miRTarBase - #MIRT005919


—
pre-miRNA Information
pre-miRNA hsa-mir-24-1   
Genomic Coordinates chr9: 95086021 - 95086088
Synonyms MIR189, MIRN24-1, miR-24-1, miRNA24-1, MIR24-1
Description Homo sapiens miR-24-1 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-24-2   
Genomic Coordinates chr19: 13836287 - 13836359
Synonyms MIRN24-2, miR-24-2, miRNA24-2, MIR24-2
Description Homo sapiens miR-24-2 stem-loop
Comment mir-24-2 was identified independently by two groups. This sequence was named miR-24 precursor-19 in reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-24-3p
Sequence 44| UGGCUCAGUUCAGCAGGAACAG |65
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 7 19 - 13836304 29233923 MiREDiBase
A-to-I 15 19 - 13836296 29233923 MiREDiBase
A-to-I 19 19 - 13836292 29233923 MiREDiBase
A-to-I 21 19 - 13836290 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1296736495 1 dbSNP
rs1449243881 3 dbSNP
rs768693029 6 dbSNP
rs1401187484 16 dbSNP
rs773200905 18 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BW8S3J miR-24-3p Monitoring Biomarker (MOI) Clinical/Experimental Data Expression Decrease Blood Quantitative real-time PCR
Gene Information
Gene Symbol FURIN   
Synonyms FUR, PACE, PCSK3, SPC1
Description furin, paired basic amino acid cleaving enzyme
Transcript NM_002569   
Expression
Putative miRNA Targets on FURIN
3'UTR of FURIN
(miRNA target sites are highlighted)		 
>FURIN|NM_002569|3'UTR
   1 TGAGCCCACTGCCCACCCCCTCAAGCCAATCCCCTCCTTGGGCACTTTTTAATTCACCAAAGTATTTTTTTATCTTGGGA
  81 CTGGGTTTGGACCCCAGCTGGGAGGCAAGAGGGGTGGAGACTGCTTCCCATCCTACCCTCGGGCCCACCTGGCCACCTGA
 161 GGTGGGCCCAGGACCAGCTGGGGCGTGGGGAGGGCCGTACCCCACCCTCAGCACCCCTTCCATGTGGAGAAAGGAGTGAA
 241 ACCTTTAGGGCAGCTTGCCCCGGCCCCGGCCCCAGCCAGAGTTCCTGCGGAGTGAAGAGGGGCAGCCCTTGCTTGTTGGG
 321 ATTCCTGACCCAGGCCGCAGCTCTTGCCCTTCCCTGTCCCTCTAAAGCAATAATGGTCCCATCCAGGCAGTCGGGGGCTG
 401 GCCTAGGAGATATCTGAGGGAGGAGGCCACCTCTCCAAGGGCTTCTGCACCCTCCACCCTGTCCCCCAGCTCTGGTGAGT
 481 CTTGGCGGCAGCAGCCATCATAGGAAGGGACCAAGGCAAGGCAGGTGCCTCCAGGTGTGCACGTGGCATGTGGCCTGTGG
 561 CCTGTGTCCCATGACCCACCCCTGTGCTCCGTGCCTCCACCACCACTGGCCACCAGGCTGGCGCAGCCAAGGCCGAAGCT
 641 CTGGCTGAACCCTGTGCTGGTGTCCTGACCACCCTCCCCTCTCTTGCACCCGCCTCTCCCGTCAGGGCCCAAGTCCCTGT
 721 TTTCTGAGCCCGGGCTGCCTGGGCTGTTGGCACTCACAGACCTGGAGCCCCTGGGTGGGTGGTGGGGAGGGGCGCTGGCC
 801 CAGCCGGCCTCTCTGGCCTCCCACCCGATGCTGCTTTCCCCTGTGGGGATCTCAGGGGCTGTTTGAGGATATATTTTCAC
 881 TTTGTGATTATTTCACTTTAGATGCTGATGATTTGTTTTTGTATTTTTAATGGGGGTAGCAGCTGGACTACCCACGTTCT
 961 CACACCCACCGTCCGCCCTGCTCCTCCCTGGCTGCCCTGGCCCTGAGGTGTGGGGGCTGCAGCATGTTGCTGAGGAGTGA
1041 GGAATAGTTGAGCCCCAAGTCCTGAAGAGGCGGGCCAGCCAGGCGGGCTCAAGGAAAGGGGGTCCCAGTGGGAGGGGCAG
1121 GCTGACATCTGTGTTTCAAGTGGGGCTCGCCATGCCGGGGGTTCATAGGTCACTGGCTCTCCAAGTGCCAGAGGTGGGCA
1201 GGTGGTGGCACTGAGCCCCCCCAACACTGTGCCCTGGTGGAGAAAGCACTGACCTGTCATGCCCCCCTCAAACCTCCTCT
1281 TCTGACGTGCCTTTTGCACCCCTCCCATTAGGACAATCAGTCCCCTCCCATCTGGGAGTCCCCTTTTCTTTTCTACCCTA
1361 GCCATTCCTGGTACCCAGCCATCTGCCCAGGGGTGCCCCCTCCTCTCCCATCCCCCTGCCCTCGTGGCCAGCCCGGCTGG
1441 TTTTGTAAGATGCTGGGTTGGTGCACAGTGATTTTTTTCTTGTAATTTAAACAGGCCCAGCATTGCTGGTTCTATTTAAT
1521 GGACATGAGATAATGTTAGAGGTTTTAAAGTGATTAAACGTGCAGACTATGCAAACCAGGAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gaCAAGGACGACUUGACUCGGu 5'
            || ||||:|   ||||||| 
Target 5' aaGTCCCTGTT-TTCTGAGCCc 3'
 711 - 731 159.00 -20.30
2 
miRNA  3' gacaaggACGACU-UGACUCGGu 5'
                 || ||: |||||||| 
Target 5' gggcaggTGGTGGCACTGAGCCc 3'
 1196 - 1218 155.00 -16.40
3 
miRNA  3' gaCAAGGAC----GAC------UUGACUCGGu 5'
            ||| |||     ||      |::|||||| 
Target 5' atGTTGCTGAGGAGTGAGGAATAGTTGAGCCc 3'
 1024 - 1055 132.00 -18.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30460852 21 COSMIC
COSN30478584 59 COSMIC
COSN15662669 125 COSMIC
COSN5214499 126 COSMIC
COSN31542858 182 COSMIC
COSN7253700 186 COSMIC
COSN31536143 268 COSMIC
COSN31541026 327 COSMIC
COSN31513276 356 COSMIC
COSN31513314 460 COSMIC
COSN32062897 487 COSMIC
COSN9641100 627 COSMIC
COSN17998858 672 COSMIC
COSN31565669 775 COSMIC
COSN31596403 792 COSMIC
COSN22435641 795 COSMIC
COSN1688712 874 COSMIC
COSN31522874 1163 COSMIC
COSN31528378 1223 COSMIC
COSN30541259 1237 COSMIC
COSN27069326 1288 COSMIC
COSN1688714 1312 COSMIC
COSN26679047 1394 COSMIC
COSN27688204 1396 COSMIC
COSN28750288 1453 COSMIC
COSN17181745 1458 COSMIC
COSN31539198 1522 COSMIC
COSN31521127 1540 COSMIC
rs6227 125 GWAS
rs4702 1453 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs766132371 6 dbSNP
rs1345282246 10 dbSNP
rs753608057 11 dbSNP
rs754895440 13 dbSNP
rs751590902 14 dbSNP
rs1203342488 15 dbSNP
rs757408104 16 dbSNP
rs761095034 16 dbSNP
rs1286211158 18 dbSNP
rs545927137 19 dbSNP
rs189984206 30 dbSNP
rs1251438558 31 dbSNP
rs1455749358 32 dbSNP
rs1194436522 39 dbSNP
rs1363605812 43 dbSNP
rs780423202 44 dbSNP
rs749633833 46 dbSNP
rs921312296 49 dbSNP
rs769145385 51 dbSNP
rs1228105816 56 dbSNP
rs1377996086 65 dbSNP
rs1289029460 72 dbSNP
rs1432323391 76 dbSNP
rs1245579351 77 dbSNP
rs1358120322 78 dbSNP
rs961209874 79 dbSNP
rs1406842135 85 dbSNP
rs1387005679 90 dbSNP
rs1161446173 91 dbSNP
rs989424423 107 dbSNP
rs568809718 112 dbSNP
rs1399389668 114 dbSNP
rs945209586 119 dbSNP
rs6227 125 dbSNP
rs906352481 127 dbSNP
rs1491003316 137 dbSNP
rs1310725854 141 dbSNP
rs1244534087 144 dbSNP
rs1308399751 157 dbSNP
rs1298143570 165 dbSNP
rs937816802 170 dbSNP
rs779862398 172 dbSNP
rs182592330 173 dbSNP
rs573997654 176 dbSNP
rs373346219 185 dbSNP
rs541371974 186 dbSNP
rs910631029 190 dbSNP
rs1027215243 192 dbSNP
rs887322036 196 dbSNP
rs1358088629 198 dbSNP
rs943473296 199 dbSNP
rs1210762241 206 dbSNP
rs1004348153 208 dbSNP
rs1019813164 209 dbSNP
rs1040192392 220 dbSNP
rs901690391 221 dbSNP
rs879365440 224 dbSNP
rs1053024537 233 dbSNP
rs564584847 237 dbSNP
rs965924809 242 dbSNP
rs1481426040 247 dbSNP
rs35829213 247 dbSNP
rs1209810181 257 dbSNP
rs374349317 257 dbSNP
rs531649739 257 dbSNP
rs553515299 259 dbSNP
rs1028811947 262 dbSNP
rs578130022 263 dbSNP
rs1239384577 266 dbSNP
rs958037866 268 dbSNP
rs1256962390 269 dbSNP
rs545455100 269 dbSNP
rs1346799265 272 dbSNP
rs1011191069 274 dbSNP
rs1022626136 280 dbSNP
rs1473260513 284 dbSNP
rs374763290 289 dbSNP
rs563644807 290 dbSNP
rs1299741197 297 dbSNP
rs1422659713 298 dbSNP
rs982435562 300 dbSNP
rs530884164 306 dbSNP
rs1177357636 311 dbSNP
rs1471015735 313 dbSNP
rs148953668 321 dbSNP
rs1400992977 327 dbSNP
rs1420272534 328 dbSNP
rs748232584 337 dbSNP
rs960921896 338 dbSNP
rs1457557755 339 dbSNP
rs1257062593 349 dbSNP
rs972664421 350 dbSNP
rs1325222009 355 dbSNP
rs1331654414 359 dbSNP
rs752730976 361 dbSNP
rs1444335414 365 dbSNP
rs952431356 374 dbSNP
rs1337122368 375 dbSNP
rs920323672 380 dbSNP
rs6228 388 dbSNP
rs1400327917 389 dbSNP
rs910557678 394 dbSNP
rs752074498 395 dbSNP
rs528388688 400 dbSNP
rs1366078389 404 dbSNP
rs1157336205 411 dbSNP
rs976183908 414 dbSNP
rs546954172 426 dbSNP
rs1443856048 427 dbSNP
rs571399328 431 dbSNP
rs886100297 434 dbSNP
rs1259228590 438 dbSNP
rs934499877 443 dbSNP
rs777724397 449 dbSNP
rs1004506495 451 dbSNP
rs914494412 452 dbSNP
rs1262454033 453 dbSNP
rs188064567 455 dbSNP
rs901368100 459 dbSNP
rs573292373 461 dbSNP
rs1443150038 465 dbSNP
rs1044007813 466 dbSNP
rs905547998 468 dbSNP
rs1002552260 473 dbSNP
rs1476715545 479 dbSNP
rs1010919153 480 dbSNP
rs550617215 487 dbSNP
rs749752740 488 dbSNP
rs1021006825 492 dbSNP
rs1170227297 493 dbSNP
rs896923683 494 dbSNP
rs568869902 496 dbSNP
rs993672439 498 dbSNP
rs777778205 501 dbSNP
rs1447185565 503 dbSNP
rs1297202038 505 dbSNP
rs1338026174 507 dbSNP
rs1264775238 514 dbSNP
rs952291325 516 dbSNP
rs927842685 521 dbSNP
rs1292334461 530 dbSNP
rs1224468290 536 dbSNP
rs959256272 538 dbSNP
rs1283347828 539 dbSNP
rs1228488390 542 dbSNP
rs1006486289 543 dbSNP
rs1276459551 544 dbSNP
rs1017593448 545 dbSNP
rs964689125 546 dbSNP
rs1366753134 547 dbSNP
rs920354705 548 dbSNP
rs1403983751 549 dbSNP
rs930430579 549 dbSNP
rs976111512 549 dbSNP
rs923372939 556 dbSNP
rs1047465646 562 dbSNP
rs373060525 563 dbSNP
rs1312079382 564 dbSNP
rs1425239489 565 dbSNP
rs907568308 565 dbSNP
rs1477180964 568 dbSNP
rs944355419 572 dbSNP
rs1200956796 579 dbSNP
rs1257774540 582 dbSNP
rs1288947308 588 dbSNP
rs76248370 591 dbSNP
rs1041311468 592 dbSNP
rs1218120115 599 dbSNP
rs988623834 601 dbSNP
rs914400562 612 dbSNP
rs1285240316 614 dbSNP
rs774745882 615 dbSNP
rs1331027137 616 dbSNP
rs759952786 623 dbSNP
rs1411946189 624 dbSNP
rs947278997 625 dbSNP
rs1489407416 626 dbSNP
rs1402049325 629 dbSNP
rs6229 634 dbSNP
rs927234217 635 dbSNP
rs938335152 636 dbSNP
rs1049887214 641 dbSNP
rs1173804521 642 dbSNP
rs1477039977 646 dbSNP
rs1432471090 648 dbSNP
rs1196654233 651 dbSNP
rs893970164 660 dbSNP
rs1458891041 661 dbSNP
rs1466081331 666 dbSNP
rs879007834 672 dbSNP
rs372580307 680 dbSNP
rs1236616115 684 dbSNP
rs1198297650 688 dbSNP
rs1409666685 689 dbSNP
rs1011020518 692 dbSNP
rs757604348 693 dbSNP
rs1217479517 694 dbSNP
rs1421169351 701 dbSNP
rs966713790 702 dbSNP
rs1444853063 705 dbSNP
rs1375193360 707 dbSNP
rs1367362348 716 dbSNP
rs1331066703 718 dbSNP
rs1057234048 732 dbSNP
rs1034948143 733 dbSNP
rs1177613510 735 dbSNP
rs1304042945 736 dbSNP
rs959520121 743 dbSNP
rs990745408 756 dbSNP
rs896900044 758 dbSNP
rs994325326 764 dbSNP
rs1047856995 767 dbSNP
rs1332217740 768 dbSNP
rs35633578 768 dbSNP
rs951861740 769 dbSNP
rs776200253 780 dbSNP
rs554141144 782 dbSNP
rs1441874852 783 dbSNP
rs1006417842 790 dbSNP
rs1284013197 793 dbSNP
