>CCKBR|NM_176875|3'UTR
   1 GGAGTAGAGGGGCCGTGGGGGTTGAGGCAGGGCAAATGACATGCACTGACCCTTCCAGACATACGAAACACAAACCACAA
  81 CTGACACAGGAAACCAACACCCAAAGCATGGACTAACCCCAACGCACAGGAAAAGGTAGCTTACCTGACACAAGAGGAAT
 161 AAGAATGGAGCAGTACATGGGAAAGGAGGCATGCCTCTGATATGGGACTGAGCCTGGCCCATAGAAACATGACACTGACC
 241 TTGGAGAGACACAGCGTCCCTAGCAGTGAACTATTTCTACACAGTGGGAACTCTGACAAGGGCTGACCTGCCTCTCACAC
 321 ACATAGATTAATGGCACTGATTGTTTTAGAGACTATGGAGCCTGGCACAGGACTGACTCTGGGATGCTCCTAGTTTGACC
 401 TCACAGTGACCCTTCCCAATCAGCACTGAAAATACCATCAGGCCTAATCTCATACCTCTGACCAACAGGCTGTTCTGCAC
 481 TGAAAAGGTTCTTCATCCCTTTCCAGTTAAGGACCGTGGCCCTGCCCTCTCCTTCCTTACCCAAACTGTTCAAGAAATAA
 561 TAAATTGTTTGGCTTCCTCCTGAAAAAAAAAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' ugUUUCAAGACAUCACGUGACu 5' | || |||| ||||||| Target 5' caACAG-GCTGTTCTGCACTGa 3'	463 - 483	155.00	-18.40
2	miRNA 3' ugUUUCAAGACAUCACGUGACu 5' ||| || ||||||| Target 5' gcAAA----TGACATGCACTGa 3'	32 - 49	142.00	-11.60
3	miRNA 3' uguuucaagacaucaCGUGACu 5' |||||| Target 5' acacatagattaatgGCACTGa 3'	319 - 340	120.00	-10.70

