>Ass1|NM_007494|3'UTR
   1 ACCCTGACAAAGAGGAGCGGGCCTCCCCACTCTGCAGCTCTCCCAGGCTTCAGCATTAATTGTTGTGATAAATTTGTAAT
  81 TGTAGCTTGTTCTCCACCACCTGACTGGGGCTGCTGTGTCCCCCCCCGCCCCCCCACAGCCTTTGTTCCCTGGTCCCCTA
 161 TAGCCTACAAAAGTGGTCATCCAAGGGAAGGGAGGGTGGCGGGCAGCTGCAGAAAGCATAAAATGACAATTAAAAGAAGT
 241 TACATTAGTCTTT

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' ugaGUGGUCA-CGGUCAGGUUCUu 5' || ||| |:|| ||||||: Target 5' ctaCAAAAGTGGTCA-TCCAAGGg 3'	165 - 187	143.00	-17.60
2	miRNA 3' ugAGUGGUCACG-GUC---AGGUUCUu 5' || ||| | : ||| ||| ||: Target 5' ccTCCCCACTCTGCAGCTCTCCCAGGc 3'	22 - 48	109.00	-11.00
3	miRNA 3' ugAGUGGUC---ACGGU-CAGGuucuu 5' | ||::| |||:: |||| Target 5' ccTGACTGGGGCTGCTGTGTCCccccc 3'	100 - 126	81.00	-10.73

- Aging cell, 2010

The Ames dwarf mouse is well known for its remarkable propensity to delay the onset of aging. Although significant advances have been made demonstrating that this aging phenotype results primarily from an endocrine imbalance, the post-transcriptional regulation of gene expression and its impact on longevity remains to be explored. Towards this end, we present the first comprehensive study by microRNA (miRNA) microarray screening to identify dwarf-specific lead miRNAs, and investigate their roles as pivotal molecular regulators directing the long-lived phenotype. Mapping the signature miRNAs to the inversely expressed putative target genes, followed by in situ immunohistochemical staining and in vitro correlation assays, reveals that dwarf mice post-transcriptionally regulate key proteins of intermediate metabolism, most importantly the biosynthetic pathway involving ornithine decarboxylase and spermidine synthase. Functional assays using 3'-untranslated region reporter constructs in co-transfection experiments confirm that miRNA-27a indeed suppresses the expression of both of these proteins, marking them as probable targets of this miRNA in vivo. Moreover, the putative repressed action of this miRNA on ornithine decarboxylase is identified in dwarf mouse liver as early as 2 months of age. Taken together, our results show that among the altered aspects of intermediate metabolism detected in the dwarf mouse liver--glutathione metabolism, the urea cycle and polyamine biosynthesis--miRNA-27a is a key post-transcriptional control. Furthermore, compared to its normal siblings, the dwarf mouse exhibits a head start in regulating these pathways to control their normality, which may ultimately contribute to its extended health-span and longevity.