2112 dbSNP
rs1414806081 2113 dbSNP
rs1017263165 2115 dbSNP
rs1369195979 2117 dbSNP
rs563868789 2125 dbSNP
rs1189709841 2135 dbSNP
rs1425425707 2173 dbSNP
rs1012207159 2179 dbSNP
rs1209837726 2182 dbSNP
rs1292138784 2198 dbSNP
rs1023381209 2200 dbSNP
rs575952624 2204 dbSNP
rs970094374 2209 dbSNP
rs1202674521 2213 dbSNP
rs1251856387 2225 dbSNP
rs1338459641 2239 dbSNP
rs543055452 2248 dbSNP
rs1265459497 2254 dbSNP
rs975062714 2303 dbSNP
rs1339187368 2306 dbSNP
rs1293258719 2312 dbSNP
rs1410803360 2318 dbSNP
rs561420729 2329 dbSNP
rs1306399069 2332 dbSNP
rs1409535265 2356 dbSNP
rs528972360 2365 dbSNP
rs545104220 2383 dbSNP
rs141928419 2384 dbSNP
rs1366611048 2387 dbSNP
rs972882165 2391 dbSNP
rs1187190638 2392 dbSNP
rs1255481633 2412 dbSNP
rs1430431746 2413 dbSNP
rs1253627660 2427 dbSNP
rs770092074 2429 dbSNP
rs1436818425 2433 dbSNP
rs1267653925 2442 dbSNP
rs775805037 2450 dbSNP
rs1211079139 2453 dbSNP
rs1353707258 2455 dbSNP
rs1273094127 2459 dbSNP
rs985763776 2464 dbSNP
rs910844927 2465 dbSNP
rs1331844358 2473 dbSNP
rs1042004924 2486 dbSNP
rs946421533 2488 dbSNP
rs1331855786 2489 dbSNP
rs761489708 2492 dbSNP
rs1325819977 2502 dbSNP
rs1043428834 2503 dbSNP
rs1393903886 2505 dbSNP
rs1160012646 2506 dbSNP
rs1457653837 2508 dbSNP
rs1414124073 2512 dbSNP
rs1466314647 2514 dbSNP
rs533023959 2522 dbSNP
rs902259333 2523 dbSNP
rs935107250 2525 dbSNP
rs551640489 2537 dbSNP
rs576609646 2540 dbSNP
rs1251761256 2549 dbSNP
rs1208823568 2553 dbSNP
rs1276811245 2554 dbSNP
rs397807997 2554 dbSNP
rs61679086 2554 dbSNP
rs896355140 2554 dbSNP
rs1014261192 2572 dbSNP
rs1370553227 2576 dbSNP
rs1311944899 2583 dbSNP
rs144699627 2617 dbSNP
rs1437411135 2622 dbSNP
rs886987604 2623 dbSNP
rs1316195077 2632 dbSNP
rs1399883328 2635 dbSNP
rs1296144627 2641 dbSNP
rs1004447174 2649 dbSNP
rs1016880965 2653 dbSNP
rs1452120985 2654 dbSNP
rs1224880404 2656 dbSNP
rs962602099 2662 dbSNP
rs1012547245 2685 dbSNP
rs1450834419 2687 dbSNP
rs1246700333 2704 dbSNP
rs1215773033 2706 dbSNP
rs191878051 2726 dbSNP
rs1443345111 2736 dbSNP
rs772835626 2739 dbSNP
rs1348390187 2745 dbSNP
rs1281101066 2747 dbSNP
rs1199119807 2755 dbSNP
rs1347383283 2756 dbSNP
rs1298664374 2758 dbSNP
rs760043986 2759 dbSNP
rs905832943 2762 dbSNP
rs35447628 2769 dbSNP
rs986586296 2771 dbSNP
rs913632087 2773 dbSNP
rs1335882168 2776 dbSNP
rs1278511851 2789 dbSNP
rs1486868460 2793 dbSNP
rs1374443159 2797 dbSNP
rs753787980 2810 dbSNP
rs967598861 2817 dbSNP
rs961434953 2823 dbSNP
rs1185432173 2827 dbSNP
rs1427264972 2831 dbSNP
rs1196129356 2834 dbSNP
rs1186222572 2840 dbSNP
rs1485579935 2845 dbSNP
rs977972580 2846 dbSNP
rs1340309326 2850 dbSNP
rs1272304547 2873 dbSNP
rs745365296 2879 dbSNP
rs1228983898 2888 dbSNP
rs936226269 2894 dbSNP
rs768191450 2901 dbSNP
rs972850974 2907 dbSNP
rs184320428 2908 dbSNP
rs915875027 2927 dbSNP
rs1431179682 2931 dbSNP
rs759428018 2941 dbSNP
rs145653775 2942 dbSNP
rs1357092067 2953 dbSNP
rs752509592 2961 dbSNP
rs1405490131 2971 dbSNP
rs758717091 2980 dbSNP
rs1454839126 2982 dbSNP
rs1163476758 2991 dbSNP
rs887178487 2992 dbSNP
rs1252908834 2994 dbSNP
rs986092245 2997 dbSNP
rs553532318 3000 dbSNP
rs1184804329 3001 dbSNP
rs1288943998 3008 dbSNP
rs1004074108 3011 dbSNP
rs34259285 3014 dbSNP
rs397688665 3014 dbSNP
rs200925423 3015 dbSNP
rs898428052 3028 dbSNP
rs796229010 3033 dbSNP
rs1291915879 3041 dbSNP
rs578116739 3042 dbSNP
rs1334073281 3047 dbSNP
rs911491425 3051 dbSNP
rs764212541 3052 dbSNP
rs1370688693 3054 dbSNP
rs538869298 3055 dbSNP
rs191336176 3060 dbSNP
rs12659398 3064 dbSNP
rs138302863 3065 dbSNP
rs1413372407 3072 dbSNP
rs1020724536 3073 dbSNP
rs1417745686 3077 dbSNP
rs896271950 3080 dbSNP
rs1318972152 3081 dbSNP
rs947928045 3082 dbSNP
rs1045354975 3083 dbSNP
rs1216507216 3088 dbSNP
rs190796165 3098 dbSNP
rs1251144616 3100 dbSNP
rs1006165234 3103 dbSNP
rs1033109453 3117 dbSNP
rs1216062439 3118 dbSNP
rs1016942025 3120 dbSNP
rs73808323 3125 dbSNP
rs1192159852 3127 dbSNP
rs1314973224 3127 dbSNP
rs991742795 3128 dbSNP
rs1369304067 3135 dbSNP
rs916157878 3148 dbSNP
rs994218696 3149 dbSNP
rs541825284 3150 dbSNP
rs1323197329 3157 dbSNP
rs955699571 3159 dbSNP
rs940070678 3161 dbSNP
rs1420495738 3163 dbSNP
rs1177245742 3168 dbSNP
rs573333590 3174 dbSNP
rs1393523300 3183 dbSNP
rs1018882566 3188 dbSNP
rs866032388 3189 dbSNP
rs979689380 3199 dbSNP
rs923576474 3205 dbSNP
rs1344065831 3214 dbSNP
rs1210588604 3219 dbSNP
rs932465157 3225 dbSNP
rs1300854214 3226 dbSNP
rs1455228733 3230 dbSNP
rs1365365779 3244 dbSNP
rs1298364087 3269 dbSNP
rs1327797111 3274 dbSNP
rs756578958 3280 dbSNP
rs1384884550 3297 dbSNP
rs1439819943 3298 dbSNP
rs1467940673 3305 dbSNP
rs1373849310 3318 dbSNP
rs1173314272 3325 dbSNP
rs1430487521 3326 dbSNP
rs1291578194 3328 dbSNP
rs1191133798 3330 dbSNP
rs780462696 3347 dbSNP
rs749638761 3350 dbSNP
rs540726101 3363 dbSNP
rs917685942 3365 dbSNP
rs1021008889 3367 dbSNP
rs561638741 3368 dbSNP
rs541924139 3370 dbSNP
rs909077689 3377 dbSNP
rs1252491286 3379 dbSNP
rs1224635523 3380 dbSNP
rs941917337 3380 dbSNP
rs540727231 3390 dbSNP
rs868136335 3393 dbSNP
rs533105915 3403 dbSNP
rs897119081 3407 dbSNP
rs1354034187 3414 dbSNP
rs991605564 3420 dbSNP
rs1410605090 3427 dbSNP
rs994184016 3432 dbSNP
rs114749944 3433 dbSNP
rs1166191761 3440 dbSNP
rs1461582153 3442 dbSNP
rs1372405135 3443 dbSNP
rs891193740 3466 dbSNP
rs972033934 3475 dbSNP
rs1255049916 3477 dbSNP
rs1481190020 3479 dbSNP
rs770300666 3483 dbSNP
rs564209372 3487 dbSNP
rs1018437637 3496 dbSNP
rs1193551407 3498 dbSNP
rs532975069 3511 dbSNP
rs1338252539 3515 dbSNP
rs968197064 3519 dbSNP
rs1235613968 3532 dbSNP
rs1471298236 3535 dbSNP
rs373134253 3540 dbSNP
rs193069016 3541 dbSNP
rs1410864533 3542 dbSNP
rs868249662 3543 dbSNP
rs956347293 3546 dbSNP
rs1327159999 3553 dbSNP
rs1460856859 3557 dbSNP
rs1390876634 3562 dbSNP
rs1391627213 3564 dbSNP
rs1162665598 3573 dbSNP
rs1356041744 3575 dbSNP
rs1462893535 3577 dbSNP
rs1442700216 3578 dbSNP
rs940033875 3591 dbSNP
rs1365171662 3606 dbSNP
rs1472817669 3606 dbSNP
rs1348875328 3610 dbSNP
rs1436870621 3623 dbSNP
rs974596688 3632 dbSNP
rs1416623896 3633 dbSNP
rs991827919 3636 dbSNP
rs1229374496 3645 dbSNP
rs1334333511 3652 dbSNP
rs917600017 3655 dbSNP
rs776820720 3656 dbSNP
rs969163751 3672 dbSNP
rs1049564445 3675 dbSNP
rs1438838772 3675 dbSNP
rs1392158827 3678 dbSNP
rs980965510 3681 dbSNP
rs1204299293 3692 dbSNP
rs909013414 3701 dbSNP
rs1386785154 3707 dbSNP
rs941845442 3715 dbSNP
rs943915743 3716 dbSNP