Mutant ID	Mutant Position	Mutant Source
COSN30524616	4	COSMIC
COSN31506935	8	COSMIC
COSN31572973	15	COSMIC
COSN21940710	57	COSMIC
COSN30182962	61	COSMIC
COSN8584430	63	COSMIC
COSN28858858	75	COSMIC
COSN26436117	124	COSMIC
COSN16606094	172	COSMIC
COSN19353404	256	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs972485429	5	dbSNP
rs760096070	6	dbSNP
rs200359528	7	dbSNP
rs761111172	9	dbSNP
rs777419612	10	dbSNP
rs201108874	11	dbSNP
rs1355484681	12	dbSNP
rs774283301	13	dbSNP
rs745844650	15	dbSNP
rs772116954	16	dbSNP
rs771489700	17	dbSNP
rs202141489	18	dbSNP
rs74598750	19	dbSNP
rs959572055	20	dbSNP
rs75702171	21	dbSNP
rs199662573	22	dbSNP
rs776852704	25	dbSNP
rs1206156190	28	dbSNP
rs1235424153	33	dbSNP
rs765657178	34	dbSNP
rs188680188	39	dbSNP
rs1247849323	42	dbSNP
rs201716847	44	dbSNP
rs1360421152	46	dbSNP
rs1259019693	50	dbSNP
rs1417937179	51	dbSNP
rs1477089489	52	dbSNP
rs1387215228	59	dbSNP
rs1412079143	59	dbSNP
rs1303330790	61	dbSNP
rs548851433	62	dbSNP
rs371722459	64	dbSNP
rs71472181	64	dbSNP
rs879623915	64	dbSNP
rs10839535	65	dbSNP
rs10839536	66	dbSNP
rs35917099	66	dbSNP
rs564914793	66	dbSNP
rs540565930	70	dbSNP
rs1224636504	75	dbSNP
rs201473959	83	dbSNP
rs1288906756	96	dbSNP
rs1214754444	98	dbSNP
rs199752833	101	dbSNP
rs200726124	103	dbSNP
rs571062134	104	dbSNP
rs1007404763	108	dbSNP
rs1304207734	109	dbSNP
rs201379655	119	dbSNP
rs199959078	120	dbSNP
rs1410931496	121	dbSNP
rs201080709	125	dbSNP
rs1212104826	131	dbSNP
rs141257400	135	dbSNP
rs1477499262	140	dbSNP
rs1269714658	141	dbSNP
rs1201438246	143	dbSNP
rs1433156953	146	dbSNP
rs1246093285	148	dbSNP
rs199821533	150	dbSNP
rs551796939	153	dbSNP
rs201100175	163	dbSNP
rs1414359296	169	dbSNP
rs1204927898	170	dbSNP
rs533844621	171	dbSNP
rs1020693419	172	dbSNP
rs1255751492	175	dbSNP
rs1217635768	178	dbSNP
rs889373392	184	dbSNP
rs202080389	186	dbSNP
rs200392776	191	dbSNP
rs1384617264	216	dbSNP
rs1019257240	219	dbSNP
rs1158715905	221	dbSNP
rs201168406	222	dbSNP
rs201938413	223	dbSNP
rs1329493939	231	dbSNP
rs200409585	241	dbSNP
rs1035152404	245	dbSNP
rs959541054	247	dbSNP
rs201475409	249	dbSNP
rs993896240	251	dbSNP
rs1025383126	255	dbSNP
rs202220273	256	dbSNP
rs200541535	257	dbSNP
rs1177776254	258	dbSNP
rs1481453250	260	dbSNP
rs1236147045	261	dbSNP
rs201062309	269	dbSNP
rs755768715	278	dbSNP
rs1386189445	279	dbSNP
rs199690182	284	dbSNP
rs1461511435	288	dbSNP
rs962735115	291	dbSNP
rs973185281	296	dbSNP
rs1311175592	302	dbSNP
rs918592164	307	dbSNP
rs1226118862	310	dbSNP
rs1224841165	324	dbSNP
rs934044977	328	dbSNP
rs200589865	333	dbSNP
rs911699651	334	dbSNP
rs201226220	336	dbSNP
rs199527484	338	dbSNP
rs1307571980	344	dbSNP
rs200790296	347	dbSNP
rs201708123	367	dbSNP
rs1023927377	376	dbSNP
rs7944010	378	dbSNP
rs555657400	383	dbSNP
rs1420826835	384	dbSNP
rs1378202442	389	dbSNP
rs1177755976	392	dbSNP
rs200905279	400	dbSNP
rs8192471	407	dbSNP
rs1042047	410	dbSNP
rs902189153	412	dbSNP
rs915315716	420	dbSNP
rs201103884	428	dbSNP
rs1181665951	437	dbSNP
rs1042048	438	dbSNP
rs1425817753	439	dbSNP
rs200174736	445	dbSNP
rs201100180	449	dbSNP
rs1166617134	450	dbSNP
rs1394520849	466	dbSNP
rs1366559673	467	dbSNP
rs202039325	473	dbSNP
rs200520897	474	dbSNP
rs1421635876	481	dbSNP
rs201231443	486	dbSNP
rs1423925967	488	dbSNP
rs895302791	489	dbSNP
rs201624351	499	dbSNP
rs200258777	501	dbSNP
rs944912507	507	dbSNP
rs1040667844	511	dbSNP
rs201162896	512	dbSNP
rs199724021	513	dbSNP
rs200915768	516	dbSNP
rs147405755	517	dbSNP
rs1042049	518	dbSNP
rs1216525348	521	dbSNP
rs199588623	523	dbSNP
rs200694196	527	dbSNP
rs540937545	534	dbSNP
rs986830859	538	dbSNP
rs562018574	541	dbSNP
rs1267627351	548	dbSNP
rs1242826438	556	dbSNP
rs911337623	557	dbSNP
rs529522509	559	dbSNP
rs1401923311	567	dbSNP
rs1338527918	569	dbSNP
rs943210848	575	dbSNP

- Journal of gastrointestinal surgery : official journal of the Society for Surgery of the Alimentary Tract, 2010

BACKGROUND: MicroRNAs are endogenous small noncoding RNAs that aberrantly expressed in various carcinomas. MiR-148a and miR-152, which have the same "seed region", have not been comprehensively investigated in gastrointestinal cancers. METHODS: Total RNA was extracted from the tissues of 101 patients with gastric cancer and 101 patients with colorectal cancer as well as their matched nontumor adjacent tissues. After polyadenylation and reverse transcription, the expression of miR-148a and miR-152 was determined using quantitative real-time polymerase chain reaction. The protein level of cholecystokinin B receptor, which might be the target gene of miR-148a and miR-152, was analyzed by Western blot in 40 patients with gastric cancer. RESULTS: Expression levels of miR-148a and miR-152 in human gastric (p < 0.001 and p = 0.038, respectively, t-test) and colorectal (all p < 0.001) cancers were significantly lower than that in their matched nontumor adjacent tissues. Moreover, their low expression was also found in several gastrointestinal cancer cell lines compared with normal gastric epithelial cell line and normal colorectal tissue, respectively. A strong correlation was found between the expression of miR-148a and miR-152 (all p < 0.001, Pearson's correlation). Furthermore, low expression of miR-152 was correlated with increased tumor size (p = 0.023 and 0.004, respectively, Mann-Whitney U test) and advanced pT stage (p = 0.018 and 0.002, respectively) in gastrointestinal cancers. Low expression of miR-148a was also correlated with increased tumor size (p = 0.045 and 0.018, respectively) in gastrointestinal cancers, but only correlated with advanced pT stage (p = 0.023) in colorectal cancer. We also found the expression of miR-148a (p < 0.001, chi-square test) and miR-152 (p = 0.002) inversely correlated with cholecystokinin B receptor protein in gastric cancer. CONCLUSION: MiR-148a and miR-152 may be involved in the carcinogenesis of gastrointestinal cancers and might be potential biomarkers in these cancers.