rs566165224 794 dbSNP
rs1243006695 795 dbSNP
rs1352126960 800 dbSNP
rs370685584 801 dbSNP
rs964994083 805 dbSNP
rs552513636 806 dbSNP
rs534963868 812 dbSNP
rs1304175792 814 dbSNP
rs944404597 816 dbSNP
rs976115206 819 dbSNP
rs1030751974 826 dbSNP
rs553410529 827 dbSNP
rs540345335 828 dbSNP
rs989316368 842 dbSNP
rs1189295577 844 dbSNP
rs545280206 847 dbSNP
rs1157838826 848 dbSNP
rs1444960250 854 dbSNP
rs968502211 871 dbSNP
rs979932881 872 dbSNP
rs1269353282 874 dbSNP
rs1180378580 879 dbSNP
rs1472577069 881 dbSNP
rs927203173 890 dbSNP
rs1487595498 897 dbSNP
rs938640159 900 dbSNP
rs1285864200 904 dbSNP
rs932929225 907 dbSNP
rs557378105 911 dbSNP
rs1310994830 914 dbSNP
rs1226305452 923 dbSNP
rs1377972774 929 dbSNP
rs1049987311 932 dbSNP
rs1177421263 933 dbSNP
rs894008880 936 dbSNP
rs1297460614 937 dbSNP
rs1458319158 939 dbSNP
rs992466674 946 dbSNP
rs1351450181 947 dbSNP
rs1377949778 949 dbSNP
rs1162412154 950 dbSNP
rs1405055979 952 dbSNP
rs946838430 956 dbSNP
rs1042513797 963 dbSNP
rs1195954229 966 dbSNP
rs1476855985 967 dbSNP
rs918255052 971 dbSNP
rs577237723 972 dbSNP
rs929712593 975 dbSNP
rs1048601087 983 dbSNP
rs1012139814 984 dbSNP
rs756982382 989 dbSNP
rs1456685188 998 dbSNP
rs575803272 1017 dbSNP
rs942168895 1019 dbSNP
rs545270985 1025 dbSNP
rs1276994306 1027 dbSNP
rs983223593 1038 dbSNP
rs1369631749 1044 dbSNP
rs1291572924 1045 dbSNP
rs1435416096 1051 dbSNP
rs1401333997 1053 dbSNP
rs1014628625 1057 dbSNP
rs1464238925 1062 dbSNP
rs1423074800 1063 dbSNP
rs1177228888 1071 dbSNP
rs746058545 1072 dbSNP
rs1307107300 1073 dbSNP
rs966150204 1079 dbSNP
rs998185560 1085 dbSNP
rs561254518 1086 dbSNP
rs1030305871 1090 dbSNP
rs1241050628 1094 dbSNP
rs563856929 1097 dbSNP
rs1456470968 1104 dbSNP
rs1315664932 1106 dbSNP
rs1312246187 1113 dbSNP
rs1233250768 1117 dbSNP
rs1320199344 1120 dbSNP
rs1219043337 1121 dbSNP
rs1299046128 1129 dbSNP
rs975849056 1133 dbSNP
rs1468805092 1134 dbSNP
rs1010259812 1138 dbSNP
rs1377421078 1140 dbSNP
rs921631724 1142 dbSNP
rs1236342010 1144 dbSNP
rs528527113 1149 dbSNP
rs968806319 1150 dbSNP
rs1303505712 1151 dbSNP
rs1177313885 1152 dbSNP
rs979901935 1157 dbSNP
rs1467599474 1158 dbSNP
rs1034147537 1160 dbSNP
rs1376462179 1161 dbSNP
rs770033960 1162 dbSNP
rs540494055 1165 dbSNP
rs1412591646 1166 dbSNP
rs985722546 1167 dbSNP
rs1440822988 1169 dbSNP
rs915473871 1172 dbSNP
rs1382613407 1174 dbSNP
rs565051401 1180 dbSNP
rs1042548272 1182 dbSNP
rs993166537 1184 dbSNP
rs902674344 1196 dbSNP
rs939473220 1198 dbSNP
rs918535383 1199 dbSNP
rs1056536175 1200 dbSNP
rs532295149 1202 dbSNP
rs191700724 1206 dbSNP
rs1012170860 1208 dbSNP
rs1027545017 1216 dbSNP
rs887654431 1217 dbSNP
rs983839199 1218 dbSNP
rs373178041 1225 dbSNP
rs1237609376 1227 dbSNP
rs1004679290 1228 dbSNP
rs1313650096 1234 dbSNP
rs1015204688 1237 dbSNP
rs965903712 1245 dbSNP
rs1302320943 1250 dbSNP
rs997697792 1252 dbSNP
rs749936974 1255 dbSNP
rs953044393 1261 dbSNP
rs1439415451 1262 dbSNP
rs1362897378 1264 dbSNP
rs1187868510 1265 dbSNP
rs909631458 1266 dbSNP
rs942430652 1268 dbSNP
rs968325221 1270 dbSNP
rs1217853766 1273 dbSNP
rs1288004276 1275 dbSNP
rs978339406 1277 dbSNP
rs1048346 1283 dbSNP
rs562390666 1287 dbSNP
rs900687482 1294 dbSNP
rs1284544160 1306 dbSNP
rs762919011 1307 dbSNP
rs1247325980 1308 dbSNP
rs529732171 1311 dbSNP
rs547909790 1315 dbSNP
rs1312100393 1316 dbSNP
rs1052426843 1317 dbSNP
rs766278476 1326 dbSNP
rs892074748 1333 dbSNP
rs1010643574 1343 dbSNP
rs771725792 1343 dbSNP
rs1165352025 1346 dbSNP
rs11546538 1349 dbSNP
rs11546540 1354 dbSNP
rs948057544 1358 dbSNP
rs1021617969 1362 dbSNP
rs904575912 1370 dbSNP
rs1265288991 1373 dbSNP
rs1001580580 1376 dbSNP
rs370251844 1381 dbSNP
rs1446339658 1383 dbSNP
rs1004795359 1385 dbSNP
rs1036263032 1394 dbSNP
rs901687562 1396 dbSNP
rs997335891 1398 dbSNP
rs953075515 1403 dbSNP
rs1169053092 1406 dbSNP
rs960163137 1417 dbSNP
rs1332175453 1421 dbSNP
rs992704622 1424 dbSNP
rs1385399330 1425 dbSNP
rs1388165765 1430 dbSNP
rs1411040828 1432 dbSNP
rs1175363865 1435 dbSNP
rs1357510989 1436 dbSNP
rs751383215 1437 dbSNP
rs566102837 1444 dbSNP
rs4702 1453 dbSNP
rs1021342392 1466 dbSNP
rs983749744 1469 dbSNP
rs967019648 1471 dbSNP
rs545665145 1472 dbSNP
rs547231299 1478 dbSNP
rs11546539 1480 dbSNP
rs978780550 1496 dbSNP
rs1215100150 1498 dbSNP
rs924186466 1499 dbSNP
rs1330930173 1501 dbSNP
rs961176574 1502 dbSNP
rs909557932 1509 dbSNP
rs1401937720 1510 dbSNP
rs143669943 1519 dbSNP
rs1309928670 1522 dbSNP
rs1211665783 1526 dbSNP
rs975180681 1527 dbSNP
rs1174285246 1528 dbSNP
rs539363356 1530 dbSNP
rs1280566485 1531 dbSNP
rs1335944066 1536 dbSNP
rs922372581 1540 dbSNP
rs1179018166 1546 dbSNP
rs1459262707 1551 dbSNP
rs1443037585 1560 dbSNP
rs371258832 1560 dbSNP
rs1051970086 1561 dbSNP
rs1199299685 1563 dbSNP
rs1347780609 1565 dbSNP
rs1475996116 1566 dbSNP
rs1191112205 1568 dbSNP
rs913470077 1569 dbSNP
rs1378685710 1570 dbSNP
rs946320295 1571 dbSNP
rs78192020 1580 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HTM
Disease MIMAT0000080
Location of target site 3'UTR
Tools used in this research MicroCosm , PicTar , TargetScan
Original Description (Extracted from the article) ... "In conclusion ...

- Luna C; Li G; Qiu J; Epstein DL; Gonzalez P, 2011, Journal of cellular physiology.

Article - Luna C; Li G; Qiu J; Epstein DL; Gonzalez P
- Journal of cellular physiology, 2011
Cyclic mechanical stress (CMS) leads to alterations of cellular functions in the trabecular meshwork (TM), including the up-regulation of transforming growth factor beta 1 (TGFbeta1), that can potentially contribute to the pathogenesis of glaucoma. Although microRNAs (miRNAs) are known to play important roles in many biological functions, little is known about their potential involvement in the cellular responses elicited by mechanical stress. Here we analyzed changes in miRNA expression induced by CMS, and examined the possible role of miR-24 in the response of human TM cells to CMS. CMS induced the expression of miR-24 that led to the down regulation of the subtilisin-like proprotein convertase FURIN, which is known to play a major role in the processing of TGFbeta1. FURIN was confirmed as a novel target of miR-24 by 3' UTR luciferase assay and western blot. Overexpression of miR-24 resulted in a significant decrease in activated TGFbeta1. This effect was mimicked by down regulation of FURIN by siRNA. Conversely, inhibition of miR-24 expression with a specific antagomir led to a small but significant increase in TGFbeta1. Furthermore, the increase in active TGFbeta1 induced by CMS in HTM cells was prevented by miR-24. Altogether, our results suggest that miRNAs might contribute to the regulation of responses to CMS in TM cells. Specifically, miR-24 might play an important role in modulating the induction of TGFbeta1 mediated by CMS through direct targeting of FURIN.
LinkOut: [PMID: 20945401]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions mouse heart
Disease 5045.0
Location of target site 3'UTR
Tools used in this research TargetScan , Sanger database
Original Description (Extracted from the article) ... "Loss-of-function and gain-of-function experiments indicated that the transfected miR-24 precursors in CFs significantly down-regulated furin expression at protein and mRNA levels ...

- Wang J; Huang W; Xu R; Nie Y; Cao X; Meng et al., 2012, Journal of cellular and molecular medicine.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gacaaGGACGACUUGACUCGGu 5'
               ||||:|   ||||||| 
Target 5' agggcCCUGUU-UUCUGAGCCc 3'
 		2 - 22
Article - Wang J; Huang W; Xu R; Nie Y; Cao X; Meng et al.
- Journal of cellular and molecular medicine, 2012
Cardiac fibrosis after myocardial infarction (MI) has been identified as a key factor in the development of heart failure. Although dysregulation of microRNA (miRNA) is involved in various pathophysiological processes in the heart, the role of miRNA in fibrosis regulation after MI is not clear. Previously we observed the correlation between fibrosis and the miR-24 expression in hypertrophic hearts, herein we assessed how miR-24 regulates fibrosis after MI. Using qRT-PCR, we showed that miR-24 was down-regulated in the MI heart; the change in miR-24 expression was closely related to extracellular matrix (ECM) remodelling. In vivo, miR-24 could improve heart function and attenuate fibrosis in the infarct border zone of the heart two weeks after MI through intramyocardial injection of Lentiviruses. Moreover, in vitro experiments suggested that up-regulation of miR-24 by synthetic miR-24 precursors could reduce fibrosis and also decrease the differentiation and migration of cardiac fibroblasts (CFs). TGF-beta (a pathological mediator of fibrotic disease) increased miR-24 expression, overexpression of miR-24 reduced TGF-beta secretion and Smad2/3 phosphorylation in CFs. By performing microarray analyses and bioinformatics analyses, we found furin to be a potential target for miR-24 in fibrosis (furin is a protease which controls latent TGF-beta activation processing). Finally, we demonstrated that protein and mRNA levels of furin were regulated by miR-24 in CFs. These findings suggest that miR-24 has a critical role in CF function and cardiac fibrosis after MI through a furin-TGF-beta pathway. Thus, miR-24 may be used as a target for treatment of MI and other fibrotic heart diseases.