rs1481873110 3717 dbSNP
rs1377875050 3720 dbSNP
rs1036257238 3726 dbSNP
rs1042060535 3733 dbSNP
rs1189713198 3746 dbSNP
rs1209973665 3754 dbSNP
rs1257590261 3755 dbSNP
rs1474622641 3771 dbSNP
rs1161361520 3777 dbSNP
rs1421594388 3792 dbSNP
rs1282523161 3797 dbSNP
rs528927951 3802 dbSNP
rs902217771 3802 dbSNP
rs919162551 3803 dbSNP
rs1282783120 3828 dbSNP
rs933256301 3860 dbSNP
rs1368546368 3868 dbSNP
rs1051099690 3883 dbSNP
rs1431319918 3891 dbSNP
rs894881407 3893 dbSNP
rs1315916016 3906 dbSNP
rs1399935690 3914 dbSNP
rs891153429 3917 dbSNP
rs1175190319 3927 dbSNP
rs1006940586 3928 dbSNP
rs1393885615 3932 dbSNP
rs549331863 3942 dbSNP
rs1354862780 3946 dbSNP
rs1445957688 3947 dbSNP
rs1272388182 3954 dbSNP
rs1476646754 3963 dbSNP
rs1240896941 3966 dbSNP
rs1023061100 3967 dbSNP
rs567643595 3968 dbSNP
rs528541624 3977 dbSNP
rs762317169 3978 dbSNP
rs1347447149 3980 dbSNP
rs904005255 3986 dbSNP
rs1216439983 3988 dbSNP
rs1341354284 3989 dbSNP
rs974050593 3995 dbSNP
rs1429756535 4000 dbSNP
rs1355920890 4007 dbSNP
rs1212551203 4012 dbSNP
rs1280649015 4016 dbSNP
rs1314493830 4019 dbSNP
rs552584560 4019 dbSNP
rs1374493055 4023 dbSNP
rs1184794488 4028 dbSNP
rs1170485860 4035 dbSNP
rs1411192971 4036 dbSNP
rs1243707138 4040 dbSNP
rs1167903091 4052 dbSNP
rs1000998644 4053 dbSNP
rs1259979906 4056 dbSNP
rs770412188 4059 dbSNP
rs1485444533 4070 dbSNP
rs1233711033 4079 dbSNP
rs1206693915 4091 dbSNP
rs1436212139 4100 dbSNP
rs547075275 4110 dbSNP
rs377447746 4116 dbSNP
rs985297014 4129 dbSNP
rs912343375 4151 dbSNP
rs1294841321 4155 dbSNP
rs1231261545 4161 dbSNP
rs1031160585 4162 dbSNP
rs892703439 4165 dbSNP
rs1455449688 4172 dbSNP
rs1014294422 4186 dbSNP
rs1443722007 4187 dbSNP
rs17696407 4196 dbSNP
rs969469486 4203 dbSNP
rs943885399 4206 dbSNP
rs1412780055 4209 dbSNP
rs1420692883 4211 dbSNP
rs1320378097 4212 dbSNP
rs1345936537 4213 dbSNP
rs1430629380 4214 dbSNP
rs1042734481 4221 dbSNP
rs1446877003 4239 dbSNP
rs765265730 4242 dbSNP
rs775487577 4252 dbSNP
rs1408970231 4253 dbSNP
rs1179245334 4256 dbSNP
rs1479782037 4258 dbSNP
rs1016039613 4259 dbSNP
rs1373608452 4260 dbSNP
rs762600094 4261 dbSNP
rs539196301 4262 dbSNP
rs1192182078 4273 dbSNP
rs184586739 4286 dbSNP
rs1053362223 4289 dbSNP
rs1211564708 4308 dbSNP
rs189066916 4308 dbSNP
rs1307254901 4309 dbSNP
rs536529465 4311 dbSNP
rs1011917307 4315 dbSNP
rs1044546246 4320 dbSNP
rs1441058416 4322 dbSNP
rs1397303154 4326 dbSNP
rs971872424 4328 dbSNP
rs919131273 4330 dbSNP
rs181455702 4331 dbSNP
rs1285729771 4332 dbSNP
rs751679661 4335 dbSNP
rs933243669 4346 dbSNP
rs1447123954 4349 dbSNP
rs987799859 4352 dbSNP
rs912523337 4354 dbSNP
rs942712540 4355 dbSNP
rs185547185 4357 dbSNP
rs1455675730 4358 dbSNP
rs561598605 4365 dbSNP
rs1191740013 4368 dbSNP
rs72812861 4370 dbSNP
rs995519397 4371 dbSNP
rs1194046054 4378 dbSNP
rs1314732320 4381 dbSNP
rs1052551765 4382 dbSNP
rs1234370643 4387 dbSNP
rs150666817 4392 dbSNP
rs545152337 4396 dbSNP
rs189085055 4403 dbSNP
rs1363292985 4409 dbSNP
rs1290955859 4413 dbSNP
rs1160574694 4418 dbSNP
rs1452129557 4422 dbSNP
rs1344807808 4424 dbSNP
rs1013804014 4433 dbSNP
rs965618121 4438 dbSNP
rs1478229678 4439 dbSNP
rs530760894 4441 dbSNP
rs904834369 4443 dbSNP
rs1262392429 4453 dbSNP
rs1188024463 4472 dbSNP
rs1262019008 4476 dbSNP
rs767620973 4476 dbSNP
rs1211078282 4488 dbSNP
rs1349620209 4500 dbSNP
rs1277504218 4501 dbSNP
rs1015960831 4505 dbSNP
rs977935697 4519 dbSNP
rs542939626 4522 dbSNP
rs561176909 4539 dbSNP
rs1361778450 4541 dbSNP
rs750494447 4545 dbSNP
rs971839862 4546 dbSNP
rs528448633 4563 dbSNP
rs1053392954 4574 dbSNP
rs547038960 4579 dbSNP
rs1373563986 4588 dbSNP
rs954702579 4594 dbSNP
rs55729943 4595 dbSNP
rs1172532250 4601 dbSNP
rs916208802 4605 dbSNP
rs1329769033 4614 dbSNP
rs756671034 4627 dbSNP
rs1046159970 4629 dbSNP
rs560090766 4630 dbSNP
rs1003471119 4631 dbSNP
rs910470621 4633 dbSNP
rs574999521 4638 dbSNP
rs1350709043 4641 dbSNP
rs1199363478 4642 dbSNP
rs1253591455 4644 dbSNP
rs1480706372 4644 dbSNP
rs1225791091 4652 dbSNP
rs532486774 4655 dbSNP
rs780481098 4659 dbSNP
rs1235578149 4660 dbSNP
rs975368704 4666 dbSNP
rs766314908 4682 dbSNP
rs551083547 4683 dbSNP
rs1266397316 4686 dbSNP
rs569350193 4687 dbSNP
rs889827065 4696 dbSNP
rs1422863847 4697 dbSNP
rs1165336292 4700 dbSNP
rs892597540 4703 dbSNP
rs114615042 4708 dbSNP
rs139836079 4716 dbSNP
rs905430727 4717 dbSNP
rs1419306747 4726 dbSNP
rs1157038551 4727 dbSNP
rs145477868 4730 dbSNP
rs1462411983 4734 dbSNP
rs1164890487 4735 dbSNP
rs777505891 4745 dbSNP
rs1388982944 4751 dbSNP
rs1002495787 4762 dbSNP
rs1274405682 4770 dbSNP
rs1030801411 4775 dbSNP
rs1333239000 4776 dbSNP
rs116109401 4788 dbSNP
rs3749652 4796 dbSNP
rs552708640 4814 dbSNP
rs1337781085 4818 dbSNP
rs993205166 4819 dbSNP
rs746691196 4822 dbSNP
rs1399425240 4827 dbSNP
rs947746814 4830 dbSNP
rs1462813550 4834 dbSNP
rs1285910188 4835 dbSNP
rs1336389417 4841 dbSNP
rs981775931 4842 dbSNP
rs1453952270 4843 dbSNP
rs954538181 4857 dbSNP
rs1233803118 4879 dbSNP
rs1009131083 4895 dbSNP
rs1438602365 4903 dbSNP
rs1264835749 4906 dbSNP
rs1254170596 4909 dbSNP
rs1195980277 4911 dbSNP
rs940417034 4936 dbSNP
rs74604333 4939 dbSNP
rs1197362996 4944 dbSNP
rs1037606192 4951 dbSNP
rs1259230784 4957 dbSNP
rs11948757 4958 dbSNP
rs149406928 4965 dbSNP
rs1305723754 4979 dbSNP
rs575500575 4980 dbSNP
rs1329293891 4987 dbSNP
rs767824733 4994 dbSNP
rs1006916590 4999 dbSNP
rs569259121 5002 dbSNP
rs1259677612 5024 dbSNP
rs1418723447 5029 dbSNP
rs535022480 5032 dbSNP
rs1175001014 5036 dbSNP
rs1453077552 5043 dbSNP
rs999577917 5048 dbSNP
rs1187403062 5051 dbSNP
rs988162113 5061 dbSNP
rs1367256639 5064 dbSNP
rs1031502054 5067 dbSNP
rs957894315 5068 dbSNP
rs867170018 5069 dbSNP
rs745362421 5081 dbSNP
rs1168860579 5087 dbSNP
rs989255199 5091 dbSNP
rs1232220075 5092 dbSNP
rs1428694558 5115 dbSNP
rs1274246326 5123 dbSNP
rs779526009 5124 dbSNP
rs1356782900 5126 dbSNP
rs969247445 5134 dbSNP
rs1296131203 5143 dbSNP
rs1046998185 5150 dbSNP
rs1375715145 5157 dbSNP
rs1311861219 5168 dbSNP
rs1412305048 5169 dbSNP
rs775504037 5171 dbSNP
rs17696495 5172 dbSNP
rs1169063310 5181 dbSNP
rs1476675412 5184 dbSNP
rs1229606431 5188 dbSNP
rs575295074 5188 dbSNP
rs1251657430 5191 dbSNP
rs1341257001 5196 dbSNP
rs1421860316 5196 dbSNP
rs1193418112 5199 dbSNP
rs542847402 5204 dbSNP
rs757097778 5205 dbSNP
rs1259922341 5207 dbSNP
rs571752302 5215 dbSNP
rs898807168 5228 dbSNP
rs940345452 5230 dbSNP
rs1273812789 5234 dbSNP
rs971871472 5235 dbSNP
