miRTarBase - #MIRT006507


—
pre-miRNA Information
pre-miRNA hsa-mir-24-1   
Genomic Coordinates chr9: 95086021 - 95086088
Synonyms MIR189, MIRN24-1, miR-24-1, miRNA24-1, MIR24-1
Description Homo sapiens miR-24-1 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-24-2   
Genomic Coordinates chr19: 13836287 - 13836359
Synonyms MIRN24-2, miR-24-2, miRNA24-2, MIR24-2
Description Homo sapiens miR-24-2 stem-loop
Comment mir-24-2 was identified independently by two groups. This sequence was named miR-24 precursor-19 in reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-24-3p
Sequence 44| UGGCUCAGUUCAGCAGGAACAG |65
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 7 19 - 13836304 29233923 MiREDiBase
A-to-I 15 19 - 13836296 29233923 MiREDiBase
A-to-I 19 19 - 13836292 29233923 MiREDiBase
A-to-I 21 19 - 13836290 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1296736495 1 dbSNP
rs1449243881 3 dbSNP
rs768693029 6 dbSNP
rs1401187484 16 dbSNP
rs773200905 18 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BW8S3J miR-24-3p Monitoring Biomarker (MOI) Clinical/Experimental Data Expression Decrease Blood Quantitative real-time PCR
Gene Information
Gene Symbol FAF1   
Synonyms CGI-03, HFAF1s, UBXD12, UBXN3A, hFAF1
Description Fas associated factor 1
Transcript NM_007051   
Expression
Putative miRNA Targets on FAF1
3'UTR of FAF1
(miRNA target sites are highlighted)		 
>FAF1|NM_007051|3'UTR
   1 ACACGGCCCAGCGGTGGAACCAGCCATTCCTTGACAAGCCAGCAGCCTGCGTCAGGAGAAGGGCTCCTCGCCAACCCACC
  81 CACACGCTCGTCTCACTCAATTCAATGTCACACTTCTGCCTCTTGCAAAATTGCTGGAAAAAGTAATAATAAATATAGCT
 161 ACTTAAGATTTCCCATCAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gacaaGGACGACUUGACUCGGu 5'
               || || |  ||| |:| 
Target 5' acaagCCAGCAG-CCTGCGTCa 3'
 34 - 54 100.00 -9.20
2 
miRNA  3' gacaAGGACGACUU---GACUcggu 5'
              ||:|||  ||   |||:    
Target 5' tgccTCTTGCAAAATTGCTGGaaaa 3'
 117 - 141 82.00 -8.07
3 
miRNA  3' gacaaggacgacuugacUCGGu 5'
                           |||| 
Target 5' ggcccagcggtggaaccAGCCa 3'
 5 - 26 80.00 -12.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN1105411 25 COSMIC
COSN19655900 63 COSMIC
COSN30135967 70 COSMIC
COSN31596968 85 COSMIC
COSN30124274 120 COSMIC
COSN26548158 159 COSMIC
COSN8473003 335 COSMIC
COSN17045412 487 COSMIC
COSN29072084 819 COSMIC
COSN1448228 895 COSMIC
COSN22749053 925 COSMIC
COSN22365993 1053 COSMIC
COSN17338675 1140 COSMIC
COSN21405958 1238 COSMIC
COSN7222851 1372 COSMIC
COSN21070862 2250 COSMIC
COSN27031444 2342 COSMIC
COSN1448227 2505 COSMIC
COSN27513752 2567 COSMIC
COSN24544581 2666 COSMIC
COSN20776124 2754 COSMIC
COSN26616642 2759 COSMIC
COSN6038040 2820 COSMIC
COSN1448226 2845 COSMIC
COSN8473002 2872 COSMIC
COSN16624138 2972 COSMIC
COSN5373089 3050 COSMIC
COSN25932671 4111 COSMIC
COSN22917975 4234 COSMIC
COSN5168743 4278 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs765795263 1 dbSNP
rs759777870 2 dbSNP
rs200710823 4 dbSNP
rs747294487 5 dbSNP
rs1428350769 9 dbSNP
rs1344583787 12 dbSNP
rs1298717519 13 dbSNP
rs533521926 14 dbSNP
rs543370954 18 dbSNP
rs1382781929 30 dbSNP
rs1041201784 32 dbSNP
rs773422449 33 dbSNP
rs772212793 35 dbSNP
rs1416447175 45 dbSNP
rs1185181544 48 dbSNP
rs1382106191 50 dbSNP
rs764699238 51 dbSNP
rs911470911 52 dbSNP
rs559818433 54 dbSNP
rs1048718172 59 dbSNP
rs1162187838 60 dbSNP
rs1385038614 66 dbSNP
rs1290787277 67 dbSNP
rs763528596 69 dbSNP
rs191382480 70 dbSNP
rs1288996784 74 dbSNP
rs1363416926 83 dbSNP
rs186526933 85 dbSNP
rs970854594 86 dbSNP
rs1359910494 89 dbSNP
rs918017319 90 dbSNP
rs775773626 95 dbSNP
rs77961797 96 dbSNP
rs990599226 98 dbSNP
rs1315410731 103 dbSNP
rs1215298929 104 dbSNP
rs1242817090 106 dbSNP
rs1486866107 108 dbSNP
rs929092008 117 dbSNP
rs1243001857 125 dbSNP
rs562091349 126 dbSNP
rs959231594 132 dbSNP
rs553965979 133 dbSNP
rs1000745106 135 dbSNP
rs746096070 138 dbSNP
rs760660397 168 dbSNP
rs1433619505 169 dbSNP
rs1020637808 180 dbSNP
rs915604774 196 dbSNP
rs989803641 197 dbSNP
rs1277603730 198 dbSNP
rs1372303476 199 dbSNP
rs1223459656 201 dbSNP
rs997616534 206 dbSNP
rs1318827426 219 dbSNP
rs1201924797 220 dbSNP
rs958331369 224 dbSNP
rs372214566 229 dbSNP
rs1386261871 235 dbSNP
rs1158120694 236 dbSNP
rs978289618 237 dbSNP
rs1401247454 238 dbSNP
rs967312818 239 dbSNP
rs150683021 240 dbSNP
rs1467895188 250 dbSNP
rs964751634 251 dbSNP
rs1170907562 252 dbSNP
rs1470940313 253 dbSNP
rs576649758 261 dbSNP
rs1326726328 262 dbSNP
rs558188444 265 dbSNP
rs538456318 266 dbSNP
rs1006612465 268 dbSNP
rs1352622969 279 dbSNP
rs180795646 290 dbSNP
rs1282770302 291 dbSNP
rs771786745 293 dbSNP
rs1048641304 299 dbSNP
rs1463692526 304 dbSNP
rs1437611043 308 dbSNP
rs747935047 310 dbSNP
rs1234953126 313 dbSNP
rs931564344 316 dbSNP
rs1209711346 324 dbSNP
rs1481104883 325 dbSNP
rs553005387 332 dbSNP
rs189304908 335 dbSNP
rs1045574926 337 dbSNP
rs1395602734 382 dbSNP
rs1410452296 388 dbSNP
rs948482057 391 dbSNP
rs894203564 394 dbSNP
rs1403368919 395 dbSNP
rs74082524 400 dbSNP
rs1346240717 405 dbSNP
rs1277057423 408 dbSNP
rs1268484689 411 dbSNP
rs1339378111 424 dbSNP
rs935630763 427 dbSNP
rs1277267346 431 dbSNP
rs1489950937 444 dbSNP
rs1221312605 456 dbSNP
rs1216977016 461 dbSNP
rs924289880 461 dbSNP
rs1190470880 462 dbSNP
rs548612068 463 dbSNP
rs1475723156 466 dbSNP
rs1169535554 473 dbSNP
rs1303487424 479 dbSNP
rs949442782 482 dbSNP
rs1442714210 487 dbSNP
rs1423694635 512 dbSNP
rs1362544203 515 dbSNP
rs1366498000 516 dbSNP
rs945613282 522 dbSNP
rs923470080 523 dbSNP
rs1325902360 528 dbSNP
rs771078683 531 dbSNP
rs374027359 537 dbSNP
rs1432152928 538 dbSNP
rs1300385721 553 dbSNP
rs1319667764 554 dbSNP
rs536611367 577 dbSNP
rs918000485 578 dbSNP
rs1292955577 585 dbSNP
rs41286821 596 dbSNP
rs1332189454 600 dbSNP
rs113652958 612 dbSNP
rs144746515 623 dbSNP
rs749217828 625 dbSNP
rs1175561070 634 dbSNP
rs952177841 640 dbSNP
rs1164033966 641 dbSNP
rs966634226 650 dbSNP
rs1389732870 656 dbSNP
rs1021317728 661 dbSNP
rs975764457 664 dbSNP
rs377646049 666 dbSNP
rs1323144807 678 dbSNP
rs1236083569 679 dbSNP
rs1452520448 680 dbSNP
rs1210103681 686 dbSNP
rs1450297681 687 dbSNP
rs966140124 688 dbSNP
rs559930989 689 dbSNP
rs547652888 697 dbSNP
