miRTarBase - #MIRT006122


—
pre-miRNA Information
pre-miRNA hsa-let-7e   
Genomic Coordinates chr19: 51692786 - 51692864
Synonyms MIRNLET7E, hsa-let-7e, let-7e, MIRLET7E
Description Homo sapiens let-7e stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-let-7e-5p
Sequence 8| UGAGGUAGGAGGUUGUAUAGUU |29
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1189776118 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CCND1   
Synonyms BCL1, D11S287E, PRAD1, U21B31
Description cyclin D1
Transcript NM_053056   
Expression
Putative miRNA Targets on CCND1
3'UTR of CCND1
(miRNA target sites are highlighted)		 
>CCND1|NM_053056|3'UTR
   1 GGGCGCCAGGCAGGCGGGCGCCACCGCCACCCGCAGCGAGGGCGGAGCCGGCCCCAGGTGCTCCCCTGACAGTCCCTCCT
  81 CTCCGGAGCATTTTGATACCAGAAGGGAAAGCTTCATTCTCCTTGTTGTTGGTTGTTTTTTCCTTTGCTCTTTCCCCCTT
 161 CCATCTCTGACTTAAGCAAAAGAAAAAGATTACCCAAAAACTGTCTTTAAAAGAGAGAGAGAGAAAAAAAAAATAGTATT
 241 TGCATAACCCTGAGCGGTGGGGGAGGAGGGTTGTGCTACAGATGATAGAGGATTTTATACCCCAATAATCAACTCGTTTT
 321 TATATTAATGTACTTGTTTCTCTGTTGTAAGAATAGGCATTAACACAAAGGAGGCGTCTCGGGAGAGGATTAGGTTCCAT
 401 CCTTTACGTGTTTAAAAAAAAGCATAAAAACATTTTAAAAACATAGAAAAATTCAGCAAACCATTTTTAAAGTAGAAGAG
 481 GGTTTTAGGTAGAAAAACATATTCTTGTGCTTTTCCTGATAAAGCACAGCTGTAGTGGGGTTCTAGGCATCTCTGTACTT
 561 TGCTTGCTCATATGCATGTAGTCACTTTATAAGTCATTGTATGTTATTATATTCCGTAGGTAGATGTGTAACCTCTTCAC
 641 CTTATTCATGGCTGAAGTCACCTCTTGGTTACAGTAGCGTAGCGTGCCCGTGTGCATGTCCTTTGCGCCTGTGACCACCA
 721 CCCCAACAAACCATCCAGTGACAAACCATCCAGTGGAGGTTTGTCGGGCACCAGCCAGCGTAGCAGGGTCGGGAAAGGCC
 801 ACCTGTCCCACTCCTACGATACGCTACTATAAAGAGAAGACGAAATAGTGACATAATATATTCTATTTTTATACTCTTCC
 881 TATTTTTGTAGTGACCTGTTTATGAGATGCTGGTTTTCTACCCAACGGCCCTGCAGCCAGCTCACGTCCAGGTTCAACCC
 961 ACAGCTACTTGGTTTGTGTTCTTCTTCATATTCTAAAACCATTCCATTTCCAAGCACTTTCAGTCCAATAGGTGTAGGAA
1041 ATAGCGCTGTTTTTGTTGTGTGTGCAGGGAGGGCAGTTTTCTAATGGAATGGTTTGGGAATATCCATGTACTTGTTTGCA
1121 AGCAGGACTTTGAGGCAAGTGTGGGCCACTGTGGTGGCAGTGGAGGTGGGGTGTTTGGGAGGCTGCGTGCCAGTCAAGAA
1201 GAAAAAGGTTTGCATTCTCACATTGCCAGGATGATAAGTTCCTTTCCTTTTCTTTAAAGAAGTTGAAGTTTAGGAATCCT
1281 TTGGTGCCAACTGGTGTTTGAAAGTAGGGACCTCAGAGGTTTACCTAGAGAACAGGTGGTTTTTAAGGGTTATCTTAGAT
1361 GTTTCACACCGGAAGGTTTTTAAACACTAAAATATATAATTTATAGTTAAGGCTAAAAAGTATATTTATTGCAGAGGATG
1441 TTCATAAGGCCAGTATGATTTATAAATGCAATCTCCCCTTGATTTAAACACACAGATACACACACACACACACACACACA
1521 CAAACCTTCTGCCTTTGATGTTACAGATTTAATACAGTTTATTTTTAAAGATAGATCCTTTTATAGGTGAGAAAAAAACA
1601 ATCTGGAAGAAAAAAACCACACAAAGACATTGATTCAGCCTGTTTGGCGTTTCCCAGAGTCATCTGATTGGACAGGCATG
1681 GGTGCAAGGAAAATTAGGGTACTCAACCTAAGTTCGGTTCCGATGAATTCTTATCCCCTGCCCCTTCCTTTAAAAAACTT
1761 AGTGACAAAATAGACAATTTGCACATCTTGGCTATGTAATTCTTGTAATTTTTATTTAGGAAGTGTTGAAGGGAGGTGGC
1841 AAGAGTGTGGAGGCTGACGTGTGAGGGAGGACAGGCGGGAGGAGGTGTGAGGAGGAGGCTCCCGAGGGGAAGGGGCGGTG
1921 CCCACACCGGGGACAGGCCGCAGCTCCATTTTCTTATTGCGCTGCTACCGTTGACTTCCAGGCACGGTTTGGAAATATTC
2001 ACATCGCTTCTGTGTATCTCTTTCACATTGTTTGCTGCTATTGGAGGATCAGTTTTTTGTTTTACAATGTCATATACTGC
2081 CATGTACTAGTTTTAGTTTTCTCTTAGAACATTGTATTACAGATGCCTTTTTTGTAGTTTTTTTTTTTTTTATGTGATCA
2161 ATTTTGACTTAATGTGATTACTGCTCTATTCCAAAAAGGTTGCTGTTTCACAATACCTCATGCTTCACTTAGCCATGGTG
2241 GACCCAGCGGGCAGGTTCTGCCTGCTTTGGCGGGCAGACACGCGGGCGCGATCCCACACAGGCTGGCGGGGGCCGGCCCC
2321 GAGGCCGCGTGCGTGAGAACCGCGCCGGTGTCCCCAGAGACCAGGCTGTGTCCCTCTTCTCTTCCCTGCGCCTGTGATGC
2401 TGGGCACTTCATCTGATCGGGGGCGTAGCATCATAGTAGTTTTTACAGCTGTGTTATTCTTTGCGTGTAGCTATGGAAGT
2481 TGCATAATTATTATTATTATTATTATAACAAGTGTGTCTTACGTGCCACCACGGCGTTGTACCTGTAGGACTCTCATTCG
2561 GGATGATTGGAATAGCTTCTGGAATTTGTTCAAGTTTTGGGTATGTTTAATCTGTTATGTACTAGTGTTCTGTTTGTTAT
2641 TGTTTTGTTAATTACACCATAATGCTAATTTAAAGAGACTCCAAATCTCAATGAAGCCAGCTCACAGTGCTGTGTGCCCC
2721 GGTCACCTAGCAAGCTGCCGAACCAAAAGAATTTGCACCCCGCTGCGGGCCCACGTGGTTGGGGCCCTGCCCTGGCAGGG
2801 TCATCCTGTGCTCGGAGGCCATCTCGGGCACAGGCCCACCCCGCCCCACCCCTCCAGAACACGGCTCACGCTTACCTCAA
2881 CCATCCTGGCTGCGGCGTCTGTCTGAACCACGCGGGGGCCTTGAGGGACGCTTTGTCTGTCGTGATGGGGCAAGGGCACA
2961 AGTCCTGGATGTTGTGTGTATCGAGAGGCCAAAGGCTGGTGGCAAGTGCACGGGGCACAGCGGAGTCTGTCCTGTGACGC
3041 GCAAGTCTGAGGGTCTGGGCGGCGGGCGGCTGGGTCTGTGCATTTCTGGTTGCACCGCGGCGCTTCCCAGCACCAACATG
3121 TAACCGGCATGTTTCCAGCAGAAGACAAAAAGACAAACATGAAAGTCTAGAAATAAAACTGGTAAAACCCCAAAAAAAAA
3201 AAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uugaUAUG-UUGGAGGAUGGAGu 5'
              | || |||||:||:|||: 
Target 5' acacACACAAACCTTCTGCCTTt 3'
 1514 - 1536 138.00 -18.40
2 
miRNA  3' uugaUAUGUUG---GAGGAUGGAGu 5'
              | ||::|   | |:|||||| 
Target 5' cagaACACGGCTCACGCTTACCTCa 3'
 2855 - 2879 138.00 -16.20
3 
miRNA  3' uuGAUAUGUUGGAGGAUGGAGu 5'
            :|||||  |:|||||::|: 
Target 5' ttTTATAC-TCTTCCTATTTTt 3'
 867 - 887 123.00 -15.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30140134 2 COSMIC
COSN30452344 7 COSMIC
COSN30452288 8 COSMIC
COSN26440643 39 COSMIC
COSN24361326 66 COSMIC
COSN22751060 113 COSMIC
COSN17037802 226 COSMIC
COSN27221469 234 COSMIC
COSN9031603 239 COSMIC
COSN8689115 480 COSMIC
COSN25902211 575 COSMIC
COSN21634633 584 COSMIC
COSN16049000 706 COSMIC
COSN16904533 866 COSMIC
COSN22843579 903 COSMIC
COSN17078425 946 COSMIC
COSN22892708 971 COSMIC
COSN25236763 1154 COSMIC
COSN20982451 1164 COSMIC
COSN31611721 1187 COSMIC
COSN20108461 1523 COSMIC
COSN23819460 1524 COSMIC
COSN22850192 1771 COSMIC
COSN30171021 1803 COSMIC
COSN26481971 1832 COSMIC
COSN20077368 1883 COSMIC
COSN15333221 1887 COSMIC
COSN8584632 1909 COSMIC
COSN31481844 1928 COSMIC
COSN22883090 1991 COSMIC
COSN30580846 2013 COSMIC
COSN26435161 2081 COSMIC
COSN20494675 2128 COSMIC
COSN20071077 2152 COSMIC
COSN27226707 2152 COSMIC
COSN22850657 2345 COSMIC
COSN29114185 2839 COSMIC
COSN26808038 2933 COSMIC
COSN30761558 2939 COSMIC
COSN21980728 2951 COSMIC
COSN17077262 2981 COSMIC
COSN21626459 2998 COSMIC
COSN20066464 3098 COSMIC
COSN25983202 3109 COSMIC
COSN29397813 3174 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs889887455 1 dbSNP
rs1488354205 3 dbSNP
rs1187898588 5 dbSNP
rs775045588 6 dbSNP
rs1427570013 16 dbSNP
rs762429663 17 dbSNP
rs547958193 18 dbSNP
rs749904542 19 dbSNP
rs760169968 20 dbSNP
rs766001683 21 dbSNP
rs1039242204 24 dbSNP
rs753482335 26 dbSNP
rs566169135 27 dbSNP
rs1369045429 28 dbSNP
rs921788689 30 dbSNP
rs1307838783 32 dbSNP
rs765041741 33 dbSNP
rs752451676 34 dbSNP
rs1315426736 35 dbSNP
rs1484682583 38 dbSNP
rs539869079 39 dbSNP
rs1243654858 40 dbSNP
rs777708554 41 dbSNP
rs998406664 44 dbSNP
rs1047369285 45 dbSNP
rs1217235549 46 dbSNP
rs1480409396 50 dbSNP
rs745993963 51 dbSNP
rs1205616417 53 dbSNP
rs1439433362 56 dbSNP
rs967545535 60 dbSNP
rs7177 66 dbSNP
rs926066318 71 dbSNP
rs1345079984 75 dbSNP
rs957390352 77 dbSNP
rs991857797 81 dbSNP
rs915920225 82 dbSNP
rs963666606 85 dbSNP
rs747230443 86 dbSNP
rs1443367693 89 dbSNP
rs768816930 100 dbSNP
rs1173069451 101 dbSNP
rs1414454711 112 dbSNP
rs1355445394 117 dbSNP
rs982043723 120 dbSNP
rs1406864458 124 dbSNP
rs1306426360 127 dbSNP
rs1327099514 129 dbSNP
rs1032082450 133 dbSNP
rs927763170 136 dbSNP
rs1405629980 144 dbSNP
rs1803356 144 dbSNP
rs1235571055 152 dbSNP
rs376382983 159 dbSNP
rs913366940 178 dbSNP
rs1244371234 183 dbSNP
rs967532519 186 dbSNP
rs775791411 188 dbSNP
rs1366890864 193 dbSNP
rs1225160244 201 dbSNP
rs928893937 203 dbSNP
rs1282818621 212 dbSNP
rs1447899800 212 dbSNP
rs937341595 212 dbSNP
rs1338717348 216 dbSNP
rs1056234350 221 dbSNP
rs1388087284 222 dbSNP
rs113802535 223 dbSNP
rs1445100963 224 dbSNP
rs200641419 224 dbSNP
rs888155431 224 dbSNP
rs1217378954 225 dbSNP
rs76139292 226 dbSNP
rs1464026391 235 dbSNP
rs1242247152 238 dbSNP
rs1039316488 239 dbSNP
rs1204132747 243 dbSNP
rs931414116 250 dbSNP
rs556325124 256 dbSNP