rs774162482 5239 dbSNP
rs931495176 5247 dbSNP
rs1217831495 5251 dbSNP
rs1355669472 5259 dbSNP
rs1486009729 5276 dbSNP
rs993174466 5278 dbSNP
rs1358001417 5281 dbSNP
rs1047417190 5289 dbSNP
rs890057232 5293 dbSNP
rs890180919 5302 dbSNP
rs1008689978 5303 dbSNP
rs1430807648 5305 dbSNP
rs796402943 5306 dbSNP
rs1475772969 5307 dbSNP
rs1389924831 5319 dbSNP
rs1448089283 5323 dbSNP
rs964524289 5327 dbSNP
rs1041447369 5329 dbSNP
rs1000031740 5343 dbSNP
rs1376921852 5348 dbSNP
rs1206756771 5356 dbSNP
rs1459013791 5373 dbSNP
rs573191636 5374 dbSNP
rs540568547 5380 dbSNP
rs1399506513 5387 dbSNP
rs988089877 5390 dbSNP
rs1335307500 5408 dbSNP
rs1294904850 5409 dbSNP
rs999927600 5413 dbSNP
rs913926991 5414 dbSNP
rs565114800 5415 dbSNP
rs1375298836 5424 dbSNP
rs537231514 5424 dbSNP
rs1462432127 5430 dbSNP
rs1296256948 5436 dbSNP
rs71613104 5453 dbSNP
rs1364140090 5461 dbSNP
rs1225924754 5467 dbSNP
rs1305823661 5482 dbSNP
rs971211576 5484 dbSNP
rs762003853 5503 dbSNP
rs969278350 5511 dbSNP
rs1232897961 5514 dbSNP
rs562233128 5518 dbSNP
rs926743412 5527 dbSNP
rs1486921046 5530 dbSNP
rs1035338898 5534 dbSNP
rs938177968 5536 dbSNP
rs1206210781 5540 dbSNP
rs1247986711 5542 dbSNP
rs1037927763 5551 dbSNP
rs532588134 5559 dbSNP
rs929566199 5563 dbSNP
rs1047849712 5568 dbSNP
rs972124015 5570 dbSNP
rs920362595 5573 dbSNP
rs951748126 5576 dbSNP
rs984297725 5578 dbSNP
rs1436274485 5581 dbSNP
rs1442221802 5581 dbSNP
rs201825932 5581 dbSNP
rs34255035 5581 dbSNP
rs36095984 5581 dbSNP
rs532773704 5581 dbSNP
rs543680699 5581 dbSNP
rs192445623 5582 dbSNP
rs1174971565 5583 dbSNP
rs1161636574 5589 dbSNP
rs1418098791 5596 dbSNP
rs1375397809 5597 dbSNP
rs1454922848 5598 dbSNP
rs182735096 5599 dbSNP
rs1387828275 5602 dbSNP
rs1432544374 5610 dbSNP
rs1327660973 5611 dbSNP
rs761190260 5613 dbSNP
rs10069164 5616 dbSNP
rs942860013 5617 dbSNP
rs1454629264 5618 dbSNP
rs1041333995 5620 dbSNP
rs1189225238 5627 dbSNP
rs1488068418 5630 dbSNP
rs944421598 5644 dbSNP
rs922826587 5656 dbSNP
rs371719502 5672 dbSNP
rs1351084662 5673 dbSNP
rs1318769998 5679 dbSNP
rs563005647 5683 dbSNP
rs935364880 5685 dbSNP
rs1038787086 5686 dbSNP
rs1299895049 5701 dbSNP
rs1218999432 5712 dbSNP
rs900321870 5727 dbSNP
rs147526951 5728 dbSNP
rs1398326479 5734 dbSNP
rs893899127 5734 dbSNP
rs1313522389 5735 dbSNP
rs1032835943 5743 dbSNP
rs1010904855 5762 dbSNP
rs1216158109 5763 dbSNP
rs891697161 5767 dbSNP
rs905058425 5768 dbSNP
rs1419908367 5772 dbSNP
rs1195617877 5775 dbSNP
rs1487087857 5786 dbSNP
rs1488381810 5791 dbSNP
rs1190231814 5807 dbSNP
rs1313542499 5809 dbSNP
rs1483987982 5809 dbSNP
rs397770642 5809 dbSNP
rs550409770 5809 dbSNP
rs566101136 5809 dbSNP
rs5873402 5809 dbSNP
rs1264849912 5819 dbSNP
rs1340094783 5833 dbSNP
rs1294195811 5840 dbSNP
rs1420289219 5842 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions K562 , CaSki , GM00637 , HACAT , Hep 3B , HEK 293T , HeLa , SK-N-BE , T98G , MCF-7 , U2OS , SA02
Disease 80315.0
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... "CPEB2 ...

- Morgan M; Iaconcig A; Muro AF, 2010, Nucleic acids research.

Article - Morgan M; Iaconcig A; Muro AF
- Nucleic acids research, 2010
The cytoplasmic polyadenylation element binding-protein (CPEB) is an RNA-binding protein that participates in translational control. CPEB2, CPEB3 and CPEB4 are paralog proteins very similar among themselves referred as the CPEB2 subfamily. To gain insight into common mechanisms of regulation of the CPEB2 subfamily transcripts, we looked for putative cis-acting elements present in the 3'-UTRs of the three paralogs. We found different families of miRNAs predicted to target all subfamily members. Most predicted target sites for these families are located in paralog positions suggesting that these putative regulatory motifs were already present in the ancestral gene. We validated target sites for miR-92 and miR-26 in the three paralogs using mutagenesis of miRNA-binding sites in reporter constructs combined with over-expression and depletion of miRNAs. Both miR-92 and miR-26 induced a decrease in Luciferase activity associated to a reduction in mRNA levels of the reporter constructs. We also showed that the endogenous miRNAs co-regulate CPEB2, CPEB3 and CPEB4 transcripts, supporting our hypothesis that these genes have a common regulatory mechanism mediated by miRNAs. We also suggest that the ancestral pattern of miRNA-binding motifs was maintained throughout the generation of highly conserved elements in each of the 3'-UTRs.
LinkOut: [PMID: 20660482]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Leeper NJ; Raiesdana A; Kojima Y; Chun HJ; et al.
- Journal of cellular physiology, 2011
Aberrant smooth muscle cell (SMC) plasticity has been implicated in a variety of vascular disorders including atherosclerosis, restenosis, and abdominal aortic aneurysm (AAA) formation. While the pathways governing this process remain unclear, epigenetic regulation by specific microRNAs (miRNAs) has been demonstrated in SMCs. We hypothesized that additional miRNAs might play an important role in determining vascular SMC phenotype. Microarray analysis of miRNAs was performed on human aortic SMCs undergoing phenotypic switching in response to serum withdrawal, and identified 31 significantly regulated entities. We chose the highly conserved candidate miRNA-26a for additional studies. Inhibition of miRNA-26a accelerated SMC differentiation, and also promoted apoptosis, while inhibiting proliferation and migration. Overexpression of miRNA-26a blunted differentiation. As a potential mechanism, we investigated whether miRNA-26a influences TGF-beta-pathway signaling. Dual-luciferase reporter assays demonstrated enhanced SMAD signaling with miRNA-26a inhibition, and the opposite effect with miRNA-26a overexpression in transfected human cells. Furthermore, inhibition of miRNA-26a increased gene expression of SMAD-1 and SMAD-4, while overexpression inhibited SMAD-1. MicroRNA-26a was also found to be downregulated in two mouse models of AAA formation (2.5- to 3.8-fold decrease, P < 0.02) in which enhanced switching from contractile to synthetic phenotype occurs. In summary, miRNA-26a promotes vascular SMC proliferation while inhibiting cellular differentiation and apoptosis, and alters TGF-beta pathway signaling. MicroRNA-26a represents an important new regulator of SMC biology and a potential therapeutic target in AAA disease.