rs1236455900 706 dbSNP
rs1024160098 721 dbSNP
rs1012714964 725 dbSNP
rs1339649104 742 dbSNP
rs12076604 746 dbSNP
rs889931464 753 dbSNP
rs186317833 755 dbSNP
rs1027176427 758 dbSNP
rs996103254 761 dbSNP
rs1184101347 766 dbSNP
rs1258052268 773 dbSNP
rs1417035161 775 dbSNP
rs556235590 778 dbSNP
rs1041370012 779 dbSNP
rs543847409 787 dbSNP
rs1470633442 794 dbSNP
rs1161536284 799 dbSNP
rs945644331 800 dbSNP
rs1337908717 804 dbSNP
rs1037724019 808 dbSNP
rs923501182 810 dbSNP
rs976225295 815 dbSNP
rs576455079 826 dbSNP
rs1306728152 827 dbSNP
rs1336039413 832 dbSNP
rs943508046 833 dbSNP
rs910713325 834 dbSNP
rs949411041 842 dbSNP
rs1204250981 850 dbSNP
rs1447247185 856 dbSNP
rs952146747 857 dbSNP
rs1195078847 864 dbSNP
rs1250957312 867 dbSNP
rs142022813 867 dbSNP
rs972062936 870 dbSNP
rs1055104431 877 dbSNP
rs1314868850 878 dbSNP
rs971324245 887 dbSNP
rs1024192952 890 dbSNP
rs1427842028 893 dbSNP
rs1370193423 895 dbSNP
rs1298010580 910 dbSNP
rs1171478502 911 dbSNP
rs1411315348 926 dbSNP
rs1300850417 927 dbSNP
rs1344340262 929 dbSNP
rs1430509253 933 dbSNP
rs1223523990 934 dbSNP
rs1302763708 938 dbSNP
rs1305753803 941 dbSNP
rs1226576384 944 dbSNP
rs1412142353 972 dbSNP
rs1251704800 975 dbSNP
rs1483885907 976 dbSNP
rs938115548 977 dbSNP
rs546242656 991 dbSNP
rs1266956989 992 dbSNP
rs1490245611 993 dbSNP
rs369044069 1001 dbSNP
rs1181609043 1008 dbSNP
rs925393914 1009 dbSNP
rs572430812 1012 dbSNP
rs538282570 1016 dbSNP
rs945235159 1017 dbSNP
rs1269525612 1020 dbSNP
rs1427298270 1025 dbSNP
rs913815537 1025 dbSNP
rs1431956555 1028 dbSNP
rs1260155761 1031 dbSNP
rs1212408773 1044 dbSNP
rs976406059 1062 dbSNP
rs1364647368 1070 dbSNP
rs553181896 1074 dbSNP
rs181982522 1079 dbSNP
rs1204832155 1083 dbSNP
rs573609967 1084 dbSNP
rs1359202234 1086 dbSNP
rs1000380974 1088 dbSNP
rs902903516 1090 dbSNP
rs188875228 1093 dbSNP
rs1243581551 1103 dbSNP
rs576386132 1103 dbSNP
rs1290740723 1104 dbSNP
rs1359050364 1126 dbSNP
rs1222539440 1133 dbSNP
rs577472143 1135 dbSNP
rs951759335 1138 dbSNP
rs1027435847 1146 dbSNP
rs1186462363 1153 dbSNP
rs995683758 1155 dbSNP
rs997767674 1155 dbSNP
rs902111902 1173 dbSNP
rs897355063 1179 dbSNP
rs1166410009 1181 dbSNP
rs943621284 1185 dbSNP
rs1015808053 1187 dbSNP
rs35320823 1202 dbSNP
rs1320632731 1203 dbSNP
rs1350013896 1206 dbSNP
rs567435922 1207 dbSNP
rs1014261999 1208 dbSNP
rs896466807 1211 dbSNP
rs867183442 1214 dbSNP
rs1383199393 1215 dbSNP
rs1229127454 1217 dbSNP
rs1292226800 1219 dbSNP
rs1298798424 1226 dbSNP
rs1463759588 1227 dbSNP
rs756825479 1242 dbSNP
rs138067885 1243 dbSNP
rs1466678594 1246 dbSNP
rs1462232425 1251 dbSNP
rs1242942464 1253 dbSNP
rs1183240888 1255 dbSNP
rs1473297341 1255 dbSNP
rs569600503 1258 dbSNP
rs1405424139 1259 dbSNP
rs1418133671 1271 dbSNP
rs903938343 1272 dbSNP
rs551075585 1277 dbSNP
rs752001723 1279 dbSNP
rs539546197 1282 dbSNP
rs972065462 1283 dbSNP
rs971420735 1284 dbSNP
rs917249843 1289 dbSNP
rs991426176 1291 dbSNP
rs1359543555 1297 dbSNP
rs565633594 1298 dbSNP
rs945188744 1302 dbSNP
rs1277554041 1304 dbSNP
rs1472535895 1310 dbSNP
rs1371526581 1316 dbSNP
rs1227995410 1317 dbSNP
rs868370597 1319 dbSNP
rs1331276388 1329 dbSNP
rs958635255 1344 dbSNP
rs1262991894 1351 dbSNP
rs548009364 1353 dbSNP
rs1212751258 1354 dbSNP
rs34374898 1355 dbSNP
rs913730255 1359 dbSNP
rs1000008341 1360 dbSNP
rs1040265998 1365 dbSNP
rs116053112 1366 dbSNP
rs562370022 1372 dbSNP
rs1479138892 1379 dbSNP
rs1175625543 1395 dbSNP
rs1263258204 1397 dbSNP
rs900886697 1409 dbSNP
rs764355548 1419 dbSNP
rs1326664185 1423 dbSNP
rs879808849 1427 dbSNP
rs985782705 1430 dbSNP
rs1409479823 1431 dbSNP
rs550464179 1433 dbSNP
rs1352413094 1436 dbSNP
rs763624186 1438 dbSNP
rs972227123 1442 dbSNP
rs1226550136 1445 dbSNP
rs961534090 1463 dbSNP
rs1349765405 1465 dbSNP
rs1049715259 1472 dbSNP
rs1016194966 1477 dbSNP
rs930791084 1483 dbSNP
rs1013776572 1485 dbSNP
rs1307226188 1486 dbSNP
rs1393165760 1492 dbSNP
rs1253445799 1498 dbSNP
rs568418011 1500 dbSNP
rs1489720118 1511 dbSNP
rs1198141260 1512 dbSNP
rs1365759256 1524 dbSNP
rs1478991086 1526 dbSNP
rs1293225018 1536 dbSNP
rs960930606 1548 dbSNP
rs1033925184 1552 dbSNP
rs1441898988 1557 dbSNP
rs1002156315 1568 dbSNP
rs1397206152 1580 dbSNP
rs1036486260 1585 dbSNP
rs1403310338 1590 dbSNP
rs950092404 1592 dbSNP
rs903864602 1595 dbSNP
rs1439244918 1597 dbSNP
rs1268871861 1598 dbSNP
rs1157352094 1599 dbSNP
rs1229695582 1606 dbSNP
rs991458964 1616 dbSNP
rs1356895353 1626 dbSNP
rs958891528 1628 dbSNP
rs1290007127 1629 dbSNP
rs1452787694 1643 dbSNP
rs925852856 1644 dbSNP
rs531751979 1652 dbSNP
rs1159211495 1654 dbSNP
rs1470815767 1655 dbSNP
rs1190326801 1662 dbSNP
rs1383115211 1663 dbSNP
rs967272694 1665 dbSNP
rs1010077319 1666 dbSNP
rs892278453 1677 dbSNP
rs1040594661 1683 dbSNP
rs1162836974 1686 dbSNP
rs1391557877 1687 dbSNP
rs944553296 1702 dbSNP
rs1020074066 1713 dbSNP
rs910465816 1716 dbSNP
rs997915049 1728 dbSNP
rs1365184447 1729 dbSNP
rs879126889 1730 dbSNP
rs755494321 1733 dbSNP
rs1050374007 1736 dbSNP
rs965088220 1743 dbSNP
rs146241729 1746 dbSNP
rs545876365 1751 dbSNP
rs527827396 1752 dbSNP
rs765424758 1753 dbSNP
rs1358019080 1754 dbSNP
rs889370951 1767 dbSNP
rs1266914896 1770 dbSNP
rs1465320025 1770 dbSNP
rs1210465719 1776 dbSNP
rs1206549153 1777 dbSNP
rs1241060065 1792 dbSNP
rs1422965062 1800 dbSNP
rs1328130443 1803 dbSNP
rs971811143 1805 dbSNP
rs1187110118 1811 dbSNP
rs962082104 1814 dbSNP
rs1473891888 1817 dbSNP
rs1261167816 1820 dbSNP
rs1027937852 1822 dbSNP
rs1241090294 1826 dbSNP
rs1310574312 1828 dbSNP
rs1323081993 1846 dbSNP
rs1302731395 1856 dbSNP
rs747491486 1883 dbSNP
rs1235350581 1888 dbSNP
rs1373419255 1899 dbSNP
rs1404382419 1900 dbSNP
rs560346287 1912 dbSNP
rs995492891 1922 dbSNP
rs917033807 1924 dbSNP
rs1318987595 1938 dbSNP
rs555730312 1939 dbSNP
rs960898985 1958 dbSNP
rs1036517393 1959 dbSNP
rs551710067 1961 dbSNP
rs895878677 1964 dbSNP
rs759640455 1967 dbSNP
rs1386324158 1974 dbSNP
rs980995644 1975 dbSNP
rs776749314 1976 dbSNP
rs1257988986 1982 dbSNP
rs1444387840 2014 dbSNP
rs1180239581 2015 dbSNP
rs1411355829 2017 dbSNP
rs540832275 2027 dbSNP
rs554144736 2034 dbSNP
rs534104389 2036 dbSNP
rs937323064 2038 dbSNP
rs1375477804 2040 dbSNP