rs1288085496 257 dbSNP
rs1228124166 271 dbSNP
rs761451423 277 dbSNP
rs1317775071 281 dbSNP
rs998377292 282 dbSNP
rs1221740074 287 dbSNP
rs1029900280 316 dbSNP
rs1364482937 317 dbSNP
rs903354801 323 dbSNP
rs1008064753 324 dbSNP
rs1433076036 331 dbSNP
rs1040977626 341 dbSNP
rs1477349002 343 dbSNP
rs999469780 344 dbSNP
rs1033182389 350 dbSNP
rs957648987 352 dbSNP
rs899783172 358 dbSNP
rs1166619312 362 dbSNP
rs991600123 371 dbSNP
rs1420786830 375 dbSNP
rs574336406 376 dbSNP
rs1022946937 377 dbSNP
rs764711212 379 dbSNP
rs772901129 381 dbSNP
rs1020669276 382 dbSNP
rs1167026121 390 dbSNP
rs982012596 402 dbSNP
rs1342079296 403 dbSNP
rs927900196 406 dbSNP
rs929822730 408 dbSNP
rs967480225 409 dbSNP
rs982989701 411 dbSNP
rs1405836417 414 dbSNP
rs981615909 414 dbSNP
rs1367156675 415 dbSNP
rs1425518966 420 dbSNP
rs1323051530 423 dbSNP
rs541612852 433 dbSNP
rs909730931 441 dbSNP
rs781535069 443 dbSNP
rs1432919660 445 dbSNP
rs941084451 447 dbSNP
rs1039452423 455 dbSNP
rs899497814 458 dbSNP
rs933694635 460 dbSNP
rs1481230545 464 dbSNP
rs1051284716 482 dbSNP
rs1365759038 483 dbSNP
rs1271412750 489 dbSNP
rs959243736 505 dbSNP
rs1295114186 511 dbSNP
rs1361242546 517 dbSNP
rs903393378 519 dbSNP
rs991490308 538 dbSNP
rs559847341 545 dbSNP
rs1207287453 562 dbSNP
rs1310492992 568 dbSNP
rs1228503339 570 dbSNP
rs1224316580 580 dbSNP
rs1347630523 586 dbSNP
rs186742914 604 dbSNP
rs776194489 604 dbSNP
rs748518127 616 dbSNP
rs1033564593 617 dbSNP
rs149785366 620 dbSNP
rs545808319 628 dbSNP
rs1299784950 629 dbSNP
rs893320935 634 dbSNP
rs1464528045 639 dbSNP
rs762561244 641 dbSNP
rs1176521656 648 dbSNP
rs1470716579 662 dbSNP
rs1409288813 675 dbSNP
rs1158048486 679 dbSNP
rs1249191027 680 dbSNP
rs1251750595 683 dbSNP
rs563895387 684 dbSNP
rs1482581479 687 dbSNP
rs678653 688 dbSNP
rs1387464453 691 dbSNP
rs1445524386 693 dbSNP
rs866708873 696 dbSNP
rs908664926 697 dbSNP
rs1317273012 701 dbSNP
rs1308915003 702 dbSNP
rs3212893 707 dbSNP
rs773730838 708 dbSNP
rs1337371631 711 dbSNP
rs1454115336 719 dbSNP
rs951346316 722 dbSNP
rs2510607 723 dbSNP
rs1006889485 726 dbSNP
rs899731091 728 dbSNP
rs932536509 733 dbSNP
rs1434276774 734 dbSNP
rs1318342035 737 dbSNP
rs1384695013 743 dbSNP
rs1245183600 745 dbSNP
rs1161743192 752 dbSNP
rs1422523889 754 dbSNP
rs1385144919 756 dbSNP
rs1184825768 760 dbSNP
rs758933493 767 dbSNP
rs562366357 772 dbSNP
rs1486317592 780 dbSNP
rs1009238475 781 dbSNP
rs1242317339 786 dbSNP
rs1020659443 789 dbSNP
rs1315607468 791 dbSNP
rs371387647 792 dbSNP
rs1002984710 801 dbSNP
rs1317057521 804 dbSNP
rs147194931 806 dbSNP
rs958913683 813 dbSNP
rs1291489032 814 dbSNP
rs992125953 818 dbSNP
rs975127144 819 dbSNP
rs952817760 821 dbSNP
rs3212894 823 dbSNP
rs140469724 824 dbSNP
rs1429252063 827 dbSNP
rs1264112819 828 dbSNP
rs1208327904 831 dbSNP
rs3212895 835 dbSNP
rs774916002 840 dbSNP
rs144537936 842 dbSNP
rs535459249 843 dbSNP
rs1411291996 845 dbSNP
rs1379827926 847 dbSNP
rs976847787 848 dbSNP
rs1456684997 853 dbSNP
rs569902409 854 dbSNP
rs1269021446 861 dbSNP
rs1227503058 862 dbSNP
rs1327751313 866 dbSNP
rs1156883501 873 dbSNP
rs1298706058 881 dbSNP
rs1404009591 882 dbSNP
rs1408156897 885 dbSNP
rs924312590 889 dbSNP
rs1396397470 890 dbSNP
rs934882518 891 dbSNP
rs763841185 893 dbSNP
rs1054735331 895 dbSNP
rs1427039959 898 dbSNP
rs1454450316 899 dbSNP
rs3212896 913 dbSNP
rs1462530743 926 dbSNP
rs1374910955 927 dbSNP
rs756315808 928 dbSNP
rs1480249962 933 dbSNP
rs1044495316 935 dbSNP
rs1288470188 946 dbSNP
rs569348935 947 dbSNP
rs1226001045 954 dbSNP
rs1265552441 960 dbSNP
rs1481984872 972 dbSNP
rs147844202 975 dbSNP
rs1346262089 979 dbSNP
rs1002972414 985 dbSNP
rs1196354922 994 dbSNP
rs1200300205 996 dbSNP
rs1253765879 1000 dbSNP
rs1026710744 1023 dbSNP
rs1276942770 1028 dbSNP
rs1054077660 1030 dbSNP
rs893757435 1032 dbSNP
rs1407137145 1033 dbSNP
rs777972591 1035 dbSNP
rs950772737 1041 dbSNP
rs1004524092 1046 dbSNP
rs368481159 1047 dbSNP
rs538149856 1056 dbSNP
rs1201599930 1064 dbSNP
rs1469433109 1068 dbSNP
rs975179817 1069 dbSNP
rs921103137 1075 dbSNP
rs1178937280 1076 dbSNP
rs1466472310 1090 dbSNP
rs955094946 1091 dbSNP
rs1171850262 1098 dbSNP
rs574372109 1101 dbSNP
rs1399752490 1102 dbSNP
rs1232142407 1110 dbSNP
rs3212897 1117 dbSNP
rs1054818039 1119 dbSNP
rs1308295142 1123 dbSNP
rs924251044 1127 dbSNP
rs1253382783 1138 dbSNP
rs1369486890 1142 dbSNP
rs934372065 1154 dbSNP
rs1407474444 1155 dbSNP
rs1202465803 1156 dbSNP
rs1323704648 1158 dbSNP
rs1284634686 1159 dbSNP
rs1332246915 1160 dbSNP
rs183243879 1169 dbSNP
rs1348922942 1177 dbSNP
rs1233125326 1180 dbSNP
rs894594204 1183 dbSNP
rs757572186 1187 dbSNP
rs111859970 1188 dbSNP
rs948951785 1194 dbSNP
rs1406975710 1205 dbSNP
rs1338925619 1212 dbSNP
rs1399201572 1213 dbSNP
rs1406928566 1229 dbSNP
rs1027649724 1230 dbSNP
rs371251672 1233 dbSNP
rs1383297190 1247 dbSNP
rs1471071051 1247 dbSNP
rs1274194846 1252 dbSNP
rs761720025 1253 dbSNP
rs1211578322 1263 dbSNP
rs1482163737 1264 dbSNP
rs953017725 1265 dbSNP
rs1244467378 1278 dbSNP
rs1044555453 1279 dbSNP
rs3212898 1288 dbSNP
rs1283929898 1291 dbSNP
rs1224675033 1293 dbSNP
rs1015575047 1295 dbSNP
rs965390152 1297 dbSNP
rs1313519134 1302 dbSNP
rs113745276 1303 dbSNP
rs1383556328 1307 dbSNP
rs1047837263 1309 dbSNP
rs116435189 1310 dbSNP
rs886433547 1312 dbSNP
rs543396488 1329 dbSNP
rs1317294991 1330 dbSNP
rs1428814839 1331 dbSNP
rs1006263910 1334 dbSNP
rs1016682182 1337 dbSNP
rs1198051948 1363 dbSNP
rs1319301392 1366 dbSNP
rs962570595 1369 dbSNP
rs187904389 1371 dbSNP
rs529583023 1372 dbSNP
rs1369628949 1374 dbSNP
rs373375621 1377 dbSNP
rs1427418927 1378 dbSNP
rs1184268540 1391 dbSNP
rs746244692 1396 dbSNP
rs1242335589 1402 dbSNP
rs1390800209 1407 dbSNP
rs1489463103 1416 dbSNP
rs1290072457 1419 dbSNP
rs772318265 1427 dbSNP
rs548026313 1440 dbSNP
rs1360802516 1446 dbSNP
rs1322179844 1451 dbSNP
rs945323633 1452 dbSNP
rs747492017 1454 dbSNP
rs1328638508 1456 dbSNP
rs1270963217 1461 dbSNP
rs559944633 1468 dbSNP
rs1297304182 1472 dbSNP
rs1302312958 1474 dbSNP
rs1419954996 1475 dbSNP
rs11557584 1476 dbSNP
rs1425157811 1485 dbSNP
rs1248403804 1491 dbSNP
rs955895941 1494 dbSNP
rs10640302 1498 dbSNP
rs1306936640 1498 dbSNP
rs1452276366 1498 dbSNP
rs145829811 1498 dbSNP
rs1491009201 1498 dbSNP
rs200813571 1498 dbSNP
rs60324592 1498 dbSNP
rs796610638 1498 dbSNP
rs35535428 1499 dbSNP
rs1266159040 1505 dbSNP
rs927608268 1506 dbSNP
rs67101880 1508 dbSNP
rs1321686892 1510 dbSNP
rs1282946202 1517 dbSNP
rs1405323732 1520 dbSNP
rs1491562372 1522 dbSNP
rs57561503 1523 dbSNP
rs1265204473 1524 dbSNP
rs989791551 1524 dbSNP
rs1441419432 1526 dbSNP
rs1466192106 1531 dbSNP
rs1189054864 1533 dbSNP
rs1171916439 1547 dbSNP
rs1054766570 1556 dbSNP
rs868561360 1558 dbSNP
rs1176756544 1571 dbSNP
rs948927165 1572 dbSNP
rs533468346 1573 dbSNP
rs1269935354 1584 dbSNP
rs1048587604 1592 dbSNP
rs888626655 1592 dbSNP
rs1233470997 1599 dbSNP
rs2062445 1602 dbSNP
rs1389286648 1603 dbSNP
rs1004445319 1607 dbSNP
rs1166503789 1610 dbSNP
rs1368642303 1618 dbSNP
rs1313689106 1623 dbSNP
rs928775532 1635 dbSNP
rs1223081873 1637 dbSNP
rs772731825 1645 dbSNP
rs1160889502 1649 dbSNP
rs551627621 1650 dbSNP
rs1048276516 1664 dbSNP
rs886488437 1669 dbSNP
rs998220961 1679 dbSNP
rs1379663503 1680 dbSNP
rs1320348405 1682 dbSNP
rs570124582 1689 dbSNP
rs530841990 1694 dbSNP
rs1363437950 1697 dbSNP
rs556766891 1699 dbSNP
rs548942087 1700 dbSNP
rs568668101 1708 dbSNP
rs1242635386 1716 dbSNP
rs1313711693 1717 dbSNP
rs1037680665 1722 dbSNP
rs1321290060 1723 dbSNP
rs535334547 1728 dbSNP
rs900527940 1729 dbSNP
rs377373695 1736 dbSNP
