pre-miRNA Information
pre-miRNA hsa-let-7d   
Genomic Coordinates chr9: 94178834 - 94178920
Synonyms LET7D, MIRNLET7D, hsa-let-7d, let-7d, MIRLET7D
Description Homo sapiens let-7d stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-let-7d-5p
Sequence 8| AGAGGUAGUAGGUUGCAUAGUU |29
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 3 9 + 94178843 27292188 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1462778813 2 dbSNP
rs1467512593 13 dbSNP
rs1329655735 14 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol IL13   
Synonyms IL-13, P600
Description interleukin 13
Transcript NM_002188   
Expression
Putative miRNA Targets on IL13
3'UTR of IL13
(miRNA target sites are highlighted)
>IL13|NM_002188|3'UTR
   1 AACTTCGAAAGCATCATTATTTGCAGAGACAGGACCTGACTATTGAAGTTGCAGATTCATTTTTCTTTCTGATGTCAAAA
  81 ATGTCTTGGGTAGGCGGGAAGGAGGGTTAGGGAGGGGTAAAATTCCTTAGCTTAGACCTCAGCCTGTGCTGCCCGTCTTC
 161 AGCCTAGCCGACCTCAGCCTTCCCCTTGCCCAGGGCTCAGCCTGGTGGGCCTCCTCTGTCCAGGGCCCTGAGCTCGGTGG
 241 ACCCAGGGATGACATGTCCCTACACCCCTCCCCTGCCCTAGAGCACACTGTAGCATTACAGTGGGTGCCCCCCTTGCCAG
 321 ACATGTGGTGGGACAGGGACCCACTTCACACACAGGCAACTGAGGCAGACAGCAGCTCAGGCACACTTCTTCTTGGTCTT
 401 ATTTATTATTGTGTGTTATTTAAATGAGTGTGTTTGTCACCGTTGGGGATTGGGGAAGACTGTGGCTGCTAGCACTTGGA
 481 GCCAAGGGTTCAGAGACTCAGGGCCCCAGCACTAAAGCAGTGGACACCAGGAGTCCCTGGTAATAAGTACTGTGTACAGA
 561 ATTCTGCTACCTCACTGGGGTCCTGGGGCCTCGGAGCCTCATCCGAGGCAGGGTCAGGAGAGGGGCAGAACAGCCGCTCC
 641 TGTCTGCCAGCCAGCAGCCAGCTCTCAGCCAACGAGTAATTTATTGTTTTTCCTTGTATTTAAATATTAAATATGTTAGC
 721 AAAGAGTTAATATATAGAAGGGTACCTTGAACACTGGGGGAGGGGACATTGAACAAGTTGTTTCATTGACTATCAAACTG
 801 AAGCCAGAAATAAAGTTGGTGACAGAT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' uuGAUACG----UU-GGAUGAUGGAGa 5'
            ||:||:    || :||:||||||| 
Target 5' taCTGTGTACAGAATTCTGCTACCTCa 3'
548 - 574 162.00 -22.20
2
miRNA  3' uugAUACGUUGGAU--GAUGGAGa 5'
             | | ||:||||  | ||||| 
Target 5' ccgTCTTCAGCCTAGCCGACCTCa 3'
153 - 176 133.00 -14.70
3
miRNA  3' uugauacguuggaugAUGGAGa 5'
                         |||||: 
Target 5' taatatatagaagggTACCTTg 3'
728 - 749 104.00 -6.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN2070568 27 COSMIC
COSN30464214 28 COSMIC
COSN30464217 29 COSMIC
COSN9925887 70 COSMIC
COSN31576305 86 COSMIC
COSN31532678 97 COSMIC
COSN18008011 226 COSMIC
COSN26480164 334 COSMIC
COSN21402408 369 COSMIC
COSN30540396 437 COSMIC
COSN21854767 510 COSMIC
COSN29116725 585 COSMIC
COSN31589063 670 COSMIC
rs848 527 GWAS
rs847 696 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1278764592 3 dbSNP
rs767198237 7 dbSNP
rs755393562 8 dbSNP
rs1194035013 11 dbSNP
rs1292494731 12 dbSNP
rs374535004 13 dbSNP
rs1402062143 16 dbSNP
rs558907104 17 dbSNP
rs775363860 18 dbSNP
rs1265500288 19 dbSNP
rs758955797 21 dbSNP
rs1182907294 29 dbSNP
rs1363585994 33 dbSNP
rs1438297670 36 dbSNP
rs569385458 37 dbSNP
rs2069749 38 dbSNP
rs56318025 44 dbSNP
rs1166267414 46 dbSNP
rs75868517 52 dbSNP
rs201863406 56 dbSNP
rs1490668087 60 dbSNP
rs1406734325 68 dbSNP
rs1219904606 70 dbSNP
rs1318956878 72 dbSNP
rs1285141660 73 dbSNP
rs199516826 88 dbSNP
rs1050067483 96 dbSNP
rs200797041 97 dbSNP
rs1327101003 113 dbSNP
rs1285305442 117 dbSNP
rs1224007759 121 dbSNP
rs1339738379 134 dbSNP
rs1212653614 140 dbSNP
rs201802470 155 dbSNP
rs200196698 156 dbSNP
rs200786939 161 dbSNP
rs1345567796 165 dbSNP
rs1317139482 167 dbSNP
rs1005767044 169 dbSNP
rs1430752383 170 dbSNP
rs540617089 171 dbSNP
rs1176586532 173 dbSNP
rs1307728887 196 dbSNP
rs1481045023 197 dbSNP
rs1015359911 216 dbSNP
rs375776378 218 dbSNP
rs1429291535 219 dbSNP
rs201490660 221 dbSNP
rs199955551 223 dbSNP
rs1243074553 225 dbSNP
rs1215277578 235 dbSNP
rs200895460 236 dbSNP
rs554174789 237 dbSNP