rs1303832934 2043 dbSNP
rs925938880 2052 dbSNP
rs1389340060 2054 dbSNP
rs141695150 2057 dbSNP
rs1350572084 2064 dbSNP
rs372802460 2068 dbSNP
rs1454471755 2074 dbSNP
rs1411194073 2081 dbSNP
rs945936922 2083 dbSNP
rs774268130 2096 dbSNP
rs1186463012 2107 dbSNP
rs1257578658 2108 dbSNP
rs1446276812 2111 dbSNP
rs1262148912 2115 dbSNP
rs1008734062 2117 dbSNP
rs888955698 2129 dbSNP
rs768371770 2133 dbSNP
rs965119692 2136 dbSNP
rs1050300685 2139 dbSNP
rs930560757 2157 dbSNP
rs1177359859 2163 dbSNP
rs985540028 2171 dbSNP
rs952450043 2172 dbSNP
rs1168345732 2176 dbSNP
rs1027046286 2182 dbSNP
rs995127417 2185 dbSNP
rs199619775 2201 dbSNP
rs538142422 2205 dbSNP
rs899105554 2212 dbSNP
rs1387303001 2213 dbSNP
rs1015118389 2215 dbSNP
rs1303245719 2215 dbSNP
rs1036424449 2216 dbSNP
rs1227481944 2221 dbSNP
rs940402185 2236 dbSNP
rs1343189318 2239 dbSNP
rs1207511745 2244 dbSNP
rs916982083 2253 dbSNP
rs1488162640 2258 dbSNP
rs1226963072 2259 dbSNP
rs1327449580 2260 dbSNP
rs1298158209 2264 dbSNP
rs543348291 2270 dbSNP
rs992537663 2274 dbSNP
rs1391141319 2284 dbSNP
rs900963056 2287 dbSNP
rs1162207574 2289 dbSNP
rs1348809279 2291 dbSNP
rs1457910144 2295 dbSNP
rs576236340 2304 dbSNP
rs1294771741 2308 dbSNP
rs926804313 2328 dbSNP
rs1055922267 2338 dbSNP
rs749236583 2342 dbSNP
rs1367030979 2344 dbSNP
rs1230904209 2351 dbSNP
rs968255601 2352 dbSNP
rs1022576564 2356 dbSNP
rs1321341630 2362 dbSNP
rs988541514 2377 dbSNP
rs1222474885 2379 dbSNP
rs1267281250 2382 dbSNP
rs956771043 2387 dbSNP
rs1463969336 2397 dbSNP
rs779916576 2404 dbSNP
rs1249064067 2408 dbSNP
rs904546892 2414 dbSNP
rs1278513 2415 dbSNP
rs1043438817 2422 dbSNP
rs1166340032 2427 dbSNP
rs752680779 2432 dbSNP
rs745418343 2433 dbSNP
rs913128983 2462 dbSNP
rs1390561959 2483 dbSNP
rs888923212 2497 dbSNP
rs1434738315 2502 dbSNP
rs112004374 2504 dbSNP
rs397978419 2504 dbSNP
rs1314982733 2505 dbSNP
rs1327108989 2507 dbSNP
rs374363156 2515 dbSNP
rs1269247407 2519 dbSNP
rs78582120 2520 dbSNP
rs1373468190 2528 dbSNP
rs952555540 2535 dbSNP
rs780543343 2543 dbSNP
rs1237243630 2546 dbSNP
rs756989746 2550 dbSNP
rs879841146 2559 dbSNP
rs565776194 2561 dbSNP
rs1249001035 2564 dbSNP
rs1256643879 2565 dbSNP
rs747329599 2567 dbSNP
rs553856341 2576 dbSNP
rs1471940063 2578 dbSNP
rs184560854 2579 dbSNP
rs1486734385 2581 dbSNP
rs1414163320 2585 dbSNP
rs940309956 2597 dbSNP
rs1175146269 2606 dbSNP
rs1359487034 2609 dbSNP
rs1449063722 2611 dbSNP
rs895488508 2612 dbSNP
rs138650116 2616 dbSNP
rs1056777587 2645 dbSNP
rs1348714446 2647 dbSNP
rs937107769 2654 dbSNP
rs1409359992 2659 dbSNP
rs1289053883 2666 dbSNP
rs1353535561 2668 dbSNP
rs927066963 2674 dbSNP
rs1015150981 2675 dbSNP
rs1272557699 2679 dbSNP
rs1313088902 2691 dbSNP
rs1211804108 2711 dbSNP
rs193000528 2712 dbSNP
rs980894262 2714 dbSNP
rs375915804 2715 dbSNP
rs960234456 2715 dbSNP
rs1182329353 2729 dbSNP
rs1253305060 2730 dbSNP
rs1340280604 2736 dbSNP
rs1253485250 2738 dbSNP
rs1243011060 2750 dbSNP
rs946940762 2752 dbSNP
rs915478346 2754 dbSNP
rs1294374951 2755 dbSNP
rs904578353 2769 dbSNP
rs1166483450 2779 dbSNP
rs551611912 2785 dbSNP
rs532842259 2786 dbSNP
rs956888559 2789 dbSNP
rs911910327 2790 dbSNP
rs1434959823 2796 dbSNP
rs1274706632 2799 dbSNP
rs1356865180 2806 dbSNP
rs1010154148 2814 dbSNP
rs891724978 2815 dbSNP
rs1326239696 2818 dbSNP
rs1040976547 2819 dbSNP
rs1396710263 2822 dbSNP
rs1276186456 2824 dbSNP
rs1449317494 2826 dbSNP
rs1220750571 2831 dbSNP
rs987530565 2833 dbSNP
rs1247291545 2836 dbSNP
rs953429981 2838 dbSNP
rs865900012 2846 dbSNP
rs994668937 2852 dbSNP
rs911080383 2859 dbSNP
rs1169397923 2867 dbSNP
rs17106175 2871 dbSNP
rs1015219533 2875 dbSNP
rs1416888048 2877 dbSNP
rs1403738845 2878 dbSNP
rs1188646742 2880 dbSNP
rs1004813753 2881 dbSNP
rs1249766011 2892 dbSNP
rs895445111 2895 dbSNP
rs1322957486 2896 dbSNP
rs150157866 2908 dbSNP
rs1438634771 2910 dbSNP
rs919629302 2913 dbSNP
rs1275312693 2916 dbSNP
rs1364861348 2919 dbSNP
rs972433350 2933 dbSNP
rs961066042 2952 dbSNP
rs917586543 2963 dbSNP
rs534217143 2972 dbSNP
rs1208788842 2975 dbSNP
rs58605345 2980 dbSNP
rs560659633 2988 dbSNP
rs1206701289 2991 dbSNP
rs1235716334 2992 dbSNP
rs1042827498 2994 dbSNP
rs1327645929 3001 dbSNP
rs946836397 3004 dbSNP
rs1471920572 3006 dbSNP
rs140738051 3007 dbSNP
rs1440757462 3021 dbSNP
rs1414573502 3022 dbSNP
rs1335984712 3025 dbSNP
rs915420703 3028 dbSNP
rs1319063615 3033 dbSNP
rs960265115 3034 dbSNP
rs1053088267 3035 dbSNP
rs1320684208 3037 dbSNP
rs1338389922 3047 dbSNP
rs1438245285 3048 dbSNP
rs1002086561 3050 dbSNP
rs935615361 3051 dbSNP
rs968835302 3058 dbSNP
rs1336219521 3065 dbSNP
rs912171984 3077 dbSNP
rs1267497206 3096 dbSNP
rs987460370 3099 dbSNP
rs75231794 3102 dbSNP
rs1253780545 3105 dbSNP
rs1440940637 3109 dbSNP
rs1010271589 3110 dbSNP
rs561576493 3115 dbSNP
rs1238140080 3116 dbSNP
rs1476190495 3119 dbSNP
rs1157029518 3128 dbSNP
rs866824909 3131 dbSNP
rs891819487 3132 dbSNP
rs1160698262 3134 dbSNP
rs1041007856 3137 dbSNP
rs1395117261 3140 dbSNP
rs1334325519 3148 dbSNP
rs1356968118 3158 dbSNP
rs1407517076 3158 dbSNP
rs921971448 3167 dbSNP
rs1241045887 3175 dbSNP
rs973520104 3177 dbSNP
rs12124303 3182 dbSNP
rs1254051001 3185 dbSNP
rs550297775 3207 dbSNP
rs1200098156 3208 dbSNP
rs1281398582 3209 dbSNP
rs1234670873 3218 dbSNP
rs963512871 3221 dbSNP
rs1251135484 3222 dbSNP
rs1420240304 3233 dbSNP
rs1197083673 3234 dbSNP
rs28513134 3240 dbSNP
rs543209611 3246 dbSNP
rs1049583947 3247 dbSNP
rs1468176766 3248 dbSNP
rs931104276 3249 dbSNP
rs1254051612 3250 dbSNP
rs1014777529 3251 dbSNP
rs576324727 3253 dbSNP
rs1306905919 3264 dbSNP
rs1350513850 3265 dbSNP
rs1463945226 3267 dbSNP
rs778206199 3268 dbSNP
rs59982971 3282 dbSNP
rs1233778778 3294 dbSNP
rs777644644 3294 dbSNP
rs1042727677 3302 dbSNP
rs959969584 3306 dbSNP
rs1203240609 3315 dbSNP
rs1035606954 3319 dbSNP
rs1001155754 3324 dbSNP
rs1228177146 3335 dbSNP
rs991796346 3340 dbSNP
rs905541415 3345 dbSNP
rs1231677513 3357 dbSNP
rs960297688 3357 dbSNP
rs927499556 3360 dbSNP
rs1349097051 3361 dbSNP
rs947051581 3365 dbSNP
rs1397225991 3366 dbSNP
rs980304972 3370 dbSNP
rs1167505590 3376 dbSNP
rs1042755191 3378 dbSNP
rs894260274 3381 dbSNP
rs1326360967 3387 dbSNP
rs1413883197 3389 dbSNP
