pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-708 |
Genomic Coordinates | chr11: 79402022 - 79402109 |
Synonyms | MIRN708, hsa-mir-708, MIR708 |
Description | Homo sapiens miR-708 stem-loop |
Comment | None |
RNA Secondary Structure | |
Associated Diseases |
Mature miRNA Information | ||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-708-3p | |||||||||||||||||||||||||||||||||||
Sequence | 57| CAACUAGACUGUGAGCUUCUAG |78 | |||||||||||||||||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||||||||||||||||
Experiments | Cloned | |||||||||||||||||||||||||||||||||||
Editing Events in miRNAs |
|
DRVs in miRNA |
|
|||||||||||||||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | OTUB1 | ||||||||||||||||||||
Synonyms | HSPC263, OTB1, OTU1 | ||||||||||||||||||||
Description | OTU deubiquitinase, ubiquitin aldehyde binding 1 | ||||||||||||||||||||
Transcript | NM_017670 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on OTUB1 | |||||||||||||||||||||
3'UTR of OTUB1 (miRNA target sites are highlighted) |
>OTUB1|NM_017670|3'UTR 1 GGCTGGCTCCAGCCCGCTGCTGCCCTGCTGCCCCCCTCTGCCAGGCGCTAGACATGTACAGAGGTTTTTCTGTGGTTGTA 81 AATGGTCCTATTTCACCCCCTTCTTCCTGTCACATGACCCCCCCCCATGTTTTATTAAAGGGGGTGCTGGTGGTGAGCCG 161 TGTGTGCGTGTCCCTGCTCTGCTGCCCGCCTGGCTGCTCTGTCTGCTGCCCCCTCCCCCCAGGTGGGTCCCCCTGCTTTT 241 CACCTATCTACTCCTGAGCTTCCCCAACAGGAGCAGGTTTGAGGGGCCAGGCCTCTTGGAGGCCCCTCCTGCTTCGTTGG 321 GTTCTGCTTCCTTCCCTTCTTAGCTGGCTCAGGGGCTTCTATGGGATCCTGGAAGTTCCTTAGGGACTTGCCCAGGGTCC 401 CAGGGCCACCCACACTTCATCTGCTCCCTCATAGGCCCCACCTCCACGTCCCGGCTGGGCCCCAGACCCCAGCTTCCTGC 481 CCTCCACCGGGAGTCTGCATGGTTGGGAGTCCTGGGTGGAGGGGCCTTTGTGAGGCTGGACCCGGCTCAGGGCAGGTGGA 561 GGAGCTGGGCCTCCCACAGGGTGCCCGGGCAGTGCCATCCTGGTGGGGGAGGGCAGCCTTCAAACGTGTGGGGTCTACAG 641 TCCTCAGGTCTAGGCAGGGCTGCCGGTTCTCCACCTCCCCATCCGCCCCAGGCCCCCTGCCTGTGCCTGCCTTGCACCCC 721 CTCTGCTTGGGCCACGGTGTCTCTGCATTGCCTGCCTTTTTGCCTTCACCTCTTTTCTTCCCCGCCCCCTGCACATTCGG 801 GGTCTCAGCCCCCAGGCTGTGAGCTCCTTGGGGGCAGGCCCTCAATAAATGTGAACTGCTGCTGCCGCCTCTGCAAAAAA 881 AAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | Mo7e |
Disease | MIMAT0004927 |
Location of target site | 3'UTR |
Original Description (Extracted from the article) |
...
"miR-28 and closely related miR-151 and miR-708 inhibit Tpodependent proliferation of Mo7e cells and target mRNAs coding for proteins involved in proliferation and apoptosis.//OTUB1 (Otubain1)
... - Girardot M; Pecquet C; Boukour S; Knoops L; et al., 2010, Blood. |
Article |
- Girardot M; Pecquet C; Boukour S; Knoops L; et al. - Blood, 2010
BCR-ABL negative myeloproliferative neoplasms (MPNs; polycythemia vera, essential thrombocythemia, primary myelofibrosis) are malignant diseases arising from a multipotent hematopoietic progenitor, frequently altered by JAK2 V617F or other JAK/STAT activating mutations. The thrombopoietin receptor (TpoR, MPL) is one of the major dimeric cytokine receptors that use JAK2 in the myeloid lineage, and was found to be down-modulated in certain MPN patients. We searched for negative regulators of MPL expression. Here we report that miR-28 targets the 3' untranslated (3'UTR) region of MPL, inhibiting its translation, as well as other proteins potentially involved in megakaryocyte differentiation, such as E2F6. Expression of miR-28 in CD34-derived megakaryocytes inhibited terminal differentiation. miR-28 was found to be overexpressed in platelets of a fraction of MPN patients, while it was expressed at constant low levels in platelets from healthy subjects. Constitutive activation of STAT5 leading to autonomous growth of hematopoietic cell lines was associated with increased miR-28 expression. We discuss how down-modulating MPL and other targets of miR-28, and of related miR-708 and miR-151, could contribute to MPN pathogenicity.
