>TAGLN2|NM_003564|3'UTR
   1 TCCCACCCCAGGCCTTGCCCCTGCCCTCCCACGAATGGTTAATATATATGTAGATATATATTTTAGCAGTGACATTCCCA
  81 GAGAGCCCCAGAGCTCTCAAGCTCCTTTCTGTCAGGGTGGGGGGTTCAGCCTGTCCTGTCACCTCTGAGGTGCCTGCTGG
 161 CATCCTCTCCCCCATGCTTACTAATACATTCCCTTCCCCATAGCCATCAAAACTGGACCAACTGGCCTCTTCCTTTCCCC
 241 TGGGACCAAAATTTAGGGGCCTCAGTCCCTCACCGCCATGCCCTGGCCTATTCTGTCTCTCCTTCTTCCCCCTGGCCTGT
 321 TCTGTCTCTGAGCTCTGTGTCCTCCGTTCATTCCATGGCTGGGAGTCACTGATGCTGCCTCTGCCTTCTGATGCTGGACT
 401 GGCCTTGCTTCTACAAGTATGCTTCTCCCACAGCTGTGGCTGCAGGAACTTAATTTATAGGGAGGAGCCTGTGGCAGCTG
 481 CTGCCCCAGCCACAGCTGCACTGACTGTGCTCACCACACATCTGGGGCAGCCTTCCCTGGCAGGGGCCCTCGTGGCTTCT
 561 CATTTTCCATTCCCTTCACTGTGGCTAAGGGGTGGGGTGAGGGGATGGAGAGGGAGGGCTGCCTACCATGGTCTGGGGCT
 641 TGAGGAAGATGAGTTTGTTGATTTAAATAAAGAATTTGTCATTTTTGAATGGAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' gucgaccaacuucCCCUGGUUu 5' |||||||| Target 5' cttcctttcccctGGGACCAAa 3'	229 - 250	145.00	-13.80
2	miRNA 3' gucgaccaacUUCCCCUGGUUu 5' || ||||||| Target 5' tagccatcaaAACTGGACCAAc 3'	201 - 222	144.00	-10.05
3	miRNA 3' guCGACCAACUUCCCCUGGUUu 5' |: || || ||||||: :| Target 5' ggGTGGGGTG-AGGGGATGGAg 3'	590 - 610	103.00	-19.30