rs74798798 3390 dbSNP
rs1011340349 3391 dbSNP
rs146123777 3391 dbSNP
rs1317639228 3399 dbSNP
rs1291276416 3400 dbSNP
rs893943428 3400 dbSNP
rs1401193196 3401 dbSNP
rs866046625 3401 dbSNP
rs1391449942 3402 dbSNP
rs1410305988 3405 dbSNP
rs1052597644 3407 dbSNP
rs1226485015 3411 dbSNP
rs1171797637 3417 dbSNP
rs1188324812 3418 dbSNP
rs1214811308 3418 dbSNP
rs1229762637 3418 dbSNP
rs1255298805 3418 dbSNP
rs1263721668 3418 dbSNP
rs1297222441 3418 dbSNP
rs1308283865 3418 dbSNP
rs1362962313 3418 dbSNP
rs1377861931 3418 dbSNP
rs1463771548 3418 dbSNP
rs1468168626 3418 dbSNP
rs1488457847 3418 dbSNP
rs869236089 3418 dbSNP
rs1310690719 3419 dbSNP
rs545785921 3420 dbSNP
rs1395857657 3421 dbSNP
rs1195899988 3425 dbSNP
rs1234440921 3427 dbSNP
rs1448118774 3428 dbSNP
rs1241877338 3430 dbSNP
rs1327685928 3431 dbSNP
rs571915815 3433 dbSNP
rs1243025947 3434 dbSNP
rs1486662987 3436 dbSNP
rs912145771 3438 dbSNP
rs1285785149 3439 dbSNP
rs764916045 3439 dbSNP
rs1208040140 3441 dbSNP
rs1052019064 3442 dbSNP
rs1346724359 3448 dbSNP
rs1021794845 3454 dbSNP
rs1456607610 3460 dbSNP
rs1236037720 3462 dbSNP
rs528917974 3463 dbSNP
rs921938974 3465 dbSNP
rs1433171642 3469 dbSNP
rs988882706 3473 dbSNP
rs1355054930 3480 dbSNP
rs956093131 3482 dbSNP
rs1269343488 3491 dbSNP
rs973871044 3492 dbSNP
rs942106411 3494 dbSNP
rs1311154105 3500 dbSNP
rs1228277462 3509 dbSNP
rs889717105 3515 dbSNP
rs907978830 3525 dbSNP
rs1207595231 3534 dbSNP
rs983297994 3535 dbSNP
rs1434106752 3551 dbSNP
rs1189491738 3555 dbSNP
rs1028692114 3556 dbSNP
rs959906625 3571 dbSNP
rs1035533648 3586 dbSNP
rs1376140308 3589 dbSNP
rs1472235252 3600 dbSNP
rs189771022 3601 dbSNP
rs898346338 3602 dbSNP
rs1426936307 3608 dbSNP
rs1412609209 3611 dbSNP
rs969668180 3615 dbSNP
rs1021310326 3618 dbSNP
rs1406380175 3621 dbSNP
rs1314876159 3626 dbSNP
rs1368735601 3629 dbSNP
rs561223683 3641 dbSNP
rs939765505 3642 dbSNP
rs891532356 3653 dbSNP
rs1187433208 3655 dbSNP
rs1031877214 3663 dbSNP
rs1476687226 3679 dbSNP
rs1255955412 3680 dbSNP
rs1348189743 3682 dbSNP
rs1212511957 3683 dbSNP
rs568137644 3688 dbSNP
rs765800882 3689 dbSNP
rs1051987991 3691 dbSNP
rs932237917 3692 dbSNP
rs1234589243 3695 dbSNP
rs900777567 3696 dbSNP
rs1037693387 3703 dbSNP
rs116569344 3704 dbSNP
rs1395415160 3708 dbSNP
rs74319026 3711 dbSNP
rs947648584 3717 dbSNP
rs983946939 3718 dbSNP
rs1272047034 3728 dbSNP
rs988913499 3729 dbSNP
rs1329612323 3741 dbSNP
rs1356829194 3743 dbSNP
rs938485424 3752 dbSNP
rs1325674040 3756 dbSNP
rs928485503 3758 dbSNP
rs1236046060 3762 dbSNP
rs1019621281 3764 dbSNP
rs113353420 3779 dbSNP
rs1314798565 3781 dbSNP
rs1214695132 3784 dbSNP
rs969930064 3788 dbSNP
rs954225496 3800 dbSNP
rs1021989727 3801 dbSNP
rs1028305968 3804 dbSNP
rs552570180 3828 dbSNP
rs1354107551 3829 dbSNP
rs1253410389 3834 dbSNP
rs147977545 3840 dbSNP
rs1186447400 3846 dbSNP
rs1411941816 3850 dbSNP
rs1475188391 3855 dbSNP
rs898384407 3858 dbSNP
rs955900838 3859 dbSNP
rs1164750650 3862 dbSNP
rs1404108135 3862 dbSNP
rs754000667 3865 dbSNP
rs1031383650 3866 dbSNP
rs1015455461 3873 dbSNP
rs1004010174 3874 dbSNP
rs1325530850 3874 dbSNP
rs896246607 3874 dbSNP
rs1353577381 3877 dbSNP
rs566561647 3885 dbSNP
rs1273810606 3886 dbSNP
rs562587449 3887 dbSNP
rs1475809305 3900 dbSNP
rs766357897 3905 dbSNP
rs1206646252 3912 dbSNP
rs1260723465 3929 dbSNP
rs1446655541 3934 dbSNP
rs937774656 3951 dbSNP
rs1243920919 3961 dbSNP
rs370488234 3965 dbSNP
rs375476103 3976 dbSNP
rs1463446950 3977 dbSNP
rs1157443477 3986 dbSNP
rs1384639785 3990 dbSNP
rs1007992882 3996 dbSNP
rs1204771209 3997 dbSNP
rs1338336085 4000 dbSNP
rs1413701721 4016 dbSNP
rs1293349773 4018 dbSNP
rs947643926 4021 dbSNP
rs114806393 4022 dbSNP
rs1030484966 4023 dbSNP
rs1351037841 4037 dbSNP
rs1206668256 4039 dbSNP
rs1271013865 4041 dbSNP
rs1187359343 4042 dbSNP
rs201892496 4042 dbSNP
rs1258268327 4043 dbSNP
rs1476486344 4043 dbSNP
rs1180581101 4046 dbSNP
rs879301628 4047 dbSNP
rs1335352800 4052 dbSNP
rs1295226431 4053 dbSNP
rs996373001 4054 dbSNP
rs1055917999 4058 dbSNP
rs1160645953 4058 dbSNP
rs1407923387 4058 dbSNP
rs1470757125 4058 dbSNP
rs34587402 4058 dbSNP
rs398049264 4058 dbSNP
rs368161750 4059 dbSNP
rs1336263991 4063 dbSNP
rs75450729 4063 dbSNP
rs1272826284 4064 dbSNP
rs562631440 4064 dbSNP
rs549573455 4065 dbSNP
rs74082520 4070 dbSNP
rs1299030137 4073 dbSNP
rs1281146772 4074 dbSNP
rs886448384 4079 dbSNP
rs954142128 4097 dbSNP
rs1392805159 4109 dbSNP
rs1184477141 4119 dbSNP
rs1164625002 4120 dbSNP
rs1047780989 4123 dbSNP
rs1453432451 4129 dbSNP
rs1173798415 4135 dbSNP
rs115221040 4138 dbSNP
rs1166293191 4139 dbSNP
rs545741556 4142 dbSNP
rs1416860994 4149 dbSNP
rs112707031 4154 dbSNP
rs1015486655 4155 dbSNP
rs1044197364 4160 dbSNP
rs1321368071 4163 dbSNP
rs1458792627 4165 dbSNP
rs1233854954 4178 dbSNP
rs1304532867 4179 dbSNP
rs560216066 4180 dbSNP
rs948590199 4183 dbSNP
rs1212790256 4191 dbSNP
rs1225403189 4195 dbSNP
rs1004126102 4196 dbSNP
rs1267075326 4198 dbSNP
rs1481266685 4200 dbSNP
rs1243979914 4201 dbSNP
rs914455582 4201 dbSNP
rs990479521 4214 dbSNP
rs955704204 4221 dbSNP
rs1468369272 4222 dbSNP
rs1194639684 4242 dbSNP
rs1254546265 4250 dbSNP
rs924289992 4252 dbSNP
rs1169171745 4254 dbSNP
rs768461665 4259 dbSNP
rs1373102982 4265 dbSNP
rs1463474608 4268 dbSNP
rs1034834445 4269 dbSNP
rs1393638568 4271 dbSNP
rs1441443573 4282 dbSNP
rs1327647190 4290 dbSNP
rs1373521916 4294 dbSNP
rs775435416 4297 dbSNP
rs904916099 4300 dbSNP
rs1308080656 4305 dbSNP
rs184919761 4309 dbSNP
rs192597749 4323 dbSNP
rs1010536064 4328 dbSNP
rs1214750973 4329 dbSNP
rs1275394153 4331 dbSNP
rs1225728002 4333 dbSNP
rs556249138 4337 dbSNP
rs373386660 4372 dbSNP
rs1261824903 4382 dbSNP
rs1429849281 4385 dbSNP
rs892122737 4387 dbSNP
rs1053339821 4389 dbSNP
rs1325664145 4400 dbSNP
rs1461869853 4400 dbSNP
rs1166873565 4402 dbSNP
rs1442007994 4406 dbSNP
rs934895743 4411 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions 293T , Hela , HGC-27 , MGC-803 , DU-145
Location of target site CDS
Tools used in this research RNA22
Original Description (Extracted from the article) ... miR-24 regulates FAF1 by targeting its ORF region. ...

- Qin W; Shi Y; Zhao B; Yao C; Jin L; Ma J; Jin Y, 2010, PloS one.