LinkOut: [PMID: 20857419]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.747 2.1e-5 0.712 6.9e-5 23 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.677 5.2e-4 0.713 2.1e-4 20 Click to see details
GSE19536 Breast cancer 0.295 1.4e-3 0.284 2.1e-3 100 Click to see details
GSE19783 ER- ER- breast cancer 0.33 1.5e-3 0.335 1.3e-3 79 Click to see details
GSE21849 B cell lymphoma 0.504 2.7e-3 0.381 2.1e-2 29 Click to see details
GSE32688 Pancreatic cancer -0.44 5.9e-3 0.089 3.1e-1 32 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.741 1.1e-2 0.767 7.9e-3 9 Click to see details
GSE28260 Renal cortex and medulla -0.537 2.9e-2 -0.549 2.6e-2 13 Click to see details
GSE28544 Breast cancer -0.351 4.6e-2 -0.399 2.7e-2 24 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.298 7.4e-2 0.211 1.6e-1 25 Click to see details
GSE17306 Multiple myeloma 0.209 7.5e-2 0.218 6.6e-2 49 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.251 1.1e-1 0.261 1.0e-1 25 Click to see details
GSE19350 CNS germ cell tumors 0.337 1.4e-1 0.175 2.9e-1 12 Click to see details
GSE21687 Ependynoma primary tumors -0.11 1.9e-1 -0.041 3.7e-1 64 Click to see details
GSE14794 Lymphoblastoid cells 0.087 2.1e-1 0.131 1.1e-1 90 Click to see details
GSE21032 Prostate cancer 0.068 2.7e-1 0.068 2.7e-1 83 Click to see details
GSE19783 ER+ ER+ breast cancer 0.135 2.9e-1 0.114 3.2e-1 20 Click to see details
GSE38226 Liver fibrosis -0.05 4.1e-1 -0.162 2.4e-1 21 Click to see details
GSE26953 Aortic valvular endothelial cells 0.017 4.7e-1 0.024 4.6e-1 24 Click to see details
GSE27834 Pluripotent stem cells -0.016 4.8e-1 0.076 3.9e-1 16 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PRAD -0.379 0 -0.340 0.01 50 Click to see details
BRCA -0.209 0.03 -0.182 0.05 84 Click to see details
BLCA 0.384 0.06 0.618 0 18 Click to see details
UCEC -0.283 0.12 -0.307 0.1 19 Click to see details
CHOL 0.394 0.15 0.233 0.27 9 Click to see details
CESC -0.895 0.15 -1.000 0.5 3 Click to see details
STAD 0.173 0.17 0.100 0.29 32 Click to see details
PAAD -0.646 0.18 -0.200 0.4 4 Click to see details
ESCA -0.3 0.19 -0.045 0.45 11 Click to see details
KICH 0.167 0.21 0.094 0.33 25 Click to see details
LUSC 0.11 0.26 0.049 0.39 38 Click to see details
KIRC -0.064 0.3 -0.058 0.32 68 Click to see details
COAD 0.217 0.3 0.048 0.46 8 Click to see details
HNSC -0.045 0.39 -0.052 0.37 42 Click to see details
LUAD -0.063 0.42 0.112 0.36 12 Click to see details
THCA 0.024 0.43 0.000 0.5 59 Click to see details
KIRP -0.016 0.47 0.021 0.45 32 Click to see details
PCPG 0.015 0.5 -0.500 0.33 3 Click to see details
LIHC 0.001 0.5 0.025 0.43 49 Click to see details
LIHC 0.001 0.5 0.025 0.43 49 Click to see details
LIHC 0.001 0.5 0.025 0.43 49 Click to see details
449 hsa-miR-26a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000109 HMGA2 high mobility group AT-hook 2 4 5
MIRT000110 HMGA1 high mobility group AT-hook 1 3 5
MIRT000111 CCNE2 cyclin E2 4 2
MIRT000112 CCND2 cyclin D2 5 10
MIRT001021 CDK8 cyclin dependent kinase 8 2 2
MIRT001022 CDC6 cell division cycle 6 3 3
MIRT001039 LIF LIF, interleukin 6 family cytokine 1 2
MIRT001095 PTEN phosphatase and tensin homolog 4 7
MIRT001771 EZH2 enhancer of zeste 2 polycomb repressive complex 2 subunit 5 11
MIRT001772 PLAG1 PLAG1 zinc finger 3 2
MIRT002315 SERBP1 SERPINE1 mRNA binding protein 1 3 3
MIRT002340 SMAD1 SMAD family member 1 4 6
MIRT003212 MAP3K2 mitogen-activated protein kinase kinase kinase 2 3 2
MIRT003213 RB1 RB transcriptional corepressor 1 5 2
MIRT003803 SMAD4 SMAD family member 4 3 3
MIRT003968 MYC MYC proto-oncogene, bHLH transcription factor 2 2
MIRT004338 CTGF connective tissue growth factor 2 2
MIRT004339 STRADB STE20-related kinase adaptor beta 4 4
MIRT004615 IFNB1 interferon beta 1 3 2
MIRT004676 GSK3B glycogen synthase kinase 3 beta 7 10
MIRT005587 CPEB2 cytoplasmic polyadenylation element binding protein 2 3 2
MIRT005588 CPEB3 cytoplasmic polyadenylation element binding protein 3 4 2
MIRT005589 CPEB4 cytoplasmic polyadenylation element binding protein 4 3 2
MIRT005751 GDAP1 ganglioside induced differentiation associated protein 1 3 1
MIRT005920 MTDH metadherin 5 4
MIRT006306 CDK6 cyclin dependent kinase 6 2 1
MIRT006309 CCNE1 cyclin E1 3 2
MIRT006389 ESR1 estrogen receptor 1 1 1
MIRT006711 ABCA1 ATP binding cassette subfamily A member 1 2 1
MIRT006712 ARL4C ADP ribosylation factor like GTPase 4C 2 1
MIRT007177 E2F7 E2F transcription factor 7 2 7
MIRT007347 NOS2 nitric oxide synthase 2 3 2
MIRT007374 IL6 interleukin 6 2 1
MIRT030358 TGFBR2 transforming growth factor beta receptor 2 3 1
MIRT050053 HIST1H4E histone cluster 1 H4 family member e 1 1
MIRT050054 ZNF814 zinc finger protein 814 1 1
MIRT050055 ZNF233 zinc finger protein 233 1 1
MIRT050056 ABCB7 ATP binding cassette subfamily B member 7 1 1
MIRT050057 SCRN1 secernin 1 1 1
MIRT050058 NABP1 nucleic acid binding protein 1 2 8
MIRT050059 FAM20B FAM20B, glycosaminoglycan xylosylkinase 1 1
MIRT050060 ARCN1 archain 1 1 1
MIRT050061 ANO3 anoctamin 3 1 1
MIRT050062 TFAM transcription factor A, mitochondrial 1 1
MIRT050063 FER FER tyrosine kinase 1 1
MIRT050064 HIAT1 major facilitator superfamily domain containing 14A 1 1
MIRT050065 PPP1CC protein phosphatase 1 catalytic subunit gamma 1 1
MIRT050066 SLC35B4 solute carrier family 35 member B4 1 1
MIRT050067 RASA1 RAS p21 protein activator 1 1 1
MIRT050068 COX1 cytochrome c oxidase subunit I 1 1
MIRT050069 MSL3 MSL complex subunit 3 1 1
MIRT050070 GGA2 golgi associated, gamma adaptin ear containing, ARF binding protein 2 1 1
MIRT050071 GIT2 GIT ArfGAP 2 1 1
MIRT050072 DNMT1 DNA methyltransferase 1 1 1
MIRT050073 MFHAS1 malignant fibrous histiocytoma amplified sequence 1 1 1
MIRT050074 UBA2 ubiquitin like modifier activating enzyme 2 1 1
MIRT050075 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT050076 MTRF1 mitochondrial translation release factor 1 1 1
MIRT050077 WBSCR16 RCC1 like 1 1
MIRT050078 NUAK1 NUAK family kinase 1 1 1
MIRT050079 TUT1 terminal uridylyl transferase 1, U6 snRNA-specific 1 1
MIRT050080 PNMA2 paraneoplastic Ma antigen 2 1 1
MIRT050081 ACTL8 actin like 8 1 1
MIRT050082 HSPA8 heat shock protein family A (Hsp70) member 8 1 1
MIRT050083 DHX15 DEAH-box helicase 15 1 1
MIRT050084 TCP1 t-complex 1 1 1
MIRT050085 SLC25A5 solute carrier family 25 member 5 1 1
MIRT050086 LSM14A LSM14A, mRNA processing body assembly factor 1 1
MIRT050087 CAMKV CaM kinase like vesicle associated 1 1
MIRT050088 ALG10B ALG10B, alpha-1,2-glucosyltransferase 1 1
MIRT050089 TYW1 tRNA-yW synthesizing protein 1 homolog 1 1
MIRT050090 RPL13A ribosomal protein L13a 1 1
MIRT050091 AGO1 argonaute 1, RISC catalytic component 1 1
MIRT050092 TXLNG taxilin gamma 1 1
MIRT050093 RAB18 RAB18, member RAS oncogene family 1 1
MIRT050094 RPS27A ribosomal protein S27a 1 1
MIRT050095 RPS26 ribosomal protein S26 1 1
MIRT050096 PIKFYVE phosphoinositide kinase, FYVE-type zinc finger containing 1 1
MIRT050097 TP53INP1 tumor protein p53 inducible nuclear protein 1 1 1