LinkOut: [PMID: 20445018]
|
MiRNA-Target Expression Profile | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
39 hsa-miR-708-3p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT006410 | MPL | MPL proto-oncogene, thrombopoietin receptor | 2 | 1 | ||||||||
MIRT006412 | N4BP1 | NEDD4 binding protein 1 | 1 | 1 | ||||||||
MIRT006415 | OTUB1 | OTU deubiquitinase, ubiquitin aldehyde binding 1 | 1 | 1 | ||||||||
MIRT006417 | TEX261 | testis expressed 261 | 1 | 1 | ||||||||
MIRT098750 | PHACTR2 | phosphatase and actin regulator 2 | 2 | 4 | ||||||||
MIRT106226 | C8ORF44-SGK3 | C8orf44-SGK3 readthrough | 2 | 2 | ||||||||
MIRT106238 | SGK3 | serum/glucocorticoid regulated kinase family member 3 | 2 | 2 | ||||||||
MIRT118987 | BCL2L11 | BCL2 like 11 | 2 | 2 | ||||||||
MIRT135257 | TMBIM6 | transmembrane BAX inhibitor motif containing 6 | 2 | 8 | ||||||||
MIRT175244 | PSAT1 | phosphoserine aminotransferase 1 | 2 | 6 | ||||||||
MIRT215590 | SUB1 | SUB1 homolog, transcriptional regulator | 2 | 2 | ||||||||
MIRT273159 | RAD51AP1 | RAD51 associated protein 1 | 2 | 2 | ||||||||
MIRT290312 | RNF138 | ring finger protein 138 | 2 | 2 | ||||||||
MIRT344689 | CRLF3 | cytokine receptor like factor 3 | 2 | 4 | ||||||||
MIRT441854 | KCNJ10 | potassium voltage-gated channel subfamily J member 10 | 2 | 2 | ||||||||
MIRT454894 | SEPT8 | septin 8 | 2 | 16 | ||||||||
MIRT476647 | G2E3 | G2/M-phase specific E3 ubiquitin protein ligase | 2 | 2 | ||||||||
MIRT483005 | RASGRP3 | RAS guanyl releasing protein 3 | 2 | 2 | ||||||||
MIRT503376 | SCAMP1 | secretory carrier membrane protein 1 | 2 | 2 | ||||||||
MIRT506802 | KLHL15 | kelch like family member 15 | 2 | 6 | ||||||||
MIRT507255 | FGF2 | fibroblast growth factor 2 | 2 | 8 | ||||||||
MIRT512206 | C1orf21 | chromosome 1 open reading frame 21 | 2 | 6 | ||||||||
MIRT526269 | CCDC169 | coiled-coil domain containing 169 | 2 | 2 | ||||||||
MIRT536797 | HNRNPA2B1 | heterogeneous nuclear ribonucleoprotein A2/B1 | 2 | 2 | ||||||||
MIRT537112 | GP5 | glycoprotein V platelet | 2 | 4 | ||||||||
MIRT537991 | DPP8 | dipeptidyl peptidase 8 | 2 | 2 | ||||||||
MIRT544395 | SMC5 | structural maintenance of chromosomes 5 | 2 | 2 | ||||||||
MIRT547532 | MARCH6 | membrane associated ring-CH-type finger 6 | 2 | 2 | ||||||||
MIRT559095 | C18orf25 | chromosome 18 open reading frame 25 | 2 | 2 | ||||||||
MIRT568179 | CCDC6 | coiled-coil domain containing 6 | 2 | 2 | ||||||||
MIRT568441 | ARPP19 | cAMP regulated phosphoprotein 19 | 2 | 2 | ||||||||
MIRT568543 | AKT3 | AKT serine/threonine kinase 3 | 2 | 2 | ||||||||
MIRT571568 | WDR26 | WD repeat domain 26 | 2 | 2 | ||||||||
MIRT571877 | NCL | nucleolin | 2 | 2 | ||||||||
MIRT575657 | Synpo | synaptopodin | 2 | 2 | ||||||||
MIRT624649 | ASXL3 | additional sex combs like 3, transcriptional regulator | 2 | 2 | ||||||||
MIRT698454 | TM4SF1 | transmembrane 4 L six family member 1 | 2 | 2 | ||||||||
MIRT700268 | RAP2B | RAP2B, member of RAS oncogene family | 2 | 2 | ||||||||
MIRT704283 | DENND5B | DENN domain containing 5B | 2 | 2 |
miRNA-Drug Associations | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|