Article - Qin W; Shi Y; Zhao B; Yao C; Jin L; Ma J; Jin Y
- PloS one, 2010
BACKGROUND: microRNAs (miRNAs) are small noncoding RNAs that regulate cognate mRNAs at the post-transcriptional stage. Several studies have shown that miRNAs modulate gene expression in mammalian cells by base pairing to complementary sites in the 3'-untranslated region (3'-UTR) of the target mRNAs. METHODOLOGY/PRINCIPAL FINDINGS: In the present study, miR-24 was found to target fas associated factor 1(FAF1) by binding to its amino acid coding sequence (CDS) region, thereby regulating apoptosis in DU-145 cells. This result supports an augmented model whereby animal miRNAs can exercise their effects through binding to the CDS region of the target mRNA. Transfection of miR-24 antisense oligonucleotide (miR-24-ASO) also induced apoptosis in HGC-27, MGC-803 and HeLa cells. CONCLUSIONS/SIGNIFICANCE: We found that miR-24 regulates apoptosis by targeting FAF1 in cancer cells. These findings suggest that miR-24 could be an effective drug target for treatment of hormone-insensitive prostate cancer or other types of cancers. Future work may further develop miR-24 for therapeutic applications in cancer biology.
LinkOut: [PMID: 20195546]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer -0.573 1.7e-3 -0.597 1.0e-3 24 Click to see details
GSE19783 ER+ ER+ breast cancer -0.56 5.1e-3 -0.639 1.2e-3 20 Click to see details
GSE21032 Prostate cancer -0.27 6.8e-3 -0.173 5.9e-2 83 Click to see details
GSE32688 Pancreatic cancer -0.374 1.7e-2 -0.117 2.6e-1 32 Click to see details
GSE38226 Liver fibrosis -0.369 5.0e-2 -0.342 6.5e-2 21 Click to see details
GSE28260 Renal cortex and medulla -0.387 9.6e-2 -0.225 2.3e-1 13 Click to see details
GSE42095 Differentiated embryonic stem cells -0.278 1.0e-1 -0.198 1.8e-1 23 Click to see details
GSE19783 ER- ER- breast cancer 0.138 1.1e-1 0.042 3.6e-1 79 Click to see details
GSE26953 Aortic valvular endothelial cells -0.243 1.3e-1 -0.135 2.6e-1 24 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.231 1.3e-1 0.373 3.3e-2 25 Click to see details
GSE19350 CNS germ cell tumors 0.301 1.7e-1 0.343 1.4e-1 12 Click to see details
GSE14794 Lymphoblastoid cells -0.093 1.9e-1 -0.103 1.7e-1 90 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.174 2.0e-1 0.200 1.7e-1 25 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.17 2.4e-1 -0.038 4.4e-1 20 Click to see details
GSE17498 Multiple myeloma 0.108 2.5e-1 -0.055 3.7e-1 40 Click to see details
GSE17306 Multiple myeloma 0.075 3.0e-1 0.030 4.2e-1 49 Click to see details
GSE19536 Breast cancer 0.045 3.3e-1 -0.068 2.5e-1 100 Click to see details
GSE21849 B cell lymphoma 0.024 4.5e-1 0.105 2.9e-1 29 Click to see details
GSE21687 Ependynoma primary tumors 0.009 4.7e-1 0.043 3.7e-1 64 Click to see details
GSE27834 Pluripotent stem cells -0.016 4.8e-1 -0.071 4.0e-1 16 Click to see details
GSE27834 Pluripotent stem cells -0.016 4.8e-1 -0.071 4.0e-1 16 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA 0.328 0 0.190 0.04 84 Click to see details
CHOL 0.652 0.03 0.467 0.1 9 Click to see details
STAD -0.282 0.06 -0.315 0.04 32 Click to see details
HNSC 0.233 0.07 0.202 0.1 42 Click to see details
LUSC -0.151 0.18 -0.026 0.44 38 Click to see details
CESC -0.785 0.21 -1.000 0.5 3 Click to see details
PRAD 0.104 0.24 0.048 0.37 50 Click to see details
LUAD 0.219 0.25 0.252 0.21 12 Click to see details
BLCA -0.132 0.3 -0.230 0.18 18 Click to see details
KIRC 0.064 0.3 0.022 0.43 68 Click to see details
THCA 0.068 0.3 0.172 0.1 59 Click to see details
PCPG -0.328 0.39 -0.500 0.33 3 Click to see details
ESCA -0.066 0.42 0.036 0.46 11 Click to see details
UCEC 0.045 0.43 -0.147 0.27 19 Click to see details
COAD 0.048 0.46 0.071 0.43 8 Click to see details
KICH -0.021 0.46 -0.126 0.27 25 Click to see details
LIHC -0.01 0.47 0.012 0.47 49 Click to see details
KIRP -0.012 0.47 -0.043 0.41 32 Click to see details
PAAD -0.022 0.49 0.400 0.3 4 Click to see details
PAAD -0.022 0.49 0.400 0.3 4 Click to see details
PAAD -0.022 0.49 0.400 0.3 4 Click to see details
819 hsa-miR-24-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000116 FEN1 flap structure-specific endonuclease 1 5 1
MIRT000117 CDK4 cyclin dependent kinase 4 5 1
MIRT000119 CCNA2 cyclin A2 5 1
MIRT000120 AURKB aurora kinase B 5 1
MIRT000121 MYC MYC proto-oncogene, bHLH transcription factor 5 1
MIRT000122 E2F2 E2F transcription factor 2 5 1
MIRT001773 NOTCH1 notch 1 2 2
MIRT002018 DHFR dihydrofolate reductase 5 3
MIRT002950 MAPK14 mitogen-activated protein kinase 14 7 2
MIRT003354 TRIB3 tribbles pseudokinase 3 6 6
MIRT003355 HNF4A hepatocyte nuclear factor 4 alpha 5 2
MIRT003830 ACVR1B activin A receptor type 1B 5 6
MIRT003889 MLEC malectin 3 2
MIRT004362 CDKN2A cyclin dependent kinase inhibitor 2A 4 1
MIRT004836 BRCA1 BRCA1, DNA repair associated 5 2
MIRT004837 POLD1 DNA polymerase delta 1, catalytic subunit 5 1
MIRT005063 CDKN1B cyclin dependent kinase inhibitor 1B 6 6
MIRT005397 KHSRP KH-type splicing regulatory protein 2 2
MIRT005398 NFAT5 nuclear factor of activated T-cells 5 2 2
MIRT005766 DND1 DND microRNA-mediated repression inhibitor 1 3 1
MIRT005918 TGFB1 transforming growth factor beta 1 4 1
MIRT005919 FURIN furin, paired basic amino acid cleaving enzyme 4 2
MIRT006507 FAF1 Fas associated factor 1 2 1
MIRT007012 ZNF217 zinc finger protein 217 2 2
MIRT007215 ST7L suppression of tumorigenicity 7 like 3 1
MIRT030361 VRK1 vaccinia related kinase 1 1 1
MIRT030362 NOP56 NOP56 ribonucleoprotein 1 1
MIRT030363 TBPL1 TATA-box binding protein like 1 1 1
MIRT030364 TNPO3 transportin 3 3 5
MIRT030365 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 1
MIRT030366 DDHD2 DDHD domain containing 2 1 1
MIRT030367 THOP1 thimet oligopeptidase 1 1 1
MIRT030368 MAP2K4 mitogen-activated protein kinase kinase 4 1 1
MIRT030369 UBE2C ubiquitin conjugating enzyme E2 C 1 1
MIRT030370 GNPAT glyceronephosphate O-acyltransferase 1 1
MIRT030371 METAP2 methionyl aminopeptidase 2 1 1
MIRT030372 KIAA0020 pumilio RNA binding family member 3 1 1
MIRT030373 UGDH UDP-glucose 6-dehydrogenase 3 5
MIRT030374 URM1 ubiquitin related modifier 1 1 1
MIRT030375 GTF2E1 general transcription factor IIE subunit 1 1 1
MIRT030376 MED22 mediator complex subunit 22 1 1
MIRT030377 USP10 ubiquitin specific peptidase 10 1 1
MIRT030378 FKBP1B FK506 binding protein 1B 1 1
MIRT030379 SCML1 Scm polycomb group protein like 1 1 1
MIRT030380 CNDP2 carnosine dipeptidase 2 2 1
MIRT030381 MCM10 minichromosome maintenance 10 replication initiation factor 2 1
MIRT030382 TOP1 DNA topoisomerase I 2 1
MIRT030383 H2AFX H2A histone family member X 4 3
MIRT030384 TOMM22 translocase of outer mitochondrial membrane 22 1 1
MIRT030385 HBQ1 hemoglobin subunit theta 1 1 1
MIRT030386 PRIM1 DNA primase subunit 1 1 1
MIRT030387 PSMD1 proteasome 26S subunit, non-ATPase 1 3 3
MIRT030388 AUNIP aurora kinase A and ninein interacting protein 1 1
MIRT030389 NARF nuclear prelamin A recognition factor 1 1
MIRT030390 MALSU1 mitochondrial assembly of ribosomal large subunit 1 1 1
MIRT030391 TCEA3 transcription elongation factor A3 1 1
MIRT030392 ADRM1 adhesion regulating molecule 1 1 1
MIRT030393 AGFG1 ArfGAP with FG repeats 1 1 1
MIRT030394 ACD ACD, shelterin complex subunit and telomerase recruitment factor 1 1
MIRT030395 RCE1 Ras converting CAAX endopeptidase 1 1 1