MIRT050098 ZNF703 zinc finger protein 703 1 1
MIRT050099 MTRF1L mitochondrial translational release factor 1 like 1 1
MIRT050100 ZNF506 zinc finger protein 506 1 1
MIRT050101 KCTD5 potassium channel tetramerization domain containing 5 1 1
MIRT050102 CTC1 CST telomere replication complex component 1 1 1
MIRT050103 TKT transketolase 1 1
MIRT050104 LYST lysosomal trafficking regulator 1 1
MIRT050105 FAM134A reticulophagy regulator family member 2 1 1
MIRT050106 NKX2-5 NK2 homeobox 5 1 1
MIRT050107 AURKAIP1 aurora kinase A interacting protein 1 1 1
MIRT050108 ATP1A1 ATPase Na+/K+ transporting subunit alpha 1 1 1
MIRT050109 COASY Coenzyme A synthase 1 1
MIRT050110 CTR9 CTR9 homolog, Paf1/RNA polymerase II complex component 1 1
MIRT050111 COX3 cytochrome c oxidase III 1 1
MIRT050112 ELOVL6 ELOVL fatty acid elongase 6 1 1
MIRT050113 PIGT phosphatidylinositol glycan anchor biosynthesis class T 1 1
MIRT050114 TMCC3 transmembrane and coiled-coil domain family 3 1 1
MIRT050115 ARHGEF1 Rho guanine nucleotide exchange factor 1 1 1
MIRT050116 SHC2 SHC adaptor protein 2 1 1
MIRT050117 PSMA3 proteasome subunit alpha 3 1 1
MIRT050118 PTTG1 pituitary tumor-transforming 1 1 1
MIRT050119 RPS24 ribosomal protein S24 1 1
MIRT050120 SPTBN1 spectrin beta, non-erythrocytic 1 1 1
MIRT050121 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT050122 BTBD3 BTB domain containing 3 1 1
MIRT050123 AHR aryl hydrocarbon receptor 1 1
MIRT050124 EEF1B2 eukaryotic translation elongation factor 1 beta 2 1 1
MIRT050125 MRPL51 mitochondrial ribosomal protein L51 1 1
MIRT050126 SETD2 SET domain containing 2 1 1
MIRT050127 LRP6 LDL receptor related protein 6 1 1
MIRT050128 RHOBTB1 Rho related BTB domain containing 1 1 1
MIRT050129 HIST1H4J histone cluster 1 H4 family member j 1 1
MIRT050130 MYO10 myosin X 1 1
MIRT050131 ATP7B ATPase copper transporting beta 1 1
MIRT050132 CSRP2BP lysine acetyltransferase 14 1 1
MIRT050133 RBM39 RNA binding motif protein 39 1 1
MIRT050134 C14orf37 chromosome 14 open reading frame 37 2 3
MIRT050135 SFMBT1 Scm like with four mbt domains 1 1 1
MIRT050136 KIAA1704 GPALPP motifs containing 1 1 1
MIRT050137 ABCB9 ATP binding cassette subfamily B member 9 1 1
MIRT050138 ADM adrenomedullin 2 11
MIRT050139 USP7 ubiquitin specific peptidase 7 1 1
MIRT050140 TTN titin 1 1
MIRT050141 HNRNPU heterogeneous nuclear ribonucleoprotein U 1 1
MIRT050142 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon 1 1
MIRT050143 CEPT1 choline/ethanolamine phosphotransferase 1 1 1
MIRT050144 HOXC8 homeobox C8 1 1
MIRT050145 CTBP1 C-terminal binding protein 1 1 1
MIRT050146 SET SET nuclear proto-oncogene 1 1
MIRT050147 MCM3AP minichromosome maintenance complex component 3 associated protein 1 1
MIRT050148 TPGS2 tubulin polyglutamylase complex subunit 2 1 1
MIRT050149 CA2 carbonic anhydrase 2 1 1
MIRT050150 PCYT1A phosphate cytidylyltransferase 1, choline, alpha 1 1
MIRT050151 ACTN4 actinin alpha 4 1 1
MIRT050152 EPG5 ectopic P-granules autophagy protein 5 homolog 1 1
MIRT050153 OLA1 Obg like ATPase 1 1 1
MIRT050154 RRM2 ribonucleotide reductase regulatory subunit M2 1 1
MIRT050155 BBX BBX, HMG-box containing 1 1
MIRT050156 NUP205 nucleoporin 205 1 1
MIRT050157 C6orf47 chromosome 6 open reading frame 47 1 1
MIRT050158 CFLAR CASP8 and FADD like apoptosis regulator 1 1
MIRT050159 SEC31A SEC31 homolog A, COPII coat complex component 1 1
MIRT050160 GLG1 golgi glycoprotein 1 1 1
MIRT050161 TBC1D16 TBC1 domain family member 16 1 1
MIRT050162 BTBD9 BTB domain containing 9 1 1
MIRT050163 RND2 Rho family GTPase 2 1 1
MIRT050164 TUBG1 tubulin gamma 1 1 1
MIRT050165 AHRR aryl-hydrocarbon receptor repressor 1 1
MIRT050166 CNTD2 cyclin N-terminal domain containing 2 1 1
MIRT050167 UBE2A ubiquitin conjugating enzyme E2 A 1 1
MIRT050168 CCDC43 coiled-coil domain containing 43 1 1
MIRT050169 MSH6 mutS homolog 6 1 1
MIRT050170 HIST4H4 histone cluster 4 H4 1 1
MIRT050171 C17orf51 chromosome 17 open reading frame 51 1 1
MIRT050172 SLC25A30 solute carrier family 25 member 30 1 1
MIRT050173 USB1 U6 snRNA biogenesis phosphodiesterase 1 1 1
MIRT050174 MYH10 myosin heavy chain 10 1 1
MIRT050175 LINS lines homolog 1 1 1
MIRT050176 UBR4 ubiquitin protein ligase E3 component n-recognin 4 1 2
MIRT050177 ZNF207 zinc finger protein 207 1 1
MIRT050178 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 1
MIRT050179 TXNL1 thioredoxin like 1 1 1
MIRT050180 FOXO3 forkhead box O3 1 1
MIRT050181 COPB1 coatomer protein complex subunit beta 1 1 1
MIRT050182 FASN fatty acid synthase 1 1
MIRT050183 SARS seryl-tRNA synthetase 1 1
MIRT050184 DDB1 damage specific DNA binding protein 1 1 1
MIRT050185 PPIA peptidylprolyl isomerase A 1 1
MIRT050186 SLC35A4 solute carrier family 35 member A4 1 1
MIRT050187 TXNDC11 thioredoxin domain containing 11 1 1
MIRT050188 HIST2H2AA3 histone cluster 2 H2A family member a3 1 1
MIRT050189 TRAP1 TNF receptor associated protein 1 1 1
MIRT050190 SDCBP syndecan binding protein 1 1
MIRT050191 ASCC2 activating signal cointegrator 1 complex subunit 2 1 1
MIRT050192 KDM5C lysine demethylase 5C 1 1
MIRT050193 DST dystonin 1 1
MIRT050194 CLIC4 chloride intracellular channel 4 1 1
MIRT050195 WWP2 WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT050196 ATP5A1 ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle 1 1
MIRT050197 RPL13 ribosomal protein L13 1 1
MIRT050198 CNBP CCHC-type zinc finger nucleic acid binding protein 1 1
MIRT052649 MCL1 MCL1, BCL2 family apoptosis regulator 1 1
MIRT052903 CHD1 chromodomain helicase DNA binding protein 1 2 1
MIRT053077 CKS2 CDC28 protein kinase regulatory subunit 2 4 3
MIRT053097 PRKCD protein kinase C delta 4 2
MIRT053251 BAG4 BCL2 associated athanogene 4 2 1
MIRT053574 FGF9 fibroblast growth factor 9 3 1
MIRT054062 ACVR1 activin A receptor type 1 2 1
MIRT054415 AMACR alpha-methylacyl-CoA racemase 3 1
MIRT054432 ATM ATM serine/threonine kinase 3 1
MIRT054484 RCBTB1 RCC1 and BTB domain containing protein 1 3 1
MIRT054645 HGF hepatocyte growth factor 3 1
MIRT054676 LIN28B lin-28 homolog B 3 1
MIRT054677 ZCCHC11 zinc finger CCHC-type containing 11 3 1
MIRT060004 VANGL2 VANGL planar cell polarity protein 2 2 4
MIRT062177 WNK1 WNK lysine deficient protein kinase 1 2 2
MIRT064905 ZBTB18 zinc finger and BTB domain containing 18 2 6
MIRT066809 ZDHHC18 zinc finger DHHC-type containing 18 2 3
MIRT067540 METAP2 methionyl aminopeptidase 2 1 1
MIRT072092 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 5
MIRT072125 RTF1 RTF1 homolog, Paf1/RNA polymerase II complex component 1 1
MIRT073375 ABHD2 abhydrolase domain containing 2 1 1
MIRT075111 C16ORF70 chromosome 16 open reading frame 70 2 5
MIRT080605 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 2 8
MIRT085205 SLC5A3 solute carrier family 5 member 3 2 2
MIRT086007 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 2 2
MIRT087899 TNRC6B trinucleotide repeat containing 6B 2 5
MIRT089450 TET3 tet methylcytosine dioxygenase 3 2 3
MIRT089599 MAT2A methionine adenosyltransferase 2A 2 11
MIRT090517 SLC25A36 solute carrier family 25 member 36 2 2