rs1311335435 1739 dbSNP
rs1331191870 1740 dbSNP
rs996698011 1740 dbSNP
rs1459466939 1743 dbSNP
rs773872692 1745 dbSNP
rs1243707954 1752 dbSNP
rs1381349084 1759 dbSNP
rs1315143312 1760 dbSNP
rs759436493 1767 dbSNP
rs989705211 1770 dbSNP
rs1312811203 1785 dbSNP
rs1287992380 1788 dbSNP
rs915049324 1788 dbSNP
rs1346211387 1793 dbSNP
rs767197346 1796 dbSNP
rs553562452 1804 dbSNP
rs1209257177 1806 dbSNP
rs1028223563 1814 dbSNP
rs758315102 1824 dbSNP
rs1183311429 1825 dbSNP
rs1256433711 1826 dbSNP
rs1259916029 1831 dbSNP
rs1422861886 1833 dbSNP
rs78871738 1835 dbSNP
rs111229733 1846 dbSNP
rs1486041951 1850 dbSNP
rs539618802 1851 dbSNP
rs1413490858 1859 dbSNP
rs1220072056 1860 dbSNP
rs939020900 1861 dbSNP
rs1292481019 1862 dbSNP
rs3212899 1871 dbSNP
rs916304541 1875 dbSNP
rs557610582 1876 dbSNP
rs764070397 1877 dbSNP
rs369309004 1878 dbSNP
rs1021283352 1886 dbSNP
rs945693596 1887 dbSNP
rs1423228751 1890 dbSNP
rs1365496769 1894 dbSNP
rs1164855892 1895 dbSNP
rs1303778732 1897 dbSNP
rs969740984 1904 dbSNP
rs879160060 1905 dbSNP
rs753976474 1909 dbSNP
rs901464281 1913 dbSNP
rs998168513 1917 dbSNP
rs3212900 1918 dbSNP
rs1490143659 1923 dbSNP
rs757336988 1929 dbSNP
rs191306538 1930 dbSNP
rs1336824761 1936 dbSNP
rs1250300308 1937 dbSNP
rs373248238 1940 dbSNP
rs1267435614 1941 dbSNP
rs1281048612 1955 dbSNP
rs1403490211 1956 dbSNP
rs966480696 1956 dbSNP
rs908050805 1958 dbSNP
rs942101620 1961 dbSNP
rs977926375 1962 dbSNP
rs1034883880 1963 dbSNP
rs1038214162 1970 dbSNP
rs182627279 1971 dbSNP
rs1174595348 1972 dbSNP
rs1256360205 1973 dbSNP
rs1485315433 1974 dbSNP
rs1200863953 1979 dbSNP
rs759446411 1986 dbSNP
rs932016436 1986 dbSNP
rs756216186 1987 dbSNP
rs1244101535 2006 dbSNP
rs780180675 2007 dbSNP
rs1162221043 2015 dbSNP
rs1385226649 2016 dbSNP
rs1222581441 2021 dbSNP
rs1323218986 2022 dbSNP
rs1275811865 2025 dbSNP
rs1457780093 2028 dbSNP
rs1401813696 2032 dbSNP
rs1161296162 2033 dbSNP
rs1343542350 2034 dbSNP
rs930309612 2040 dbSNP
rs1430219764 2042 dbSNP
rs1337700185 2043 dbSNP
rs1384718191 2044 dbSNP
rs1343720661 2047 dbSNP
rs778592697 2053 dbSNP
rs1314125525 2059 dbSNP
rs1328856414 2066 dbSNP
rs140779377 2067 dbSNP
rs187991526 2068 dbSNP
rs1008568415 2071 dbSNP
rs774887918 2072 dbSNP
rs1052927645 2074 dbSNP
rs1264693835 2076 dbSNP
rs1462927270 2077 dbSNP
rs560082693 2078 dbSNP
rs533399976 2079 dbSNP
rs1470775829 2084 dbSNP
rs1179486901 2088 dbSNP
rs1182490400 2112 dbSNP
rs1440979002 2113 dbSNP
rs386589338 2121 dbSNP
rs3918303 2121 dbSNP
rs535391224 2123 dbSNP
rs545565093 2126 dbSNP
rs563656986 2127 dbSNP
rs1349033603 2128 dbSNP
rs1279465076 2131 dbSNP
rs1379156762 2138 dbSNP
rs1452116540 2138 dbSNP
rs375055236 2138 dbSNP
rs555151080 2138 dbSNP
rs770510145 2138 dbSNP
rs1409298721 2139 dbSNP
rs1336475576 2140 dbSNP
rs1398710506 2142 dbSNP
rs1384039295 2148 dbSNP
rs1159132833 2152 dbSNP
rs1286513721 2153 dbSNP
rs1371175035 2154 dbSNP
rs200730331 2155 dbSNP
rs1301778195 2156 dbSNP
rs1311412192 2157 dbSNP
rs1208409238 2158 dbSNP
rs1182425922 2162 dbSNP
rs1021419331 2174 dbSNP
rs1276337937 2178 dbSNP
rs3212901 2181 dbSNP
rs969709977 2183 dbSNP
rs1190638587 2184 dbSNP
rs1203904411 2187 dbSNP
rs1217904775 2193 dbSNP
rs1356485584 2200 dbSNP
rs1290293713 2201 dbSNP
rs1001164563 2204 dbSNP
rs573466828 2206 dbSNP
rs1248948087 2213 dbSNP
rs1286158385 2220 dbSNP
rs1428918461 2221 dbSNP
rs889752561 2230 dbSNP
rs1298592558 2234 dbSNP
rs1401673109 2245 dbSNP
rs1363629659 2247 dbSNP
rs1035365934 2249 dbSNP
rs1479318454 2250 dbSNP
rs1192312607 2253 dbSNP
rs112206819 2272 dbSNP
rs1431810825 2273 dbSNP
rs1474879841 2282 dbSNP
rs1011330889 2283 dbSNP
rs960291962 2284 dbSNP
rs902631600 2285 dbSNP
rs1322356714 2287 dbSNP
rs534546330 2288 dbSNP
rs999303995 2289 dbSNP
rs908016001 2290 dbSNP
rs963907104 2291 dbSNP
rs1401582268 2300 dbSNP
rs372791652 2308 dbSNP
rs1437144057 2309 dbSNP
rs3212902 2309 dbSNP
rs3212903 2313 dbSNP
rs1294073881 2314 dbSNP
rs565957345 2315 dbSNP
rs1423893996 2316 dbSNP
rs1172426071 2317 dbSNP
rs932070532 2321 dbSNP
rs1427669336 2322 dbSNP
rs3212904 2327 dbSNP
rs911905538 2328 dbSNP
rs1227184171 2329 dbSNP
rs1270391923 2330 dbSNP
rs1220717747 2333 dbSNP
rs940450146 2333 dbSNP
rs140024500 2334 dbSNP
rs1452868578 2342 dbSNP
rs1053477162 2343 dbSNP
rs879685183 2344 dbSNP
rs1011864065 2345 dbSNP
rs1042915355 2346 dbSNP
rs1467513938 2347 dbSNP
rs1049973811 2349 dbSNP
rs112144268 2355 dbSNP
rs557913711 2365 dbSNP
rs1001300235 2368 dbSNP
rs1449142718 2370 dbSNP
rs1404287008 2377 dbSNP
rs946734279 2382 dbSNP
rs113288142 2385 dbSNP
rs1427826991 2389 dbSNP
rs374256592 2390 dbSNP
rs959997411 2391 dbSNP
rs758843980 2404 dbSNP
rs565876334 2406 dbSNP
rs1460161625 2408 dbSNP
rs1255687506 2419 dbSNP
rs963573790 2420 dbSNP
rs1313780145 2422 dbSNP
rs1304765558 2425 dbSNP
rs973503325 2426 dbSNP
rs780250886 2428 dbSNP
rs1164098940 2436 dbSNP
rs537102020 2438 dbSNP
rs1449945903 2448 dbSNP
rs922111453 2454 dbSNP
rs1381551629 2457 dbSNP
rs1051062 2459 dbSNP
rs1438586768 2465 dbSNP
rs769165547 2466 dbSNP
rs1419658225 2471 dbSNP
rs1012529446 2482 dbSNP
rs1023549919 2487 dbSNP
rs1182718399 2487 dbSNP
rs574345911 2487 dbSNP
rs911885483 2487 dbSNP
rs1365689629 2490 dbSNP
rs1215752889 2493 dbSNP
rs1354347501 2507 dbSNP
rs573725552 2509 dbSNP
rs1243137834 2513 dbSNP
rs961724240 2514 dbSNP
rs777055939 2522 dbSNP
rs541016434 2523 dbSNP
rs975789273 2524 dbSNP
rs923022915 2529 dbSNP
rs1161045043 2533 dbSNP
rs955557121 2533 dbSNP
rs1268054081 2534 dbSNP
rs1165662777 2536 dbSNP
rs986069216 2536 dbSNP
rs3212905 2537 dbSNP
rs913101981 2538 dbSNP
rs1228457034 2560 dbSNP
rs1043974781 2561 dbSNP
rs1220183742 2568 dbSNP
rs578178280 2574 dbSNP
rs545292410 2575 dbSNP
rs563873737 2576 dbSNP
rs192114382 2601 dbSNP
rs1042886088 2604 dbSNP
rs3212906 2619 dbSNP
rs1305379282 2629 dbSNP
rs1277224558 2643 dbSNP
rs1249137284 2644 dbSNP
rs113088923 2656 dbSNP
rs778155795 2657 dbSNP
rs1300523723 2658 dbSNP
rs1045330577 2659 dbSNP
rs1390054503 2665 dbSNP
rs1294215093 2682 dbSNP
rs1056928220 2692 dbSNP
rs1170313239 2702 dbSNP
rs1477994440 2703 dbSNP
rs1006117863 2707 dbSNP
rs895472191 2709 dbSNP
rs756359481 2711 dbSNP
rs1197143821 2712 dbSNP
rs528508692 2714 dbSNP
rs1004993622 2716 dbSNP
rs1473247516 2717 dbSNP
rs546576059 2718 dbSNP
rs1014593776 2721 dbSNP
rs55666306 2722 dbSNP
rs1257014693 2724 dbSNP
rs3212907 2727 dbSNP
rs1161328012 2734 dbSNP
rs1030080895 2736 dbSNP
rs1234459178 2740 dbSNP
rs1331006092 2741 dbSNP
rs1302630244 2749 dbSNP
rs551296182 2750 dbSNP
rs953576526 2761 dbSNP
rs3212908 2762 dbSNP
rs1019488041 2763 dbSNP
rs1341960716 2764 dbSNP
rs956816501 2766 dbSNP
rs1170573426 2767 dbSNP
rs968249749 2768 dbSNP
rs537238485 2769 dbSNP
rs760484924 2770 dbSNP
rs1416731727 2773 dbSNP
rs979621757 2775 dbSNP
rs988515364 2776 dbSNP
rs992143011 2779 dbSNP
rs917995807 2780 dbSNP
rs1269325777 2788 dbSNP
rs3212909 2789 dbSNP
rs1236080184 2790 dbSNP
rs947265437 2795 dbSNP
rs1203814114 2797 dbSNP
rs1045171871 2801 dbSNP
rs140650017 2803 dbSNP
rs1036271782 2804 dbSNP
rs1332520654 2808 dbSNP
rs1209710625 2811 dbSNP
rs534628073 2814 dbSNP
rs937189911 2815 dbSNP
rs1030383965 2826 dbSNP
rs748455804 2827 dbSNP
rs764129482 2828 dbSNP
rs940459407 2832 dbSNP
rs1177398427 2834 dbSNP
rs1228535482 2835 dbSNP
rs773752502 2835 dbSNP
rs1021383912 2836 dbSNP
rs760166916 2838 dbSNP
rs979610379 2839 dbSNP
rs898853917 2841 dbSNP
rs765879174 2843 dbSNP
rs956981787 2844 dbSNP
rs776074405 2849 dbSNP
rs995031239 2850 dbSNP
rs1284667513 2853 dbSNP
rs759220714 2854 dbSNP
rs1029234600 2863 dbSNP
rs992382225 2864 dbSNP