rs202233186 242 dbSNP
rs915780937 247 dbSNP
rs1322725821 253 dbSNP
rs1299020004 256 dbSNP
rs190222211 257 dbSNP
rs1362351567 258 dbSNP
rs1269420739 261 dbSNP
rs150177673 263 dbSNP
rs1263174459 264 dbSNP
rs1043320298 268 dbSNP
rs529997471 271 dbSNP
rs1336820286 277 dbSNP
rs1487591712 279 dbSNP
rs1023970992 288 dbSNP
rs1188664125 290 dbSNP
rs904337589 292 dbSNP
rs1000978586 295 dbSNP
rs201185816 296 dbSNP
rs202101165 298 dbSNP
rs200632360 301 dbSNP
rs892486627 304 dbSNP
rs1162900086 305 dbSNP
rs1008604284 312 dbSNP
rs115325936 316 dbSNP
rs1297650491 321 dbSNP
rs149809253 323 dbSNP
rs1206502615 325 dbSNP
rs926166133 326 dbSNP
rs1428482715 327 dbSNP
rs997091700 332 dbSNP
rs1290434324 336 dbSNP
rs199511991 338 dbSNP
rs200265585 339 dbSNP
rs1384737022 341 dbSNP
rs1315245681 342 dbSNP
rs201420607 349 dbSNP
rs1227498665 350 dbSNP
rs1376290789 358 dbSNP
rs1312527957 364 dbSNP
rs199804866 368 dbSNP
rs1463956502 370 dbSNP
rs1361137464 374 dbSNP
rs989362244 376 dbSNP
rs1246160320 381 dbSNP
rs1355684067 384 dbSNP
rs1168348342 385 dbSNP
rs200650844 387 dbSNP
rs982513882 387 dbSNP
rs201965069 390 dbSNP
rs1284604171 391 dbSNP
rs1445790529 397 dbSNP
rs1254146038 410 dbSNP
rs1179082956 412 dbSNP
rs766993780 421 dbSNP
rs913341120 432 dbSNP
rs944780276 437 dbSNP
rs181825588 439 dbSNP
rs959708199 440 dbSNP
rs1040391959 442 dbSNP
rs184838848 443 dbSNP
rs199713326 444 dbSNP
rs1244745302 446 dbSNP
rs921937738 449 dbSNP
rs1180463351 451 dbSNP
rs368300404 459 dbSNP
rs1319601186 461 dbSNP
rs200586394 465 dbSNP
rs527319875 466 dbSNP
rs1295685 472 dbSNP
rs765879797 473 dbSNP
rs1408558438 483 dbSNP
rs199903635 488 dbSNP
rs570083916 497 dbSNP
rs200557616 498 dbSNP
rs1378501858 502 dbSNP
rs1042965129 511 dbSNP
rs1398913417 515 dbSNP
rs1161250432 516 dbSNP
rs753119382 517 dbSNP
rs1345690699 519 dbSNP
rs925788855 522 dbSNP
rs848 527 dbSNP
rs1334443037 541 dbSNP
rs200202231 544 dbSNP
rs896939233 550 dbSNP
rs1209076475 553 dbSNP
rs1487296781 582 dbSNP
rs189329440 583 dbSNP
rs1239333758 584 dbSNP
rs1024024787 585 dbSNP
rs202204367 594 dbSNP
rs1307932616 602 dbSNP
rs181985600 603 dbSNP
rs201076793 605 dbSNP
rs202147858 606 dbSNP
rs1285638893 608 dbSNP
rs200189368 613 dbSNP
rs1312116277 615 dbSNP
rs1001579345 620 dbSNP
rs944127432 622 dbSNP
rs1386498740 623 dbSNP
rs2069750 624 dbSNP
rs899819947 636 dbSNP
rs370110665 637 dbSNP
rs997521421 641 dbSNP
rs202102174 642 dbSNP
rs1481368001 644 dbSNP
rs200635007 649 dbSNP
rs116240019 653 dbSNP
rs1198080518 658 dbSNP
rs1449598173 659 dbSNP
rs1236546650 666 dbSNP
rs1205311695 668 dbSNP
rs1471226714 669 dbSNP
rs1177840096 674 dbSNP
rs1265683665 675 dbSNP
rs989023551 677 dbSNP
rs1205089960 683 dbSNP
rs847 696 dbSNP
rs1413772598 697 dbSNP
rs1233192337 705 dbSNP
rs1329673314 707 dbSNP
rs1298244013 715 dbSNP
rs1174010299 716 dbSNP
rs1388250798 732 dbSNP
rs966142916 733 dbSNP
rs1318612635 740 dbSNP
rs138637232 742 dbSNP
rs1406938364 753 dbSNP
rs921991437 755 dbSNP
rs1171879868 760 dbSNP
rs1470028547 761 dbSNP
rs1477016909 762 dbSNP
rs1374551058 763 dbSNP
rs1015709255 765 dbSNP
rs960100878 768 dbSNP
rs932000237 778 dbSNP
rs143032763 779 dbSNP
rs1333602059 787 dbSNP
rs199848775 789 dbSNP
rs909828973 793 dbSNP
rs941266016 798 dbSNP
rs1443823880 800 dbSNP
rs546023282 813 dbSNP
rs556618159 817 dbSNP
rs1253432304 824 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions A549
Location of target site 3'UTR
Tools used in this research miRanda , RNA22 , RNAhybrid , TargetScan
Original Description (Extracted from the article) ... let-7d ...

- Kumar M; Ahmad T; Sharma A; Mabalirajan U; et al., 2011, The Journal of allergy and clinical immunology.

Article - Kumar M; Ahmad T; Sharma A; Mabalirajan U; et al.