LinkOut: [PMID: 22260784]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.683 1.6e-4 0.648 4.1e-4 23 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.677 5.2e-4 -0.678 5.1e-4 20 Click to see details
GSE28544 Breast cancer 0.624 5.6e-4 0.692 9.0e-5 24 Click to see details
GSE32688 Pancreatic cancer -0.469 3.4e-3 -0.338 2.9e-2 32 Click to see details
GSE14794 Lymphoblastoid cells 0.272 4.8e-3 0.173 5.1e-2 90 Click to see details
GSE19350 CNS germ cell tumors -0.705 5.2e-3 -0.874 1.0e-4 12 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.465 9.6e-3 -0.454 1.1e-2 25 Click to see details
GSE26953 Aortic valvular endothelial cells 0.406 2.5e-2 0.395 2.8e-2 24 Click to see details
GSE28260 Renal cortex and medulla 0.393 9.2e-2 0.159 3.0e-1 13 Click to see details
GSE19783 ER+ ER+ breast cancer -0.266 1.3e-1 -0.176 2.3e-1 20 Click to see details
GSE21849 B cell lymphoma 0.174 1.8e-1 0.361 2.7e-2 29 Click to see details
GSE19783 ER- ER- breast cancer 0.098 2.0e-1 0.102 1.9e-1 79 Click to see details
GSE17306 Multiple myeloma 0.115 2.2e-1 -0.010 4.7e-1 49 Click to see details
GSE27834 Pluripotent stem cells 0.172 2.6e-1 0.088 3.7e-1 16 Click to see details
GSE38226 Liver fibrosis 0.129 2.9e-1 0.040 4.3e-1 21 Click to see details
GSE21032 Prostate cancer -0.049 3.3e-1 0.040 3.6e-1 83 Click to see details
GSE19536 Breast cancer 0.041 3.4e-1 0.017 4.3e-1 100 Click to see details
GSE17498 Multiple myeloma 0.059 3.6e-1 -0.020 4.5e-1 40 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.07 3.7e-1 0.136 2.6e-1 25 Click to see details
GSE21687 Ependynoma primary tumors -0.01 4.7e-1 0.009 4.7e-1 64 Click to see details
GSE21687 Ependynoma primary tumors -0.01 4.7e-1 0.009 4.7e-1 64 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC -0.629 0 -0.507 0 42 Click to see details
BLCA 0.549 0.01 0.531 0.01 18 Click to see details
COAD -0.713 0.02 -0.714 0.02 8 Click to see details
CESC -0.995 0.03 -0.500 0.33 3 Click to see details
PRAD -0.217 0.07 -0.189 0.09 50 Click to see details
KICH 0.299 0.07 0.338 0.05 25 Click to see details
PCPG 0.954 0.1 0.500 0.33 3 Click to see details
ESCA 0.421 0.1 0.309 0.18 11 Click to see details
PAAD -0.596 0.2 -0.800 0.1 4 Click to see details
BRCA -0.081 0.23 -0.060 0.29 84 Click to see details
STAD 0.127 0.24 0.290 0.05 32 Click to see details
UCEC 0.132 0.3 0.095 0.35 19 Click to see details
THCA 0.06 0.33 0.080 0.27 59 Click to see details
LIHC -0.042 0.39 -0.056 0.35 49 Click to see details
KIRC -0.021 0.43 -0.093 0.23 68 Click to see details
LUAD 0.033 0.46 -0.245 0.22 12 Click to see details
CHOL 0.032 0.47 -0.033 0.47 9 Click to see details
KIRP 0.009 0.48 -0.011 0.48 32 Click to see details
LUSC 0.005 0.49 -0.035 0.42 38 Click to see details
LUSC 0.005 0.49 -0.035 0.42 38 Click to see details
LUSC 0.005 0.49 -0.035 0.42 38 Click to see details
819 hsa-miR-24-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000116 FEN1 flap structure-specific endonuclease 1 5 1
MIRT000117 CDK4 cyclin dependent kinase 4 5 1
MIRT000119 CCNA2 cyclin A2 5 1
MIRT000120 AURKB aurora kinase B 5 1
MIRT000121 MYC MYC proto-oncogene, bHLH transcription factor 5 1
MIRT000122 E2F2 E2F transcription factor 2 5 1
MIRT001773 NOTCH1 notch 1 2 2
MIRT002018 DHFR dihydrofolate reductase 5 3
MIRT002950 MAPK14 mitogen-activated protein kinase 14 7 2
MIRT003354 TRIB3 tribbles pseudokinase 3 6 6
MIRT003355 HNF4A hepatocyte nuclear factor 4 alpha 5 2
MIRT003830 ACVR1B activin A receptor type 1B 5 6
MIRT003889 MLEC malectin 3 2
MIRT004362 CDKN2A cyclin dependent kinase inhibitor 2A 4 1
MIRT004836 BRCA1 BRCA1, DNA repair associated 5 2
MIRT004837 POLD1 DNA polymerase delta 1, catalytic subunit 5 1
MIRT005063 CDKN1B cyclin dependent kinase inhibitor 1B 6 6
MIRT005397 KHSRP KH-type splicing regulatory protein 2 2
MIRT005398 NFAT5 nuclear factor of activated T-cells 5 2 2
MIRT005766 DND1 DND microRNA-mediated repression inhibitor 1 3 1
MIRT005918 TGFB1 transforming growth factor beta 1 4 1
MIRT005919 FURIN furin, paired basic amino acid cleaving enzyme 4 2
MIRT006507 FAF1 Fas associated factor 1 2 1
MIRT007012 ZNF217 zinc finger protein 217 2 2
MIRT007215 ST7L suppression of tumorigenicity 7 like 3 1
MIRT030361 VRK1 vaccinia related kinase 1 1 1
MIRT030362 NOP56 NOP56 ribonucleoprotein 1 1
MIRT030363 TBPL1 TATA-box binding protein like 1 1 1
MIRT030364 TNPO3 transportin 3 3 5
MIRT030365 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 1
MIRT030366 DDHD2 DDHD domain containing 2 1 1
MIRT030367 THOP1 thimet oligopeptidase 1 1 1
MIRT030368 MAP2K4 mitogen-activated protein kinase kinase 4 1 1
MIRT030369 UBE2C ubiquitin conjugating enzyme E2 C 1 1
MIRT030370 GNPAT glyceronephosphate O-acyltransferase 1 1
MIRT030371 METAP2 methionyl aminopeptidase 2 1 1
MIRT030372 KIAA0020 pumilio RNA binding family member 3 1 1
MIRT030373 UGDH UDP-glucose 6-dehydrogenase 3 5
MIRT030374 URM1 ubiquitin related modifier 1 1 1
MIRT030375 GTF2E1 general transcription factor IIE subunit 1 1 1
MIRT030376 MED22 mediator complex subunit 22 1 1
MIRT030377 USP10 ubiquitin specific peptidase 10 1 1
MIRT030378 FKBP1B FK506 binding protein 1B 1 1
MIRT030379 SCML1 Scm polycomb group protein like 1 1 1
MIRT030380 CNDP2 carnosine dipeptidase 2 2 1
MIRT030381 MCM10 minichromosome maintenance 10 replication initiation factor 2 1
MIRT030382 TOP1 DNA topoisomerase I 2 1
MIRT030383 H2AFX H2A histone family member X 4 3
MIRT030384 TOMM22 translocase of outer mitochondrial membrane 22 1 1
MIRT030385 HBQ1 hemoglobin subunit theta 1 1 1
MIRT030386 PRIM1 DNA primase subunit 1 1 1
MIRT030387 PSMD1 proteasome 26S subunit, non-ATPase 1 3 3
MIRT030388 AUNIP aurora kinase A and ninein interacting protein 1 1
MIRT030389 NARF nuclear prelamin A recognition factor 1 1
MIRT030390 MALSU1 mitochondrial assembly of ribosomal large subunit 1 1 1
MIRT030391 TCEA3 transcription elongation factor A3 1 1
MIRT030392 ADRM1 adhesion regulating molecule 1 1 1
MIRT030393 AGFG1 ArfGAP with FG repeats 1 1 1
MIRT030394 ACD ACD, shelterin complex subunit and telomerase recruitment factor 1 1
MIRT030395 RCE1 Ras converting CAAX endopeptidase 1 1 1
MIRT030396 SUMO3 small ubiquitin-like modifier 3 1 1
MIRT030397 CYP20A1 cytochrome P450 family 20 subfamily A member 1 3 3
MIRT030398 C18orf56 TYMS opposite strand 1 1
MIRT030399 MIS18A MIS18 kinetochore protein A 1 1
MIRT030400 GLYR1 glyoxylate reductase 1 homolog 1 1
MIRT030401 NAE1 NEDD8 activating enzyme E1 subunit 1 1 1
MIRT030402 ACTL6A actin like 6A 1 1
MIRT030403 NCBP2 nuclear cap binding protein subunit 2 1 1
MIRT030404 SLC29A4 solute carrier family 29 member 4 1 1
MIRT030405 PHF16 jade family PHD finger 3 1 1
MIRT030406 GYG2 glycogenin 2 1 1
MIRT030407 SLC7A2 solute carrier family 7 member 2 1 1
MIRT030408 EXOSC8 exosome component 8 1 1
MIRT030409 TDRP testis development related protein 1 1
MIRT030410 R3HDM4 R3H domain containing 4 1 1
MIRT030411 DCAF4 DDB1 and CUL4 associated factor 4 1 1
MIRT030412 TAF15 TATA-box binding protein associated factor 15 1 1
MIRT030413 VPS25 vacuolar protein sorting 25 homolog 1 1
MIRT030414 NR0B2 nuclear receptor subfamily 0 group B member 2 1 1
MIRT030415 NASP nuclear autoantigenic sperm protein 1 1
MIRT030416 STRADB STE20-related kinase adaptor beta 1 1
MIRT030417 MTF2 metal response element binding transcription factor 2 1 1
MIRT030418 PHOSPHO2 phosphatase, orphan 2 1 1
MIRT030419 ATAD3A ATPase family, AAA domain containing 3A 1 1
MIRT030420 CCDC59 coiled-coil domain containing 59 3 3
MIRT030421 VPS35 VPS35, retromer complex component 1 1
MIRT030422 PAF1 PAF1 homolog, Paf1/RNA polymerase II complex component 1 1
MIRT030423 CIRBP cold inducible RNA binding protein 1 1
MIRT030424 S100P S100 calcium binding protein P 1 1
MIRT030425 ARHGEF7 Rho guanine nucleotide exchange factor 7 1 1
MIRT030426 PROSER1 proline and serine rich 1 1 1
MIRT030427 PDLIM7 PDZ and LIM domain 7 1 1
MIRT030428 KIAA0100 KIAA0100 1 1
MIRT030429 TOMM34 translocase of outer mitochondrial membrane 34 1 1
MIRT030430 CTCF CCCTC-binding factor 1 1
MIRT030431 EIF4G3 eukaryotic translation initiation factor 4 gamma 3 1 1
MIRT030432 SLC52A2 solute carrier family 52 member 2 1 1
MIRT030433 KHNYN KH and NYN domain containing 1 1
MIRT030434 ADD1 adducin 1 1 1
MIRT030435 ZBED1 zinc finger BED-type containing 1 1 1
MIRT030436 KLHL23 kelch like family member 23 1 1
MIRT030437 SULT2A1 sulfotransferase family 2A member 1 1 1
MIRT030438 LSM12 LSM12 homolog 1 1
MIRT030439 PDPK1 3-phosphoinositide dependent protein kinase 1 3 3
MIRT030440 CARD10 caspase recruitment domain family member 10 4 2
MIRT030441 PPM1F protein phosphatase, Mg2+/Mn2+ dependent 1F 1 1
MIRT030442 NRIP1 nuclear receptor interacting protein 1 1 1
MIRT030443 ARHGEF18 Rho/Rac guanine nucleotide exchange factor 18 1 1
MIRT030444 FNTB farnesyltransferase, CAAX box, beta 1 1
MIRT030445 PAK4 p21 (RAC1) activated kinase 4 4 4
MIRT030446 KPNA6 karyopherin subunit alpha 6 1 1
MIRT030447 BCL2L2 BCL2 like 2 1 1
MIRT030448 PSTPIP2 proline-serine-threonine phosphatase interacting protein 2 1 1
MIRT030449 ACACA acetyl-CoA carboxylase alpha 1 1
MIRT030450 MATR3 matrin 3 3 3
MIRT030451 PTPLAD1 3-hydroxyacyl-CoA dehydratase 3 1 1
MIRT030452 TSPAN14 tetraspanin 14 1 1
MIRT030453 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT030454 MIDN midnolin 1 1
MIRT030455 CCDC58 coiled-coil domain containing 58 1 1
MIRT030456 LAPTM4B lysosomal protein transmembrane 4 beta 1 1
MIRT030457 PPP3R1 protein phosphatase 3 regulatory subunit B, alpha 1 1
MIRT030458 ZNF813 zinc finger protein 813 1 1
MIRT030459 MAGI1 membrane associated guanylate kinase, WW and PDZ domain containing 1 1 1
MIRT030460 ZCCHC14 zinc finger CCHC-type containing 14 1 1
MIRT030461 PTGFRN prostaglandin F2 receptor inhibitor 1 1
MIRT030462 SCML2 Scm polycomb group protein like 2 2 2
MIRT030463 DNAJB12 DnaJ heat shock protein family (Hsp40) member B12 1 1
MIRT030464 NUP54 nucleoporin 54 2 2
MIRT030465 SESN1 sestrin 1 2 2
MIRT030466 SLC35B2 solute carrier family 35 member B2 2 2
MIRT030467 AGPAT3 1-acylglycerol-3-phosphate O-acyltransferase 3 2 2
MIRT030468 UBD ubiquitin D 2 1
MIRT030469 RRM2 ribonucleotide reductase regulatory subunit M2 2 1
MIRT030470 BCL2L12 BCL2 like 12 2 1
MIRT030471 MBD6 methyl-CpG binding domain protein 6 2 1
MIRT030472 OXSR1 oxidative stress responsive 1 1 1
MIRT030473 PER2 period circadian clock 2 2 1
MIRT030474 UNG uracil DNA glycosylase 1 1
MIRT030475 RRP12 ribosomal RNA processing 12 homolog 1 1
MIRT030476 CWC27 CWC27 spliceosome associated protein homolog 1 1
MIRT030477 SRRT serrate, RNA effector molecule 1 1
MIRT030478 PACSIN3 protein kinase C and casein kinase substrate in neurons 3 1 1
MIRT030479 EXOSC3 exosome component 3 1 1
MIRT030480 ALG5 ALG5, dolichyl-phosphate beta-glucosyltransferase 1 1
MIRT030481 SLC2A3 solute carrier family 2 member 3 1 1
MIRT030482 MRPS24 mitochondrial ribosomal protein S24 1 1
MIRT030483 EIF2S3 eukaryotic translation initiation factor 2 subunit gamma 4 4
MIRT030484 GTF3C2 general transcription factor IIIC subunit 2 1 1
MIRT030485 FAH fumarylacetoacetate hydrolase 1 1
MIRT030486 ARL1 ADP ribosylation factor like GTPase 1 1 1
MIRT030487 MED16 mediator complex subunit 16 3 3
MIRT030488 MED24 mediator complex subunit 24 1 1
MIRT030489 CCAR1 cell division cycle and apoptosis regulator 1 1 1
MIRT030490 DUS1L dihydrouridine synthase 1 like 1 1
MIRT030491 BEX1 brain expressed X-linked 1 1 1