MIRT097631 POLR3G RNA polymerase III subunit G 1 1
MIRT118410 DNMT3B DNA methyltransferase 3 beta 4 1
MIRT122040 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 1
MIRT133477 EP400 E1A binding protein p400 1 1
MIRT134087 KLHL42 kelch like family member 42 1 1
MIRT136529 KPNA6 karyopherin subunit alpha 6 1 1
MIRT137414 RLF rearranged L-myc fusion 1 1
MIRT137577 RCOR1 REST corepressor 1 1 1
MIRT137722 EIF5 eukaryotic translation initiation factor 5 1 1
MIRT147274 KPNA2 karyopherin subunit alpha 2 2 10
MIRT151691 CHAF1A chromatin assembly factor 1 subunit A 1 1
MIRT156734 FAM126B family with sequence similarity 126 member B 2 2
MIRT159273 RASGRP3 RAS guanyl releasing protein 3 1 1
MIRT166022 SFXN1 sideroflexin 1 1 1
MIRT166592 ZSWIM6 zinc finger SWIM-type containing 6 1 1
MIRT168865 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT168937 IRF4 interferon regulatory factor 4 1 1
MIRT169515 TTK TTK protein kinase 1 1
MIRT169560 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT170138 KLHDC10 kelch domain containing 10 1 1
MIRT175075 DCAF10 DDB1 and CUL4 associated factor 10 1 1
MIRT183141 WEE1 WEE1 G2 checkpoint kinase 2 1
MIRT187790 ANKRD52 ankyrin repeat domain 52 1 1
MIRT191753 ZNF410 zinc finger protein 410 2 2
MIRT193070 MAPK6 mitogen-activated protein kinase 6 2 2
MIRT193726 USP3 ubiquitin specific peptidase 3 1 1
MIRT203408 DYRK1A dual specificity tyrosine phosphorylation regulated kinase 1A 1 1
MIRT206543 RHOQ ras homolog family member Q 2 2
MIRT210981 TET2 tet methylcytosine dioxygenase 2 1 1
MIRT213685 PTPN13 protein tyrosine phosphatase, non-receptor type 13 3 1
MIRT215349 CREBRF CREB3 regulatory factor 2 2
MIRT227685 TBC1D13 TBC1 domain family member 13 2 2
MIRT243962 MAP1B microtubule associated protein 1B 2 2
MIRT250410 TNRC6A trinucleotide repeat containing 6A 2 7
MIRT262152 OTUD1 OTU deubiquitinase 1 1 1
MIRT277212 AKIRIN1 akirin 1 2 2
MIRT286389 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 3
MIRT308147 PDE12 phosphodiesterase 12 2 2
MIRT319694 UBN2 ubinuclein 2 2 3
MIRT327077 KLHL15 kelch like family member 15 2 10
MIRT346489 SSX2IP SSX family member 2 interacting protein 1 1
MIRT438130 ADAM17 ADAM metallopeptidase domain 17 6 3
MIRT438159 PIK3C2A phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha 1 1
MIRT438209 CHEK1 checkpoint kinase 1 2 1
MIRT438638 TDG thymine DNA glycosylase 1 1
MIRT438656 PHB prohibitin 3 1
MIRT444707 ZNF772 zinc finger protein 772 2 2
MIRT448615 OTUD4 OTU deubiquitinase 4 2 2
MIRT451358 UQCR11 ubiquinol-cytochrome c reductase, complex III subunit XI 2 2
MIRT457292 ZBTB45 zinc finger and BTB domain containing 45 2 2
MIRT458763 CES2 carboxylesterase 2 2 2
MIRT458855 CD55 CD55 molecule (Cromer blood group) 2 2
MIRT460261 SLC26A2 solute carrier family 26 member 2 2 2
MIRT461702 ZNF426 zinc finger protein 426 2 2
MIRT465730 TMTC3 transmembrane and tetratricopeptide repeat containing 3 2 2
MIRT466688 TAF13 TATA-box binding protein associated factor 13 2 4
MIRT468541 SERP1 stress associated endoplasmic reticulum protein 1 2 2
MIRT468809 SACS sacsin molecular chaperone 2 11
MIRT470198 PSAT1 phosphoserine aminotransferase 1 2 6
MIRT476009 GTF2A1 general transcription factor IIA subunit 1 2 8
MIRT477228 ETF1 eukaryotic translation termination factor 1 2 4
MIRT477752 EDEM3 ER degradation enhancing alpha-mannosidase like protein 3 2 2
MIRT478346 DDIT4 DNA damage inducible transcript 4 2 2
MIRT478525 CTNS cystinosin, lysosomal cystine transporter 2 2
MIRT480793 BLOC1S2 biogenesis of lysosomal organelles complex 1 subunit 2 2 6
MIRT482242 AGPAT5 1-acylglycerol-3-phosphate O-acyltransferase 5 2 2
MIRT486465 MDM2 MDM2 proto-oncogene 2 10
MIRT487561 LOXL2 lysyl oxidase like 2 2 2
MIRT498663 ZNF664 zinc finger protein 664 2 8
MIRT499509 RNF6 ring finger protein 6 2 6
MIRT502456 FRAT2 FRAT2, WNT signaling pathway regulator 2 6
MIRT502713 CREBZF CREB/ATF bZIP transcription factor 2 6
MIRT502853 CHEK2 checkpoint kinase 2 2 6
MIRT507558 DEPDC1 DEP domain containing 1 2 6
MIRT524742 BRCA1 BRCA1, DNA repair associated 2 2
MIRT527178 LRRTM4 leucine rich repeat transmembrane neuronal 4 2 2
MIRT527909 B3GALT5 beta-1,3-galactosyltransferase 5 2 2
MIRT532895 ZNF451 zinc finger protein 451 2 2
MIRT533588 TOB1 transducer of ERBB2, 1 2 7
MIRT534368 SETD8 lysine methyltransferase 5A 2 4
MIRT535060 PPP2R5D protein phosphatase 2 regulatory subunit B'delta 2 4
MIRT536204 MAD2L1 mitotic arrest deficient 2 like 1 2 2
MIRT537233 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 2 2
MIRT539774 KIAA0408 KIAA0408 2 6
MIRT540867 ZBTB24 zinc finger and BTB domain containing 24 2 2
MIRT541042 SOGA3 SOGA family member 3 2 6
MIRT541350 DDX3X DEAD-box helicase 3, X-linked 2 2
MIRT544949 TUB tubby bipartite transcription factor 2 4
MIRT545809 ZNF608 zinc finger protein 608 2 2
MIRT547008 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 2
MIRT551188 EPB41L3 erythrocyte membrane protein band 4.1 like 3 2 2
MIRT551973 TMEM19 transmembrane protein 19 2 2
MIRT552044 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 2 2
MIRT553325 TSC22D2 TSC22 domain family member 2 2 2
MIRT554367 SFPQ splicing factor proline and glutamine rich 2 2
MIRT555741 PDCD10 programmed cell death 10 2 2
MIRT556346 MAN2A1 mannosidase alpha class 2A member 1 2 3
MIRT560389 TMEM254 transmembrane protein 254 2 2
MIRT560465 SMIM9 small integral membrane protein 9 2 2
MIRT561122 ATP2B1 ATPase plasma membrane Ca2+ transporting 1 2 2
MIRT562626 ARNTL2 aryl hydrocarbon receptor nuclear translocator like 2 2 2
MIRT564084 NSA2 NSA2, ribosome biogenesis homolog 2 2
MIRT564207 SDE2 SDE2 telomere maintenance homolog 2 2
MIRT565191 TSHZ1 teashirt zinc finger homeobox 1 2 2
MIRT567887 CSTF2 cleavage stimulation factor subunit 2 2 2
MIRT568259 BMP2K BMP2 inducible kinase 2 2
MIRT568505 ARF1 ADP ribosylation factor 1 2 2
MIRT572178 CDV3 CDV3 homolog 2 2
MIRT574711 HAUS8 HAUS augmin like complex subunit 8 2 3
MIRT610597 NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit 2 2
MIRT614445 WDR92 WD repeat domain 92 2 2
MIRT615442 FAXC failed axon connections homolog 2 2
MIRT618503 HSPD1 heat shock protein family D (Hsp60) member 1 2 2
MIRT618903 CDK9 cyclin dependent kinase 9 2 2
MIRT620083 TNFAIP8L1 TNF alpha induced protein 8 like 1 2 2
MIRT620286 GLTP glycolipid transfer protein 2 2
MIRT622464 RNF11 ring finger protein 11 2 2
MIRT624644 ASXL3 additional sex combs like 3, transcriptional regulator 2 2
MIRT624697 AQR aquarius intron-binding spliceosomal factor 2 2
MIRT625256 ZNF566 zinc finger protein 566 2 2
MIRT628258 EFCAB14 EF-hand calcium binding domain 14 2 2
MIRT628872 FAM177A1 family with sequence similarity 177 member A1 2 2
MIRT630720 FPR1 formyl peptide receptor 1 2 2
MIRT631887 SLFN13 schlafen family member 13 2 2
MIRT637716 MYOZ3 myozenin 3 2 2
MIRT639892 SSR3 signal sequence receptor subunit 3 2 2
MIRT642506 ORC6 origin recognition complex subunit 6 2 2
MIRT644723 SEPT14 septin 14 2 2
MIRT645341 AGTPBP1 ATP/GTP binding protein 1 2 2