- The Journal of allergy and clinical immunology, 2011
BACKGROUND: IL-13, a cytokine secreted by T(H)2 lymphocytes and other cells, critically modulates allergic inflammation and tissue remodeling in allergic asthma. Although much is known about transcriptional regulation of IL-13, posttranscriptional regulation is poorly understood. OBJECTIVE: Because many inflammatory pathways are known to be regulated by microRNAs, permitting a rapid and fine-tuned response, the role of microRNA-mediated regulation of IL-13 was investigated using both in vitro and in vivo studies. METHODS: A combination of in silico approaches and in vitro transfections in A549 cells and primary cultured T cells was used to demonstrate the involvement of let-7 in IL-13 regulation. Furthermore, intranasal delivery of let-7 microRNA mimic in mice was performed to study its effects in allergic airway inflammatory conditions. RESULTS: Using a combination of bioinformatics and molecular approaches, we demonstrate that the let-7 family of microRNAs regulates IL-13 expression. Induced levels of IL-13 in cultured T cells were inversely related to let-7 levels. In an IL-13-dependent murine model of allergic airway inflammation, we observed that inflammation was associated with a reduction in most of the members of the let-7 family. Exogenous administration of let-7 mimic to lungs of mice with allergic inflammation resulted in a decrease in IL-13 levels, resolution of airway inflammation, reduction in airway hyperresponsiveness, and attenuation of mucus metaplasia and subepithelial fibrosis. CONCLUSION: Let-7 microRNAs inhibit IL-13 expression and represent a major regulatory mechanism for modulating IL-13 secretion in IL-13-producing cell types and thereby T(H)2 inflammation.
LinkOut: [PMID: 21616524]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA -0.245 0.01 -0.227 0.02 84 Click to see details
CESC 0.985 0.06 1.000 0.5 3 Click to see details
ESCA -0.461 0.08 -0.664 0.01 11 Click to see details
STAD -0.244 0.09 -0.363 0.02 32 Click to see details
LIHC 0.193 0.09 0.274 0.03 49 Click to see details
UCEC 0.282 0.12 0.396 0.05 19 Click to see details
LUAD 0.338 0.14 0.427 0.08 12 Click to see details
THCA -0.126 0.17 -0.033 0.4 59 Click to see details
KICH -0.187 0.19 -0.110 0.3 25 Click to see details
CHOL 0.315 0.2 0.213 0.29 9 Click to see details
PRAD -0.106 0.23 -0.085 0.28 50 Click to see details
KIRC -0.071 0.28 -0.041 0.37 68 Click to see details
PCPG 0.628 0.28 0.500 0.33 3 Click to see details
LUSC 0.095 0.29 0.159 0.17 38 Click to see details
PAAD -0.321 0.34 0.000 0.5 4 Click to see details
BLCA -0.081 0.37 -0.049 0.42 18 Click to see details
HNSC 0.048 0.38 0.130 0.21 42 Click to see details
COAD 0.107 0.4 -0.071 0.43 8 Click to see details
KIRP -0.046 0.4 -0.038 0.42 32 Click to see details
KIRP -0.046 0.4 -0.038 0.42 32 Click to see details
KIRP -0.046 0.4 -0.038 0.42 32 Click to see details
370 hsa-let-7d-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000401 BDNF brain derived neurotrophic factor 1 1
MIRT000402 CDK6 cyclin dependent kinase 6 1 1
MIRT000403 CDC25A cell division cycle 25A 1 1
MIRT000405 BCL2 BCL2, apoptosis regulator 1 1
MIRT000406 KRAS KRAS proto-oncogene, GTPase 1 1
MIRT002005 HMGA2 high mobility group AT-hook 2 6 8
MIRT003901 APP amyloid beta precursor protein 2 1
MIRT004347 DICER1 dicer 1, ribonuclease III 3 1
MIRT004505 SLC11A2 solute carrier family 11 member 2 6 5
MIRT005549 PDGFA platelet derived growth factor subunit A 3 1
MIRT006398 IL13 interleukin 13 2 1
MIRT006406 MPL MPL proto-oncogene, thrombopoietin receptor 1 1
MIRT032101 RABGAP1L RAB GTPase activating protein 1 like 1 1
MIRT032102 DRD3 dopamine receptor D3 1 1
MIRT032103 SMOX spermine oxidase 1 1
MIRT032104 DAD1 defender against cell death 1 1 1
MIRT032105 EIF4G2 eukaryotic translation initiation factor 4 gamma 2 3 5
MIRT032106 CALCOCO2 calcium binding and coiled-coil domain 2 1 1
MIRT032107 GPR63 G protein-coupled receptor 63 1 1
MIRT032108 FAM135A family with sequence similarity 135 member A 1 1
MIRT032109 CPNE1 copine 1 1 1
MIRT032110 NR4A1 nuclear receptor subfamily 4 group A member 1 1 1
MIRT032111 BUB3 BUB3, mitotic checkpoint protein 1 1
MIRT032112 TBC1D9B TBC1 domain family member 9B 1 1
MIRT032113 LARP4B La ribonucleoprotein domain family member 4B 1 1
MIRT032114 NAA20 N(alpha)-acetyltransferase 20, NatB catalytic subunit 2 3
MIRT032115 FBXO3 F-box protein 3 1 1
MIRT032116 ZNF763 zinc finger protein 763 1 1
MIRT032117 PCNP PEST proteolytic signal containing nuclear protein 1 1
MIRT032118 HOMER1 homer scaffolding protein 1 1 1
MIRT032119 RBM12 RNA binding motif protein 12 1 1
MIRT032120 KMT2A lysine methyltransferase 2A 1 1
MIRT032121 CBR4 carbonyl reductase 4 1 1
MIRT032122 THBS1 thrombospondin 1 2 4
MIRT032123 TLE4 transducin like enhancer of split 4 1 1
MIRT032124 TOMM20 translocase of outer mitochondrial membrane 20 1 1
MIRT032125 TMED4 transmembrane p24 trafficking protein 4 1 1