MIRT030492 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT030493 EIF4H eukaryotic translation initiation factor 4H 1 1
MIRT030494 DCP2 decapping mRNA 2 1 1
MIRT030495 ABCE1 ATP binding cassette subfamily E member 1 1 1
MIRT030496 UBE3A ubiquitin protein ligase E3A 1 1
MIRT030497 TYW3 tRNA-yW synthesizing protein 3 homolog 1 1
MIRT030498 UQCC ubiquinol-cytochrome c reductase complex assembly factor 1 1 1
MIRT030499 NKD1 naked cuticle homolog 1 1 1
MIRT030500 NFKBIA NFKB inhibitor alpha 1 1
MIRT030501 AK3 adenylate kinase 3 1 1
MIRT030502 NSA2 NSA2, ribosome biogenesis homolog 1 1
MIRT030503 CDK1 cyclin dependent kinase 1 5 1
MIRT030504 HSF2 heat shock transcription factor 2 1 1
MIRT030505 CDCA7 cell division cycle associated 7 1 1
MIRT030506 NCOA6 nuclear receptor coactivator 6 1 1
MIRT030507 TNIP2 TNFAIP3 interacting protein 2 1 1
MIRT030508 AKAP7 A-kinase anchoring protein 7 1 1
MIRT030509 TUBGCP2 tubulin gamma complex associated protein 2 1 1
MIRT030510 POLR2D RNA polymerase II subunit D 3 3
MIRT030511 FBXO34 F-box protein 34 1 1
MIRT030512 STK35 serine/threonine kinase 35 1 1
MIRT030513 CTDSP2 CTD small phosphatase 2 1 1
MIRT030514 C8orf33 chromosome 8 open reading frame 33 1 1
MIRT030515 ZDHHC3 zinc finger DHHC-type containing 3 1 1
MIRT030516 IQCB1 IQ motif containing B1 1 1
MIRT030517 RHOT2 ras homolog family member T2 1 1
MIRT030518 ALDH5A1 aldehyde dehydrogenase 5 family member A1 1 1
MIRT030519 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT030520 SLC11A2 solute carrier family 11 member 2 1 1
MIRT030521 GBAS nipsnap homolog 2 1 1
MIRT030522 SLC5A6 solute carrier family 5 member 6 1 1
MIRT030523 NEK6 NIMA related kinase 6 1 1
MIRT030524 SLC7A1 solute carrier family 7 member 1 1 1
MIRT030525 GGA2 golgi associated, gamma adaptin ear containing, ARF binding protein 2 3 3
MIRT030526 ADPGK ADP dependent glucokinase 1 1
MIRT030527 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT030528 FZD4 frizzled class receptor 4 1 1
MIRT030529 AAMP angio associated migratory cell protein 1 1
MIRT030530 PLIN3 perilipin 3 1 1
MIRT030531 LLGL1 LLGL1, scribble cell polarity complex component 3 5
MIRT030532 KLHDC3 kelch domain containing 3 1 1
MIRT030533 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT030534 MARCKSL1 MARCKS like 1 3 3
MIRT030535 C1orf106 chromosome 1 open reading frame 106 3 3
MIRT030536 ADD3 adducin 3 1 1
MIRT030537 SNTB1 syntrophin beta 1 1 1
MIRT030538 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT030539 TMTC4 transmembrane and tetratricopeptide repeat containing 4 1 1
MIRT030540 GLUL glutamate-ammonia ligase 1 1
MIRT030541 TMEM209 transmembrane protein 209 1 1
MIRT030542 LBR lamin B receptor 1 1
MIRT030543 LIMD1 LIM domains containing 1 1 1
MIRT030544 SPIN4 spindlin family member 4 1 1
MIRT030545 ZNF264 zinc finger protein 264 2 6
MIRT030546 VGLL3 vestigial like family member 3 1 1
MIRT030547 BCL2L11 BCL2 like 11 5 12
MIRT030548 DEDD death effector domain containing 1 1
MIRT030549 CD34 CD34 molecule 1 1
MIRT030550 TMED7 transmembrane p24 trafficking protein 7 1 1
MIRT030551 E2F3 E2F transcription factor 3 2 1
MIRT030552 ZNF317 zinc finger protein 317 2 1
MIRT030553 STX16 syntaxin 16 2 1
MIRT030554 DHFRP1 dihydrofolate reductase pseudogene 1 1 1
MIRT030555 CHEK1 checkpoint kinase 1 4 1
MIRT030556 NOTUM NOTUM, palmitoleoyl-protein carboxylesterase 1 1
MIRT030557 ABCB10 ATP binding cassette subfamily B member 10 1 1
MIRT030558 CCL2 C-C motif chemokine ligand 2 1 1
MIRT030559 OARD1 O-acyl-ADP-ribose deacylase 1 1 1
MIRT030560 PCGF6 polycomb group ring finger 6 1 1
MIRT030561 SNRPD3 small nuclear ribonucleoprotein D3 polypeptide 3 3
MIRT030562 CTDSP1 CTD small phosphatase 1 1 1
MIRT030563 MAK16 MAK16 homolog 1 1
MIRT030564 RNF144A ring finger protein 144A 1 1
MIRT030565 TM9SF3 transmembrane 9 superfamily member 3 1 1
MIRT030566 C15orf57 coiled-coil domain containing 32 1 1
MIRT030567 COMMD9 COMM domain containing 9 1 1
MIRT030568 SLC25A15 solute carrier family 25 member 15 1 1
MIRT030569 NOP14 NOP14 nucleolar protein 1 1
MIRT030570 CHD8 chromodomain helicase DNA binding protein 8 1 1
MIRT030571 OGFR opioid growth factor receptor 1 1
MIRT030572 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT030573 PCK2 phosphoenolpyruvate carboxykinase 2, mitochondrial 1 1
MIRT030574 SERGEF secretion regulating guanine nucleotide exchange factor 1 1
MIRT030575 ANPEP alanyl aminopeptidase, membrane 1 1
MIRT030576 ITFG3 family with sequence similarity 234 member A 1 1
MIRT030577 PSME3 proteasome activator subunit 3 1 1
MIRT030578 PRKRIR THAP domain containing 12 1 1
MIRT030579 AP5M1 adaptor related protein complex 5 mu 1 subunit 1 1
MIRT030580 HMGB2 high mobility group box 2 1 1
MIRT030581 TNFAIP3 TNF alpha induced protein 3 1 1
MIRT030582 CSTF3 cleavage stimulation factor subunit 3 1 1
MIRT030583 FOXQ1 forkhead box Q1 1 1
MIRT030584 BTBD3 BTB domain containing 3 1 1
MIRT030585 PA2G4 proliferation-associated 2G4 1 1
MIRT030586 ZMYND19 zinc finger MYND-type containing 19 1 1
MIRT030587 CHFR checkpoint with forkhead and ring finger domains 1 1
MIRT030588 CCNB1 cyclin B1 1 1
MIRT030589 ERBB3 erb-b2 receptor tyrosine kinase 3 3 3
MIRT030590 NEDD4L neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase 1 1
MIRT030591 NETO2 neuropilin and tolloid like 2 3 3
MIRT030592 LAMTOR3 late endosomal/lysosomal adaptor, MAPK and MTOR activator 3 1 1
MIRT030593 MRPL27 mitochondrial ribosomal protein L27 1 1
MIRT030594 COPS7A COP9 signalosome subunit 7A 1 1
MIRT030595 DSC2 desmocollin 2 1 1
MIRT030596 DHCR24 24-dehydrocholesterol reductase 1 1
MIRT030597 RPL7L1 ribosomal protein L7 like 1 1 1
MIRT030598 KIAA0195 transmembrane protein 94 1 1
MIRT030599 KIAA1967 cell cycle and apoptosis regulator 2 1 1
MIRT030600 HIC2 HIC ZBTB transcriptional repressor 2 1 1
MIRT030601 DTL denticleless E3 ubiquitin protein ligase homolog 1 1
MIRT030602 NUBPL nucleotide binding protein like 1 1
MIRT030603 GMFB glia maturation factor beta 1 1
MIRT030604 PLAGL2 PLAG1 like zinc finger 2 3 3
MIRT030605 CMTM3 CKLF like MARVEL transmembrane domain containing 3 1 1
MIRT030606 CSK C-terminal Src kinase 1 1
MIRT030607 MMS19 MMS19 homolog, cytosolic iron-sulfur assembly component 1 1
MIRT030608 MRPS22 mitochondrial ribosomal protein S22 1 1
MIRT030609 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT030610 NET1 neuroepithelial cell transforming 1 1 1
MIRT030611 GUCD1 guanylyl cyclase domain containing 1 3 5
MIRT030612 RALA RAS like proto-oncogene A 1 1
MIRT030613 AK4 adenylate kinase 4 1 1
MIRT030614 KCNJ14 potassium voltage-gated channel subfamily J member 14 1 1
MIRT030615 JARID2 jumonji and AT-rich interaction domain containing 2 1 1
MIRT030616 BRD8 bromodomain containing 8 1 1
MIRT030617 PIM2 Pim-2 proto-oncogene, serine/threonine kinase 1 1
MIRT030618 GFOD1 glucose-fructose oxidoreductase domain containing 1 1 1
MIRT030619 HDAC1 histone deacetylase 1 1 1
MIRT030620 WRB tryptophan rich basic protein 1 1
MIRT030621 TMEM194A nuclear envelope integral membrane protein 1 1 1
MIRT030622 YOD1 YOD1 deubiquitinase 1 1
MIRT030623 RNF11 ring finger protein 11 1 1
MIRT030624 RNF2 ring finger protein 2 2 3
MIRT030625 FZD5 frizzled class receptor 5 5 2
MIRT030626 E2F1 E2F transcription factor 1 1 1
MIRT030627 CORO1A coronin 1A 1 1
MIRT030628 UBC ubiquitin C 1 1
MIRT030629 MCM4 minichromosome maintenance complex component 4 2 1
MIRT030630 PDXK pyridoxal kinase 2 2
MIRT030631 PCNA proliferating cell nuclear antigen 3 1
MIRT035526 PTPN9 protein tyrosine phosphatase, non-receptor type 9 1 1
MIRT035527 PTPRF protein tyrosine phosphatase, receptor type F 1 1
MIRT035542 SH3PXD2A SH3 and PX domains 2A 1 1
MIRT035543 ARHGAP19 Rho GTPase activating protein 19 1 1
MIRT050365 RPS7 ribosomal protein S7 1 1
MIRT050366 EXOSC1 exosome component 1 1 1
MIRT050367 AMPD2 adenosine monophosphate deaminase 2 1 1
MIRT050368 RANBP1 RAN binding protein 1 1 1
MIRT050369 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 1
MIRT050370 DARS2 aspartyl-tRNA synthetase 2, mitochondrial 1 1
MIRT050371 RPS16 ribosomal protein S16 1 1
MIRT050372 DEPDC1 DEP domain containing 1 1 1
MIRT050373 DDX5 DEAD-box helicase 5 1 1
MIRT050374 BCL7A BCL tumor suppressor 7A 1 1
MIRT050375 SNX12 sorting nexin 12 1 1
MIRT050376 GORASP2 golgi reassembly stacking protein 2 1 1
MIRT050377 RIF1 replication timing regulatory factor 1 2 3
MIRT050378 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT050379 CCNG1 cyclin G1 1 1
MIRT050380 IKBKAP elongator complex protein 1 1 1
MIRT050381 ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide 1 1
MIRT050382 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT050383 DCAF10 DDB1 and CUL4 associated factor 10 1 1
MIRT052941 Furin furin (paired basic amino acid cleaving enzyme) 2 1
MIRT052953 S100A8 S100 calcium binding protein A8 2 1
MIRT053042 MXI1 MAX interactor 1, dimerization protein 3 1
MIRT053061 XIAP X-linked inhibitor of apoptosis 5 3
MIRT053134 NOS3 nitric oxide synthase 3 3 1
MIRT053161 INSIG1 insulin induced gene 1 4 7
MIRT053238 CYP11B2 cytochrome P450 family 11 subfamily B member 2 2 1
MIRT053779 REG4 regenerating family member 4 3 1
MIRT054288 MEN1 menin 1 5 3
MIRT054320 LDHA lactate dehydrogenase A 4 3
MIRT054323 LDHB lactate dehydrogenase B 2 1
MIRT054386 JPH2 junctophilin 2 3 3
MIRT054393 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 1 1
MIRT054474 MAP3K9 mitogen-activated protein kinase kinase kinase 9 2 1
MIRT054710 SSSCA1 Sjogren syndrome/scleroderma autoantigen 1 3 1
MIRT054754 HMOX1 heme oxygenase 1 2 1
MIRT054828 PSAP prosaposin 4 1
MIRT115232 ABHD2 abhydrolase domain containing 2 2 2
MIRT123977 POLR3D RNA polymerase III subunit D 2 2
MIRT196600 TAOK1 TAO kinase 1 2 2
MIRT249228 EIF5 eukaryotic translation initiation factor 5 2 2
MIRT256046 UBE2K ubiquitin conjugating enzyme E2 K 2 4
MIRT324457 ASB6 ankyrin repeat and SOCS box containing 6 2 2
MIRT327634 ZXDB zinc finger, X-linked, duplicated B 2 6
MIRT338141 SP1 Sp1 transcription factor 1 1
MIRT352061 BZW1 basic leucine zipper and W2 domains 1 2 2
MIRT395244 MT1E metallothionein 1E 2 2
MIRT437500 MMP14 matrix metallopeptidase 14 1 1
MIRT437826 AGPAT2 1-acylglycerol-3-phosphate O-acyltransferase 2 1 1
MIRT437970 IFNG interferon gamma 3 1
MIRT438418 FGFR3 fibroblast growth factor receptor 3 4 1
MIRT438421 TACC3 transforming acidic coiled-coil containing protein 3 4 1
MIRT438424 MAFB MAF bZIP transcription factor B 4 1
MIRT438427 CCND1 cyclin D1 4 1
MIRT438454 NCSTN nicastrin 1 1
MIRT438533 IFNR interferon production regulator 2 1
MIRT438608 WNT4 Wnt family member 4 1 1
MIRT438644 NDST1 N-deacetylase and N-sulfotransferase 1 3 1
MIRT447723 RPS6KA5 ribosomal protein S6 kinase A5 2 2
MIRT447760 TTLL7 tubulin tyrosine ligase like 7 2 2
MIRT455064 ARHGAP39 Rho GTPase activating protein 39 2 2
MIRT455750 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 2 2
MIRT457051 NEGR1 neuronal growth regulator 1 2 4
MIRT458116 TMEM173 transmembrane protein 173 2 2
MIRT458530 HKR1 HKR1, GLI-Kruppel zinc finger family member 2 2
MIRT462325 SETX senataxin 2 2
MIRT464501 UCK2 uridine-cytidine kinase 2 2 2
MIRT465466 TOR2A torsin family 2 member A 2 2
MIRT471227 PHAX phosphorylated adaptor for RNA export 2 2
MIRT476066 GRINA glutamate ionotropic receptor NMDA type subunit associated protein 1 2 2
MIRT476461 GBA2 glucosylceramidase beta 2 2 2
MIRT476706 FSCN1 fascin actin-bundling protein 1 2 2
MIRT476916 FBLIM1 filamin binding LIM protein 1 2 4