rs1447578556 2865 dbSNP
rs1438806825 2866 dbSNP
rs764807554 2867 dbSNP
rs1231731590 2868 dbSNP
rs3802782 2870 dbSNP
rs1008981840 2871 dbSNP
rs1431580946 2872 dbSNP
rs1479548648 2881 dbSNP
rs1359787072 2884 dbSNP
rs1172259240 2887 dbSNP
rs1396899681 2890 dbSNP
rs948081304 2891 dbSNP
rs1411516603 2893 dbSNP
rs1326755443 2894 dbSNP
rs1019120785 2895 dbSNP
rs956978418 2896 dbSNP
rs758200830 2897 dbSNP
rs909330324 2898 dbSNP
rs1343120821 2900 dbSNP
rs941838775 2905 dbSNP
rs988263745 2912 dbSNP
rs764005327 2913 dbSNP
rs1270452510 2914 dbSNP
rs189388457 2915 dbSNP
rs1216631712 2916 dbSNP
rs756198452 2919 dbSNP
rs1287850235 2923 dbSNP
rs1482991667 2924 dbSNP
rs34781697 2925 dbSNP
rs1442806962 2929 dbSNP
rs552902181 2930 dbSNP
rs1271111248 2931 dbSNP
rs1489890920 2934 dbSNP
rs1198414998 2935 dbSNP
rs1229680202 2937 dbSNP
rs1373915658 2940 dbSNP
rs780204390 2942 dbSNP
rs978665135 2943 dbSNP
rs553821905 2948 dbSNP
rs1425169635 2950 dbSNP
rs1165449107 2951 dbSNP
rs1363132668 2954 dbSNP
rs888747494 2955 dbSNP
rs1405488511 2957 dbSNP
rs539281793 2959 dbSNP
rs937242416 2967 dbSNP
rs755255558 2969 dbSNP
rs1204383584 2970 dbSNP
rs779218398 2972 dbSNP
rs1268737656 2974 dbSNP
rs1423359243 2978 dbSNP
rs1021791904 2979 dbSNP
rs904305753 2980 dbSNP
rs7178 2981 dbSNP
rs1294668998 2983 dbSNP
rs917101810 2984 dbSNP
rs1357350806 2989 dbSNP
rs1209258531 2991 dbSNP
rs940411341 2998 dbSNP
rs1384911321 2999 dbSNP
rs1196996121 3000 dbSNP
rs575482362 3012 dbSNP
rs1448921540 3013 dbSNP
rs1191338214 3016 dbSNP
rs200170583 3020 dbSNP
rs1445061410 3021 dbSNP
rs1165392467 3022 dbSNP
rs182540344 3023 dbSNP
rs1457348485 3026 dbSNP
rs930351808 3029 dbSNP
rs1436559105 3035 dbSNP
rs1158599364 3038 dbSNP
rs1328785666 3038 dbSNP
rs145912824 3039 dbSNP
rs889333390 3040 dbSNP
rs1009168079 3041 dbSNP
rs1364913527 3042 dbSNP
rs1453908820 3046 dbSNP
rs574666788 3051 dbSNP
rs980834196 3053 dbSNP
rs1040921012 3056 dbSNP
rs1381141866 3057 dbSNP
rs372155093 3061 dbSNP
rs776125781 3062 dbSNP
rs1352996367 3063 dbSNP
rs565242482 3064 dbSNP
rs919056104 3065 dbSNP
rs1461594851 3066 dbSNP
rs1185129222 3068 dbSNP
rs758993756 3069 dbSNP
rs1022409854 3070 dbSNP
rs757993935 3070 dbSNP
rs11604847 3071 dbSNP
rs533078965 3077 dbSNP
rs933149551 3077 dbSNP
rs1423120774 3090 dbSNP
rs1051357 3096 dbSNP
rs750697023 3097 dbSNP
rs551698744 3098 dbSNP
rs776449946 3099 dbSNP
rs762698268 3100 dbSNP
rs1470755860 3101 dbSNP
rs1339061438 3102 dbSNP
rs992776664 3103 dbSNP
rs1395935024 3104 dbSNP
rs1463837724 3107 dbSNP
rs1357795577 3112 dbSNP
rs917050973 3113 dbSNP
rs1308392384 3116 dbSNP
rs904210762 3117 dbSNP
rs1226716096 3119 dbSNP
rs1287826053 3126 dbSNP
rs763928703 3127 dbSNP
rs1210996435 3131 dbSNP
rs972222092 3135 dbSNP
rs1156900165 3147 dbSNP
rs1439240460 3149 dbSNP
rs1242579788 3151 dbSNP
rs1274707203 3160 dbSNP
rs1803191 3161 dbSNP
rs758578621 3162 dbSNP
rs1482825753 3163 dbSNP
rs1803190 3169 dbSNP
rs1196301536 3174 dbSNP
rs761597546 3175 dbSNP
rs1252652188 3176 dbSNP
rs1417251326 3179 dbSNP
rs1180746537 3182 dbSNP
rs1429420358 3183 dbSNP
rs1481186183 3189 dbSNP
rs920305726 3190 dbSNP
rs1376255517 3191 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions MCF-7 , T47D
Disease 595.0
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... "Cyclin D1 is a direct target of let-7e//cyclin D1 which also promotes G1 progression ...

- Mitra D; Das PM; Huynh FC; Jones FE, 2011, The Journal of biological chemistry.

Article - Mitra D; Das PM; Huynh FC; Jones FE
- The Journal of biological chemistry, 2011
MicroRNAs (miRs) function as tumor suppressors or oncogenes in multiple tumor types. Although miR expression is tightly regulated, the molecular basis of miR regulation is poorly understood. Here, we investigated the influence of the histone demethylase Jumonji/ARID1 B (JARID1B) on miR regulation in breast tumor cells. In MCF-7 cells with stable RNAi-mediated suppression of JARID1B expression we identified altered regulation of multiple miRs including let-7e, a member of the let-7 family of tumor suppressor miRs. Chromatin immunoprecipitation analysis demonstrated JARID1B binding to the let-7e promoter region as well as removal of the of H3K4me3 histone mark associated with active gene expression. These results suggest that JARID1B epigenetically represses let-7e expression. JARID1B stimulates tumor cell proliferation by promoting the G(1) to S transition. As predicted, suppression of JARID1B resulted in an accumulation of MCF-7 cells in G(1). We confirmed that cyclin D1, which also promotes G(1) progression, is a direct target of let-7e, and we show that cyclin D1 expression is suppressed in JARID1B knockdown cells. Cyclin D1 expression and cell cycle progression were restored following inhibition of let-7e, suggesting that JARID1B repression of let-7e contributes to cyclin D1 expression and JARID1B-mediated cell cycle progression. Our results indicate that the JARID1B demethylase contributes to tumor cell proliferation through the epigenetic repression of a tumor suppressor miR.
LinkOut: [PMID: 21969366]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uugaUAUGUUG---GAGGAUGGAGu 5'
              | ||::|   | |:|||||| 
Target 5' ---aACACGGCUCACGCUUACCUCa 3'
 		1 - 22
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions A2780 , ES2 , SKOV3
Disease MIMAT0000066
Location of target site 3'UTR
Tools used in this research PicTar , TargetScan
Original Description (Extracted from the article) ... "We found that A2780/CP cells expressed more EZH2 and CCND1 but less RBM3 compared with A2780 (Figures 3a and b). After treatment with let-7e agomirs ...

- Cai J; Yang C; Yang Q; Ding H; Jia J; Guo et al., 2013, Oncogenesis.

Article - Cai J; Yang C; Yang Q; Ding H; Jia J; Guo et al.
- Oncogenesis, 2013
Drug resistance remains a major clinical obstacle to successful treatment in ovarian cancer patients, and the evidence of microRNAs involvement in drug resistance has been emerging recently. In this report, we investigated the role of let-7e in the development of cisplatin-resistant ovarian cancer. On the cellular level, let-7e expression was significantly reduced in cisplatin-resistant human epithelial ovarian cancer (EOC) cell line A2780/CP compared with parental A2780 cell and decreased in a concentration-dependent manner in A2780, SKOV3 and ES2 cells treated with cisplatin. Overexpression of let-7e by transfection of agomir could resensitize A2780/CP and reduce the expression of cisplatin-resistant-related proteins enhancer of zeste 2 (EZH2) and cyclin D1 (CCND1), whereas let-7e inhibitors increased resistance to cisplatin in parental A2780 cells. Quantitative methylation-specific PCR analysis showed hypermethylation of the CpG island adjacent to let-7e in A2780/CP cells, and demethylation treatment with 5-aza-CdR or transfection of pYr-let-7e-shRNA plasmid containing unmethylated let-7e DNA sequence could restore let-7e expression and partly reduce the chemoresistance. In addition, cisplatin combined with let-7e agomirs inhibited the growth of A2780/CP xenograft more effectively than cisplatin alone. Diminished expression of EZH2 and CCND1 and higher cisplatin concentrations in tumor tissue of mice subjected to administration of let-7e agomirs in addition to cisplatin were revealed by immunohistochemistry and atomic absorption spectroscopy, respectively. Taken together, our findings suggest that let-7e may act as a promising therapeutic target for improvement of the sensibility to cisplatin in EOC.