MIRT032126 AKAP8 A-kinase anchoring protein 8 2 4
MIRT032127 TST thiosulfate sulfurtransferase 1 1
MIRT032128 GPR137B G protein-coupled receptor 137B 1 1
MIRT032129 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 1
MIRT032130 IGF2BP3 insulin like growth factor 2 mRNA binding protein 3 2 4
MIRT032131 RPUSD2 RNA pseudouridylate synthase domain containing 2 1 1
MIRT032132 ZBTB24 zinc finger and BTB domain containing 24 1 1
MIRT032133 SPATA2 spermatogenesis associated 2 1 1
MIRT032134 GOLT1B golgi transport 1B 1 1
MIRT032135 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT032136 SREK1IP1 SREK1 interacting protein 1 1 1
MIRT032137 RFX5 regulatory factor X5 1 1
MIRT032138 BIN3 bridging integrator 3 1 1
MIRT032139 CEP120 centrosomal protein 120 2 3
MIRT032140 ZNF526 zinc finger protein 526 1 1
MIRT032141 ISL1 ISL LIM homeobox 1 1 1
MIRT032142 POLR2D RNA polymerase II subunit D 2 5
MIRT032143 SMCR7L mitochondrial elongation factor 1 1 4
MIRT032144 TMEM194A nuclear envelope integral membrane protein 1 1 1
MIRT032145 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT032146 C12orf4 chromosome 12 open reading frame 4 2 3
MIRT032147 TMEM2 transmembrane protein 2 1 1
MIRT032148 DLC1 DLC1 Rho GTPase activating protein 1 1
MIRT032149 TMTC3 transmembrane and tetratricopeptide repeat containing 3 2 3
MIRT032150 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 1
MIRT032151 ZNF354B zinc finger protein 354B 1 1
MIRT032152 ZNF200 zinc finger protein 200 2 4
MIRT032153 ADCY9 adenylate cyclase 9 1 1
MIRT032154 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT032155 STK40 serine/threonine kinase 40 1 1
MIRT032156 PCGF3 polycomb group ring finger 3 2 6
MIRT032157 ZBTB39 zinc finger and BTB domain containing 39 1 1
MIRT032158 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT032159 RAD9A RAD9 checkpoint clamp component A 1 1
MIRT032160 ARRDC4 arrestin domain containing 4 1 1
MIRT032161 SLC30A6 solute carrier family 30 member 6 1 1
MIRT032162 LBR lamin B receptor 1 1
MIRT032163 C9orf41 carnosine N-methyltransferase 1 1 1
MIRT032164 ESPL1 extra spindle pole bodies like 1, separase 2 5
MIRT032165 ABT1 activator of basal transcription 1 2 9
MIRT032166 NHLRC3 NHL repeat containing 3 2 6
MIRT032167 GLMN glomulin, FKBP associated protein 1 1
MIRT032168 IGDCC4 immunoglobulin superfamily DCC subclass member 4 2 6
MIRT032169 ZNF644 zinc finger protein 644 2 3
MIRT032170 C11orf57 chromosome 11 open reading frame 57 2 5
MIRT032171 FAM104A family with sequence similarity 104 member A 2 2
MIRT032172 SPRYD4 SPRY domain containing 4 1 1
MIRT032173 ARID3A AT-rich interaction domain 3A 2 3
MIRT032174 SLC10A7 solute carrier family 10 member 7 2 6
MIRT032175 ONECUT2 one cut homeobox 2 2 3
MIRT032176 USP24 ubiquitin specific peptidase 24 1 1
MIRT032177 SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 2 4
MIRT032178 TGFBR1 transforming growth factor beta receptor 1 1 1
MIRT032179 HAND1 heart and neural crest derivatives expressed 1 2 3
MIRT032180 KPNA5 karyopherin subunit alpha 5 2 8
MIRT032181 IGF1R insulin like growth factor 1 receptor 2 9
MIRT032182 TMEM135 transmembrane protein 135 1 1
MIRT032183 SLC20A1 solute carrier family 20 member 1 2 4
MIRT032184 ZNF280B zinc finger protein 280B 1 1
MIRT032185 LIN28B lin-28 homolog B 1 1
MIRT032186 IGF2BP1 insulin like growth factor 2 mRNA binding protein 1 2 3
MIRT051710 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 1 1
MIRT051711 PRR13 proline rich 13 1 1
MIRT051712 ZNF746 zinc finger protein 746 1 1
MIRT051713 SLC35A4 solute carrier family 35 member A4 1 1
MIRT051714 RPL31 ribosomal protein L31 1 1
MIRT051715 TPD52L2 tumor protein D52 like 2 1 1
MIRT051716 MRPL51 mitochondrial ribosomal protein L51 1 1
MIRT051717 CTDP1 CTD phosphatase subunit 1 1 1
MIRT051718 RPS6 ribosomal protein S6 1 1
MIRT051719 SENP5 SUMO1/sentrin specific peptidase 5 1 1
MIRT051720 PAXBP1 PAX3 and PAX7 binding protein 1 1 1
MIRT051721 DHX57 DExH-box helicase 57 1 1
MIRT051722 H2AFX H2A histone family member X 1 1
MIRT051723 DSC3 desmocollin 3 1 1
MIRT051724 CIZ1 CDKN1A interacting zinc finger protein 1 1 1
MIRT051725 NCOA1 nuclear receptor coactivator 1 1 1
MIRT051726 LRRC42 leucine rich repeat containing 42 1 1
MIRT051727 UTP6 UTP6, small subunit processome component 1 1
MIRT063194 ADIPOR2 adiponectin receptor 2 2 2
MIRT068153 TXLNA taxilin alpha 2 2
MIRT068788 FNDC3A fibronectin type III domain containing 3A 2 2
MIRT073005 ARID3B AT-rich interaction domain 3B 2 6
MIRT076222 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 2 6
MIRT083299 ZCCHC3 zinc finger CCHC-type containing 3 2 2
MIRT084975 BACH1 BTB domain and CNC homolog 1 4 3
MIRT095765 GRPEL2 GrpE like 2, mitochondrial 2 10
MIRT112241 MDM4 MDM4, p53 regulator 2 4
MIRT118585 STK4 serine/threonine kinase 4 2 2
MIRT120920 PDE12 phosphodiesterase 12 2 8
MIRT123316 CALU calumenin 2 2
MIRT123975 POLR3D RNA polymerase III subunit D 2 2
MIRT152271 TNFSF9 TNF superfamily member 9 2 2
MIRT153846 NCOA3 nuclear receptor coactivator 3 2 2