MIRT477425 EMP1 epithelial membrane protein 1 2 2
MIRT477908 DVL3 dishevelled segment polarity protein 3 2 4
MIRT478339 DDN dendrin 2 2
MIRT478801 CRTAP cartilage associated protein 2 4
MIRT479899 CCDC117 coiled-coil domain containing 117 2 2
MIRT480435 C17orf49 chromosome 17 open reading frame 49 2 2
MIRT481095 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 2 2
MIRT481990 AMOTL2 angiomotin like 2 2 2
MIRT486982 STEAP3 STEAP3 metalloreductase 2 4
MIRT489236 CLN8 CLN8, transmembrane ER and ERGIC protein 2 4
MIRT490739 SRCIN1 SRC kinase signaling inhibitor 1 2 2
MIRT492019 UGCG UDP-glucose ceramide glucosyltransferase 2 2
MIRT493589 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 6
MIRT494058 DUSP7 dual specificity phosphatase 7 2 2
MIRT499970 NCOA5 nuclear receptor coactivator 5 2 2
MIRT501272 NHS NHS actin remodeling regulator 2 4
MIRT501542 POGZ pogo transposable element derived with ZNF domain 2 2
MIRT527694 IL17REL interleukin 17 receptor E like 2 2
MIRT527729 TMEM241 transmembrane protein 241 2 2
MIRT528420 MRPS16 mitochondrial ribosomal protein S16 2 2
MIRT528870 ATF3 activating transcription factor 3 2 2
MIRT530340 GABRB3 gamma-aminobutyric acid type A receptor beta3 subunit 2 2
MIRT540115 KLF17 Kruppel like factor 17 2 2
MIRT540603 CD3D CD3d molecule 2 4
MIRT540636 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT541054 SEPHS1 selenophosphate synthetase 1 2 2
MIRT541713 TMEM33 transmembrane protein 33 2 2
MIRT541847 PLIN5 perilipin 5 2 2
MIRT541892 LY6G5B lymphocyte antigen 6 family member G5B 2 2
MIRT542947 GIGYF1 GRB10 interacting GYF protein 1 2 2
MIRT545431 SCAMP2 secretory carrier membrane protein 2 2 2
MIRT549513 HDDC2 HD domain containing 2 2 2
MIRT556737 KLHL15 kelch like family member 15 2 4
MIRT559280 AURKA aurora kinase A 2 2
MIRT564581 ZXDA zinc finger, X-linked, duplicated A 2 2
MIRT571909 LSM14A LSM14A, mRNA processing body assembly factor 2 4
MIRT575280 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 2 2
MIRT607045 IDS iduronate 2-sulfatase 2 2
MIRT607713 LIMS1 LIM zinc finger domain containing 1 2 2
MIRT608083 CRISPLD2 cysteine rich secretory protein LCCL domain containing 2 2 2
MIRT609645 PACS2 phosphofurin acidic cluster sorting protein 2 2 2
MIRT610567 HIST3H2BB histone cluster 3 H2B family member b 2 2
MIRT611112 NIPA1 non imprinted in Prader-Willi/Angelman syndrome 1 2 2
MIRT613671 KIAA1210 KIAA1210 2 2
MIRT615060 CRY2 cryptochrome circadian clock 2 2 2
MIRT617926 ZNF783 zinc finger family member 783 2 2
MIRT618465 GPR55 G protein-coupled receptor 55 2 2
MIRT619409 NTPCR nucleoside-triphosphatase, cancer-related 2 2
MIRT620694 RFTN2 raftlin family member 2 2 2
MIRT620921 LRRTM2 leucine rich repeat transmembrane neuronal 2 2 2
MIRT621035 POLA2 DNA polymerase alpha 2, accessory subunit 2 2
MIRT622583 PRRG4 proline rich and Gla domain 4 2 2
MIRT623371 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 2
MIRT623402 LEPROTL1 leptin receptor overlapping transcript like 1 2 2
MIRT625024 ZNF730 zinc finger protein 730 2 2
MIRT625113 SLC1A5 solute carrier family 1 member 5 2 4
MIRT625326 TNFRSF13B TNF receptor superfamily member 13B 2 2
MIRT625414 IMP4 IMP4, U3 small nucleolar ribonucleoprotein 2 2
MIRT625832 NXPE2 neurexophilin and PC-esterase domain family member 2 2 2
MIRT625899 LINC00632 long intergenic non-protein coding RNA 632 2 2
MIRT626169 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 2 2
MIRT626607 ACAA2 acetyl-CoA acyltransferase 2 2 2
MIRT626675 CISD2 CDGSH iron sulfur domain 2 2 2
MIRT626815 PRR11 proline rich 11 2 2
MIRT626828 ZNF430 zinc finger protein 430 2 2
MIRT627784 RAB11FIP1 RAB11 family interacting protein 1 2 2
MIRT628137 HM13 histocompatibility minor 13 2 2
MIRT628610 ZBTB3 zinc finger and BTB domain containing 3 2 2
MIRT628683 TRAF3IP1 TRAF3 interacting protein 1 2 2
MIRT628787 GSDMA gasdermin A 2 2
MIRT628858 KCNE4 potassium voltage-gated channel subfamily E regulatory subunit 4 2 2
MIRT629019 OSBPL10 oxysterol binding protein like 10 2 2
MIRT629125 APPL1 adaptor protein, phosphotyrosine interacting with PH domain and leucine zipper 1 2 4
MIRT629200 PAPOLA poly(A) polymerase alpha 2 2
MIRT629207 ZNF878 zinc finger protein 878 2 2
MIRT629234 CINP cyclin dependent kinase 2 interacting protein 2 2
MIRT629398 CRCP CGRP receptor component 2 2
MIRT629517 ULBP3 UL16 binding protein 3 2 4
MIRT629559 EMP2 epithelial membrane protein 2 2 2
MIRT629570 PIGR polymeric immunoglobulin receptor 2 2
MIRT629748 SCD5 stearoyl-CoA desaturase 5 2 2
MIRT629797 GPR82 G protein-coupled receptor 82 2 2
MIRT629813 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 2 2
MIRT629833 CCL16 C-C motif chemokine ligand 16 2 2
MIRT629907 SPATA5 spermatogenesis associated 5 2 2
MIRT629982 NARS asparaginyl-tRNA synthetase 2 2
MIRT630004 PDE6B phosphodiesterase 6B 2 2
MIRT630034 MTL5 testis expressed metallothionein like protein 2 2
MIRT630075 GRWD1 glutamate rich WD repeat containing 1 2 2
MIRT630136 ZFYVE9 zinc finger FYVE-type containing 9 2 2
MIRT630208 SVIP small VCP interacting protein 2 2
MIRT630219 SORD sorbitol dehydrogenase 2 2
MIRT630250 SMTNL2 smoothelin like 2 2 2
MIRT630295 PRICKLE1 prickle planar cell polarity protein 1 2 2
MIRT630400 MYH9 myosin heavy chain 9 2 2
MIRT630411 MOB1A MOB kinase activator 1A 2 2
MIRT630436 KIF1C kinesin family member 1C 2 2
MIRT630475 DTD2 D-tyrosyl-tRNA deacylase 2 (putative) 2 2
MIRT630517 CDC73 cell division cycle 73 2 2
MIRT630809 XPNPEP3 X-prolyl aminopeptidase 3 2 2
MIRT630819 YTHDC1 YTH domain containing 1 2 2
MIRT630833 ZNF621 zinc finger protein 621 2 2
MIRT630913 ZMAT2 zinc finger matrin-type 2 2 2
MIRT631166 APTX aprataxin 2 2
MIRT631210 DENND6B DENN domain containing 6B 2 2
MIRT631569 TRAF3IP2 TRAF3 interacting protein 2 2 2
MIRT631648 C19orf35 PEAK family member 3 2 2
MIRT631698 C1QTNF6 C1q and TNF related 6 2 2
MIRT631755 MINOS1 mitochondrial inner membrane organizing system 1 2 2
MIRT631997 POPDC2 popeye domain containing 2 2 2
MIRT632015 TAF1B TATA-box binding protein associated factor, RNA polymerase I subunit B 2 2
MIRT632034 SPPL2A signal peptide peptidase like 2A 2 2
MIRT632219 YME1L1 YME1 like 1 ATPase 2 2
MIRT632351 STRN3 striatin 3 2 2
MIRT632358 SRRD SRR1 domain containing 2 2
MIRT632426 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 2
MIRT632456 SGTB small glutamine rich tetratricopeptide repeat containing beta 2 2
MIRT632493 RBM3 RNA binding motif (RNP1, RRM) protein 3 2 2
MIRT632631 PARP2 poly(ADP-ribose) polymerase 2 2 2
MIRT632637 OSMR oncostatin M receptor 2 2
MIRT632718 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT632753 MED28 mediator complex subunit 28 2 2
MIRT632761 MDM4 MDM4, p53 regulator 2 2
MIRT632841 IGF1 insulin like growth factor 1 3 2
MIRT633144 C4orf32 family with sequence similarity 241 member A 2 2
MIRT633162 C11orf84 chromosome 11 open reading frame 84 2 2
MIRT633256 ZNF581 zinc finger protein 581 2 2
MIRT633260 ZNF556 zinc finger protein 556 2 2
MIRT633305 LINC00346 long intergenic non-protein coding RNA 346 2 2
MIRT633327 PRPF6 pre-mRNA processing factor 6 2 2
MIRT633336 GRK4 G protein-coupled receptor kinase 4 2 2
MIRT633354 TFDP2 transcription factor Dp-2 2 2
MIRT633460 DSN1 DSN1 homolog, MIS12 kinetochore complex component 2 2
MIRT633498 ERO1L endoplasmic reticulum oxidoreductase 1 alpha 1 1
MIRT633534 PGBD5 piggyBac transposable element derived 5 2 2
MIRT633621 R3HDM2 R3H domain containing 2 2 2
MIRT633748 MCM9 minichromosome maintenance 9 homologous recombination repair factor 2 2
MIRT633874 ATP6V1A ATPase H+ transporting V1 subunit A 2 2
MIRT634001 SSR1 signal sequence receptor subunit 1 2 2
MIRT634106 ZNF8 zinc finger protein 8 2 2
MIRT634121 ZMYM1 zinc finger MYM-type containing 1 2 4
MIRT634135 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 2 2
MIRT634182 TXNDC16 thioredoxin domain containing 16 2 2
MIRT634205 TMEM192 transmembrane protein 192 2 2
MIRT634277 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT634308 SNTN sentan, cilia apical structure protein 2 2
MIRT634362 RASSF9 Ras association domain family member 9 2 2
MIRT634446 PDE7A phosphodiesterase 7A 2 2
MIRT634467 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 2
MIRT634482 OR7D2 olfactory receptor family 7 subfamily D member 2 2 2
MIRT634612 IKZF3 IKAROS family zinc finger 3 2 2
MIRT634627 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT635035 WWTR1 WW domain containing transcription regulator 1 2 2
MIRT635140 PLEKHA2 pleckstrin homology domain containing A2 2 2
MIRT635801 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT636093 ZFP30 ZFP30 zinc finger protein 2 2
MIRT636334 PI4K2B phosphatidylinositol 4-kinase type 2 beta 2 2
MIRT636711 ARSK arylsulfatase family member K 2 4
MIRT636762 C17orf75 chromosome 17 open reading frame 75 2 2
MIRT636840 MBOAT1 membrane bound O-acyltransferase domain containing 1 2 4
MIRT636938 CCDC122 coiled-coil domain containing 122 2 2
MIRT637028 SPTLC3 serine palmitoyltransferase long chain base subunit 3 2 2
MIRT637079 SELPLG selectin P ligand 2 2
MIRT637426 ZC3H12B zinc finger CCCH-type containing 12B 2 2
MIRT637959 NECAB3 N-terminal EF-hand calcium binding protein 3 2 2
MIRT638184 TLN1 talin 1 2 2
MIRT638344 RBMS2 RNA binding motif single stranded interacting protein 2 2 4
MIRT638571 IER5 immediate early response 5 2 2
MIRT638607 HINT1 histidine triad nucleotide binding protein 1 2 2
MIRT638657 GGCX gamma-glutamyl carboxylase 2 2
MIRT638768 EPB41 erythrocyte membrane protein band 4.1 2 2
MIRT638773 EMC7 ER membrane protein complex subunit 7 2 2
MIRT639018 AAK1 AP2 associated kinase 1 2 2
MIRT639091 ALDOA aldolase, fructose-bisphosphate A 2 2
MIRT639575 AVL9 AVL9 cell migration associated 2 2
MIRT639828 ZKSCAN1 zinc finger with KRAB and SCAN domains 1 2 2
MIRT640336 AP5B1 adaptor related protein complex 5 beta 1 subunit 2 2
MIRT640568 CPE carboxypeptidase E 2 2
MIRT641826 TSC22D2 TSC22 domain family member 2 2 2
MIRT642059 KCNK2 potassium two pore domain channel subfamily K member 2 2 2
MIRT643080 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643278 ZNF566 zinc finger protein 566 2 2
MIRT643443 LAX1 lymphocyte transmembrane adaptor 1 2 4
MIRT643866 COX20 COX20, cytochrome c oxidase assembly factor 2 2
MIRT645034 ATAD3C ATPase family, AAA domain containing 3C 2 2
MIRT645089 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT645155 NOL9 nucleolar protein 9 2 2
MIRT645990 ACP6 acid phosphatase 6, lysophosphatidic 2 2
MIRT646444 XRCC2 X-ray repair cross complementing 2 2 2
MIRT646505 FAM217B family with sequence similarity 217 member B 2 2
MIRT647713 NFX1 nuclear transcription factor, X-box binding 1 2 2
MIRT647978 PDE12 phosphodiesterase 12 2 2
MIRT648112 PTDSS2 phosphatidylserine synthase 2 2 2
MIRT649180 DNPEP aspartyl aminopeptidase 2 2
MIRT649311 IGSF6 immunoglobulin superfamily member 6 2 2
MIRT649384 TMEM19 transmembrane protein 19 2 2
MIRT649625 EHD2 EH domain containing 2 2 2
MIRT649716 TWSG1 twisted gastrulation BMP signaling modulator 1 2 2
MIRT649845 IRAK3 interleukin 1 receptor associated kinase 3 2 2
MIRT650369 MOCS3 molybdenum cofactor synthesis 3 2 2
MIRT651349 ZBTB8B zinc finger and BTB domain containing 8B 2 4
MIRT651388 ZBTB16 zinc finger and BTB domain containing 16 2 2
MIRT651610 WDFY2 WD repeat and FYVE domain containing 2 2 2
MIRT652860 TAB1 TGF-beta activated kinase 1 (MAP3K7) binding protein 1 2 2