Mutant ID	Mutant Position	Mutant Source
COSN26997828	13	COSMIC
COSN30485277	29	COSMIC
COSN28874178	32	COSMIC
COSN30504899	33	COSMIC
COSN26997825	55	COSMIC
COSN30144364	57	COSMIC
COSN19468763	63	COSMIC
COSN31532205	92	COSMIC
COSN7180421	93	COSMIC
COSN31488945	98	COSMIC
COSN30187376	102	COSMIC
COSN30476353	102	COSMIC
COSN31593894	117	COSMIC
COSN28759140	145	COSMIC
COSN30465674	169	COSMIC
COSN30481606	183	COSMIC
COSN21669104	263	COSMIC
COSN31540483	268	COSMIC
COSN31561917	268	COSMIC
COSN28397925	297	COSMIC
COSN31484487	299	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1277269551	2	dbSNP
rs1440208969	3	dbSNP
rs577289067	4	dbSNP
rs1374463045	7	dbSNP
rs1360080306	11	dbSNP
rs11556956	13	dbSNP
rs769569595	17	dbSNP
rs1437337060	20	dbSNP
rs1393830646	21	dbSNP
rs1324480453	23	dbSNP
rs1467593140	25	dbSNP
rs970685163	27	dbSNP
rs1424817296	30	dbSNP
rs747951609	32	dbSNP
rs1427078383	34	dbSNP
rs780897933	44	dbSNP
rs755260441	46	dbSNP
rs1291324805	74	dbSNP
rs36076633	80	dbSNP
rs1329365111	96	dbSNP
rs113008022	106	dbSNP
rs1392483953	109	dbSNP
rs139865543	119	dbSNP
rs1181500572	120	dbSNP
rs1242357582	125	dbSNP
rs1445162763	130	dbSNP
rs1165397920	140	dbSNP
rs530323201	146	dbSNP
rs1408310219	150	dbSNP
rs1169880789	153	dbSNP
rs1355315070	162	dbSNP
rs1449355688	169	dbSNP
rs1335138735	170	dbSNP
rs1428823016	173	dbSNP
rs1453938813	183	dbSNP
rs1388097172	185	dbSNP
rs562868802	187	dbSNP
rs1170350470	193	dbSNP
rs960273987	205	dbSNP
rs11556953	221	dbSNP
rs1273154202	225	dbSNP
rs1319540106	226	dbSNP
rs181751868	229	dbSNP
rs1201457841	232	dbSNP
rs879131629	236	dbSNP
rs1015624267	237	dbSNP
rs1461613401	240	dbSNP
rs11556950	251	dbSNP
rs1004218482	264	dbSNP
rs952800390	271	dbSNP
rs1196903363	273	dbSNP
rs1453525518	274	dbSNP
rs1026919840	275	dbSNP
rs1420404224	278	dbSNP
rs1269805252	280	dbSNP
rs1174567447	283	dbSNP
rs1204739138	290	dbSNP
rs1405744171	297	dbSNP
rs1340392052	301	dbSNP
rs1277225282	302	dbSNP
rs531171681	303	dbSNP
rs1430715112	304	dbSNP
rs899734635	305	dbSNP
rs774365514	309	dbSNP
rs1221243323	311	dbSNP
rs1273698101	314	dbSNP
rs1008478129	316	dbSNP
rs1201942590	323	dbSNP
rs892341152	324	dbSNP
rs115070391	337	dbSNP
rs1216421048	341	dbSNP
rs759589237	345	dbSNP
rs1303311513	346	dbSNP
rs1197483487	350	dbSNP
rs1408854485	355	dbSNP
rs1480912732	371	dbSNP
rs1368458644	381	dbSNP
rs1174660977	387	dbSNP
rs1052277935	390	dbSNP
rs1400566098	395	dbSNP
rs1170331553	402	dbSNP
rs1319571170	410	dbSNP
rs146132606	412	dbSNP
rs1402519585	413	dbSNP
rs1302041859	417	dbSNP
rs1424439077	418	dbSNP
rs763342436	425	dbSNP
rs553650730	426	dbSNP
rs1277492371	427	dbSNP
rs1349711225	432	dbSNP
rs1224227916	442	dbSNP
rs553922888	468	dbSNP
rs1489849830	487	dbSNP
rs916144154	488	dbSNP
rs1430072935	493	dbSNP
rs1452398958	495	dbSNP
rs1181654327	502	dbSNP
rs1362363724	512	dbSNP
rs1049905	522	dbSNP
rs1482228778	533	dbSNP
rs1254411503	537	dbSNP
rs1350386568	537	dbSNP
rs1423363137	538	dbSNP
rs35792571	538	dbSNP
rs993128238	541	dbSNP
rs938944357	551	dbSNP
rs1442327270	552	dbSNP
rs753847255	560	dbSNP
rs1277074209	569	dbSNP
rs541705576	577	dbSNP
rs574762239	578	dbSNP
rs766422525	593	dbSNP
rs1311241677	594	dbSNP
rs1221440334	595	dbSNP
rs1357169020	598	dbSNP
rs1245235990	608	dbSNP
rs1291044770	612	dbSNP
rs1211809182	614	dbSNP
rs1324998878	623	dbSNP
rs982930510	625	dbSNP
rs1179639349	627	dbSNP
rs1049974	633	dbSNP
rs952770842	636	dbSNP
rs556532800	639	dbSNP
rs1027057089	645	dbSNP
rs1348288957	650	dbSNP
rs760675434	665	dbSNP
rs370592800	677	dbSNP
rs1442607920	678	dbSNP
rs538155785	682	dbSNP
rs772236706	686	dbSNP
rs954536818	687	dbSNP

- British journal of cancer, 2011

BACKGROUND: On the base of the microRNA (miRNA) expression signature of bladder cancer (BC), we found that miR-1 and miR-133a were significantly downregulated in BC. In this study, we focussed on the functional significance of miR-1 and miR-133a in BC cell lines and identified a molecular network of these miRNAs. METHODS AND RESULTS: We investigated the miRNA expression signature of BC clinical specimens and identified several downregulated miRNAs (miR-133a, miR-204, miR-1, miR-139-5p, and miR-370). MiR-1 and miR-133a showed potential role of tumour suppressors by functional analyses of BC cells such as cell proliferation, apoptosis, migration, and invasion assays. Molecular target searches of these miRNAs showed that transgelin 2 (TAGLN2) was directly regulated by both miR-1 and miR-133a. Silencing of TAGLN2 study demonstrated significant inhibitions of cell proliferation and increase of apoptosis in BC cell lines. The immunohistochemistry showed a positive correlation between TAGLN2 expression and tumour grade in clinical BC specimens. CONCLUSIONS: The downregulation of miR-1 and miR-133a was a frequent event in BC, and these miRNAs were recognised as tumour suppressive. TAGLN2 may be a target of both miRNAs and had a potential oncogenic function. Therefore, novel molecular networks provided by miRNAs may provide new insights into the underlying molecular mechanisms of BC.