MIRT168582 HMGA1 high mobility group AT-hook 1 2 4
MIRT180602 CRY2 cryptochrome circadian clock 2 2 2
MIRT187716 SUOX sulfite oxidase 2 2
MIRT191403 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 2 2
MIRT193100 MAPK6 mitogen-activated protein kinase 6 2 2
MIRT215719 C5ORF51 chromosome 5 open reading frame 51 2 10
MIRT218814 CDKN1A cyclin dependent kinase inhibitor 1A 2 2
MIRT240329 UBXN2B UBX domain protein 2B 2 2
MIRT243472 TRIM71 tripartite motif containing 71 2 2
MIRT244068 EDN1 endothelin 1 2 2
MIRT252329 SALL3 spalt like transcription factor 3 2 2
MIRT255313 CDV3 CDV3 homolog 2 2
MIRT259276 PGRMC1 progesterone receptor membrane component 1 2 2
MIRT259478 TXLNG taxilin gamma 2 2
MIRT260706 CLDN12 claudin 12 2 6
MIRT266211 PEX11B peroxisomal biogenesis factor 11 beta 2 2
MIRT266625 CHTOP chromatin target of PRMT1 2 2
MIRT268838 C1ORF21 chromosome 1 open reading frame 21 2 2
MIRT284527 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT294445 ZNF264 zinc finger protein 264 2 2
MIRT297012 RRM2 ribonucleotide reductase regulatory subunit M2 2 2
MIRT300036 BZW1 basic leucine zipper and W2 domains 1 2 4
MIRT300892 KREMEN1 kringle containing transmembrane protein 1 2 2
MIRT303319 MXD1 MAX dimerization protein 1 2 2
MIRT309845 NAT8L N-acetyltransferase 8 like 2 2
MIRT322427 PPP2R2A protein phosphatase 2 regulatory subunit Balpha 2 2
MIRT324730 ACER2 alkaline ceramidase 2 2 2
MIRT402056 ATP6V1F ATPase H+ transporting V1 subunit F 2 4
MIRT437855 EIF2C1 argonaute 1, RISC catalytic component 3 1
MIRT438633 TNFRSF10B TNF receptor superfamily member 10b 2 1
MIRT439136 ZEB2 zinc finger E-box binding homeobox 2 0 1
MIRT439137 MYC MYC proto-oncogene, bHLH transcription factor 0 1
MIRT442021 NDUFA4P1 NDUFA4, mitochondrial complex associated pseudogene 1 2 2
MIRT445659 ATP6V1G1 ATPase H+ transporting V1 subunit G1 2 6
MIRT447137 KIF27 kinesin family member 27 2 2
MIRT448263 ZNF774 zinc finger protein 774 2 2
MIRT449006 ANKRD46 ankyrin repeat domain 46 2 2
MIRT449954 FMNL3 formin like 3 2 2
MIRT451156 C19orf53 chromosome 19 open reading frame 53 2 2
MIRT451625 MEIS3P1 Meis homeobox 3 pseudogene 1 2 2
MIRT451694 C1RL complement C1r subcomponent like 2 2
MIRT452093 NUCB2 nucleobindin 2 2 2
MIRT452432 QDPR quinoid dihydropteridine reductase 2 2
MIRT452944 DISC1 disrupted in schizophrenia 1 2 2
MIRT453402 RHD Rh blood group D antigen 2 6
MIRT454165 HIST1H2BK histone cluster 1 H2B family member k 2 2
MIRT454281 FXN frataxin 2 2
MIRT454540 RABL2A RAB, member of RAS oncogene family like 2A 2 2
MIRT454855 ACOT9 acyl-CoA thioesterase 9 2 4
MIRT455677 GLO1 glyoxalase I 2 2
MIRT457249 RABL2B RAB, member of RAS oncogene family like 2B 2 2
MIRT457678 ZNF587 zinc finger protein 587 2 2
MIRT457888 THEM6 thioesterase superfamily member 6 2 4
MIRT458017 MRPL12 mitochondrial ribosomal protein L12 2 2
MIRT458280 FUT10 fucosyltransferase 10 2 2
MIRT459737 RRM1 ribonucleotide reductase catalytic subunit M1 2 2
MIRT460454 NOM1 nucleolar protein with MIF4G domain 1 2 4
MIRT460501 FAM105A family with sequence similarity 105 member A 2 6
MIRT460939 NOA1 nitric oxide associated 1 2 4
MIRT461093 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT461365 COL8A1 collagen type VIII alpha 1 chain 2 2
MIRT462383 YAE1D1 Yae1 domain containing 1 2 2
MIRT462781 ZNF8 zinc finger protein 8 2 2
MIRT463418 ZC3HAV1L zinc finger CCCH-type containing, antiviral 1 like 2 2
MIRT463663 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 2 2
MIRT464266 VCL vinculin 2 2
MIRT465125 TSC22D2 TSC22 domain family member 2 2 4
MIRT466186 TMED5 transmembrane p24 trafficking protein 5 2 4
MIRT466720 SYNJ2BP synaptojanin 2 binding protein 2 2
MIRT469103 RNF144B ring finger protein 144B 2 2
MIRT469713 RAB40C RAB40C, member RAS oncogene family 2 2
MIRT470424 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 2
MIRT470860 PLXND1 plexin D1 2 2
MIRT471270 PGM2L1 phosphoglucomutase 2 like 1 2 2
MIRT471965 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT472738 MTUS1 microtubule associated scaffold protein 1 2 6
MIRT473135 MLLT10 MLLT10, histone lysine methyltransferase DOT1L cofactor 2 2
MIRT473829 MAP2K7 mitogen-activated protein kinase kinase 7 2 2
MIRT473941 LYN LYN proto-oncogene, Src family tyrosine kinase 2 2
MIRT474024 LRRC20 leucine rich repeat containing 20 2 2
MIRT474501 KLHDC8B kelch domain containing 8B 2 2
MIRT474760 KIAA0930 KIAA0930 2 2
MIRT474908 KCTD21 potassium channel tetramerization domain containing 21 2 2
MIRT475332 IFNLR1 interferon lambda receptor 1 2 2
MIRT475380 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT475734 HERPUD1 homocysteine inducible ER protein with ubiquitin like domain 1 2 4
MIRT476549 GABPB1 GA binding protein transcription factor beta subunit 1 2 4
MIRT476974 FAM83G family with sequence similarity 83 member G 2 4
MIRT477679 EFHD2 EF-hand domain family member D2 2 2
MIRT479750 CCND1 cyclin D1 2 2
MIRT481194 ATXN7L3B ataxin 7 like 3B 2 4
MIRT481239 ATXN7L3 ataxin 7 like 3 2 2