MIRT653271 SNAP29 synaptosome associated protein 29 2 2
MIRT653829 SHROOM3 shroom family member 3 2 2
MIRT654023 SAMD5 sterile alpha motif domain containing 5 2 2
MIRT654435 RASGRP3 RAS guanyl releasing protein 3 2 2
MIRT654489 RAD54L2 RAD54 like 2 2 2
MIRT654642 PTAFR platelet activating factor receptor 2 2
MIRT654712 PRR13 proline rich 13 2 2
MIRT655096 PHLDA3 pleckstrin homology like domain family A member 3 2 2
MIRT655326 PCYOX1 prenylcysteine oxidase 1 2 2
MIRT655669 NUP43 nucleoporin 43 2 2
MIRT655933 NDUFA4P1 NDUFA4, mitochondrial complex associated pseudogene 1 2 2
MIRT657725 GPC4 glypican 4 2 2
MIRT658423 FAM177A1 family with sequence similarity 177 member A1 2 4
MIRT658703 EMC2 ER membrane protein complex subunit 2 2 2
MIRT658849 DUSP19 dual specificity phosphatase 19 2 2
MIRT658887 DRAXIN dorsal inhibitory axon guidance protein 2 2
MIRT659312 CSTF1 cleavage stimulation factor subunit 1 2 2
MIRT660234 BMP7 bone morphogenetic protein 7 2 2
MIRT661035 HIATL2 major facilitator superfamily domain containing 14C 2 2
MIRT661045 RABAC1 Rab acceptor 1 2 2
MIRT661236 ARL17B ADP ribosylation factor like GTPase 17B 2 2
MIRT661400 OLR1 oxidized low density lipoprotein receptor 1 2 2
MIRT661501 EIF1AD eukaryotic translation initiation factor 1A domain containing 2 2
MIRT661659 ZNF623 zinc finger protein 623 2 2
MIRT661872 PDLIM5 PDZ and LIM domain 5 2 2
MIRT662783 CNNM3 cyclin and CBS domain divalent metal cation transport mediator 3 2 2
MIRT663096 THEM4 thioesterase superfamily member 4 2 2
MIRT663668 TMEM216 transmembrane protein 216 2 2
MIRT663971 ZNF786 zinc finger protein 786 2 2
MIRT664170 APOBEC3F apolipoprotein B mRNA editing enzyme catalytic subunit 3F 2 2
MIRT664664 HEXA hexosaminidase subunit alpha 2 2
MIRT664692 DBF4 DBF4 zinc finger 2 2
MIRT664759 MESDC2 mesoderm development LRP chaperone 2 2
MIRT664772 LIAS lipoic acid synthetase 2 2
MIRT664862 SLC19A3 solute carrier family 19 member 3 2 2
MIRT665091 CRIPT CXXC repeat containing interactor of PDZ3 domain 2 2
MIRT665197 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 2 2
MIRT665344 YES1 YES proto-oncogene 1, Src family tyrosine kinase 2 2
MIRT665357 XKR4 XK related 4 2 2
MIRT665426 WDR55 WD repeat domain 55 2 2
MIRT665452 WDR17 WD repeat domain 17 2 2
MIRT665774 TMEM236 transmembrane protein 236 2 2
MIRT665902 TBCCD1 TBCC domain containing 1 2 2
MIRT666256 SLC33A1 solute carrier family 33 member 1 2 2
MIRT666709 RBL1 RB transcriptional corepressor like 1 2 2
MIRT667207 NIPAL1 NIPA like domain containing 1 2 2
MIRT667223 NFE2L1 nuclear factor, erythroid 2 like 1 2 2
MIRT667333 MTHFD1L methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1 like 2 2
MIRT667586 LONRF2 LON peptidase N-terminal domain and ring finger 2 2 2
MIRT667729 KIAA1456 KIAA1456 2 2
MIRT667907 ING1 inhibitor of growth family member 1 2 2
MIRT667960 HEYL hes related family bHLH transcription factor with YRPW motif-like 2 2
MIRT668074 GMPS guanine monophosphate synthase 2 2
MIRT668086 GMEB1 glucocorticoid modulatory element binding protein 1 2 2
MIRT668476 EXOSC2 exosome component 2 2 2
MIRT668507 ESYT2 extended synaptotagmin 2 2 2
MIRT668539 ERGIC1 endoplasmic reticulum-golgi intermediate compartment 1 2 2
MIRT668639 DYNLL2 dynein light chain LC8-type 2 2 2
MIRT669319 C12orf49 chromosome 12 open reading frame 49 2 2
MIRT669521 APOOL apolipoprotein O like 2 2
MIRT669875 RAET1E retinoic acid early transcript 1E 2 2
MIRT669902 KIAA0754 KIAA0754 2 4
MIRT669986 SSR3 signal sequence receptor subunit 3 2 2
MIRT670217 BAZ2B bromodomain adjacent to zinc finger domain 2B 2 2
MIRT670223 WIZ widely interspaced zinc finger motifs 2 2
MIRT670255 ZKSCAN3 zinc finger with KRAB and SCAN domains 3 2 2
MIRT670306 TAF8 TATA-box binding protein associated factor 8 2 2
MIRT670318 CEP57L1 centrosomal protein 57 like 1 2 2
MIRT670394 KCNK5 potassium two pore domain channel subfamily K member 5 2 2
MIRT670428 ELP2 elongator acetyltransferase complex subunit 2 2 2
MIRT670437 REPS2 RALBP1 associated Eps domain containing 2 2 2
MIRT670442 SYNRG synergin gamma 2 2
MIRT670469 TMEM105 transmembrane protein 105 2 2
MIRT670504 LYRM4 LYR motif containing 4 2 2
MIRT670512 ZSCAN22 zinc finger and SCAN domain containing 22 2 2
MIRT670528 SLC9A7 solute carrier family 9 member A7 2 2
MIRT670554 SHISA2 shisa family member 2 2 2
MIRT670638 BVES blood vessel epicardial substance 2 2
MIRT670656 STX4 syntaxin 4 2 2
MIRT670685 SUGT1 SGT1 homolog, MIS12 kinetochore complex assembly cochaperone 2 4
MIRT670703 SLC16A13 solute carrier family 16 member 13 2 2
MIRT670744 HOOK3 hook microtubule tethering protein 3 2 2
MIRT670798 UHRF1BP1L UHRF1 binding protein 1 like 2 2
MIRT670812 NICN1 nicolin 1 2 2
MIRT670843 SFT2D2 SFT2 domain containing 2 2 2
MIRT670976 MED17 mediator complex subunit 17 2 2
MIRT670996 PTGIS prostaglandin I2 synthase 2 2
MIRT671013 RBM22 RNA binding motif protein 22 2 2
MIRT671034 PCDHB2 protocadherin beta 2 2 2
MIRT671040 SS18 SS18, nBAF chromatin remodeling complex subunit 2 2
MIRT671092 DNAJC3 DnaJ heat shock protein family (Hsp40) member C3 2 2
MIRT671168 MAPKAPK5 mitogen-activated protein kinase-activated protein kinase 5 2 2
MIRT671222 CLSTN1 calsyntenin 1 2 2
MIRT671247 TMEM41B transmembrane protein 41B 2 2
MIRT671251 ATP6V0E1 ATPase H+ transporting V0 subunit e1 2 2
MIRT671287 RPL37A ribosomal protein L37a 2 2
MIRT671447 DNA2 DNA replication helicase/nuclease 2 2 4
MIRT671467 AGPAT6 glycerol-3-phosphate acyltransferase 4 2 2
MIRT671574 FOSL2 FOS like 2, AP-1 transcription factor subunit 2 2
MIRT671595 CBY3 chibby family member 3 2 2
MIRT671598 RILPL1 Rab interacting lysosomal protein like 1 2 2
MIRT671609 C6orf25 megakaryocyte and platelet inhibitory receptor G6b 2 2
MIRT671637 FBXO36 F-box protein 36 2 2
MIRT671721 PMPCA peptidase, mitochondrial processing alpha subunit 2 2
MIRT671766 PLA2G4A phospholipase A2 group IVA 2 2
MIRT671821 TRPM6 transient receptor potential cation channel subfamily M member 6 2 2
MIRT671831 STIL STIL, centriolar assembly protein 2 2
MIRT671853 APOL2 apolipoprotein L2 2 2
MIRT671888 MOB3A MOB kinase activator 3A 2 2
MIRT671912 PCDHB11 protocadherin beta 11 2 2
MIRT671922 PLEKHS1 pleckstrin homology domain containing S1 2 4
MIRT672028 ZNF70 zinc finger protein 70 2 2
MIRT672085 AEN apoptosis enhancing nuclease 2 2
MIRT672121 ATP6V0A2 ATPase H+ transporting V0 subunit a2 2 2
MIRT672148 PLEKHH1 pleckstrin homology, MyTH4 and FERM domain containing H1 2 2
MIRT672168 FANCF Fanconi anemia complementation group F 2 2
MIRT672205 ZNF490 zinc finger protein 490 2 2
MIRT672214 DCAF7 DDB1 and CUL4 associated factor 7 2 2
MIRT672249 SIK2 salt inducible kinase 2 2 2
MIRT672357 VPS8 VPS8, CORVET complex subunit 2 2
MIRT672365 PDE11A phosphodiesterase 11A 2 2
MIRT672455 POU2F3 POU class 2 homeobox 3 2 2
MIRT672519 CRX cone-rod homeobox 2 2
MIRT672544 BRMS1L breast cancer metastasis-suppressor 1 like 2 2
MIRT672617 IGF2R insulin like growth factor 2 receptor 2 2
MIRT672722 S1PR2 sphingosine-1-phosphate receptor 2 2 2
MIRT672724 KIF18B kinesin family member 18B 2 2
MIRT672826 GJD3 gap junction protein delta 3 2 2
MIRT672879 ZSCAN29 zinc finger and SCAN domain containing 29 2 2
MIRT672944 AKAP5 A-kinase anchoring protein 5 2 2
MIRT673004 TAF1 TATA-box binding protein associated factor 1 2 2
MIRT673027 RBBP4 RB binding protein 4, chromatin remodeling factor 2 2
MIRT673038 SGPL1 sphingosine-1-phosphate lyase 1 2 2
MIRT673070 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT673383 ZNF124 zinc finger protein 124 2 2
MIRT673414 RBBP9 RB binding protein 9, serine hydrolase 2 2
MIRT673420 RNF24 ring finger protein 24 2 2
MIRT673425 APAF1 apoptotic peptidase activating factor 1 2 2
MIRT673481 GTF3C6 general transcription factor IIIC subunit 6 2 2
MIRT673622 VCPIP1 valosin containing protein interacting protein 1 2 2
MIRT673629 PPM1D protein phosphatase, Mg2+/Mn2+ dependent 1D 2 2
MIRT673675 NUDCD2 NudC domain containing 2 2 2
MIRT673686 NDUFA7 NADH:ubiquinone oxidoreductase subunit A7 2 2
MIRT673709 SLU7 SLU7 homolog, splicing factor 2 2
MIRT673735 TCF23 transcription factor 23 2 2
MIRT673786 CDKAL1 CDK5 regulatory subunit associated protein 1 like 1 2 2
MIRT673797 MALL mal, T-cell differentiation protein like 2 2
MIRT673816 DARS aspartyl-tRNA synthetase 2 2
MIRT673969 INMT indolethylamine N-methyltransferase 2 2
MIRT674025 ANKRD9 ankyrin repeat domain 9 2 2
MIRT674257 ZNF284 zinc finger protein 284 2 2
MIRT674319 POLR1B RNA polymerase I subunit B 2 2
MIRT674456 ULK2 unc-51 like autophagy activating kinase 2 2 2
MIRT674549 GREB1 growth regulation by estrogen in breast cancer 1 2 2
MIRT674571 KIF3A kinesin family member 3A 2 2
MIRT674621 TRUB2 TruB pseudouridine synthase family member 2 2 2
MIRT674624 HECTD3 HECT domain E3 ubiquitin protein ligase 3 2 2
MIRT674837 GLRX2 glutaredoxin 2 2 2
MIRT674859 GINM1 glycoprotein integral membrane 1 2 2
MIRT674947 PEX2 peroxisomal biogenesis factor 2 2 2
MIRT675004 PPTC7 PTC7 protein phosphatase homolog 2 2
MIRT675028 SNX1 sorting nexin 1 2 2
MIRT675151 NDRG1 N-myc downstream regulated 1 2 2
MIRT675209 TTC9C tetratricopeptide repeat domain 9C 2 2
MIRT675427 CLEC7A C-type lectin domain containing 7A 2 2
MIRT675450 SRP19 signal recognition particle 19 2 2
MIRT675483 SLC1A2 solute carrier family 1 member 2 2 4
MIRT675508 HSD17B12 hydroxysteroid 17-beta dehydrogenase 12 2 2
MIRT675656 COL8A1 collagen type VIII alpha 1 chain 2 2
MIRT675709 EMC3 ER membrane protein complex subunit 3 2 2
MIRT675759 RDH10 retinol dehydrogenase 10 2 2
MIRT675872 ATP1B4 ATPase Na+/K+ transporting family member beta 4 2 2
MIRT675920 CYP51A1 cytochrome P450 family 51 subfamily A member 1 2 2
MIRT675934 RAP2B RAP2B, member of RAS oncogene family 2 2
MIRT675945 NAV1 neuron navigator 1 2 2
MIRT676053 ATL3 atlastin GTPase 3 2 2
MIRT676277 ZNF260 zinc finger protein 260 2 2
MIRT676414 MRO maestro 2 2
MIRT676635 CDH7 cadherin 7 2 2
MIRT676822 TNFSF15 TNF superfamily member 15 2 2
MIRT676866 ZNF451 zinc finger protein 451 2 2
MIRT676985 ZNF708 zinc finger protein 708 2 2
MIRT677031 ZNF107 zinc finger protein 107 2 2
MIRT677310 CPSF2 cleavage and polyadenylation specific factor 2 2 2
MIRT677401 PCNP PEST proteolytic signal containing nuclear protein 2 2
MIRT677430 PDF peptide deformylase, mitochondrial 2 2
MIRT677587 GATA6 GATA binding protein 6 2 2
MIRT677977 ITGB3 integrin subunit beta 3 2 2
MIRT678135 KLLN killin, p53-regulated DNA replication inhibitor 2 2
MIRT678390 TMEM239 transmembrane protein 239 2 2
MIRT678398 MYPN myopalladin 2 2
MIRT678593 ANAPC16 anaphase promoting complex subunit 16 2 2
MIRT678675 SCUBE3 signal peptide, CUB domain and EGF like domain containing 3 2 2
MIRT679058 RMDN1 regulator of microtubule dynamics 1 2 2
MIRT679472 RHOF ras homolog family member F, filopodia associated 2 2
MIRT679591 HUS1 HUS1 checkpoint clamp component 2 2
MIRT680041 OSBPL2 oxysterol binding protein like 2 2 2
MIRT680163 ZDHHC20 zinc finger DHHC-type containing 20 2 2
MIRT680290 AKIP1 A-kinase interacting protein 1 2 2
MIRT680342 ZNF281 zinc finger protein 281 2 2
MIRT681090 GSTO2 glutathione S-transferase omega 2 2 2
MIRT686602 TMEM70 transmembrane protein 70 2 2
MIRT687128 QPCTL glutaminyl-peptide cyclotransferase like 2 2
MIRT687298 OTUD7B OTU deubiquitinase 7B 2 2
MIRT689577 NUDT7 nudix hydrolase 7 2 2
MIRT689820 HIST1H2BJ histone cluster 1 H2B family member j 2 2
MIRT695082 ZNF17 zinc finger protein 17 2 2