LinkOut: [PMID: 24100610]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177627. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_5 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uugaUAUGUUG---GAGGAUGGAGu 5'
              | ||::|   | |:|||||| 
Target 5' ---aACACGGCUCACGCUUACCUCa 3'
 		1 - 22
Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000227507.2 | 3UTR | AACACGGCUCACGCUUACCUCAACCAUCCUGGCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
CHOL -0.73 0.01 -0.750 0.01 9 Click to see details
STAD -0.391 0.01 -0.280 0.06 32 Click to see details
THCA 0.245 0.03 0.254 0.03 59 Click to see details
UCEC -0.321 0.09 -0.368 0.06 19 Click to see details
LUAD 0.357 0.13 0.350 0.13 12 Click to see details
COAD -0.422 0.15 -0.238 0.29 8 Click to see details
HNSC -0.136 0.2 -0.110 0.24 42 Click to see details
BLCA 0.214 0.2 0.209 0.2 18 Click to see details
CESC 0.81 0.2 1.000 0.5 3 Click to see details
KIRC 0.094 0.22 0.087 0.24 68 Click to see details
KIRP 0.127 0.24 0.128 0.24 32 Click to see details
PRAD -0.072 0.31 0.081 0.29 50 Click to see details
LIHC 0.062 0.34 -0.082 0.29 49 Click to see details
BRCA 0.041 0.36 0.012 0.46 84 Click to see details
LUSC -0.049 0.39 -0.161 0.17 38 Click to see details
PCPG 0.195 0.44 0.500 0.33 3 Click to see details
ESCA 0.052 0.44 -0.073 0.42 11 Click to see details
PAAD 0.104 0.45 0.400 0.3 4 Click to see details
KICH 0.004 0.49 -0.022 0.46 25 Click to see details
KICH 0.004 0.49 -0.022 0.46 25 Click to see details
KICH 0.004 0.49 -0.022 0.46 25 Click to see details
581 hsa-let-7e-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT002081 HMGA2 high mobility group AT-hook 2 5 5
MIRT003932 EIF3J eukaryotic translation initiation factor 3 subunit J 2 1
MIRT004469 SMC1A structural maintenance of chromosomes 1A 4 7
MIRT005718 WNT1 Wnt family member 1 4 1
MIRT006122 CCND1 cyclin D1 5 4
MIRT006404 MPL MPL proto-oncogene, thrombopoietin receptor 1 1
MIRT032098 RABGAP1L RAB GTPase activating protein 1 like 1 1
MIRT032099 DAD1 defender against cell death 1 1 1
MIRT032100 MYCN MYCN proto-oncogene, bHLH transcription factor 4 2
MIRT051413 WDR67 TBC1 domain family member 31 1 1
MIRT051414 FAM219B family with sequence similarity 219 member B 1 1
MIRT051415 C11orf91 chromosome 11 open reading frame 91 1 1
MIRT051416 CENPP centromere protein P 1 1
MIRT051417 TMEM107 transmembrane protein 107 1 1
MIRT051418 SREBF1 sterol regulatory element binding transcription factor 1 1 1
MIRT051419 DAAM1 dishevelled associated activator of morphogenesis 1 1 1
MIRT051420 DGCR8 DGCR8, microprocessor complex subunit 1 1
MIRT051421 RAP1A RAP1A, member of RAS oncogene family 1 1
MIRT051422 RPA1 replication protein A1 1 1
MIRT051423 SKIV2L Ski2 like RNA helicase 1 1
MIRT051424 AGO1 argonaute 1, RISC catalytic component 4 2
MIRT051425 RPS27 ribosomal protein S27 1 1
MIRT051426 ARNT2 aryl hydrocarbon receptor nuclear translocator 2 1 1
MIRT051427 GPM6B glycoprotein M6B 1 1
MIRT051428 TTLL12 tubulin tyrosine ligase like 12 1 1
MIRT051429 HIST2H2BF histone cluster 2 H2B family member f 1 1
MIRT051430 CELF2 CUGBP Elav-like family member 2 1 1
MIRT051431 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT051432 VPS13D vacuolar protein sorting 13 homolog D 1 1
MIRT051433 RPL10 ribosomal protein L10 1 1
MIRT051434 SPCS2 signal peptidase complex subunit 2 1 1
MIRT051435 DCAF8 DDB1 and CUL4 associated factor 8 1 1
MIRT051436 CTC1 CST telomere replication complex component 1 1 1
MIRT051437 NAA60 N(alpha)-acetyltransferase 60, NatF catalytic subunit 1 1
MIRT051438 PHF3 PHD finger protein 3 1 1
MIRT051439 TUBA1B tubulin alpha 1b 1 1
MIRT051440 SHANK1 SH3 and multiple ankyrin repeat domains 1 1 1
MIRT051441 SKA2 spindle and kinetochore associated complex subunit 2 1 1
MIRT051442 SPTBN1 spectrin beta, non-erythrocytic 1 1 1
MIRT051443 ND2 MTND2 1 1
MIRT051444 MED13L mediator complex subunit 13 like 1 1
MIRT051445 RCOR3 REST corepressor 3 1 1
MIRT051446 MACF1 microtubule-actin crosslinking factor 1 1 1
MIRT051447 RDX radixin 2 5
MIRT051448 PCBP2 poly(rC) binding protein 2 1 1
MIRT051449 UBAP2L ubiquitin associated protein 2 like 1 1
MIRT051450 CDCA3 cell division cycle associated 3 1 1
MIRT051451 CABLES1 Cdk5 and Abl enzyme substrate 1 1 1
MIRT051452 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 1
MIRT051453 C12orf49 chromosome 12 open reading frame 49 1 1
MIRT051454 TIMP3 TIMP metallopeptidase inhibitor 3 1 1
MIRT051455 WBSCR16 RCC1 like 1 1
MIRT051456 SLC2A11 solute carrier family 2 member 11 1 1
MIRT051457 NF1 neurofibromin 1 1 1
MIRT051458 LRRC8A leucine rich repeat containing 8 VRAC subunit A 1 1
MIRT051459 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT051460 DTNB dystrobrevin beta 1 1
MIRT051461 SCMH1 Scm polycomb group protein homolog 1 1 1
MIRT051462 YWHAG tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein gamma 1 1
MIRT051463 RHBDD2 rhomboid domain containing 2 1 1
MIRT051464 ND5 NADH dehydrogenase, subunit 5 (complex I) 1 1
MIRT051465 NDST1 N-deacetylase and N-sulfotransferase 1 1 1
MIRT051466 IGF2BP3 insulin like growth factor 2 mRNA binding protein 3 2 5
MIRT051467 EIF4A1 eukaryotic translation initiation factor 4A1 1 1
MIRT051468 BAHCC1 BAH domain and coiled-coil containing 1 1 1
MIRT051469 CARM1 coactivator associated arginine methyltransferase 1 1 1
MIRT051470 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 1 1
MIRT051471 ND3 NADH dehydrogenase, subunit 3 (complex I) 1 1
MIRT051472 PIGS phosphatidylinositol glycan anchor biosynthesis class S 1 1
MIRT051473 ALG13 ALG13, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT051474 RPN2 ribophorin II 1 1
MIRT051475 RPL12 ribosomal protein L12 1 1
MIRT051476 NME4 NME/NM23 nucleoside diphosphate kinase 4 1 1
MIRT051477 IVD isovaleryl-CoA dehydrogenase 1 1
MIRT051478 JAZF1 JAZF zinc finger 1 1 1
MIRT051479 ND4 NADH dehydrogenase, subunit 4 (complex I) 1 1
MIRT051480 VARS valyl-tRNA synthetase 1 1
MIRT051481 RNF26 ring finger protein 26 1 1
MIRT051482 LHFPL2 LHFPL tetraspan subfamily member 2 1 1
MIRT051483 ARCN1 archain 1 1 1
MIRT051484 COX1 cytochrome c oxidase subunit I 1 1
MIRT051485 SLC12A4 solute carrier family 12 member 4 1 1
MIRT051486 AEBP2 AE binding protein 2 1 1
MIRT051487 PET112 glutamyl-tRNA amidotransferase subunit B 1 1
MIRT051488 UROC1 urocanate hydratase 1 1 1
MIRT051489 IGF1R insulin like growth factor 1 receptor 5 10
MIRT051490 BSDC1 BSD domain containing 1 1 1
MIRT051491 PTK2 protein tyrosine kinase 2 1 1
MIRT051492 CDC5L cell division cycle 5 like 1 1
MIRT051493 EN2 engrailed homeobox 2 1 1
MIRT051494 SSB Sjogren syndrome antigen B 1 1
MIRT051495 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT051496 RRAGC Ras related GTP binding C 1 1
MIRT051497 ZNF236 zinc finger protein 236 1 1
MIRT051498 SEMA4B semaphorin 4B 1 1
MIRT051499 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT051500 XIAP X-linked inhibitor of apoptosis 1 1
MIRT051501 GTF2I general transcription factor IIi 1 1
MIRT051502 JMJD1C jumonji domain containing 1C 1 1
MIRT051503 OTUD5 OTU deubiquitinase 5 1 1
MIRT051504 NOLC1 nucleolar and coiled-body phosphoprotein 1 1 1
MIRT051505 PPIG peptidylprolyl isomerase G 1 1
MIRT051506 PSMD2 proteasome 26S subunit, non-ATPase 2 1 1
MIRT051507 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 1 1
MIRT051508 VAMP2 vesicle associated membrane protein 2 1 1
MIRT051509 LSR lipolysis stimulated lipoprotein receptor 1 1
MIRT051510 KIAA0355 KIAA0355 1 1
MIRT051511 RPSA ribosomal protein SA 1 1
MIRT051512 DCAF6 DDB1 and CUL4 associated factor 6 1 1
MIRT051513 UHRF1BP1 UHRF1 binding protein 1 1 1
MIRT051514 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT051515 PIGP phosphatidylinositol glycan anchor biosynthesis class P 1 1
MIRT051516 LMLN leishmanolysin like peptidase 1 1
MIRT051517 PPP2R1A protein phosphatase 2 scaffold subunit Aalpha 1 1
MIRT051518 HIPK1 homeodomain interacting protein kinase 1 1 1
MIRT051519 SERF2 small EDRK-rich factor 2 1 1
MIRT051520 RBM4 RNA binding motif protein 4 1 1
MIRT051521 RBM14 RNA binding motif protein 14 1 1
MIRT051522 HMGB1 high mobility group box 1 1 1
MIRT051523 GMPS guanine monophosphate synthase 1 1
MIRT051524 DIAPH1 diaphanous related formin 1 1 1
MIRT051525 STAM signal transducing adaptor molecule 1 1
MIRT051526 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT051527 APPL1 adaptor protein, phosphotyrosine interacting with PH domain and leucine zipper 1 1 1
MIRT051528 MARCH5 membrane associated ring-CH-type finger 5 1 1
MIRT051529 SQLE squalene epoxidase 1 1
MIRT051530 TIMM50 translocase of inner mitochondrial membrane 50 1 1
MIRT051531 NDUFA3 NADH:ubiquinone oxidoreductase subunit A3 1 1
MIRT051532 NDUFS5 NADH:ubiquinone oxidoreductase subunit S5 1 1
MIRT051533 NRSN2 neurensin 2 1 1
MIRT051534 SALL1 spalt like transcription factor 1 1 1
MIRT051535 COX3 cytochrome c oxidase III 1 1
MIRT051536 RABL6 RAB, member RAS oncogene family like 6 1 1
MIRT051537 SUPT4H1 SPT4 homolog, DSIF elongation factor subunit 1 1
MIRT051538 PACS2 phosphofurin acidic cluster sorting protein 2 1 1
MIRT051539 MTMR14 myotubularin related protein 14 1 1
MIRT051540 LUZP1 leucine zipper protein 1 1 1
MIRT051541 PFAS phosphoribosylformylglycinamidine synthase 1 1
MIRT051542 SUZ12 SUZ12 polycomb repressive complex 2 subunit 1 1
MIRT051543 PAPD4 poly(A) RNA polymerase D4, non-canonical 1 1
MIRT051544 QSOX1 quiescin sulfhydryl oxidase 1 1 1
MIRT051545 SPATA13 spermatogenesis associated 13 1 1
MIRT051546 DHX57 DExH-box helicase 57 1 1
MIRT051547 KATNB1 katanin regulatory subunit B1 1 1
MIRT051548 COL6A1 collagen type VI alpha 1 chain 1 1
MIRT051549 DHX15 DEAH-box helicase 15 1 1
MIRT051550 MTCH2 mitochondrial carrier 2 1 1
MIRT051551 KIAA0100 KIAA0100 1 1
MIRT051552 SUGP2 SURP and G-patch domain containing 2 1 1
MIRT051553 NCLN nicalin 1 1
MIRT051554 ATXN2L ataxin 2 like 1 1
MIRT051555 CHD9 chromodomain helicase DNA binding protein 9 1 1
MIRT051556 PES1 pescadillo ribosomal biogenesis factor 1 1 1
MIRT051557 NUP155 nucleoporin 155 2 7