MIRT648886 TUBGCP5 tubulin gamma complex associated protein 5 2 2
MIRT653565 SLC35B3 solute carrier family 35 member B3 2 2
MIRT656095 MTA3 metastasis associated 1 family member 3 2 2
MIRT660204 BMPR1A bone morphogenetic protein receptor type 1A 2 2
MIRT660753 ALDH6A1 aldehyde dehydrogenase 6 family member A1 2 2
MIRT661379 RHCG Rh family C glycoprotein 2 2
MIRT662310 ADM2 adrenomedullin 2 2 2
MIRT662628 MCM8 minichromosome maintenance 8 homologous recombination repair factor 2 2
MIRT663688 ZNF347 zinc finger protein 347 2 2
MIRT665109 FKTN fukutin 2 2
MIRT665262 ZKSCAN1 zinc finger with KRAB and SCAN domains 1 2 2
MIRT666273 SLC31A1 solute carrier family 31 member 1 2 2
MIRT666646 RBM48 RNA binding motif protein 48 2 2
MIRT667511 LUC7L2 LUC7 like 2, pre-mRNA splicing factor 2 2
MIRT669228 C7orf55-LUC7L2 C7orf55-LUC7L2 readthrough 2 2
MIRT669271 C1orf50 chromosome 1 open reading frame 50 2 2
MIRT671783 RGS17 regulator of G protein signaling 17 2 2
MIRT672379 RPL37 ribosomal protein L37 2 2
MIRT673464 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 2
MIRT673600 HPSE heparanase 2 4
MIRT676269 NWD1 NACHT and WD repeat domain containing 1 2 2
MIRT676514 RNF216 ring finger protein 216 2 2
MIRT676653 LRRC27 leucine rich repeat containing 27 2 2
MIRT677335 PHAX phosphorylated adaptor for RNA export 2 2
MIRT677523 OCIAD2 OCIA domain containing 2 2 2
MIRT677548 C19orf52 translocase of inner mitochondrial membrane 29 2 2
MIRT677724 SSR1 signal sequence receptor subunit 1 2 2
MIRT677800 PNPLA3 patatin like phospholipase domain containing 3 2 2
MIRT677885 DCP1A decapping mRNA 1A 2 2
MIRT678104 MICA MHC class I polypeptide-related sequence A 2 2
MIRT678431 PDE4C phosphodiesterase 4C 2 2
MIRT678488 ARHGEF39 Rho guanine nucleotide exchange factor 39 2 2
MIRT678898 TTLL12 tubulin tyrosine ligase like 12 2 2
MIRT679296 SSBP2 single stranded DNA binding protein 2 2 2
MIRT679572 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 2 2
MIRT680003 ZNF860 zinc finger protein 860 2 2
MIRT694963 PLAC8 placenta specific 8 2 2
MIRT697861 UBE2H ubiquitin conjugating enzyme E2 H 2 2
MIRT698310 TMEM2 transmembrane protein 2 2 2
MIRT701712 MTMR12 myotubularin related protein 12 2 2
MIRT705964 ACBD5 acyl-CoA binding domain containing 5 2 2
MIRT714342 DIP2A disco interacting protein 2 homolog A 2 2
MIRT715309 POLR2E RNA polymerase II subunit E 2 2
MIRT717477 PDE4DIP phosphodiesterase 4D interacting protein 2 2
MIRT719604 PRKX protein kinase, X-linked 2 2
MIRT724483 CSNK1A1 casein kinase 1 alpha 1 2 2
MIRT726021 ZNF680 zinc finger protein 680 1 1
MIRT726041 ZNF254 zinc finger protein 254 1 1
MIRT726096 WNT5A Wnt family member 5A 1 1
MIRT726288 TMEM30A transmembrane protein 30A 1 1
MIRT726312 TMCC1 transmembrane and coiled-coil domain family 1 1 1
MIRT726446 SSH2 slingshot protein phosphatase 2 1 1
MIRT726486 SMEK1 protein phosphatase 4 regulatory subunit 3A 1 1
MIRT726514 SLC7A1 solute carrier family 7 member 1 1 1
MIRT726535 SLC38A2 solute carrier family 38 member 2 1 1
MIRT726657 SASS6 SAS-6 centriolar assembly protein 1 1
MIRT726778 REEP4 receptor accessory protein 4 1 1
MIRT726937 PIK3R4 phosphoinositide-3-kinase regulatory subunit 4 1 1
MIRT726989 PDE4B phosphodiesterase 4B 1 1
MIRT727060 NUDT19 nudix hydrolase 19 1 1
MIRT727062 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 1
MIRT727485 HSPA13 heat shock protein family A (Hsp70) member 13 1 1
MIRT727488 HNRNPA0 heterogeneous nuclear ribonucleoprotein A0 1 1
MIRT727508 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT727675 FBXO11 F-box protein 11 1 1
MIRT727780 ELAVL2 ELAV like RNA binding protein 2 1 1
MIRT727786 EIF4G2 eukaryotic translation initiation factor 4 gamma 2 1 1
MIRT727793 EHD1 EH domain containing 1 1 1
MIRT727863 DNMBP dynamin binding protein 1 1
MIRT727903 DCTN4 dynactin subunit 4 1 1
MIRT727941 CPSF2 cleavage and polyadenylation specific factor 2 1 1
MIRT727966 COX5A cytochrome c oxidase subunit 5A 1 1
MIRT728000 CHORDC1 cysteine and histidine rich domain containing 1 3 1
MIRT728203 BID BH3 interacting domain death agonist 1 1
MIRT728213 BCL7B BCL tumor suppressor 7B 1 1
MIRT728306 ARPP19 cAMP regulated phosphoprotein 19 1 1
MIRT728331 AP1S3 adaptor related protein complex 1 sigma 3 subunit 1 1
MIRT728396 ACSL3 acyl-CoA synthetase long chain family member 3 1 1
MIRT731168 ITGA5 integrin subunit alpha 5 2 1
MIRT731390 DUSP4 dual specificity phosphatase 4 3 1
MIRT732062 NRAS NRAS proto-oncogene, GTPase 3 1
MIRT732063 E2F2 E2F transcription factor 2 3 1
MIRT732182 PTGS2 prostaglandin-endoperoxide synthase 2 6 2
MIRT732280 JAG1 jagged 1 3 1
MIRT732490 NRP1 neuropilin 1 1 0
MIRT732621 MS multiple sclerosis 1 0
MIRT733344 CREB1 cAMP responsive element binding protein 1 4 0
MIRT733365 ADIPOQ adiponectin, C1Q and collagen domain containing 1 0
MIRT733699 NORAD non-coding RNA activated by DNA damage 2 0
MIRT733700 UBE3A ubiquitin protein ligase E3A 2 0
MIRT733702 CCND1 cyclin D1 2 0
MIRT733703 TGFBR1 transforming growth factor beta receptor 1 2 0
MIRT734551 SHC4 SHC adaptor protein 4 2 0
MIRT734552 PFDN4 prefoldin subunit 4 2 0
MIRT734721 CD38 CD38 molecule 3 0
MIRT736775 MAP2 microtubule associated protein 2 2 0
MIRT736838 USP35 ubiquitin specific peptidase 35 2 0
MIRT736852 EIF2A eukaryotic translation initiation factor 2A 2 0
MIRT737078 ULK1 unc-51 like autophagy activating kinase 1 3 0
MIRT737079 SNHG6 small nucleolar RNA host gene 6 3 0
MIRT737091 ULK2 unc-51 like autophagy activating kinase 2 3 0
MIRT737491 FLI1 Fli-1 proto-oncogene, ETS transcription factor 2 0
MIRT755414 NEK6 NIMA related kinase 6 3 1
MIRT755509 ICAM1 intercellular adhesion molecule 1 1 1
MIRT755687 RUNX2 runt related transcription factor 2 3 1
MIRT755688 SPP1 secreted phosphoprotein 1 3 1
MIRT755689 ALPL alkaline phosphatase, liver/bone/kidney 3 1
MIRT756239 NEAT1 nuclear paraspeckle assembly transcript 1 (non-protein coding) 2 1
MIRT756240 FANCE Fanconi anemia complementation group E 3 1
MIRT756287 ZBTB7C zinc finger and BTB domain containing 7C 3 1
MIRT756352 PLCB1 phospholipase C beta 1 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-26a Hydroxamic acid HDACi LAQ824 NULL NULL Microarray breast cancer cell line SKBr3 16452179 2006 down-regulated
miR-26a Curcumin NULL 969516 Microarray BxPC-3 human pancreatic carcinoma cell line 18347134 2008 down-regulated
miR-26a Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 down-regulated
miR-26a Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 up-regulated
miR-26a Morphine approved 5288826 Microarray human monocyte-derived macrophages (h-mdms) infection with HIV-1 20564181 2010 down-regulated
miR-26a Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-26a Enoxacin approved 3229 Quantitative real-time PCR HCT-116 and RKO colon cancer cell lines 21368194 2011 up-regulated
miR-26a Metformin approved 4091 Quantitative real-time PCR pancreatic cancer cells 22086681 2012 up-regulated
miR-26a Metformin approved 4091 Quantitative real-time PCR pancreatic cancer cells 22086681 2012 up-regulated