MIRT696483 COX6B1 cytochrome c oxidase subunit 6B1 2 2
MIRT697374 ZNF286B zinc finger protein 286B 2 2
MIRT698752 STK4 serine/threonine kinase 4 2 4
MIRT699564 SIT1 signaling threshold regulating transmembrane adaptor 1 2 2
MIRT700607 PRKCA protein kinase C alpha 2 2
MIRT703925 EPG5 ectopic P-granules autophagy protein 5 homolog 2 2
MIRT704352 DBR1 debranching RNA lariats 1 2 2
MIRT705787 ALDH6A1 aldehyde dehydrogenase 6 family member A1 2 2
MIRT705927 ADAM17 ADAM metallopeptidase domain 17 2 2
MIRT710028 POLL DNA polymerase lambda 2 2
MIRT710253 LRRC10 leucine rich repeat containing 10 2 2
MIRT711298 ACOX1 acyl-CoA oxidase 1 2 2
MIRT711504 ESCO1 establishment of sister chromatid cohesion N-acetyltransferase 1 2 2
MIRT711640 LIPG lipase G, endothelial type 2 2
MIRT716157 RBM48 RNA binding motif protein 48 2 2
MIRT719195 CASP10 caspase 10 2 2
MIRT720517 KIAA0101 PCNA clamp associated factor 2 2
MIRT722377 KAZALD1 Kazal type serine peptidase inhibitor domain 1 2 2
MIRT723133 YPEL1 yippee like 1 2 2
MIRT725288 NT5C1A 5'-nucleotidase, cytosolic IA 2 2
MIRT725568 CPT1A carnitine palmitoyltransferase 1A 2 2
MIRT731610 NCAN neurocan 3 1
MIRT731966 COPS5 COP9 signalosome subunit 5 1 1
MIRT732350 PRKCH protein kinase C eta 3 1
MIRT732608 ANGPT2 angiopoietin 2 1 0
MIRT734983 CTSD cathepsin D 2 0
MIRT735161 MRTFA megakaryoblastic leukemia (translocation) 1 2 0
MIRT735403 INS insulin 1 0
MIRT735405 TG thyroglobulin 1 0
MIRT735565 PIK3R3 phosphoinositide-3-kinase regulatory subunit 3 3 0
MIRT736027 HPCA hippocalcin 3 0
MIRT736577 LAMB3 laminin subunit beta 3 3 0
MIRT736787 CDX2 caudal type homeobox 2 1 0
MIRT755891 BPNT1 3'(2'), 5'-bisphosphate nucleotidase 1 3 1
MIRT756090 GAD1 glutamate decarboxylase 1 2 1
MIRT756091 CYTOR cytoskeleton regulator RNA 1 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-24 Cyclosporin A(CsA) approved 5284373 Quantitative real-time PCR human trophoblast (HT) cells 24453045 2014 up-regulated
miR-24 Curcumin NULL 969516 Microarray BxPC-3 human pancreatic carcinoma cell line 18347134 2008 up-regulated
miR-24 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray Pancreatic Cancer PANC-1 cells 19407485 2009 up-regulated
miR-24 5-aza-2'-deoxycytidine (5-Aza-CdR) + trichostatin A(TSA) NULL NULL Microarray Pancreatic Cancer PANC-1 cells 19407485 2009 up-regulated
miR-24 Trichostatin A (TSA) NULL 444732 Microarray Pancreatic Cancer PANC-1 cells 19407485 2009 up-regulated
miR-24 5-Fluorouracil approved 3385 Microarray HCT-8 colon cancer cell line 19956872 2010 down-regulated
miR-24 Bio-Oss NULL NULL Microarray osteoblast-like cell line (MG63) 20224834 2010 down-regulated
miR-24 Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-24 5-Fluorouracil approved 3385 Microarray NCI-60 cell-line 21159603 2011 down-regulated
miR-24 Floxuridine (FdU) approved 5790 Microarray NCI-60 cell-line 21159603 2011 down-regulated
miR-24 Irinotecan approved 60838 Microarray NCI-60 cell-line 21159603 2011 down-regulated
miR-24 Topotecan approved 60700 Microarray NCI-60 cell-line 21159603 2011 down-regulated
miR-24 Arsenic trioxide approved 14888 Microarray HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-24 Arsenic trioxide approved 14888 Quantitative real-time PCR HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-24 5-Fluorouracil approved 3385 Microarray MCF-7 breast cancer cells 21506117 2011 down-regulated
miR-24 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-24 Olea europaea leaf extract NULL NULL Quantitative real-time PCR glioblastoma cells. 22722712 2012 down-regulated
miR-24 Temozolomide approved 5394 Quantitative real-time PCR glioblastoma cells. 22722712 2012 down-regulated
miR-24 5-aminoimidazole-4-carboxamide-1-β-d-ribofuranoside (AICAR) NULL 16078949 Microarray hepatocytes 23107762 2013 down-regulated
miR-24 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse liver 19270793 2009 up-regulated
miR-24 Lithium (Li) approved 3028194 Microarray rat hippocampus 18704095 2009 down-regulated
miR-24 Lithium (Li) approved 3028194 Quantitative real-time PCR rat hippocampus 18704095 2009 down-regulated
miR-24 Valproate approved 3121 Microarray rat hippocampus 18704095 2009 down-regulated
miR-24 Valproate approved 3121 Quantitative real-time PCR rat hippocampus 18704095 2009 down-regulated
miR-24 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 down-regulated
miR-24 Comfrey NULL 6440495 Microarray rat liver 21370286 2011 up-regulated
miR-24 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 up-regulated
miR-24 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 up-regulated
miR-24 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) NULL 15625 Microarray embryos 22921993 2012 up-regulated
miR-24 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) NULL 15625 Microarray embryos 22921993 2012 up-regulated
miR-24 Morphine approved 5288826 Microarray human monocyte-derived macrophages (h-mdms) infection with HIV-1 20564181 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-24-3p (11E)-11-(3-aminopropylidene)-15,16-dimethoxy-20-methyl-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaen-19-one 9978660 NSC724562 resistant
hsa-miR-24-3p (11E)-11-(6-aminohexylidene)-15,16-dimethoxy-20-methyl-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaen-19-one 45027835 NSC727049 resistant
hsa-miR-24-3p (2r)-2-[[(2s)-2-[[2-[5-acetamido-3-hydroxy-2-(hydroxymethyl)-6-phenylmethoxyoxan-4-yl]oxyacetyl]amino]propanoyl]amino]-n'-[3-[(1-nitroacridin-9-yl)amino]propyl]pentanediamide 393689 NSC696078 resistant
hsa-miR-24-3p (3,4,4-trichloro-2-nitro-1-phenylsulfanylbuta-1,3-dienyl)sulfanylbenzene 379911 NSC665103 resistant
hsa-miR-24-3p (4Z)-4-[[1-(3-chlorophenyl)-3-(4-methoxyphenyl)pyrazol-4-yl]methylidene]-5-imino-1-phenylpyrazol-3-amine 135276800 NSC763587 resistant
hsa-miR-24-3p (6aS)-3-[4-[6-(4-fluorophenyl)-2-methylpyrimidin-4-yl]oxybutoxy]-2-methoxy-6a,7,8,9-tetrahydropyrrolo[2,1-c][1,4]benzodiazepin-11-one 405944 NSC723732 resistant
hsa-miR-24-3p (e)-1,3-diphenyl-2-(piperidin-1-ylmethyl)prop-2-en-1-one 6147837 NSC109154 resistant
hsa-miR-24-3p (e)-3-chloro-2-(4-fluorophenyl)-3-(4-methoxyphenyl)prop-2-enal 5387394 NSC623173 resistant
hsa-miR-24-3p (E)-but-2-enedioic acid;1-[[3-(diethylamino)-2-hydroxypropyl]amino]-4-(oxiran-2-ylmethylamino)anthracene-9,10-dione 5388837 NSC639366 resistant
hsa-miR-24-3p [(3aR,8S)-8-acetyloxy-6-methyl-3,9-dimethylidene-2-oxo-4,6a,7,8,9a,9b-hexahydro-3aH-azuleno[4,5-b]furan-4-yl] 3-acetyloxy-2-hydroxy-2-methylbutanoate 380982 NSC666858 resistant
hsa-miR-24-3p [(3s,8r,10r,13s,17e)-10,13-dimethyl-17-(phenylcarbamoyloxyimino)-1,2,3,4,7,8,9,11,12,14,15,16-dodecahydrocyclopenta[a]phenanthren-3-yl] n-phenylcarbamate 9569960 NSC629229 resistant
hsa-miR-24-3p [(9e,21z)-28-(1,3-dithiolan-2-yl)-2,29,31-trihydroxy-11-methoxy-3,7,12,14,17,17,20,24,32-nonamethyl-6,25-dioxo-8,16,18,33-tetraoxa-26-azapentacyclo[25.3.1.14,7.115,19.05,30]tritriaconta-1(30),2,4,9,21 54610764 NSC244404 resistant
hsa-miR-24-3p [1-[(e)-(5-nitrofuran-2-yl)methylideneamino]benzimidazol-2-yl]methanol 9572565 NSC720255 resistant
hsa-miR-24-3p 15-[2-(dimethylamino)ethyl]-10-[2-(dimethylamino)ethylamino]-5-methoxy-1,15-diazatetracyclo[7.7.1.02,7.013,17]heptadeca-2(7),3,5,9,11,13(17)-hexaene-8,14,16-trione;hydrochloride 392061 NSC691851 resistant
hsa-miR-24-3p 2-(2,4-dichlorobenzoyl)-7-hydroxy-chromen-4-one 5465338 NSC646381 resistant
hsa-miR-24-3p 2-(2,4-dichlorobenzyl)-3,5,6-trimethyl-2h-indazole-7-carbonitrile 367590 NSC637422 sensitive
hsa-miR-24-3p 2-[2-hydroxyethyl-[2-[(7-methoxy-1-nitroacridin-9-yl)amino]ethyl]amino]ethanol 384247 NSC673793 resistant
hsa-miR-24-3p 2-amino-1-[1-[(3-ethyl-9,10-dimethoxy-2,3,4,6,7,11b-hexahydro-1H-benzo[a]quinolizin-2-yl)methyl]-6,7-dimethoxy-3,4-dihydro-1H-isoquinolin-2-yl]-3-phenylpropan-1-one 419284 NSC113237 resistant
hsa-miR-24-3p 2-imidazo[2,1-b][1,3]thiazol-6-ylbenzene-1,4-diol 10775929 NSC732205 resistant
hsa-miR-24-3p 2-methyl-1-(2,3,4,5,6-pentafluorobenzoyl)-1h-benzimidazole 383504 NSC671889 resistant
hsa-miR-24-3p 2,1,3-benzoselanadiazole, nitro-6-(trifluoromethyl)- 362897 NSC627371 resistant
hsa-miR-24-3p 2,4,6-trichloro-5-methylpyrimidine NSC30722 resistant
hsa-miR-24-3p 2,6-dimethoxy-4-[7-methyl-6-(2-phenylhydrazinyl)-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-8-yl]phenol NSC671173 resistant
hsa-miR-24-3p 2,9-dimethoxy-6-(2-piperidin-1-ylethoxy)indeno[1,2-c]quinolin-11-one 54673454 NSC754240 resistant
hsa-miR-24-3p 20-(3-iodopropyl)-15,16-dimethoxy-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaene-11,19-dione 45027806 NSC722900 resistant
hsa-miR-24-3p 20-[3-(1,4-diazepan-1-yl)propyl]-15,16-dimethoxy-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaene-11,19-dione;hydrochloride 45027855 NSC728319 resistant
hsa-miR-24-3p 3-(hydroxymethyl)-5-(6-methylsulfanylpurin-9-yl)-1,4-dioxane-2,6-diol 269951 NSC111702 resistant
hsa-miR-24-3p 3-[(1-benzyl-4-chloro-2,5-dioxopyrrol-3-yl)amino]-N-[2-chloro-5-(trifluoromethyl)phenyl]benzamide 1574661 NSC732851 resistant
hsa-miR-24-3p 3-deazauridine 277822 NSC126849 resistant
hsa-miR-24-3p 3-phenyl-6-(trifluoromethyl)-n-(3,4,5-trimethoxyphenyl)-2-quinoxalinamine 364818 NSC631578 resistant
hsa-miR-24-3p 3-piperidino-2-phenylpropiophenone 89341 NSC33568 resistant
hsa-miR-24-3p 4-(2-pyridinyl)-5h-1,2,3-dithiazole-5-thione 25181424 NSC741898 resistant
hsa-miR-24-3p 4-[(1-benzyl-4-chloro-2,5-dioxopyrrol-3-yl)amino]-N-[3-(trifluoromethyl)phenyl]benzamide 1194958 NSC732841 resistant
hsa-miR-24-3p 4-[(e)-(5-nitrofuran-2-yl)methylideneamino]-3-phenyl-1h-1,2,4-triazol-5-one 9556349 NSC698058 resistant
hsa-miR-24-3p 4-[4-[bis(2-chloroethyl)amino]phenyl]imino-2,6-dimethylcyclohexa-2,5-dien-1-one 116416 NSC240529 resistant
hsa-miR-24-3p 4-chloro-5-phenoxy-3h-1,2-dithiole-3-thione 16766044 NSC729184 resistant
hsa-miR-24-3p 4,11-bis[2-(dimethylamino)ethylamino]-1H-naphtho[2,3-f]indole-5,10-dione 406501 NSC724628 resistant
hsa-miR-24-3p 4,11-bis[2-(methylamino)ethylamino]-1H-naphtho[2,3-f]indole-5,10-dione 16007259 NSC726436 resistant
hsa-miR-24-3p 5-(4-chlorophenyl)-3-[3-[(E)-3-(4-hydroxy-3-methoxyphenyl)prop-2-enoyl]phenyl]-1H-imidazol-2-one 46919707 NSC748559 resistant
hsa-miR-24-3p 5,10-dihydroxy-3-[(4-methylpiperazin-1-yl)methyl]-1H-naphtho[2,3-f]indole-4,11-dione;hydrochloride 135585400 NSC726441 resistant
hsa-miR-24-3p 5,7-dimethoxy-2-[(2-methyl-1,3-dioxan-2-yl)methyl]naphthalene-1,4-dione 372272 NSC647328 resistant
hsa-miR-24-3p 6-[3-(dimethylamino)propyl]-3-nitroindeno[1,2-c]isoquinoline-5,11-dione 44409874 NSC734872 resistant
hsa-miR-24-3p 6-[4-(1-cyclohexenyl)-1,3-butadiyn-1-yl]-2(2h)-pyranone 10263039 NSC726863 resistant
hsa-miR-24-3p 6-chloro-1,2,3-benzodithiazol-1-ium;chloride 359816 NSC621376 resistant
hsa-miR-24-3p 6-ethoxy-2-(hydroxymethyl)-2h-pyran-3(6h)-one 398342 NSC708062 resistant
hsa-miR-24-3p 8-methylbenzimidazolo[2,1-b][1,3,5]benzothiadiazepin-12-amine;hydrochloride 383197 NSC671316 resistant
hsa-miR-24-3p 8(5h)-quinolinone, 7-chloro-5-[[4-(diethylamino)-2-methylphenyl]imino]- 363174 NSC627778 resistant
hsa-miR-24-3p 9,10-anthracenedione, 1-[(oxiranylmethyl)amino]- 384119 NSC673348 resistant
hsa-miR-24-3p Acetamide, n-(2-mercaptoethyl)-, benzoate (6ci, 7ci) 281604 NSC134459 resistant
hsa-miR-24-3p Adenosine, 2-bromo-2'-deoxy- 334838 NSC341936 resistant
hsa-miR-24-3p Antineoplastic-690271 391308 NSC690271 resistant