MIRT481364 ATG9A autophagy related 9A 2 2
MIRT481389 ATG12 autophagy related 12 2 2
MIRT481653 AREL1 apoptosis resistant E3 ubiquitin protein ligase 1 2 2
MIRT481853 AP1S1 adaptor related protein complex 1 sigma 1 subunit 2 2
MIRT482185 AHR aryl hydrocarbon receptor 2 2
MIRT482221 AHCYL2 adenosylhomocysteinase like 2 2 2
MIRT485297 PLAGL2 PLAG1 like zinc finger 2 2 2
MIRT486660 ZNF28 zinc finger protein 28 2 2
MIRT489414 TUBB2A tubulin beta 2A class IIa 2 2
MIRT491865 ZBTB5 zinc finger and BTB domain containing 5 2 8
MIRT492211 SOCS1 suppressor of cytokine signaling 1 2 2
MIRT492625 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 2 2
MIRT493322 LIMD2 LIM domain containing 2 2 2
MIRT493902 FAM43A family with sequence similarity 43 member A 2 4
MIRT495969 TBC1D19 TBC1 domain family member 19 2 2
MIRT496113 SNX17 sorting nexin 17 2 2
MIRT497876 SLC12A7 solute carrier family 12 member 7 2 2
MIRT498118 PLEKHO1 pleckstrin homology domain containing O1 2 4
MIRT499406 PLCG2 phospholipase C gamma 2 2 4
MIRT499494 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 2 2
MIRT499654 SDR42E1 short chain dehydrogenase/reductase family 42E, member 1 2 2
MIRT499943 MFSD8 major facilitator superfamily domain containing 8 2 2
MIRT499998 HIST1H2BD histone cluster 1 H2B family member d 2 4
MIRT500899 STRN striatin 2 4
MIRT501113 SLC5A6 solute carrier family 5 member 6 2 4
MIRT501209 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT501247 SEMA4C semaphorin 4C 2 6
MIRT501327 RNFT1 ring finger protein, transmembrane 1 2 2
MIRT501349 RNF44 ring finger protein 44 2 4
MIRT501388 RBFOX2 RNA binding protein, fox-1 homolog 2 2 10
MIRT501442 RAB11FIP4 RAB11 family interacting protein 4 2 2
MIRT501752 NSD1 nuclear receptor binding SET domain protein 1 2 2
MIRT501941 MBD2 methyl-CpG binding domain protein 2 2 8
MIRT502121 KMT2D lysine methyltransferase 2D 2 4
MIRT502783 CEP135 centrosomal protein 135 2 2
MIRT502840 CELF1 CUGBP Elav-like family member 1 2 2
MIRT505579 SMC1A structural maintenance of chromosomes 1A 2 6
MIRT506360 NUP155 nucleoporin 155 2 6
MIRT507243 FIGN fidgetin, microtubule severing factor 2 8
MIRT507689 COIL coilin 2 6
MIRT508402 C1orf210 chromosome 1 open reading frame 210 2 6
MIRT508666 DIABLO diablo IAP-binding mitochondrial protein 2 4
MIRT508933 AK4 adenylate kinase 4 2 4
MIRT510392 ZNF566 zinc finger protein 566 2 6
MIRT510514 YOD1 YOD1 deubiquitinase 2 6
MIRT511387 IKZF3 IKAROS family zinc finger 3 2 4
MIRT512747 CD59 CD59 molecule (CD59 blood group) 2 4
MIRT515955 C9orf156 tRNA methyltransferase O 2 2
MIRT516084 ZBTB8OS zinc finger and BTB domain containing 8 opposite strand 2 4
MIRT521390 RDX radixin 2 4
MIRT522349 NCKIPSD NCK interacting protein with SH3 domain 2 4
MIRT523627 FZD9 frizzled class receptor 9 2 4
MIRT523734 FBXW2 F-box and WD repeat domain containing 2 2 4
MIRT523983 DVL3 dishevelled segment polarity protein 3 2 2
MIRT524115 DNA2 DNA replication helicase/nuclease 2 2 2
MIRT525728 SOD2 superoxide dismutase 2 2 2
MIRT527764 RRAD RRAD, Ras related glycolysis inhibitor and calcium channel regulator 2 2
MIRT529728 OPRL1 opioid related nociceptin receptor 1 2 2
MIRT533189 WASL Wiskott-Aldrich syndrome like 2 6
MIRT536379 LEFTY1 left-right determination factor 1 2 2
MIRT543786 RBM12B RNA binding motif protein 12B 2 4
MIRT543869 SLC16A9 solute carrier family 16 member 9 2 2
MIRT545388 PM20D2 peptidase M20 domain containing 2 2 2
MIRT546329 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT547372 MSI2 musashi RNA binding protein 2 2 2
MIRT547573 LRIG3 leucine rich repeats and immunoglobulin like domains 3 2 4
MIRT548266 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT548346 EPHA4 EPH receptor A4 2 2
MIRT548535 DUSP1 dual specificity phosphatase 1 2 2
MIRT548564 DNAL1 dynein axonemal light chain 1 2 2
MIRT548780 COLEC12 collectin subfamily member 12 2 2
MIRT548972 CCNT2 cyclin T2 2 2
MIRT549022 CBX5 chromobox 5 2 2
MIRT549207 BEND4 BEN domain containing 4 2 4
MIRT549764 ZNF611 zinc finger protein 611 2 6
MIRT549800 KIAA0391 KIAA0391 2 2
MIRT549848 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 2
MIRT550727 PMPCA peptidase, mitochondrial processing alpha subunit 2 4
MIRT550899 ACTA1 actin, alpha 1, skeletal muscle 2 2
MIRT551284 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 2 6
MIRT551319 GSG2 histone H3 associated protein kinase 2 6
MIRT552004 RAD18 RAD18, E3 ubiquitin protein ligase 2 2
MIRT552411 ZNF460 zinc finger protein 460 2 4
MIRT553018 USP38 ubiquitin specific peptidase 38 2 2
MIRT555551 PLEKHA3 pleckstrin homology domain containing A3 2 2
MIRT555717 PDZD8 PDZ domain containing 8 2 2
MIRT557967 FAM222B family with sequence similarity 222 member B 2 2
MIRT559088 C19orf47 chromosome 19 open reading frame 47 2 4
MIRT559498 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 2
MIRT561776 PEG10 paternally expressed 10 2 2
MIRT564403 EMILIN2 elastin microfibril interfacer 2 2 4
MIRT565450 SURF4 surfeit 4 2 2