MIRT051558 GNG5 G protein subunit gamma 5 2 3
MIRT051559 ARHGAP19 Rho GTPase activating protein 19 1 1
MIRT051560 MTFR1 mitochondrial fission regulator 1 1 1
MIRT051561 IRS2 insulin receptor substrate 2 2 1
MIRT051562 IRS4 insulin receptor substrate 4 1 1
MIRT051563 PPP1R10 protein phosphatase 1 regulatory subunit 10 1 1
MIRT051564 ZNF284 zinc finger protein 284 1 1
MIRT051565 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon 1 1
MIRT051566 SCD stearoyl-CoA desaturase 1 1
MIRT051567 FDPS farnesyl diphosphate synthase 1 1
MIRT051568 KRBOX4 KRAB box domain containing 4 1 1
MIRT051569 BRI3 brain protein I3 1 1
MIRT051570 CHD7 chromodomain helicase DNA binding protein 7 1 1
MIRT051571 PYCR1 pyrroline-5-carboxylate reductase 1 1 1
MIRT051572 SMAP2 small ArfGAP2 1 1
MIRT051573 WDFY3 WD repeat and FYVE domain containing 3 1 1
MIRT051574 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT051575 SRSF2 serine and arginine rich splicing factor 2 1 1
MIRT051576 PGD phosphogluconate dehydrogenase 1 1
MIRT051577 RMND5A required for meiotic nuclear division 5 homolog A 1 1
MIRT051578 ZNF652 zinc finger protein 652 1 1
MIRT051579 PSMA6 proteasome subunit alpha 6 1 1
MIRT051580 SLC38A2 solute carrier family 38 member 2 1 1
MIRT051581 LRRC41 leucine rich repeat containing 41 1 1
MIRT051582 RANBP2 RAN binding protein 2 1 1
MIRT051583 SVIL supervillin 1 1
MIRT051584 CCNG1 cyclin G1 1 1
MIRT051585 ZNF256 zinc finger protein 256 1 1
MIRT051586 COPG1 coatomer protein complex subunit gamma 1 1 1
MIRT051587 PDCD11 programmed cell death 11 1 1
MIRT051588 CNBP CCHC-type zinc finger nucleic acid binding protein 1 1
MIRT051589 USP37 ubiquitin specific peptidase 37 1 1
MIRT051590 UBE2V2 ubiquitin conjugating enzyme E2 V2 1 1
MIRT051591 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT051592 LMNA lamin A/C 1 1
MIRT051593 STAT3 signal transducer and activator of transcription 3 1 1
MIRT051594 TRPV1 transient receptor potential cation channel subfamily V member 1 1 1
MIRT051595 MATR3 matrin 3 1 1
MIRT051596 HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) 1 1
MIRT051597 HS6ST2 heparan sulfate 6-O-sulfotransferase 2 1 1
MIRT051598 WDR48 WD repeat domain 48 1 1
MIRT051599 RBM8A RNA binding motif protein 8A 1 1
MIRT051600 SCYL1 SCY1 like pseudokinase 1 1 1
MIRT051601 C19orf48 chromosome 19 open reading frame 48 1 1
MIRT051602 FOXD4L6 forkhead box D4 like 6 1 1
MIRT051603 PIGN phosphatidylinositol glycan anchor biosynthesis class N 1 1
MIRT051604 SPCS3 signal peptidase complex subunit 3 1 1
MIRT051605 TNFAIP1 TNF alpha induced protein 1 1 1
MIRT051606 MS4A10 membrane spanning 4-domains A10 1 1
MIRT051607 MSMO1 methylsterol monooxygenase 1 1 1
MIRT051608 ARID1A AT-rich interaction domain 1A 1 1
MIRT051609 NCKIPSD NCK interacting protein with SH3 domain 2 5
MIRT051610 NCBP1 nuclear cap binding protein subunit 1 1 1
MIRT051611 COX16 COX16, cytochrome c oxidase assembly homolog 1 1
MIRT051612 NUDT8 nudix hydrolase 8 1 1
MIRT051613 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT051614 TXNRD1 thioredoxin reductase 1 1 1
MIRT051615 ELMSAN1 ELM2 and Myb/SANT domain containing 1 1 1
MIRT051616 CTSA cathepsin A 1 1
MIRT051617 PRRC2A proline rich coiled-coil 2A 1 1
MIRT051618 SPAG9 sperm associated antigen 9 1 1
MIRT051619 AGMAT agmatinase 1 1
MIRT051620 NCKAP5L NCK associated protein 5 like 1 1
MIRT051621 ZFP62 ZFP62 zinc finger protein 1 1
MIRT051622 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 1 1
MIRT051623 POLR3D RNA polymerase III subunit D 2 3
MIRT051624 PRPF8 pre-mRNA processing factor 8 1 1
MIRT051625 ATP6 ATP synthase F0 subunit 6 1 1
MIRT051626 ZFAND5 zinc finger AN1-type containing 5 1 1
MIRT051627 BAZ1B bromodomain adjacent to zinc finger domain 1B 1 1
MIRT051628 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT051629 BMP2K BMP2 inducible kinase 1 1
MIRT051630 SPN sialophorin 1 1
MIRT051631 PA2G4 proliferation-associated 2G4 1 1
MIRT051632 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 1
MIRT051633 TUBB4B tubulin beta 4B class IVb 1 1
MIRT051634 TRRAP transformation/transcription domain associated protein 1 1
MIRT051635 SLCO4A1 solute carrier organic anion transporter family member 4A1 1 1
MIRT051636 CCRN4L nocturnin 1 1
MIRT051637 USE1 unconventional SNARE in the ER 1 1 1
MIRT051638 STARD7 StAR related lipid transfer domain containing 7 1 1
MIRT051639 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 3
MIRT051640 CLTC clathrin heavy chain 1 1
MIRT051641 TERF1 telomeric repeat binding factor 1 1 1
MIRT051642 PAX3 paired box 3 1 1
MIRT051643 CCDC97 coiled-coil domain containing 97 1 1
MIRT051644 HLA-C major histocompatibility complex, class I, C 1 1
MIRT051645 GTPBP8 GTP binding protein 8 (putative) 1 1
MIRT051646 VGLL4 vestigial like family member 4 1 1
MIRT051647 ANKRD40 ankyrin repeat domain 40 1 1
MIRT051648 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U like 1 1 1
MIRT051649 ND1 NADH dehydrogenase, subunit 1 (complex I) 1 1
MIRT051650 DSP desmoplakin 1 1
MIRT051651 UBN2 ubinuclein 2 1 1
MIRT051652 ZNF805 zinc finger protein 805 1 1
MIRT051653 RBBP4 RB binding protein 4, chromatin remodeling factor 1 1
MIRT051654 OCLN occludin 1 1
MIRT051655 CBX5 chromobox 5 2 3
MIRT051656 AMPD2 adenosine monophosphate deaminase 2 1 1
MIRT051657 MKI67 marker of proliferation Ki-67 1 1
MIRT051658 SUB1 SUB1 homolog, transcriptional regulator 1 1
MIRT051659 RSL1D1 ribosomal L1 domain containing 1 1 1
MIRT051660 SEC23IP SEC23 interacting protein 1 1
MIRT051661 RNMT RNA guanine-7 methyltransferase 1 1
MIRT051662 SGSM3 small G protein signaling modulator 3 1 1
MIRT051663 ZFP3 ZFP3 zinc finger protein 1 1
MIRT051664 GLUL glutamate-ammonia ligase 1 1
MIRT051665 POLD1 DNA polymerase delta 1, catalytic subunit 1 1
MIRT051666 WDR4 WD repeat domain 4 1 1
MIRT051667 PPP1R2 protein phosphatase 1 regulatory inhibitor subunit 2 1 1
MIRT051668 RAI2 retinoic acid induced 2 1 1
MIRT051669 PLCXD1 phosphatidylinositol specific phospholipase C X domain containing 1 1 1
MIRT051670 UTP15 UTP15, small subunit processome component 1 1
MIRT051671 THADA THADA, armadillo repeat containing 1 1
MIRT051672 ZNF451 zinc finger protein 451 1 1
MIRT051673 CREBBP CREB binding protein 1 1
MIRT051674 ZNF770 zinc finger protein 770 1 1
MIRT051675 CLDN4 claudin 4 1 1
MIRT051676 ZKSCAN7 zinc finger with KRAB and SCAN domains 7 1 1
MIRT051677 NICN1 nicolin 1 1 1
MIRT051678 RPLP2 ribosomal protein lateral stalk subunit P2 1 1
MIRT051679 DCBLD2 discoidin, CUB and LCCL domain containing 2 1 1
MIRT051680 IRGQ immunity related GTPase Q 1 1
MIRT051681 CA5B carbonic anhydrase 5B 1 1
MIRT051682 COX14 COX14, cytochrome c oxidase assembly factor 1 1
MIRT051683 PSD3 pleckstrin and Sec7 domain containing 3 1 1
MIRT051684 RPL27A ribosomal protein L27a 1 1
MIRT051685 CWC15 CWC15 spliceosome associated protein homolog 1 1
MIRT051686 NT5DC2 5'-nucleotidase domain containing 2 1 1
MIRT051687 OR7D2 olfactory receptor family 7 subfamily D member 2 1 1
MIRT051688 HIF1AN hypoxia inducible factor 1 alpha subunit inhibitor 1 1
MIRT051689 NUDT15 nudix hydrolase 15 1 1
MIRT051690 CDH18 cadherin 18 1 1
MIRT051691 FAM160B1 family with sequence similarity 160 member B1 1 1
MIRT051692 DZIP1 DAZ interacting zinc finger protein 1 1 1
MIRT051693 TDRD7 tudor domain containing 7 1 1
MIRT051694 TCF4 transcription factor 4 1 1
MIRT051695 ENSA endosulfine alpha 1 1
MIRT051696 GTF3C1 general transcription factor IIIC subunit 1 1 1
MIRT051697 TNFRSF1A TNF receptor superfamily member 1A 1 1
MIRT051698 CCDC113 coiled-coil domain containing 113 1 1
MIRT051699 MYO9B myosin IXB 1 1
MIRT051700 COX10 COX10, heme A:farnesyltransferase cytochrome c oxidase assembly factor 1 1
MIRT051701 PRAMEF13 PRAME family member 13 1 1
MIRT051702 PMPCA peptidase, mitochondrial processing alpha subunit 2 5
MIRT051703 MRPS2 mitochondrial ribosomal protein S2 1 1
MIRT051704 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT051705 CCDC106 coiled-coil domain containing 106 1 1
MIRT051706 CYP2B6 cytochrome P450 family 2 subfamily B member 6 1 1
MIRT051707 CDKAL1 CDK5 regulatory subunit associated protein 1 like 1 2 3
MIRT051708 PSME4 proteasome activator subunit 4 1 1
MIRT051709 SETD1A SET domain containing 1A 1 1
MIRT054561 MMP9 matrix metallopeptidase 9 3 1
MIRT054579 IGF1 insulin like growth factor 1 3 1
MIRT063195 ADIPOR2 adiponectin receptor 2 2 2
MIRT065687 ESPL1 extra spindle pole bodies like 1, separase 2 4
MIRT067399 TMTC3 transmembrane and tetratricopeptide repeat containing 3 2 2
MIRT068154 TXLNA taxilin alpha 2 2
MIRT068528 NHLRC3 NHL repeat containing 3 2 6
MIRT068789 FNDC3A fibronectin type III domain containing 3A 2 2
MIRT073006 ARID3B AT-rich interaction domain 3B 2 6
MIRT076223 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 2 6
MIRT077616 IGF2BP1 insulin like growth factor 2 mRNA binding protein 1 2 2
MIRT080398 ONECUT2 one cut homeobox 2 2 2
MIRT083300 ZCCHC3 zinc finger CCHC-type containing 3 2 2
MIRT084976 BACH1 BTB domain and CNC homolog 1 2 2
MIRT094160 PCGF3 polycomb group ring finger 3 2 6
MIRT094460 SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 2 4
MIRT095766 GRPEL2 GrpE like 2, mitochondrial 2 10
MIRT100094 ABT1 activator of basal transcription 1 2 8
MIRT112242 MDM4 MDM4, p53 regulator 2 4
MIRT118586 STK4 serine/threonine kinase 4 2 2
MIRT120921 PDE12 phosphodiesterase 12 2 8
MIRT123317 CALU calumenin 2 2
MIRT152272 TNFSF9 TNF superfamily member 9 2 2
MIRT153847 NCOA3 nuclear receptor coactivator 3 2 2
MIRT168583 HMGA1 high mobility group AT-hook 1 2 4
MIRT180603 CRY2 cryptochrome circadian clock 2 2 2
MIRT187717 SUOX sulfite oxidase 2 2
MIRT191404 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 2 2
MIRT193101 MAPK6 mitogen-activated protein kinase 6 2 2
MIRT215720 C5ORF51 chromosome 5 open reading frame 51 2 10
MIRT218815 CDKN1A cyclin dependent kinase inhibitor 1A 2 2
MIRT240330 UBXN2B UBX domain protein 2B 2 2
MIRT243473 TRIM71 tripartite motif containing 71 2 2
MIRT244069 EDN1 endothelin 1 2 2