MIRT030396 SUMO3 small ubiquitin-like modifier 3 1 1
MIRT030397 CYP20A1 cytochrome P450 family 20 subfamily A member 1 3 3
MIRT030398 C18orf56 TYMS opposite strand 1 1
MIRT030399 MIS18A MIS18 kinetochore protein A 1 1
MIRT030400 GLYR1 glyoxylate reductase 1 homolog 1 1
MIRT030401 NAE1 NEDD8 activating enzyme E1 subunit 1 1 1
MIRT030402 ACTL6A actin like 6A 1 1
MIRT030403 NCBP2 nuclear cap binding protein subunit 2 1 1
MIRT030404 SLC29A4 solute carrier family 29 member 4 1 1
MIRT030405 PHF16 jade family PHD finger 3 1 1
MIRT030406 GYG2 glycogenin 2 1 1
MIRT030407 SLC7A2 solute carrier family 7 member 2 1 1
MIRT030408 EXOSC8 exosome component 8 1 1
MIRT030409 TDRP testis development related protein 1 1
MIRT030410 R3HDM4 R3H domain containing 4 1 1
MIRT030411 DCAF4 DDB1 and CUL4 associated factor 4 1 1
MIRT030412 TAF15 TATA-box binding protein associated factor 15 1 1
MIRT030413 VPS25 vacuolar protein sorting 25 homolog 1 1
MIRT030414 NR0B2 nuclear receptor subfamily 0 group B member 2 1 1
MIRT030415 NASP nuclear autoantigenic sperm protein 1 1
MIRT030416 STRADB STE20-related kinase adaptor beta 1 1
MIRT030417 MTF2 metal response element binding transcription factor 2 1 1
MIRT030418 PHOSPHO2 phosphatase, orphan 2 1 1
MIRT030419 ATAD3A ATPase family, AAA domain containing 3A 1 1
MIRT030420 CCDC59 coiled-coil domain containing 59 3 3
MIRT030421 VPS35 VPS35, retromer complex component 1 1
MIRT030422 PAF1 PAF1 homolog, Paf1/RNA polymerase II complex component 1 1
MIRT030423 CIRBP cold inducible RNA binding protein 1 1
MIRT030424 S100P S100 calcium binding protein P 1 1
MIRT030425 ARHGEF7 Rho guanine nucleotide exchange factor 7 1 1
MIRT030426 PROSER1 proline and serine rich 1 1 1
MIRT030427 PDLIM7 PDZ and LIM domain 7 1 1
MIRT030428 KIAA0100 KIAA0100 1 1
MIRT030429 TOMM34 translocase of outer mitochondrial membrane 34 1 1
MIRT030430 CTCF CCCTC-binding factor 1 1
MIRT030431 EIF4G3 eukaryotic translation initiation factor 4 gamma 3 1 1
MIRT030432 SLC52A2 solute carrier family 52 member 2 1 1
MIRT030433 KHNYN KH and NYN domain containing 1 1
MIRT030434 ADD1 adducin 1 1 1
MIRT030435 ZBED1 zinc finger BED-type containing 1 1 1
MIRT030436 KLHL23 kelch like family member 23 1 1
MIRT030437 SULT2A1 sulfotransferase family 2A member 1 1 1
MIRT030438 LSM12 LSM12 homolog 1 1
MIRT030439 PDPK1 3-phosphoinositide dependent protein kinase 1 3 3
MIRT030440 CARD10 caspase recruitment domain family member 10 4 2
MIRT030441 PPM1F protein phosphatase, Mg2+/Mn2+ dependent 1F 1 1
MIRT030442 NRIP1 nuclear receptor interacting protein 1 1 1
MIRT030443 ARHGEF18 Rho/Rac guanine nucleotide exchange factor 18 1 1
MIRT030444 FNTB farnesyltransferase, CAAX box, beta 1 1
MIRT030445 PAK4 p21 (RAC1) activated kinase 4 4 4
MIRT030446 KPNA6 karyopherin subunit alpha 6 1 1
MIRT030447 BCL2L2 BCL2 like 2 1 1
MIRT030448 PSTPIP2 proline-serine-threonine phosphatase interacting protein 2 1 1
MIRT030449 ACACA acetyl-CoA carboxylase alpha 1 1
MIRT030450 MATR3 matrin 3 3 3
MIRT030451 PTPLAD1 3-hydroxyacyl-CoA dehydratase 3 1 1
MIRT030452 TSPAN14 tetraspanin 14 1 1
MIRT030453 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT030454 MIDN midnolin 1 1
MIRT030455 CCDC58 coiled-coil domain containing 58 1 1
MIRT030456 LAPTM4B lysosomal protein transmembrane 4 beta 1 1
MIRT030457 PPP3R1 protein phosphatase 3 regulatory subunit B, alpha 1 1
MIRT030458 ZNF813 zinc finger protein 813 1 1
MIRT030459 MAGI1 membrane associated guanylate kinase, WW and PDZ domain containing 1 1 1
MIRT030460 ZCCHC14 zinc finger CCHC-type containing 14 1 1
MIRT030461 PTGFRN prostaglandin F2 receptor inhibitor 1 1
MIRT030462 SCML2 Scm polycomb group protein like 2 2 2
MIRT030463 DNAJB12 DnaJ heat shock protein family (Hsp40) member B12 1 1
MIRT030464 NUP54 nucleoporin 54 2 2
MIRT030465 SESN1 sestrin 1 2 2
MIRT030466 SLC35B2 solute carrier family 35 member B2 2 2
MIRT030467 AGPAT3 1-acylglycerol-3-phosphate O-acyltransferase 3 2 2
MIRT030468 UBD ubiquitin D 2 1
MIRT030469 RRM2 ribonucleotide reductase regulatory subunit M2 2 1
MIRT030470 BCL2L12 BCL2 like 12 2 1
MIRT030471 MBD6 methyl-CpG binding domain protein 6 2 1
MIRT030472 OXSR1 oxidative stress responsive 1 1 1
MIRT030473 PER2 period circadian clock 2 2 1
MIRT030474 UNG uracil DNA glycosylase 1 1
MIRT030475 RRP12 ribosomal RNA processing 12 homolog 1 1
MIRT030476 CWC27 CWC27 spliceosome associated protein homolog 1 1
MIRT030477 SRRT serrate, RNA effector molecule 1 1
MIRT030478 PACSIN3 protein kinase C and casein kinase substrate in neurons 3 1 1
MIRT030479 EXOSC3 exosome component 3 1 1
MIRT030480 ALG5 ALG5, dolichyl-phosphate beta-glucosyltransferase 1 1
MIRT030481 SLC2A3 solute carrier family 2 member 3 1 1
MIRT030482 MRPS24 mitochondrial ribosomal protein S24 1 1
MIRT030483 EIF2S3 eukaryotic translation initiation factor 2 subunit gamma 4 4
MIRT030484 GTF3C2 general transcription factor IIIC subunit 2 1 1
MIRT030485 FAH fumarylacetoacetate hydrolase 1 1
MIRT030486 ARL1 ADP ribosylation factor like GTPase 1 1 1
MIRT030487 MED16 mediator complex subunit 16 3 3
MIRT030488 MED24 mediator complex subunit 24 1 1
MIRT030489 CCAR1 cell division cycle and apoptosis regulator 1 1 1
MIRT030490 DUS1L dihydrouridine synthase 1 like 1 1
MIRT030491 BEX1 brain expressed X-linked 1 1 1
MIRT030492 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT030493 EIF4H eukaryotic translation initiation factor 4H 1 1
MIRT030494 DCP2 decapping mRNA 2 1 1
MIRT030495 ABCE1 ATP binding cassette subfamily E member 1 1 1
MIRT030496 UBE3A ubiquitin protein ligase E3A 1 1
MIRT030497 TYW3 tRNA-yW synthesizing protein 3 homolog 1 1
MIRT030498 UQCC ubiquinol-cytochrome c reductase complex assembly factor 1 1 1
MIRT030499 NKD1 naked cuticle homolog 1 1 1
MIRT030500 NFKBIA NFKB inhibitor alpha 1 1
MIRT030501 AK3 adenylate kinase 3 1 1
MIRT030502 NSA2 NSA2, ribosome biogenesis homolog 1 1
MIRT030503 CDK1 cyclin dependent kinase 1 5 1
MIRT030504 HSF2 heat shock transcription factor 2 1 1
MIRT030505 CDCA7 cell division cycle associated 7 1 1
MIRT030506 NCOA6 nuclear receptor coactivator 6 1 1
MIRT030507 TNIP2 TNFAIP3 interacting protein 2 1 1
MIRT030508 AKAP7 A-kinase anchoring protein 7 1 1
MIRT030509 TUBGCP2 tubulin gamma complex associated protein 2 1 1
MIRT030510 POLR2D RNA polymerase II subunit D 3 3
MIRT030511 FBXO34 F-box protein 34 1 1
MIRT030512 STK35 serine/threonine kinase 35 1 1
MIRT030513 CTDSP2 CTD small phosphatase 2 1 1
MIRT030514 C8orf33 chromosome 8 open reading frame 33 1 1
MIRT030515 ZDHHC3 zinc finger DHHC-type containing 3 1 1
MIRT030516 IQCB1 IQ motif containing B1 1 1
MIRT030517 RHOT2 ras homolog family member T2 1 1
MIRT030518 ALDH5A1 aldehyde dehydrogenase 5 family member A1 1 1
MIRT030519 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT030520 SLC11A2 solute carrier family 11 member 2 1 1
MIRT030521 GBAS nipsnap homolog 2 1 1
MIRT030522 SLC5A6 solute carrier family 5 member 6 1 1
MIRT030523 NEK6 NIMA related kinase 6 1 1
MIRT030524 SLC7A1 solute carrier family 7 member 1 1 1
MIRT030525 GGA2 golgi associated, gamma adaptin ear containing, ARF binding protein 2 3 3
MIRT030526 ADPGK ADP dependent glucokinase 1 1
MIRT030527 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT030528 FZD4 frizzled class receptor 4 1 1
MIRT030529 AAMP angio associated migratory cell protein 1 1