hsa-miR-24-3p Arnebin 32465 NSC140377 resistant
hsa-miR-24-3p Arypurine derivatives 16220246 NSC733891 resistant
hsa-miR-24-3p B676297k277 3',4'-deoxypsorospermin 3',4'-chlorohydrin 354175 NSC605099 resistant
hsa-miR-24-3p Benzyl N,N-dimethyl-N'-(C-methylsulfanyl-N-phenylcarbonimidoyl)carbamimidothioate;hydroiodide 9569856 NSC622579 resistant
hsa-miR-24-3p Chinon 95715 NSC30706 resistant
hsa-miR-24-3p Cps49 9905583 NSC726796 resistant
hsa-miR-24-3p Crassin, acetate 5355441 NSC36437 resistant
hsa-miR-24-3p Diethyl 2-[[4-[(3-ethoxycarbonylquinoxalin-2-yl)amino]benzoyl]amino]pentanedioate 382848 NSC670678 sensitive
hsa-miR-24-3p Ethyl 4-(2-diethylaminoethylsulfanyl)-6-oxo-1,3-diphenyl-2-thioxo-pyrimidine-5-carboxylate 396732 NSC703442 resistant
hsa-miR-24-3p Ethyl, methoxy, prodigisine 135829283 NSC742418 resistant
hsa-miR-24-3p Fostriecin 6913994 NSC339638 resistant
hsa-miR-24-3p Heliangolide 5384466 NSC335753 resistant
hsa-miR-24-3p Iflab1_001965 1497314 NSC740963 resistant
hsa-miR-24-3p Jolkinolide b 161954 NSC700087 resistant
hsa-miR-24-3p Ls-133613 365597 NSC633398 resistant
hsa-miR-24-3p Methyl 2-[5,6,12,13-tetracyano-9-(2-methoxy-2-oxoethyl)-2,4,7,9,11,14-hexazatricyclo[8.4.0.03,8]tetradeca-1(14),3,5,7,10,12-hexaen-2-yl]acetate 396370 NSC702313 resistant
hsa-miR-24-3p Methyl ester prodigiosene 136040158 NSC753661 resistant
hsa-miR-24-3p N'-(1-adamantylmethyl)-2-chloroethanimidamide;hydrochloride 12470660 NSC187546 resistant
hsa-miR-24-3p N'-[6-(4-chlorophenyl)-5-formylimidazo[2,1-b][1,3,4]thiadiazol-2-yl]sulfonyl-n,n-dimethylmethanimidamide 9556374 NSC699667 resistant
hsa-miR-24-3p N'-benzylidene-4-((1-methyl-2,5-dioxo-4-imidazolidinylidene)methyl)benzenesulfonohydrazide 9571572 NSC683747 resistant
hsa-miR-24-3p N',N'-diethyl-N-(7-nitro-1,4-dioxido-1,2,4-benzotriazine-1,4-diium-3-yl)ethane-1,2-diamine 135426847 NSC628917 resistant
hsa-miR-24-3p N-(2-amino-phenyl)-4-{1-[4-(2-fluorophenyl)-piperazin-1-ylmethyl]-vinyl}-benzamide 11640567 NSC735406 resistant
hsa-miR-24-3p N-[(e)-(5-bromo-2-hydroxyphenyl)methylideneamino]-3-(4-hydroxyphenyl)propanamide 135545714 NSC142493 resistant
hsa-miR-24-3p N-[3-[4-[4-(3-azidophenothiazin-10-yl)butyl]piperazin-1-yl]-3-oxopropyl]-2-(4-benzoylphenyl)acetamide NSC678156 resistant
hsa-miR-24-3p N-[5-[(e)-3-[8-(chloromethyl)-1-methyl-4-phenylmethoxy-7,8-dihydro-3h-pyrrolo[3,2-e]indol-6-yl]-3-oxoprop-1-enyl]-1-methylpyrrol-3-yl]butanamide 5469857 NSC693563 resistant
hsa-miR-24-3p N-[amino-[(5-nitrothiophen-2-yl)methoxy]phosphoryl]-2-bromo-N-(2-bromoethyl)ethanamine 390534 NSC688021 resistant
hsa-miR-24-3p N-ethyl-5-[2-[2-[5-(ethylamino)-1,3,4-thiadiazol-2-yl]anilino]phenyl]-1,3,4-thiadiazol-2-amine 394756 NSC698459 resistant
hsa-miR-24-3p Niosh/br9826000 359483 NSC620462 resistant
hsa-miR-24-3p Nitrogen mustard 5935 NSC762 resistant
hsa-miR-24-3p NSC372474 NSC372474 resistant
hsa-miR-24-3p NSC683416 NSC683416 resistant
hsa-miR-24-3p Octyl 5-[(z)-[3-methoxy-5-(1h-pyrrol-2-yl)pyrrol-2-ylidene]methyl]-2,4-dimethyl-1h-pyrrole-3-carboxylate;hydrochloride 136040164 NSC753664 resistant
hsa-miR-24-3p Ovatifolin acetate 5358419 NSC251668 resistant
hsa-miR-24-3p Phenol, 4,4'-(5,5'-biisoxazole-3,3'-diyl)bis- 386651 NSC679108 resistant
hsa-miR-24-3p Propan-1-one, 2,3-dichloro-1,3-bis(4-methylphenyl)- 244246 NSC54909 resistant
hsa-miR-24-3p Psorspermin 429905 NSC266491 resistant
hsa-miR-24-3p Pyrazoloacridine 339455 NSC627168 resistant
hsa-miR-24-3p Pyrimidine, 2,4,5-trichloro-6-ethyl- 246015 NSC58573 resistant
hsa-miR-24-3p Pyrimidine, 2,4,5-trichloro-6-isopropyl- 246017 NSC58575 resistant
hsa-miR-24-3p Quinazoline, 4-ethyl-6-methoxy-7-(oxiranylmethoxy)- 333565 NSC335766 resistant
hsa-miR-24-3p Rh1 394347 NSC697726 resistant
hsa-miR-24-3p Stereoisomer of nsc 674067-p 384359 NSC674066 resistant
hsa-miR-24-3p Tetramethyl (1r,5r,6s,9s)-3,5-dihydroxy-7-[4-[(e)-3-phenylprop-2-enoyl]oxyphenyl]bicyclo[3.3.1]non-2-ene-2,4,6,9-tetracarboxylate 54681586 NSC717065 resistant
hsa-miR-24-3p Tetramethyl (1r,5r,6s,9s)-7-[4-[(e)-2,3-bis(4-chlorophenyl)prop-2-enoyl]oxyphenyl]-3,5-dihydroxybicyclo[3.3.1]non-2-ene-2,4,6,9-tetracarboxylate 54681588 NSC717067 resistant
hsa-miR-24-3p Tetraplatin 13920603 NSC363812 resistant
hsa-miR-24-3p Timtec1_002753 404248 NSC720426 sensitive
hsa-miR-24-3p Methotrexate 126941 NSC740 approved sensitive Low Fibrosarcoma cell line (HT1080)
hsa-miR-24-3p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (OHT-R, MCF-7)
hsa-miR-24-3p Docetaxel 148124 NSC628503 approved resistant Low Lung Cancer tissue
hsa-miR-24-3p Docetaxel 148124 NSC628503 approved resistant Low Gastric Cancer tissue
hsa-miR-24-3p Fluorouracil 3385 NSC19893 approved resistant High Colon Cancer cell line (KM12C)
hsa-miR-24-3p Cisplatin 5460033 NSC119875 approved sensitive Low Neuroblastoma tissue and cell line (Kelly, SK-NAS, SHSY-5Y)
hsa-miR-24-3p Etoposide 36462 NSC141540 approved sensitive Low Neuroblastoma tissue and cell line (Kelly, SK-NAS, SHSY-5Y)
hsa-miR-24-3p Cisplatin 5460033 NSC119875 approved sensitive High Bladder Cancer tissue and cell line (UMUC9, UMUC14, SLT4, 253JBV, RT4, CLR2169, HT1197, 575A)
hsa-miR-24-3p Fluorouracil 3385 NSC19893 approved resistant High Colorectal Cancer tissue
hsa-miR-24-3p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer tissue
hsa-miR-24-3p Docetaxel 148124 NSC628503 approved resistant High Prostate Cancer cell line (PC-3)
hsa-miR-24-3p Platinum-based doublet chemotherapy resistant High Lung Adenocarcinoma tissue
hsa-miR-24-3p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-24-3p Cisplatin 5460033 NSC119875 approved resistant Low Tongue Squamous Cell Carcinoma tissue and cell line
hsa-miR-24-3p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-24-3p Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-24-3p Mitoxantrone 4212 NSC279836 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-24-3p Paclitaxel 36314 NSC125973 approved sensitive Low Endometrial Cancer cell line (HEC-1A)
hsa-miR-24-3p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-miR-24-3p Fluorouracil 3385 NSC19893 approved resistant Low Head And Neck Squamous Cell Carcinoma cell line (SCC-15)
hsa-miR-24-3p Oxaliplatin 6857599 NSC266046 approved resistant Low Head And Neck Squamous Cell Carcinoma cell line (SCC-15)
hsa-miR-24-3p Fluorouracil 3385 NSC19893 approved resistant High Esophageal Squamous Cell Carcinoma cell line (EC109, EC9706, TE-1, KYSE-150)
hsa-miR-24-3p Oxaliplatin 6857599 NSC266046 approved resistant High Esophageal Squamous Cell Carcinoma cell line (EC109, EC9706, TE-1, KYSE-150)
hsa-miR-24-3p Paclitaxel 36314 NSC125973 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-24-3p Cisplatin 5460033 NSC119875 approved resistant Low Breast Cancer cell line (T47D, BT-549, MDA-MB-231, MCF-7)
hsa-miR-24-3p Fluorouracil 3385 NSC19893 approved sensitive High Colorectal Cancer cell line (DLD-1)
hsa-miR-24-3p Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-24-3p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-24-3p Gemcitabine 60750 NSC613327 approved sensitive High Cholangiocarcinoma cell line (CCLP-1, MzChA-1)
hsa-miR-24-3p Etoposide 36462 NSC141540 approved sensitive High Small Cell Lung Cancer cell line (H446)
hsa-miR-24-3p Cisplatin 5460033 NSC119875 approved sensitive Low Urothelial Bladder Cancer cell line (T24)
hsa-miR-24-3p Gemcitabine 60750 NSC613327 approved sensitive Low Urothelial Bladder Cancer cell line (T24)
hsa-miR-24-3p Trail resistant Low Hepatocellular Carcinoma cell line (HepG2, Bel-7402)
hsa-miR-24-3p Azacitidine 9444 NSC102816 approved resistant High Acute Myeloid Leukemia tissue
hsa-miR-24-3p Cyclophosphamide + Doxorubicin + Vincristine + Prednisone + Rituximab resistant High Diffuse Large B-Cell Lymphoma cell line (SU-DHL-2)
hsa-miR-24-3p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (PC-3-R)
hsa-miR-24-3p Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (M14) (1uM)
hsa-miR-24-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (M14) (1uM)
hsa-miR-24-3p Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer cell line (SKVO3ip1, HeyA8)
hsa-miR-24-3p Vincristine 5978 approved sensitive High Diffuse Large B-Cell Lymphoma cell line (DB, NU-DHL-1, NU-DUL-1, MC-116, SU-DHL-5, FARAGE, HBL-1, OCI-Ly3, OCI-Ly7, OCI-Ly19, RIVA, SU DHL-8, U2932)
hsa-miR-24-3p Tamoxifen 2733525 NSC180973 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-24-3p Cytarabine 6253 NSC287459 approved sensitive High Acute Myeloid Leukemia cell line (HL-60, MV-4-11, Kasumi-1, THP-1, AML-193, KG-1)
hsa-miR-24-3p Etanercept resistant High Rheumatoid Arthritis tissue
hsa-miR-24-3p Fluorouracil 3385 NSC19893 approved resistant High Colorectal Cancer cell line (HT-29)
hsa-miR-24-3p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (PC-3, DU-145)
hsa-miR-24-3p Cisplatin + Decitabine resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-24-3p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CIS)
hsa-miR-24-3p Methotrexate 126941 NSC740 approved sensitive Low Colon Cancer tissue and cell line (SW620, HT-29)
hsa-miR-24-3p Anthracycline 30323 NSC82151 approved resistant High Breast Cancer tissue
hsa-miR-24-3p Cyclophosphamide 2907 NSC26271 approved resistant High Breast Cancer tissue
hsa-miR-24-3p Fluorouracil 3385 NSC19893 approved resistant High Breast Cancer tissue
hsa-miR-24-3p Methotrexate 126941 NSC740 approved resistant High Breast Cancer tissue
hsa-miR-24-3p Taxol 36314 NSC125973 approved resistant High Breast Cancer tissue
hsa-miR-24-3p Platinum 23939 sensitive High High-Grade Serous Ovarian Cancer tissue
hsa-miR-24-3p Temozolomide 5394 NSC362856 approved sensitive High Glioblastoma cell line (U251)
hsa-miR-24-3p Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-24-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (mitochondrial RNA)
hsa-miR-24-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-24-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM11)
hsa-miR-24-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-24-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-24-3p Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-24-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-miR-24-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-24-3p Exemestane 60198 NSC713563 approved resistant cell line (MCF-7)
hsa-miR-24-3p Testosterone 6013 NSC9700 approved resistant cell line (MCF-7)
hsa-miR-24-3p Testosterone+Anastrozole resistant cell line (MCF-7)
hsa-miR-24-3p Testosterone+Tamoxifen resistant cell line (MCF-7)
hsa-miR-24-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-24-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-miR-24-3p Fluorouracil 3385 NSC19893 approved sensitive cell line (HCT15)
hsa-miR-24-3p 4-Hydroxytamoxifen+Tamoxifen resistant cell line (LY2)
hsa-miR-24-3p Ethanol+Tamoxifen resistant cell line (LY2)
hsa-miR-24-3p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-24-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-24-3p Platinum-based doublet chemotherapy resistant tissue (lung adenocarcinoma)
hsa-miR-24-3p Paclitaxel 36314 NSC125973 approved resistant cell line (PC3PR200)
hsa-miR-24-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-24-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-24-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-24-3p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine sensitive cell line (Bats-72)

Error report submission