MIRT566519 PARP16 poly(ADP-ribose) polymerase family member 16 2 2
MIRT567430 GNG5 G protein subunit gamma 5 2 2
MIRT567718 E2F6 E2F transcription factor 6 2 2
MIRT568649 ABHD17C abhydrolase domain containing 17C 2 2
MIRT569499 THYN1 thymocyte nuclear protein 1 2 2
MIRT573821 TGOLN2 trans-golgi network protein 2 2 2
MIRT574364 ZBTB37 zinc finger and BTB domain containing 37 2 2
MIRT574749 GOLGA4 golgin A4 2 2
MIRT576088 Poteg POTE ankyrin domain family, member G 2 2
MIRT576807 Thbs1 thrombospondin 1 2 3
MIRT616371 RWDD1 RWD domain containing 1 2 2
MIRT617852 FMO4 flavin containing monooxygenase 4 2 2
MIRT642395 ZNF556 zinc finger protein 556 2 2
MIRT680520 PRIM2 DNA primase subunit 2 2 2
MIRT680548 ZNF584 zinc finger protein 584 2 2
MIRT680801 ZNF578 zinc finger protein 578 2 2
MIRT680839 ARL8B ADP ribosylation factor like GTPase 8B 2 2
MIRT681142 INTS7 integrator complex subunit 7 2 2
MIRT681272 RFC2 replication factor C subunit 2 2 2
MIRT681324 ZFAND4 zinc finger AN1-type containing 4 2 4
MIRT681360 BRI3BP BRI3 binding protein 2 2
MIRT681507 STAT2 signal transducer and activator of transcription 2 2 2
MIRT681537 ZNF738 zinc finger protein 738 2 2
MIRT681659 DTX3L deltex E3 ubiquitin ligase 3L 2 2
MIRT681739 RAB19 RAB19, member RAS oncogene family 2 4
MIRT681761 CDKAL1 CDK5 regulatory subunit associated protein 1 like 1 2 2
MIRT681798 EIF4A3 eukaryotic translation initiation factor 4A3 2 2
MIRT681870 DNAH9 dynein axonemal heavy chain 9 2 2
MIRT681942 SLC19A3 solute carrier family 19 member 3 2 2
MIRT682103 ITGA3 integrin subunit alpha 3 2 4
MIRT682182 SLC38A7 solute carrier family 38 member 7 2 2
MIRT682239 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT682385 PHACTR4 phosphatase and actin regulator 4 2 2
MIRT682445 MTX3 metaxin 3 2 2
MIRT682605 CPA4 carboxypeptidase A4 2 2
MIRT682641 COX6B1 cytochrome c oxidase subunit 6B1 2 2
MIRT689328 FPR1 formyl peptide receptor 1 2 2
MIRT689731 ATXN2 ataxin 2 2 2
MIRT691037 ZNF799 zinc finger protein 799 2 2
MIRT691936 DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 2 2
MIRT694885 ZNF417 zinc finger protein 417 2 2
MIRT695256 ZNF443 zinc finger protein 443 2 2
MIRT695414 ADH5 alcohol dehydrogenase 5 (class III), chi polypeptide 2 2
MIRT700588 PRSS22 protease, serine 22 2 2
MIRT701425 NHLRC2 NHL repeat containing 2 2 2
MIRT702485 KIAA1328 KIAA1328 2 2
MIRT702714 IPO9 importin 9 2 2
MIRT704030 EDEM3 ER degradation enhancing alpha-mannosidase like protein 3 2 2
MIRT704422 CTPS1 CTP synthase 1 2 2
MIRT705751 AMD1 adenosylmethionine decarboxylase 1 2 2
MIRT712372 NAP1L1 nucleosome assembly protein 1 like 1 2 2
MIRT713521 PAFAH2 platelet activating factor acetylhydrolase 2 2 2
MIRT734116 Olr1 oxidized low density lipoprotein (lectin-like) receptor 1 3 0
MIRT734252 OPRM1 opioid receptor mu 1 3 0
MIRT735524 CD274 CD274 molecule 3 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
let-7d Benzene NULL 241 MiRNA PCR array white blood cell 24780745 2014 up-regulated
let-7d Benzene NULL 241 MiRNA PCR array blood mononuclear cells 24780745 2014 up-regulated
let-7d Hydroxamic acid HDACi LAQ824 NULL NULL Microarray breast cancer cell line SKBr3 16452179 2006 down-regulated
let-7d Gemcitabine approved 60750 Northern blot Mz-ChA-1 human cholangiocarcinoma cell lines 16762633 2006 up-regulated
let-7d All-trans-retinoic acid (ATRA) approved 444795 Microarray acute promyelocytic leukemia 17260024 2008 up-regulated
let-7d 17beta-estradiol (E2) approved 5757 Microarray MCF-7 breast cancer cells 19528081 2009 up-regulated
let-7d Cocaine NULL 446220 Quantitative real-time PCR HEK293 cells or rat brain parts 19703567 2009 down-regulated
let-7d Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
let-7d Ginsenoside Rh2 NULL 119307 Microarray human glioma cells U251 21372826 2011 up-regulated
let-7d 5-Fluorouracil approved 3385 Microarray MCF-7 breast cancer cells 21506117 2011 up-regulated
let-7d Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
let-7d CDF(analogues of curcumin) NULL NULL Quantitative real-time PCR pancreatic cancer cells 22108826 2012 up-regulated
let-7d Marine fungal metabolite 1386A NULL NULL Microarray MCF-7 breast cancer cells. 22159329 2012 down-regulated
let-7d 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
let-7d Vitamin D3 approved 5280795 Quantitative real-time PCR Plasma 22594500 2012 up-regulated
let-7d Olea europaea leaf extract NULL NULL Quantitative real-time PCR glioblastoma cells. 22722712 2012 up-regulated
let-7d Temozolomide approved 5394 Quantitative real-time PCR glioblastoma cells. 22722712 2012 up-regulated
let-7d Ginsenoside Rh2 NULL 119307 Microarray NSCLC cell line A549 23152132 2013 up-regulated
let-7d Sevoflurane approved 5206 Quantitative real-time PCR lung cell 23124245 2012 down-regulated
let-7d Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse liver 19270793 2009 down-regulated
let-7d Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 down-regulated