MIRT030530 PLIN3 perilipin 3 1 1
MIRT030531 LLGL1 LLGL1, scribble cell polarity complex component 3 5
MIRT030532 KLHDC3 kelch domain containing 3 1 1
MIRT030533 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT030534 MARCKSL1 MARCKS like 1 3 3
MIRT030535 C1orf106 chromosome 1 open reading frame 106 3 3
MIRT030536 ADD3 adducin 3 1 1
MIRT030537 SNTB1 syntrophin beta 1 1 1
MIRT030538 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT030539 TMTC4 transmembrane and tetratricopeptide repeat containing 4 1 1
MIRT030540 GLUL glutamate-ammonia ligase 1 1
MIRT030541 TMEM209 transmembrane protein 209 1 1
MIRT030542 LBR lamin B receptor 1 1
MIRT030543 LIMD1 LIM domains containing 1 1 1
MIRT030544 SPIN4 spindlin family member 4 1 1
MIRT030545 ZNF264 zinc finger protein 264 2 6
MIRT030546 VGLL3 vestigial like family member 3 1 1
MIRT030547 BCL2L11 BCL2 like 11 5 12
MIRT030548 DEDD death effector domain containing 1 1
MIRT030549 CD34 CD34 molecule 1 1
MIRT030550 TMED7 transmembrane p24 trafficking protein 7 1 1
MIRT030551 E2F3 E2F transcription factor 3 2 1
MIRT030552 ZNF317 zinc finger protein 317 2 1
MIRT030553 STX16 syntaxin 16 2 1
MIRT030554 DHFRP1 dihydrofolate reductase pseudogene 1 1 1
MIRT030555 CHEK1 checkpoint kinase 1 4 1
MIRT030556 NOTUM NOTUM, palmitoleoyl-protein carboxylesterase 1 1
MIRT030557 ABCB10 ATP binding cassette subfamily B member 10 1 1
MIRT030558 CCL2 C-C motif chemokine ligand 2 1 1
MIRT030559 OARD1 O-acyl-ADP-ribose deacylase 1 1 1
MIRT030560 PCGF6 polycomb group ring finger 6 1 1
MIRT030561 SNRPD3 small nuclear ribonucleoprotein D3 polypeptide 3 3
MIRT030562 CTDSP1 CTD small phosphatase 1 1 1
MIRT030563 MAK16 MAK16 homolog 1 1
MIRT030564 RNF144A ring finger protein 144A 1 1
MIRT030565 TM9SF3 transmembrane 9 superfamily member 3 1 1
MIRT030566 C15orf57 coiled-coil domain containing 32 1 1
MIRT030567 COMMD9 COMM domain containing 9 1 1
MIRT030568 SLC25A15 solute carrier family 25 member 15 1 1
MIRT030569 NOP14 NOP14 nucleolar protein 1 1
MIRT030570 CHD8 chromodomain helicase DNA binding protein 8 1 1
MIRT030571 OGFR opioid growth factor receptor 1 1
MIRT030572 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT030573 PCK2 phosphoenolpyruvate carboxykinase 2, mitochondrial 1 1
MIRT030574 SERGEF secretion regulating guanine nucleotide exchange factor 1 1
MIRT030575 ANPEP alanyl aminopeptidase, membrane 1 1
MIRT030576 ITFG3 family with sequence similarity 234 member A 1 1
MIRT030577 PSME3 proteasome activator subunit 3 1 1
MIRT030578 PRKRIR THAP domain containing 12 1 1
MIRT030579 AP5M1 adaptor related protein complex 5 mu 1 subunit 1 1
MIRT030580 HMGB2 high mobility group box 2 1 1
MIRT030581 TNFAIP3 TNF alpha induced protein 3 1 1
MIRT030582 CSTF3 cleavage stimulation factor subunit 3 1 1
MIRT030583 FOXQ1 forkhead box Q1 1 1
MIRT030584 BTBD3 BTB domain containing 3 1 1
MIRT030585 PA2G4 proliferation-associated 2G4 1 1
MIRT030586 ZMYND19 zinc finger MYND-type containing 19 1 1
MIRT030587 CHFR checkpoint with forkhead and ring finger domains 1 1
MIRT030588 CCNB1 cyclin B1 1 1
MIRT030589 ERBB3 erb-b2 receptor tyrosine kinase 3 3 3
MIRT030590 NEDD4L neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase 1 1
MIRT030591 NETO2 neuropilin and tolloid like 2 3 3
MIRT030592 LAMTOR3 late endosomal/lysosomal adaptor, MAPK and MTOR activator 3 1 1
MIRT030593 MRPL27 mitochondrial ribosomal protein L27 1 1
MIRT030594 COPS7A COP9 signalosome subunit 7A 1 1
MIRT030595 DSC2 desmocollin 2 1 1
MIRT030596 DHCR24 24-dehydrocholesterol reductase 1 1
MIRT030597 RPL7L1 ribosomal protein L7 like 1 1 1
MIRT030598 KIAA0195 transmembrane protein 94 1 1
MIRT030599 KIAA1967 cell cycle and apoptosis regulator 2 1 1
MIRT030600 HIC2 HIC ZBTB transcriptional repressor 2 1 1
MIRT030601 DTL denticleless E3 ubiquitin protein ligase homolog 1 1
MIRT030602 NUBPL nucleotide binding protein like 1 1
MIRT030603 GMFB glia maturation factor beta 1 1
MIRT030604 PLAGL2 PLAG1 like zinc finger 2 3 3
MIRT030605 CMTM3 CKLF like MARVEL transmembrane domain containing 3 1 1
MIRT030606 CSK C-terminal Src kinase 1 1
MIRT030607 MMS19 MMS19 homolog, cytosolic iron-sulfur assembly component 1 1
MIRT030608 MRPS22 mitochondrial ribosomal protein S22 1 1
MIRT030609 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT030610 NET1 neuroepithelial cell transforming 1 1 1
MIRT030611 GUCD1 guanylyl cyclase domain containing 1 3 5
MIRT030612 RALA RAS like proto-oncogene A 1 1
MIRT030613 AK4 adenylate kinase 4 1 1
MIRT030614 KCNJ14 potassium voltage-gated channel subfamily J member 14 1 1
MIRT030615 JARID2 jumonji and AT-rich interaction domain containing 2 1 1
MIRT030616 BRD8 bromodomain containing 8 1 1
MIRT030617 PIM2 Pim-2 proto-oncogene, serine/threonine kinase 1 1
MIRT030618 GFOD1 glucose-fructose oxidoreductase domain containing 1 1 1
MIRT030619 HDAC1 histone deacetylase 1 1 1
MIRT030620 WRB tryptophan rich basic protein 1 1
MIRT030621 TMEM194A nuclear envelope integral membrane protein 1 1 1
MIRT030622 YOD1 YOD1 deubiquitinase 1 1
MIRT030623 RNF11 ring finger protein 11 1 1
MIRT030624 RNF2 ring finger protein 2 2 3
MIRT030625 FZD5 frizzled class receptor 5 5 2
MIRT030626 E2F1 E2F transcription factor 1 1 1
MIRT030627 CORO1A coronin 1A 1 1
MIRT030628 UBC ubiquitin C 1 1
MIRT030629 MCM4 minichromosome maintenance complex component 4 2 1
MIRT030630 PDXK pyridoxal kinase 2 2
MIRT030631 PCNA proliferating cell nuclear antigen 3 1
MIRT035526 PTPN9 protein tyrosine phosphatase, non-receptor type 9 1 1
MIRT035527 PTPRF protein tyrosine phosphatase, receptor type F 1 1
MIRT035542 SH3PXD2A SH3 and PX domains 2A 1 1
MIRT035543 ARHGAP19 Rho GTPase activating protein 19 1 1
MIRT050365 RPS7 ribosomal protein S7 1 1
MIRT050366 EXOSC1 exosome component 1 1 1
MIRT050367 AMPD2 adenosine monophosphate deaminase 2 1 1
MIRT050368 RANBP1 RAN binding protein 1 1 1
MIRT050369 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 1
MIRT050370 DARS2 aspartyl-tRNA synthetase 2, mitochondrial 1 1
MIRT050371 RPS16 ribosomal protein S16 1 1
MIRT050372 DEPDC1 DEP domain containing 1 1 1
MIRT050373 DDX5 DEAD-box helicase 5 1 1
MIRT050374 BCL7A BCL tumor suppressor 7A 1 1
MIRT050375 SNX12 sorting nexin 12 1 1
MIRT050376 GORASP2 golgi reassembly stacking protein 2 1 1
MIRT050377 RIF1 replication timing regulatory factor 1 2 3
MIRT050378 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT050379 CCNG1 cyclin G1 1 1
MIRT050380 IKBKAP elongator complex protein 1 1 1
MIRT050381 ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide 1 1
MIRT050382 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT050383 DCAF10 DDB1 and CUL4 associated factor 10 1 1
MIRT052941 Furin furin (paired basic amino acid cleaving enzyme) 2 1
MIRT052953 S100A8 S100 calcium binding protein A8 2 1
MIRT053042 MXI1 MAX interactor 1, dimerization protein 3 1
MIRT053061 XIAP X-linked inhibitor of apoptosis 5 3
MIRT053134 NOS3 nitric oxide synthase 3 3 1
MIRT053161 INSIG1 insulin induced gene 1 4 7
MIRT053238 CYP11B2 cytochrome P450 family 11 subfamily B member 2 2 1
MIRT053779 REG4 regenerating family member 4 3 1
MIRT054288 MEN1 menin 1 5 3
MIRT054320 LDHA lactate dehydrogenase A 4 3
MIRT054323 LDHB lactate dehydrogenase B 2 1
MIRT054386 JPH2 junctophilin 2 3 3
MIRT054393 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 1 1
