>Hes1|NM_008235|3'UTR
   1 GAGCCTCAGGCCACTGCTACCCGTAAAGTCCCTAGCCCACCTCTCTCTTCTGACGGACACTAAAAACGAACTTGGATTTT
  81 AGGAGAGACTTTTATAATTTGGTGGTTATTTTGTTGCTTTTTTTAATTCTAAAAAGTTACTTTTTGTAGAGAGCTGTATT
 161 AAGTGACTGACCATGCACTGCATTTGTATATATTTTATATGTTCATATTGGATTGCGCCTTTGTATTATAAAAGTTGAGA
 241 TGACATTTCGTTTTTTACACGAGATTTCTTTTTTTATGTGATGCCAAAGATGTTTGAAAATGCTCTTAAAATATCTTCCT
 321 TTGGGGAAGTTTATTTGAGAAAATATAATAAAAGAGTGAAGGCTTTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
 401 AAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' aguaugucgauCUAUUGGUUUCu 5' ||| :|||||| Target 5' tttttttatgtGAT-GCCAAAGa 3'	269 - 290	131.00	-9.70
2	miRNA 3' aguaUGUCGAUCUAUUGG---UUUCu 5' || ||| ||| |||| Target 5' ggccACTGCT-----ACCCGTAAAGt 3'	9 - 29	98.00	-5.30
3	miRNA 3' agUAUGUCGAUCU-AUUGGUuucu 5' || ||: || |:|||| Target 5' gtATTAAGT--GACTGACCAtgca 3'	156 - 177	93.00	-5.26

- Developmental cell, 2011

Neural progenitors self-renew and generate neurons throughout the central nervous system. Here, we uncover an unexpected regional specificity in the properties of neural progenitor cells, revealed by the function of a microRNA--miR-9. miR-9 is expressed in neural progenitors, and its knockdown results in an inhibition of neurogenesis along the anterior-posterior axis. However, the underlying mechanism differs--in the hindbrain, progenitors fail to exit the cell cycle, whereas in the forebrain they undergo apoptosis, counteracting the proliferative effect. Among several targets, we functionally identify hairy1 as a primary target of miR-9, regulated at the mRNA level. hairy1 mediates the effects of miR-9 on proliferation, through Fgf8 signaling in the forebrain and Wnt signaling in the hindbrain, but affects apoptosis only in the forebrain, via the p53 pathway. Our findings show a positional difference in the responsiveness of progenitors to miR-9 depletion, revealing an underlying divergence of their properties.

- Cell reports, 2012

Short-period (ultradian) oscillations of Hes1, a Notch signaling effector, are essential for maintaining neural progenitors in a proliferative state, while constitutive downregulation of Hes1 leads to neuronal differentiation. Hes1 oscillations are driven by autorepression, coupled with high instability of the protein and mRNA. It is unknown how Hes1 mRNA stability is controlled and furthermore, how cells exit oscillations in order to differentiate. Here, we identify a microRNA, miR-9, as a component of ultradian oscillations. We show that miR-9 controls the stability of Hes1 mRNA and that both miR-9 overexpression and lack of miR-9 dampens Hes1 oscillations. Reciprocally, Hes1 represses the transcription of miR-9, resulting in out-of-phase oscillations. However, unlike the primary transcript, mature miR-9 is very stable and thus accumulates over time. Given that raising miR-9 levels leads to dampening of oscillations, these findings provide support for a self-limiting mechanism whereby cells might terminate Hes1 oscillations and differentiate.