- Biological psychiatry, 2011

BACKGROUND: The involvement of microRNAs (miRNAs) in neuronal differentiation and synaptic plasticity suggests a role for miRNAs in psychiatric disorders; association analyses and functional approaches were used to evaluate the implication of miRNAs in the susceptibility for panic disorder. METHODS: Case-control studies for 712 single-nucleotide polymorphisms (SNPs) tagging 325 human miRNA regions were performed in 203 Spanish patients with panic disorder and 341 control subjects. A sample of 321 anxiety patients and 642 control subjects from Finland and 102 panic disorder patients and 829 control subjects from Estonia was used as a replica. Reporter-gene assays and miRNA overexpression experiments in neuroblastoma cells were used to functionally evaluate the spectrum of genes regulated by the associated miRNAs. RESULTS: Two SNPs associated with panic disorder: rs6502892 tagging miR-22 (p < .0002), and rs11763020 tagging miR-339 (p < .00008). Other SNPs tagging miR-138-2, miR-488, miR-491, and miR-148a regions associated with different panic disorder phenotypes. Replication in the north-European sample supported several of these associations, although they did not pass correction for multiple testing. Functional studies revealed that miR-138-2, miR-148a, and miR-488 repress (30%-60%) several candidate genes for panic disorder--GABRA6, CCKBR and POMC, respectively--and that miR-22 regulates four other candidate genes: BDNF, HTR2C, MAOA, and RGS2. Transcriptome analysis of neuroblastoma cells transfected with miR-22 and miR-488 showed altered expression of a subset of predicted target genes for these miRNAs and of genes that might be affecting physiological pathways related to anxiety. CONCLUSIONS: This work represents the first report of a possible implication of miRNAs in the etiology of panic disorder.

- Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 2014

Our previous studies have revealed that miR-148a is downregulated in pancreatic cancer. Bioinformatics analysis has shown cholecystokinin-B receptor (CCKBR) and B cell lymphoma (Bcl-2) to be potential targets of miR-148a. But the pathophysiologic role of miR-148a and its relevance to the growth and development of pancreatic cancer are yet to be investigated. The purpose of this study is to elucidate the molecular mechanisms where miR-148a acts as a tumor suppressor in pancreatic cancer. Our results showed significant downregulation of miR-148a in 28 pancreatic cancer tissue samples and five pancreatic cancer cell lines, compared with their non-tumor counterparts by qRT-PCR. MiR-148a was found to not only inhibit the proliferation of pancreatic cancer cells (PANC-1 and AsPC-1) in vitro by MTT assay and colony formation assay, but also to promote cells apoptosis in vitro by Annexin V-FITC apoptosis detection and caspase activity assay. Using western blot and luciferase activity assay, CCKBR and Bcl-2 were identified as targets of miR-148a. Moreover, we also found that the expression of Bcl-2 lacking in 3'UTR could abrogate the pro-apoptosis function of miR-148a. These findings suggest the importance of miR-148a's targeting of CCKBR and Bcl-2 in the regulation of pancreatic cancer growth and apoptosis.

- PloS one, 2016

MicroRNAs (miRNAs) have been widely accepted as a class of gene expression regulators which post-translationally regulate protein expression. These small noncoding RNAs have been proved closely involved in the modulation of various pathobiological processes in cancer. In this research, we demonstrated that miR-148a expression was significantly down-regulated in gastric cancer tissues in comparison with the matched normal mucosal tissues, and its expression was statistically associated with lymph node metastasis. Ectopic expression of miR-148a inhibited tumor cell proliferation and migration in vitro, and inhibited tumor formation in vivo. Subsequently, we identified cholecystokinin B receptor (CCK-BR) as a direct target of miR-148a using western blot and luciferase activity assay. More importantly, siRNA-induced knockdown of CCK-BR elicited similar anti-oncogenic effects (decreased proliferation and migration) as those induced by enforced miR-148a expression. We also found that miR-148a-mediated anti-cancer effects are dependent on the inhibition of STAT3 and Akt activation, which subsequently regulates the pathways involved in cell proliferation and migration. Taken together, our results suggest that miR-148a serves as a tumor suppressor in human gastric carcinogenesis by targeting CCK-BR via inactivating STAT3 and Akt.