MIRT252330 SALL3 spalt like transcription factor 3 2 2
MIRT255314 CDV3 CDV3 homolog 2 2
MIRT259277 PGRMC1 progesterone receptor membrane component 1 2 2
MIRT259479 TXLNG taxilin gamma 2 2
MIRT260707 CLDN12 claudin 12 2 6
MIRT264693 C11ORF57 chromosome 11 open reading frame 57 2 4
MIRT266212 PEX11B peroxisomal biogenesis factor 11 beta 2 2
MIRT266626 CHTOP chromatin target of PRMT1 2 2
MIRT268839 C1ORF21 chromosome 1 open reading frame 21 2 2
MIRT294446 ZNF264 zinc finger protein 264 2 2
MIRT297013 RRM2 ribonucleotide reductase regulatory subunit M2 2 2
MIRT297443 SLC20A1 solute carrier family 20 member 1 2 4
MIRT300037 BZW1 basic leucine zipper and W2 domains 1 2 4
MIRT300893 KREMEN1 kringle containing transmembrane protein 1 2 2
MIRT303320 MXD1 MAX dimerization protein 1 2 2
MIRT309846 NAT8L N-acetyltransferase 8 like 2 2
MIRT322428 PPP2R2A protein phosphatase 2 regulatory subunit Balpha 2 2
MIRT324731 ACER2 alkaline ceramidase 2 2 2
MIRT402057 ATP6V1F ATPase H+ transporting V1 subunit F 2 4
MIRT437395 LIN28A lin-28 homolog A 4 1
MIRT437396 AURKB aurora kinase B 4 1
MIRT437435 EZH2 enhancer of zeste 2 polycomb repressive complex 2 subunit 2 1
MIRT438632 TNFRSF10B TNF receptor superfamily member 10b 2 1
MIRT439135 MYC MYC proto-oncogene, bHLH transcription factor 0 1
MIRT442020 NDUFA4P1 NDUFA4, mitochondrial complex associated pseudogene 1 2 2
MIRT445658 ATP6V1G1 ATPase H+ transporting V1 subunit G1 2 6
MIRT447136 KIF27 kinesin family member 27 2 2
MIRT448259 ZNF774 zinc finger protein 774 2 2
MIRT449005 ANKRD46 ankyrin repeat domain 46 2 2
MIRT449953 FMNL3 formin like 3 2 2
MIRT451155 C19orf53 chromosome 19 open reading frame 53 2 2
MIRT451624 MEIS3P1 Meis homeobox 3 pseudogene 1 2 2
MIRT451693 C1RL complement C1r subcomponent like 2 2
MIRT452092 NUCB2 nucleobindin 2 2 2
MIRT452431 QDPR quinoid dihydropteridine reductase 2 2
MIRT452943 DISC1 disrupted in schizophrenia 1 2 2
MIRT453401 RHD Rh blood group D antigen 2 6
MIRT454164 HIST1H2BK histone cluster 1 H2B family member k 2 2
MIRT454280 FXN frataxin 2 2
MIRT454539 RABL2A RAB, member of RAS oncogene family like 2A 2 2
MIRT454854 ACOT9 acyl-CoA thioesterase 9 2 4
MIRT455676 GLO1 glyoxalase I 2 2
MIRT457248 RABL2B RAB, member of RAS oncogene family like 2B 2 2
MIRT457677 ZNF587 zinc finger protein 587 2 2
MIRT457887 THEM6 thioesterase superfamily member 6 2 4
MIRT458016 MRPL12 mitochondrial ribosomal protein L12 2 2
MIRT458279 FUT10 fucosyltransferase 10 2 2
MIRT459736 RRM1 ribonucleotide reductase catalytic subunit M1 2 2
MIRT460453 NOM1 nucleolar protein with MIF4G domain 1 2 4
MIRT460500 FAM105A family with sequence similarity 105 member A 2 6
MIRT460938 NOA1 nitric oxide associated 1 2 4
MIRT461092 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT461169 SLC11A2 solute carrier family 11 member 2 2 4
MIRT461364 COL8A1 collagen type VIII alpha 1 chain 2 2
MIRT462382 YAE1D1 Yae1 domain containing 1 2 2
MIRT462780 ZNF8 zinc finger protein 8 2 2
MIRT463420 ZC3HAV1L zinc finger CCCH-type containing, antiviral 1 like 2 2
MIRT463662 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 2 2
MIRT464265 VCL vinculin 2 2
MIRT465122 TSC22D2 TSC22 domain family member 2 2 4
MIRT466184 TMED5 transmembrane p24 trafficking protein 5 2 4
MIRT466722 SYNJ2BP synaptojanin 2 binding protein 2 2
MIRT469102 RNF144B ring finger protein 144B 2 2
MIRT469714 RAB40C RAB40C, member RAS oncogene family 2 2
MIRT470425 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 2
MIRT470679 POLR2D RNA polymerase II subunit D 2 4
MIRT470861 PLXND1 plexin D1 2 2
MIRT471271 PGM2L1 phosphoglucomutase 2 like 1 2 2
MIRT471957 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT472672 NAA20 N(alpha)-acetyltransferase 20, NatB catalytic subunit 2 2
MIRT472739 MTUS1 microtubule associated scaffold protein 1 2 6
MIRT473134 MLLT10 MLLT10, histone lysine methyltransferase DOT1L cofactor 2 2
MIRT473234 SMCR7L mitochondrial elongation factor 1 1 4
MIRT473828 MAP2K7 mitogen-activated protein kinase kinase 7 2 2
MIRT473940 LYN LYN proto-oncogene, Src family tyrosine kinase 2 2
MIRT474022 LRRC20 leucine rich repeat containing 20 2 2
MIRT474502 KLHDC8B kelch domain containing 8B 2 2
MIRT474766 KIAA0930 KIAA0930 2 2
MIRT474905 KCTD21 potassium channel tetramerization domain containing 21 2 2
MIRT475331 IFNLR1 interferon lambda receptor 1 2 2
MIRT475379 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT475733 HERPUD1 homocysteine inducible ER protein with ubiquitin like domain 1 2 4
MIRT476548 GABPB1 GA binding protein transcription factor beta subunit 1 2 4
MIRT476973 FAM83G family with sequence similarity 83 member G 2 4
MIRT477534 EIF4G2 eukaryotic translation initiation factor 4 gamma 2 2 4
MIRT477682 EFHD2 EF-hand domain family member D2 2 2
MIRT481201 ATXN7L3B ataxin 7 like 3B 2 4
MIRT481241 ATXN7L3 ataxin 7 like 3 2 2
MIRT481363 ATG9A autophagy related 9A 2 2
MIRT481388 ATG12 autophagy related 12 2 2
MIRT481652 AREL1 apoptosis resistant E3 ubiquitin protein ligase 1 2 2
MIRT481851 AP1S1 adaptor related protein complex 1 sigma 1 subunit 2 2
MIRT482184 AHR aryl hydrocarbon receptor 2 2
MIRT482220 AHCYL2 adenosylhomocysteinase like 2 2 2
MIRT485296 PLAGL2 PLAG1 like zinc finger 2 2 2
MIRT486659 ZNF28 zinc finger protein 28 2 2
MIRT489413 TUBB2A tubulin beta 2A class IIa 2 2
MIRT491867 ZBTB5 zinc finger and BTB domain containing 5 2 8
MIRT492216 SOCS1 suppressor of cytokine signaling 1 2 2
MIRT492626 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 2 2
MIRT493323 LIMD2 LIM domain containing 2 2 2
MIRT493901 FAM43A family with sequence similarity 43 member A 2 4
MIRT494263 CEP120 centrosomal protein 120 2 2
MIRT494687 ARID3A AT-rich interaction domain 3A 2 2
MIRT495968 TBC1D19 TBC1 domain family member 19 2 2
MIRT496111 SNX17 sorting nexin 17 2 2
MIRT497875 SLC12A7 solute carrier family 12 member 7 2 2
MIRT498122 PLEKHO1 pleckstrin homology domain containing O1 2 4
MIRT499405 PLCG2 phospholipase C gamma 2 2 4
MIRT499493 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 2 2
MIRT499653 SDR42E1 short chain dehydrogenase/reductase family 42E, member 1 2 2
MIRT499942 MFSD8 major facilitator superfamily domain containing 8 2 2
MIRT499997 HIST1H2BD histone cluster 1 H2B family member d 2 4
MIRT500819 THBS1 thrombospondin 1 2 3
MIRT500902 STRN striatin 2 4
MIRT501118 SLC5A6 solute carrier family 5 member 6 2 4
MIRT501173 SLC10A7 solute carrier family 10 member 7 2 6
MIRT501202 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT501241 SEMA4C semaphorin 4C 2 6
MIRT501328 RNFT1 ring finger protein, transmembrane 1 2 2
MIRT501355 RNF44 ring finger protein 44 2 4
MIRT501387 RBFOX2 RNA binding protein, fox-1 homolog 2 2 10
MIRT501441 RAB11FIP4 RAB11 family interacting protein 4 2 2
MIRT501759 NSD1 nuclear receptor binding SET domain protein 1 2 2
MIRT501943 MBD2 methyl-CpG binding domain protein 2 2 8
MIRT502106 KPNA5 karyopherin subunit alpha 5 2 8
MIRT502130 KMT2D lysine methyltransferase 2D 2 4
MIRT502784 CEP135 centrosomal protein 135 2 2
MIRT502845 CELF1 CUGBP Elav-like family member 1 2 2
MIRT504789 C12orf4 chromosome 12 open reading frame 4 2 2
MIRT505017 ZNF644 zinc finger protein 644 2 2
MIRT506942 IGDCC4 immunoglobulin superfamily DCC subclass member 4 2 6
MIRT507252 FIGN fidgetin, microtubule severing factor 2 8
MIRT507694 COIL coilin 2 6
MIRT508401 C1orf210 chromosome 1 open reading frame 210 2 6
MIRT508665 DIABLO diablo IAP-binding mitochondrial protein 2 4
MIRT508932 AK4 adenylate kinase 4 2 4
MIRT510395 ZNF566 zinc finger protein 566 2 6
MIRT510518 YOD1 YOD1 deubiquitinase 2 6
MIRT511386 IKZF3 IKAROS family zinc finger 3 2 4
MIRT512745 CD59 CD59 molecule (CD59 blood group) 2 4
MIRT515954 C9orf156 tRNA methyltransferase O 2 2
MIRT516083 ZBTB8OS zinc finger and BTB domain containing 8 opposite strand 2 4
MIRT523619 FZD9 frizzled class receptor 9 2 4
MIRT523733 FBXW2 F-box and WD repeat domain containing 2 2 4
MIRT523990 DVL3 dishevelled segment polarity protein 3 2 2
MIRT524113 DNA2 DNA replication helicase/nuclease 2 2 2
MIRT525727 SOD2 superoxide dismutase 2 2 2
MIRT527763 RRAD RRAD, Ras related glycolysis inhibitor and calcium channel regulator 2 2
MIRT529727 OPRL1 opioid related nociceptin receptor 1 2 2
MIRT533187 WASL Wiskott-Aldrich syndrome like 2 6
MIRT536378 LEFTY1 left-right determination factor 1 2 2
MIRT543785 RBM12B RNA binding motif protein 12B 2 4
MIRT543868 SLC16A9 solute carrier family 16 member 9 2 2
MIRT545387 PM20D2 peptidase M20 domain containing 2 2 2
MIRT545890 ZNF200 zinc finger protein 200 2 4
MIRT546334 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT547373 MSI2 musashi RNA binding protein 2 2 2
MIRT547579 LRIG3 leucine rich repeats and immunoglobulin like domains 3 2 4
MIRT548264 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT548351 EPHA4 EPH receptor A4 2 2
MIRT548534 DUSP1 dual specificity phosphatase 1 2 2
MIRT548560 DNAL1 dynein axonemal light chain 1 2 2
MIRT548779 COLEC12 collectin subfamily member 12 2 2
MIRT548978 CCNT2 cyclin T2 2 2
MIRT549208 BEND4 BEN domain containing 4 2 4
MIRT549763 ZNF611 zinc finger protein 611 2 6
MIRT549799 KIAA0391 KIAA0391 2 2
MIRT549847 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 2
MIRT550898 ACTA1 actin, alpha 1, skeletal muscle 2 2
MIRT551283 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 2 6
MIRT551318 GSG2 histone H3 associated protein kinase 2 6
MIRT551932 AKAP8 A-kinase anchoring protein 8 2 4
MIRT552003 RAD18 RAD18, E3 ubiquitin protein ligase 2 2
MIRT552410 ZNF460 zinc finger protein 460 2 4
MIRT553013 USP38 ubiquitin specific peptidase 38 2 2
MIRT555550 PLEKHA3 pleckstrin homology domain containing A3 2 2
MIRT555711 PDZD8 PDZ domain containing 8 2 2
MIRT557372 HAND1 heart and neural crest derivatives expressed 1 2 2
MIRT557960 FAM222B family with sequence similarity 222 member B 2 2
MIRT559087 C19orf47 chromosome 19 open reading frame 47 2 4
MIRT559497 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 2