miR-26a Tamoxifen approved 2733526 Quantitative real-time PCR breast cancer 22094936 2012 up-regulated
miR-26a CDF(analogues of curcumin) NULL NULL Quantitative real-time PCR pancreatic cancer cells 22108826 2012 up-regulated
miR-26a Metformin approved 4091 Quantitative real-time PCR Pancreatic Neoplasms 22245693 2012 up-regulated
miR-26a Trastuzumab approved NULL Microarray HER2-positive breast cancer 22384020 2012 up-regulated
miR-26a Trastuzumab approved NULL Quantitative real-time PCR HER2-positive breast cancer 22384020 2012 up-regulated
miR-26a 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-26a 5-aminoimidazole-4-carboxamide-1-β-d-ribofuranoside (AICAR) NULL 16078949 Microarray hepatocytes 23107762 2013 down-regulated
miR-26a Sevoflurane approved 5206 Quantitative real-time PCR lung cell 23124245 2012 down-regulated
miR-26a Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse liver 19270793 2009 up-regulated
miR-26a Budesonide approved 5281004 Microarray neonatal mice liver 20145010 2010 up-regulated
miR-26a Phenethyl isothiocyanate(PEITC) NULL 16741 Microarray neonatal mice liver 20145010 2010 up-regulated
miR-26a Atorvastatin approved 60823 Quantitative real-time PCR Cardiomyocyte 23860036 2013 down-regualted
miR-26a Nicotine approved 89594 Microarray Rat adrenal pheochromocytoma PC12 cell 18845019 2009 up-regulated
miR-26a Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 down-regulated
miR-26a Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-26a Marine fungal metabolite 1386A NULL NULL Microarray MCF-7 breast cancer cells. 22159329 2012 up-regulated
miR-26a Trastuzumab approved NULL Microarray BT474 cells 22384020 2012 up-regulated
miR-26a Trastuzumab approved NULL Microarray SKBR3 cells. 22384020 2012 up-regulated
miR-26a Vitamin D3 approved 5280795 Quantitative real-time PCR Plasma 22594500 2012 up-regulated
miR-26a Vitamin D3 approved 5280795 Quantitative real-time PCR Plasma 22594500 2012 up-regulated
miR-26a Temozolomide approved 5394 Quantitative real-time PCR glioblastoma cells. 22722712 2012 down-regulated
miR-26a Phenethyl isothiocyanate(PEITC) NULL 16741 Microarray neonatal mice liver 20145010 2010 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-26a-5p [(1R,2R,3E,7S,11E,13S,15S)-15-hydroxy-7-methyl-5-oxo-6-oxabicyclo[11.3.0]hexadeca-3,11-dien-2-yl] (2R)-2-(dimethylamino)-3-methylbutanoate;hydrochloride 45028997 NSC745103 resistant
hsa-miR-26a-5p 1-[(E)-[phenyl(pyridin-2-yl)methylidene]amino]-3-(2-pyridin-2-ylethyl)thiourea 9571616 NSC689531 sensitive
hsa-miR-26a-5p 1-[phenyl(2-pyridinyl)methylene]-4-(2-methylphenyl)thiosemicarbazide 6148953 NSC668326 sensitive
hsa-miR-26a-5p 1-cyclohexyl-3-[(e)-[phenyl(2-pyridyl)methylene]amino]urea 6179448 NSC689539 sensitive
hsa-miR-26a-5p 2',6'-dibromospiro[7,8-dihydro-6h-pyrido[2,3-g]quinoline-9,4'-cyclohexa-2,5-diene]-1',5,10-trione 383051 NSC671095 resistant
hsa-miR-26a-5p 2-hydroxy-N-[(E)-1-[6-[(E)-N-[(2-hydroxybenzoyl)amino]-C-methylcarbonimidoyl]pyridin-2-yl]ethylideneamino]benzamide 5779747 NSC617573 sensitive
hsa-miR-26a-5p 2,7-dicyanoxanthone 363841 NSC629107 resistant
hsa-miR-26a-5p 3-[(Z)-[phenyl(pyridin-2-yl)methylidene]amino]-1,1-bis(pyridin-2-ylmethyl)thiourea 5466413 NSC689533 sensitive
hsa-miR-26a-5p 3-imino-n-(4-methylphenyl)-5-(methylthio)-1-phenyl-2,3-dihydro-1h-pyrazole-4-carboxamide 390314 NSC687606 resistant
hsa-miR-26a-5p 3,5,12,14-tetrabutyl-7,10-dithia-8,9-diselena-3,5,12,14-tetrazatricyclo[9.3.0.02,6]tetradeca-1(11),2(6)-diene-4,13-diselone 395765 NSC700584 sensitive
hsa-miR-26a-5p 4-amino-2-(4-chloroanilino)-5-(4-methylbenzoyl)-n-phenyl-1h-pyrrole-3-carbothioamide 5472799 NSC721554 resistant
hsa-miR-26a-5p 4-amino-8-chloro-2-(4-chlorophenyl)iminopyrimido[2,1-b][1,3]benzothiazole-3-carbonitrile 45029233 NSC745678 resistant
hsa-miR-26a-5p 5-chloro-N-[(E)-[phenyl(pyridin-2-yl)methylidene]amino]pyridin-2-amine 6519698 NSC693627 sensitive
hsa-miR-26a-5p 5-chloro-n-[(e)-1-pyridin-2-ylethylideneamino]-1,3-benzothiazol-2-amine 9572096 NSC703111 sensitive
hsa-miR-26a-5p 5-fluoro-n-[(e)-1-pyridin-2-ylethylideneamino]-1,3-benzothiazol-2-amine 9572046 NSC693634 sensitive
hsa-miR-26a-5p 5-nitro-n-[(e)-[phenyl(pyridin-2-yl)methylidene]amino]pyridin-2-amine 6519692 NSC693620 sensitive
hsa-miR-26a-5p 7-[3,4-dihydroxy-5-(hydroxymethyl)tetrahydrofuran-2-yl]-3h-thieno[3,4-d]pyrimidine-4-thione 3005067 NSC670036 sensitive
hsa-miR-26a-5p 9-[(2e)-2-(4-chlorophenyl)-2-hydroxyiminoethoxy]chromeno[3,4-b]chromene-6,12-dione 9572588 NSC721045 resistant
hsa-miR-26a-5p 9-acridinamine, n-(4-ethoxyphenyl)-, monohydrochloride 2788193 NSC165714 resistant
hsa-miR-26a-5p Crambescidin 800 trihydrochloride 400719 NSC713155 resistant
hsa-miR-26a-5p Crotonosid 223996 NSC12161 sensitive
hsa-miR-26a-5p Cryptophycin b 5468424 NSC670038 resistant
hsa-miR-26a-5p Laurusin 135476719 NSC106486 sensitive
hsa-miR-26a-5p N'-(2-hydroxy-5-(hydroxy(oxido)amino)benzylidene)-1-piperidinecarbothiohydrazide 135484941 NSC689530 sensitive
hsa-miR-26a-5p N-(2-hydroxy-5-methylphenyl)-4-[[[2-(trifluoromethyl)pyridin-4-yl]amino]methyl]benzamide 54613415 NSC748715 sensitive
hsa-miR-26a-5p N-[(e)-[(4-methoxyphenyl)-pyridin-2-ylmethylidene]amino]pyridin-2-amine 9630043 NSC693622 sensitive
hsa-miR-26a-5p N-[(e)-1-pyrimidin-2-ylethylideneamino]-1,3-benzothiazol-2-amine 9572048 NSC693636 sensitive
hsa-miR-26a-5p N,N'-bis[5-[[5-[(3-amino-3-iminopropyl)carbamoyl]-1-methylpyrrol-3-yl]carbamoyl]-1-methylpyrrol-3-yl]butanediamide;hydrochloride 367397 NSC637124 resistant
hsa-miR-26a-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-26a-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-26a-5p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-26a-5p Docetaxel 148124 NSC628503 approved resistant Low Lung Cancer tissue
hsa-miR-26a-5p Docetaxel 148124 NSC628503 approved resistant Low Gastric Cancer tissue
hsa-miR-26a-5p Fluorouracil 3385 NSC19893 approved resistant High Colon Cancer cell line (KM12C)
hsa-miR-26a-5p Paclitaxel 36314 NSC125973 approved sensitive Low Breast Cancer cell line (MDA-MB-231, MCF-7, MDA-MB-435, MDA-MB-468, MCF-10A, 184A1)
hsa-miR-26a-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (RKO)
hsa-miR-26a-5p Imatinib 5291 NSC743414 approved sensitive High Chronic Myeloid Leukemia tissue
hsa-miR-26a-5p Platinum-based doublet chemotherapy resistant High Lung Adenocarcinoma tissue
hsa-miR-26a-5p Cisplatin 5460033 NSC119875 approved resistant Low Ovarian Cancer tissue
hsa-miR-26a-5p Cetuximab resistant High Colon Cancer cell line
hsa-miR-26a-5p Cisplatin 5460033 NSC119875 approved sensitive Low Gastric Cancer cell line (SGC7901)
hsa-miR-26a-5p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-26a-5p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-26a-5p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-26a-5p Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-26a-5p Mitoxantrone 4212 NSC279836 approved resistant High Breast Cancer cell line (MCF-7)