- Urologic oncology, 2013

OBJECTIVE: We previously demonstrated that miR-133a is a tumor-suppressive microRNA (miRNA) and is commonly down-regulated in human bladder cancer (BC). The aim of this study is to determine a novel oncogenic gene targeted by miR-133a in BC. METHODS: To identify genes targeted by miR-133a, an oligo-microarray analysis was performed using the miR-133a-transfected BC cell lines. For gain/loss-of-function studies, miR-133a/si-glutathione S-transferase pi1 (GSTP1)-transfectants were subjected to XTT assay and flow cytometry to evaluate their cell viability and apoptosis status. The luciferase reporter assay was used to confirm the actual binding sites between miR-133a and GSTP1 mRNA. The mRNA and protein expression of GSTP1 in BC cell lines and clinical samples were evaluated by real-time RT-PCR and Western blot, respectively. RESULTS: MiR-133a transfection induced cell viability inhibition and apoptosis in BC cell lines. We focused on the GSTP1 gene that was the top 7 down-regulated one in the gene profile from the miR-133a-transfectants. MiR-133a transfection repressed expression levels of mRNA and protein levels of GSTP1. A luciferase reporter assay suggested that the actual binding may occur between miR-133a and GSTP1 mRNA. Cell viability inhibition and apoptosis were induced in the si-GSTP1 transfectants compared with the controls (P < 0.005). GSTP1 mRNA expression levels in 43 clinical BCs were significantly higher than those in eight normal bladder epitheliums (P = 0.0277). CONCLUSION: Our data suggest that tumor suppressive miR-133a directly regulated oncogenic GSTP1 gene in BC, and that an anti-apoptotic effect mediated by GSTP1 is maintained by miR-133a down-regulation in human BC.

- International journal of oncology, 2011

Based on our microRNA (miRNA) expression signature analysis of maxillary sinus squamous cell carcinoma (MSSCC), we found that miR-1 and miR-133a were significantly reduced in tumor tissues. Quantitative real-time RT-PCR revealed that the expression levels of miR-1 and miR-133a were significantly downregulated in clinical MSSCC tumor tissues compared with normal tissues. We focused on the functional significance of miR-1 and miR-133a in cancer cells and identification of the novel cancer networks regulated by these miRNAs in MSSCC. Restoration of downregulated miRNAs (miR-1 or miR-133a) in cancer cells revealed that both miRNAs significantly inhibited cancer cell proliferation and induced cell apoptosis. Molecular target identification of these miRNAs showed that transgelin 2 (TAGLN2) and purine nucleoside phosphorylase (PNP) were regulated by miR-1 and miR-133a. Both TAGLN2 and PNP mRNA expression levels were significantly upregulated in clinical MSSCC tumor tissues. Silencing studies of target genes demonstrated that both genes inhibited cancer cell proliferation. The identification of novel miR-1/miR-133a-regulated cancer pathways could provide new insights into potential molecular mechanisms of MSSCC oncogenesis.

- European journal of cancer (Oxford, England : 1990), 2012

PURPOSE: The aim of this study was to find a novel molecular network involved in renal cell carcinoma (RCC) development through investigating the functions of miR-1 and miR-133a and their target genes. METHODS: We checked the expression levels of miR-1 and miR-133a in RCC cell lines and specimens (N=40) using real time RT-PCR. MiR-1 and miR-133a transfectants were subjected to a gain-of-function study to identify the functions of the miRNAs. To find the target genes of the miRNAs, we analysed the gene expression profile of their transfectants and performed a luciferase reporter assay. mRNA expression levels of the candidate target gene in the clinical specimens were examined, and loss-of-function studies were performed. RESULTS: The expression levels of miR-1 and miR-133a were significantly suppressed in RCC cell lines and specimens. Ectopic restoration of miR-1 and miR-133a showed significant inhibition of cell proliferation and invasion, and moreover, revealed induction of apoptosis and cell cycle arrest. The luciferase assay revealed transgelin-2 (TAGLN2), selected as a target gene for miR-1 and miR-133a on the basis of the gene expression profile, to be directly regulated by both miR-1 and miR-133a. The loss-of-function studies showed significant inhibitions of cell proliferation and invasion in the si-TAGLN2 transfectant. The expression level of TAGLN2 mRNA was significantly up-regulated in the RCC specimens; in addition, there was a statistically significant inverse correlation between TAGLN2 and miR-1 and miR-133a expression. CONCLUSIONS: Our data indicate that up-regulation of the oncogenic TAGLN2 was due to down-regulation of tumour-suppressive miR-1 and miR-133a in human RCC.