MIRT561772 PEG10 paternally expressed 10 2 2
MIRT564402 EMILIN2 elastin microfibril interfacer 2 2 4
MIRT565443 SURF4 surfeit 4 2 2
MIRT566518 PARP16 poly(ADP-ribose) polymerase family member 16 2 2
MIRT567715 E2F6 E2F transcription factor 6 2 2
MIRT568655 ABHD17C abhydrolase domain containing 17C 2 2
MIRT569498 THYN1 thymocyte nuclear protein 1 2 2
MIRT573820 TGOLN2 trans-golgi network protein 2 2 2
MIRT574363 ZBTB37 zinc finger and BTB domain containing 37 2 2
MIRT574750 GOLGA4 golgin A4 2 2
MIRT574788 FAM104A family with sequence similarity 104 member A 2 2
MIRT576089 Poteg POTE ankyrin domain family, member G 2 2
MIRT576812 Thbs1 thrombospondin 1 2 3
MIRT616370 RWDD1 RWD domain containing 1 2 2
MIRT617851 FMO4 flavin containing monooxygenase 4 2 2
MIRT642394 ZNF556 zinc finger protein 556 2 2
MIRT680519 PRIM2 DNA primase subunit 2 2 2
MIRT680547 ZNF584 zinc finger protein 584 2 2
MIRT680800 ZNF578 zinc finger protein 578 2 2
MIRT680838 ARL8B ADP ribosylation factor like GTPase 8B 2 2
MIRT681141 INTS7 integrator complex subunit 7 2 2
MIRT681271 RFC2 replication factor C subunit 2 2 2
MIRT681323 ZFAND4 zinc finger AN1-type containing 4 2 4
MIRT681359 BRI3BP BRI3 binding protein 2 2
MIRT681506 STAT2 signal transducer and activator of transcription 2 2 2
MIRT681536 ZNF738 zinc finger protein 738 2 2
MIRT681658 DTX3L deltex E3 ubiquitin ligase 3L 2 2
MIRT681738 RAB19 RAB19, member RAS oncogene family 2 4
MIRT681797 EIF4A3 eukaryotic translation initiation factor 4A3 2 2
MIRT681869 DNAH9 dynein axonemal heavy chain 9 2 2
MIRT681941 SLC19A3 solute carrier family 19 member 3 2 2
MIRT682102 ITGA3 integrin subunit alpha 3 2 4
MIRT682181 SLC38A7 solute carrier family 38 member 7 2 2
MIRT682238 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT682384 PHACTR4 phosphatase and actin regulator 4 2 2
MIRT682444 MTX3 metaxin 3 2 2
MIRT682604 CPA4 carboxypeptidase A4 2 2
MIRT682640 COX6B1 cytochrome c oxidase subunit 6B1 2 2
MIRT689327 FPR1 formyl peptide receptor 1 2 2
MIRT689730 ATXN2 ataxin 2 2 2
MIRT691036 ZNF799 zinc finger protein 799 2 2
MIRT691935 DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 2 2
MIRT694884 ZNF417 zinc finger protein 417 2 2
MIRT695255 ZNF443 zinc finger protein 443 2 2
MIRT695413 ADH5 alcohol dehydrogenase 5 (class III), chi polypeptide 2 2
MIRT700589 PRSS22 protease, serine 22 2 2
MIRT701428 NHLRC2 NHL repeat containing 2 2 2
MIRT702484 KIAA1328 KIAA1328 2 2
MIRT702715 IPO9 importin 9 2 2
MIRT704028 EDEM3 ER degradation enhancing alpha-mannosidase like protein 3 2 2
MIRT704418 CTPS1 CTP synthase 1 2 2
MIRT705750 AMD1 adenosylmethionine decarboxylase 1 2 2
MIRT712373 NAP1L1 nucleosome assembly protein 1 like 1 2 2
MIRT713520 PAFAH2 platelet activating factor acetylhydrolase 2 2 2
MIRT731263 FASLG Fas ligand 3 1
MIRT732697 Ccr7 chemokine (C-C motif) receptor 7 2 0
MIRT732700 Snhg12 small nucleolar RNA host gene 12 2 0
MIRT734626 SYT7 synaptotagmin 7 1 0
MIRT755829 UBQLN4 ubiquilin 4 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
let-7e Docosahexaenoic acid NULL 445580 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
let-7e Hydroxamic acid HDACi LAQ824 NULL NULL Microarray breast cancer cell line SKBr3 16452179 2006 down-regulated
let-7e Doxorubicin approved 31703 Microarray ovarian cancer 19237188 2009 up-regulated
let-7e 17beta-estradiol (E2) approved 5757 Microarray MCF-7 breast cancer cells 19528081 2009 up-regulated
let-7e Etoposide approved 36462 Microarray Normal human fibroblasts (AG01522) 19633716 2009 up-regulated
let-7e Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
let-7e 5-Fluorouracil approved 3385 Microarray MCF-7 breast cancer cells 21506117 2011 down-regulated
let-7e Bicalutamide approved 2375 Microarray prostate 22674191 2012 up-regulated
let-7e Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
let-7e Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse liver 19270793 2009 down-regulated
let-7e 17beta-estradiol (E2) approved 5757 Microarray rat breast 17700064 2007 down-regulated
let-7e Marine fungal metabolite 1386A NULL NULL Microarray MCF-7 breast cancer cells. 22159329 2012 down-regulated
let-7e Ginsenoside Rh2 NULL 119307 Microarray NSCLC cell line A549 23152132 2013 down-regulated
let-7e 5-aminoimidazole-4-carboxamide-1-β-d-ribofuranoside (AICAR) NULL 16078949 Microarray hepatocytes 23107762 2013 up-regulated
let-7e Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780)
hsa-let-7e Doxorubicin 31703 NSC123127 approved resistant High Ovarian Cancer cell line (OV19, TOV21G, TOV112D, FUOV1, C13, OV2008, A2780CP, A2780S, IGROV1, T8, OVCAR5, IMCC3, A2008, OVCAR3, SKOV3, IOSER)
hsa-let-7e Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-let-7e Verapamil 2520 NSC272366 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-let-7e Cisplatin 5460033 NSC119875 approved resistant High Tongue Squamous Cell Carcinoma cell line (Tca8113)
hsa-let-7e Fluorouracil 3385 NSC19893 approved resistant High Colon Cancer cell line (DLD-1)
hsa-let-7e Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer tissue and cell line (A2780)
hsa-let-7e Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HT-29)
hsa-let-7e Paclitaxel 36314 NSC125973 approved sensitive High Pan-Cancer cell line (NCI-H460, NCI-H522, NCI-H322M, HOP62, A549, EKVX, MALME-3M, NCI-H226, HT-29, HCT-116, SE-620, HCT-15, HCC2998, COLO205, HS-578T, NCI/ADR-RES, OVCAR8, OVCAR4, ACHN, SN-12C, 786-O, CAKI-1, UO-31, TK-10, A498, SK-MEL-28, UACC-257, M14, UACC-62, SK
hsa-let-7e Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (H1155, H358, H1993)
hsa-let-7e Doxorubicin 31703 NSC123127 approved sensitive Low Gastric Cancer cell line (SGC7901)
hsa-let-7e Vincristine 5978 approved sensitive Low Gastric Cancer cell line (SGC7901)
hsa-let-7e Gefitinib 123631 NSC715055 approved sensitive High Lung Adenocarcinoma cell line (A549)
hsa-let-7e Imatinib 5291 NSC743414 approved resistant High Gastrointestinal Stromal Tumor tissue
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive High Esophageal Adenocarcinoma cell line (OE19)
hsa-let-7e Doxorubicin 31703 NSC123127 approved sensitive Low Breast Cancer tissue and cell line (MCF-7)
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780)
hsa-let-7e Plx-4720 24180719 NSC757438 resistant High Thyroid Cancer cell line (8505c, BCPAP)
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-let-7e Fluorouracil 3385 NSC19893 approved sensitive High Colorectal Cancer cell line (DLD-1)
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer cell line (A2780, HO8910, ES2, CAOV3, SKOV3)
hsa-let-7e Fluorouracil 3385 NSC19893 approved sensitive Low Colorectal Cancer cell line (HCT-8)
hsa-let-7e Daunorubicin 30323 NSC82151 approved resistant High Acute Promyelocytic Leukemia cell line (HL60)
hsa-let-7e Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7C)
hsa-let-7e Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-let-7e Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-let-7e Gefitinib 123631 NSC715055 approved sensitive Low Non-Small Cell Lung Cancer cell line (PC-9)
hsa-let-7e Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375)
hsa-let-7e Gefitinib 123631 NSC715055 approved sensitive Low Colorectal Cancer cell line (HCT-116)
hsa-let-7e Regorafenib 11167602 NSC763932 approved sensitive Low Colorectal Cancer cell line (HCT-116)
hsa-let-7e Ribavirin+Pegylated IFNa-2b resistant tissue (chronic hepatitis C)
hsa-let-7e Exemestane 60198 NSC713563 approved sensitive cell line (MCF-7)
hsa-let-7e 4-Hydroxytamoxifen+Tamoxifen resistant cell line (LY2)
hsa-let-7e Ethanol+Tamoxifen resistant cell line (LY2)
hsa-let-7e Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-let-7e Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-let-7e Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-let-7e Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-let-7e Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-let-7e Gemcitabine 60750 NSC613327 approved resistant cell line (HuH28)
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive cell line (KYSE)
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive cell line (OE19)
hsa-let-7e Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-let-7e Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-let-7e Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-let-7e Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive cell line (H460)
hsa-let-7e Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine resistant cell line (Bats-72)
hsa-let-7e-5p Alvocidib 5287969 NSC649890 resistant
hsa-let-7e-5p Ethyl, methoxy, prodigisine 135829283 NSC742418 resistant
hsa-let-7e-5p Platinum 23939 resistant Low Ovarian Cancer tissue
hsa-let-7e-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-let-7e-5p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia tissue
hsa-let-7e-5p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (AsPC-1)
hsa-let-7e-5p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CIS)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CP20)
hsa-let-7e-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-let-7e-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-let-7e-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-let-7e-5p Prednisone/Azathioprine/Methotrexate/Cyclophosphamide/Mycophenolate mofetil sensitive tissue (myasthenia gravis)
hsa-let-7e-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM17)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-let-7e-5p Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-let-7e-5p Sunitinib 5329102 NSC750690 approved sensitive tissue (clear cell renal cell carcinoma)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved resistant cell line (MGC-803)
hsa-let-7e-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-let-7e-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-let-7e-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (TOV-112D)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (OVSAHO)

Error report submission