let-7d Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-let-7d Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-let-7d Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (MIA-PaCa-2, PANC-1, Aspc-1, L3.6pl, Colo357, BXPC-3, HPAC)
hsa-let-7d Cisplatin 5460033 NSC119875 approved resistant High Tongue Squamous Cell Carcinoma cell line (Tca8113)
hsa-let-7d Imatinib 5291 NSC743414 approved resistant High Myelogenous Leukemia cell line (MYL)
hsa-let-7d Cisplatin 5460033 NSC119875 approved sensitive Low Oral Cancer Oral Cancer Tumor Initiating Cells
hsa-let-7d Paclitaxel 36314 NSC125973 approved sensitive Low Oral Cancer Oral Cancer Tumor Initiating Cells
hsa-let-7d Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-let-7d Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (HCT-116)
hsa-let-7d Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (C13*, A2780, OV2008)
hsa-let-7d Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-let-7d Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-let-7d Imatinib 5291 NSC743414 approved resistant High Gastrointestinal Stromal Tumor tissue
hsa-let-7d Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-let-7d Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-let-7d Mitoxantrone 4212 NSC279836 approved resistant High Breast Cancer cell line (MCF-7)
hsa-let-7d Gefitinib 123631 NSC715055 approved sensitive High Non-Small Cell Lung Cancer cell line (HCC827)
hsa-let-7d 7-Difluoromethoxyl-5,4’-Di-N-Octylgenistein sensitive Low Ovarian Cancer cell line (SKOV3, OVCAR)
hsa-let-7d Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-let-7d Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-let-7d Gefitinib 123631 NSC715055 approved sensitive Low Non-Small Cell Lung Cancer cell line (PC-9)
hsa-let-7d Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375)
hsa-let-7d Osimertinib 71496458 NSC779217 approved sensitive Low Non-Small Cell Lung Cancer cell line (H1975)
hsa-let-7d Doxorubicin 31703 NSC123127 approved sensitive cell line (W1)
hsa-let-7d Vincristine 5978 approved sensitive cell line (W1)
hsa-let-7d Ribavirin+Pegylated IFNa-2b resistant tissue (chronic hepatitis C)
hsa-let-7d Methotrexate 126941 NSC740 approved sensitive cell line (HT29)
hsa-let-7d Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-let-7d Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-let-7d Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-let-7d Paclitaxel 36314 NSC125973 approved resistant cell line (PC3PR70)
hsa-let-7d Paclitaxel 36314 NSC125973 approved resistant cell line (PC3PR200)
hsa-let-7d Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-let-7d Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-let-7d Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-let-7d-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-let-7d-5p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-let-7d-5p Platinum 23939 resistant Low Ovarian Cancer tissue
hsa-let-7d-5p Imatinib 5291 NSC743414 approved resistant High Gastrointestinal Stromal Tumor cell line (882R-NC, 882R-OE, 882R-KD)
hsa-let-7d-5p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-let-7d-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-let-7d-5p Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-let-7d-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-let-7d-5p Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (2uM)
hsa-let-7d-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (2uM)
hsa-let-7d-5p Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer cell line (SKOV3, A2780, OVCAR-3, CaOV3)
hsa-let-7d-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-let-7d-5p Tivantinib 11494412 NSC758242 sensitive High Breast Cancer cell line (BT-20, BT-474, BT-549, CAMA-1, HCC1143, HCC1395, HCC1569, HCC1806, HCC-1937, HCC1954, HCC202, HCC38, HCC70, Hs578T, MCF-7, MDA-MB-175VII, MDA-MB-231, MDA-MB-361, MDA-MB-415, MDA-MB-436, MDA-MB-468, SKBR3, T47D, UACC812, EVSA-T, MPE-600 , SK-BR-
hsa-let-7d-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CP20)
hsa-let-7d-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CIS)
hsa-let-7d-5p Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-let-7d-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-let-7d-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-let-7d-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM11)
hsa-let-7d-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM17)
hsa-let-7d-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-let-7d-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-let-7d-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-let-7d-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-let-7d-5p Fluorouracil 3385 NSC19893 approved sensitive cell line (HCT15)
hsa-let-7d-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-let-7d-5p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-let-7d-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-let-7d-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (OVSAHO)

Error report submission