MIRT054474 MAP3K9 mitogen-activated protein kinase kinase kinase 9 2 1
MIRT054710 SSSCA1 Sjogren syndrome/scleroderma autoantigen 1 3 1
MIRT054754 HMOX1 heme oxygenase 1 2 1
MIRT054828 PSAP prosaposin 4 1
MIRT115232 ABHD2 abhydrolase domain containing 2 2 2
MIRT123977 POLR3D RNA polymerase III subunit D 2 2
MIRT196600 TAOK1 TAO kinase 1 2 2
MIRT249228 EIF5 eukaryotic translation initiation factor 5 2 2
MIRT256046 UBE2K ubiquitin conjugating enzyme E2 K 2 4
MIRT324457 ASB6 ankyrin repeat and SOCS box containing 6 2 2
MIRT327634 ZXDB zinc finger, X-linked, duplicated B 2 6
MIRT338141 SP1 Sp1 transcription factor 1 1
MIRT352061 BZW1 basic leucine zipper and W2 domains 1 2 2
MIRT395244 MT1E metallothionein 1E 2 2
MIRT437500 MMP14 matrix metallopeptidase 14 1 1
MIRT437826 AGPAT2 1-acylglycerol-3-phosphate O-acyltransferase 2 1 1
MIRT437970 IFNG interferon gamma 3 1
MIRT438418 FGFR3 fibroblast growth factor receptor 3 4 1
MIRT438421 TACC3 transforming acidic coiled-coil containing protein 3 4 1
MIRT438424 MAFB MAF bZIP transcription factor B 4 1
MIRT438427 CCND1 cyclin D1 4 1
MIRT438454 NCSTN nicastrin 1 1
MIRT438533 IFNR interferon production regulator 2 1
MIRT438608 WNT4 Wnt family member 4 1 1
MIRT438644 NDST1 N-deacetylase and N-sulfotransferase 1 3 1
MIRT447723 RPS6KA5 ribosomal protein S6 kinase A5 2 2
MIRT447760 TTLL7 tubulin tyrosine ligase like 7 2 2
MIRT455064 ARHGAP39 Rho GTPase activating protein 39 2 2
MIRT455750 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 2 2
MIRT457051 NEGR1 neuronal growth regulator 1 2 4
MIRT458116 TMEM173 transmembrane protein 173 2 2
MIRT458530 HKR1 HKR1, GLI-Kruppel zinc finger family member 2 2
MIRT462325 SETX senataxin 2 2
MIRT464501 UCK2 uridine-cytidine kinase 2 2 2
MIRT465466 TOR2A torsin family 2 member A 2 2
MIRT471227 PHAX phosphorylated adaptor for RNA export 2 2
MIRT476066 GRINA glutamate ionotropic receptor NMDA type subunit associated protein 1 2 2
MIRT476461 GBA2 glucosylceramidase beta 2 2 2
MIRT476706 FSCN1 fascin actin-bundling protein 1 2 2
MIRT476916 FBLIM1 filamin binding LIM protein 1 2 4
MIRT477425 EMP1 epithelial membrane protein 1 2 2
MIRT477908 DVL3 dishevelled segment polarity protein 3 2 4
MIRT478339 DDN dendrin 2 2
MIRT478801 CRTAP cartilage associated protein 2 4
MIRT479899 CCDC117 coiled-coil domain containing 117 2 2
MIRT480435 C17orf49 chromosome 17 open reading frame 49 2 2
MIRT481095 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 2 2
MIRT481990 AMOTL2 angiomotin like 2 2 2
MIRT486982 STEAP3 STEAP3 metalloreductase 2 4
MIRT489236 CLN8 CLN8, transmembrane ER and ERGIC protein 2 4
MIRT490739 SRCIN1 SRC kinase signaling inhibitor 1 2 2
MIRT492019 UGCG UDP-glucose ceramide glucosyltransferase 2 2
MIRT493589 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 6
MIRT494058 DUSP7 dual specificity phosphatase 7 2 2
MIRT499970 NCOA5 nuclear receptor coactivator 5 2 2
MIRT501272 NHS NHS actin remodeling regulator 2 4
MIRT501542 POGZ pogo transposable element derived with ZNF domain 2 2
MIRT527694 IL17REL interleukin 17 receptor E like 2 2
MIRT527729 TMEM241 transmembrane protein 241 2 2
MIRT528420 MRPS16 mitochondrial ribosomal protein S16 2 2
MIRT528870 ATF3 activating transcription factor 3 2 2
MIRT530340 GABRB3 gamma-aminobutyric acid type A receptor beta3 subunit 2 2
MIRT540115 KLF17 Kruppel like factor 17 2 2
MIRT540603 CD3D CD3d molecule 2 4
MIRT540636 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT541054 SEPHS1 selenophosphate synthetase 1 2 2
MIRT541713 TMEM33 transmembrane protein 33 2 2
MIRT541847 PLIN5 perilipin 5 2 2
MIRT541892 LY6G5B lymphocyte antigen 6 family member G5B 2 2
MIRT542947 GIGYF1 GRB10 interacting GYF protein 1 2 2
MIRT545431 SCAMP2 secretory carrier membrane protein 2 2 2
MIRT549513 HDDC2 HD domain containing 2 2 2
MIRT556737 KLHL15 kelch like family member 15 2 4
MIRT559280 AURKA aurora kinase A 2 2
MIRT564581 ZXDA zinc finger, X-linked, duplicated A 2 2
MIRT571909 LSM14A LSM14A, mRNA processing body assembly factor 2 4
MIRT575280 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 2 2
MIRT607045 IDS iduronate 2-sulfatase 2 2
MIRT607713 LIMS1 LIM zinc finger domain containing 1 2 2
MIRT608083 CRISPLD2 cysteine rich secretory protein LCCL domain containing 2 2 2
MIRT609645 PACS2 phosphofurin acidic cluster sorting protein 2 2 2
MIRT610567 HIST3H2BB histone cluster 3 H2B family member b 2 2
MIRT611112 NIPA1 non imprinted in Prader-Willi/Angelman syndrome 1 2 2
MIRT613671 KIAA1210 KIAA1210 2 2
MIRT615060 CRY2 cryptochrome circadian clock 2 2 2
MIRT617926 ZNF783 zinc finger family member 783 2 2
MIRT618465 GPR55 G protein-coupled receptor 55 2 2
MIRT619409 NTPCR nucleoside-triphosphatase, cancer-related 2 2
MIRT620694 RFTN2 raftlin family member 2 2 2
MIRT620921 LRRTM2 leucine rich repeat transmembrane neuronal 2 2 2
MIRT621035 POLA2 DNA polymerase alpha 2, accessory subunit 2 2
MIRT622583 PRRG4 proline rich and Gla domain 4 2 2
MIRT623371 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 2
MIRT623402 LEPROTL1 leptin receptor overlapping transcript like 1 2 2
MIRT625024 ZNF730 zinc finger protein 730 2 2
MIRT625113 SLC1A5 solute carrier family 1 member 5 2 4
MIRT625326 TNFRSF13B TNF receptor superfamily member 13B 2 2
MIRT625414 IMP4 IMP4, U3 small nucleolar ribonucleoprotein 2 2
MIRT625832 NXPE2 neurexophilin and PC-esterase domain family member 2 2 2
MIRT625899 LINC00632 long intergenic non-protein coding RNA 632 2 2
MIRT626169 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 2 2
MIRT626607 ACAA2 acetyl-CoA acyltransferase 2 2 2
MIRT626675 CISD2 CDGSH iron sulfur domain 2 2 2
MIRT626815 PRR11 proline rich 11 2 2
MIRT626828 ZNF430 zinc finger protein 430 2 2
MIRT627784 RAB11FIP1 RAB11 family interacting protein 1 2 2
MIRT628137 HM13 histocompatibility minor 13 2 2
MIRT628610 ZBTB3 zinc finger and BTB domain containing 3 2 2
MIRT628683 TRAF3IP1 TRAF3 interacting protein 1 2 2
MIRT628787 GSDMA gasdermin A 2 2
MIRT628858 KCNE4 potassium voltage-gated channel subfamily E regulatory subunit 4 2 2
MIRT629019 OSBPL10 oxysterol binding protein like 10 2 2
MIRT629125 APPL1 adaptor protein, phosphotyrosine interacting with PH domain and leucine zipper 1 2 4
MIRT629200 PAPOLA poly(A) polymerase alpha 2 2
MIRT629207 ZNF878 zinc finger protein 878 2 2
MIRT629234 CINP cyclin dependent kinase 2 interacting protein 2 2
MIRT629398 CRCP CGRP receptor component 2 2
MIRT629517 ULBP3 UL16 binding protein 3 2 4
MIRT629559 EMP2 epithelial membrane protein 2 2 2
MIRT629570 PIGR polymeric immunoglobulin receptor 2 2
MIRT629748 SCD5 stearoyl-CoA desaturase 5 2 2
MIRT629797 GPR82 G protein-coupled receptor 82 2 2
MIRT629813 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 2 2
MIRT629833 CCL16 C-C motif chemokine ligand 16 2 2
MIRT629907 SPATA5 spermatogenesis associated 5 2 2
MIRT629982 NARS asparaginyl-tRNA synthetase 2 2
MIRT630004 PDE6B phosphodiesterase 6B 2 2
MIRT630034 MTL5 testis expressed metallothionein like protein 2 2
MIRT630075 GRWD1 glutamate rich WD repeat containing 1 2 2
MIRT630136 ZFYVE9 zinc finger FYVE-type containing 9 2 2
MIRT630208 SVIP small VCP interacting protein 2 2
MIRT630219 SORD sorbitol dehydrogenase 2 2
MIRT630250 SMTNL2 smoothelin like 2 2 2
MIRT630295 PRICKLE1 prickle planar cell polarity protein 1 2 2
MIRT630400 MYH9 myosin heavy chain 9 2 2
MIRT630411 MOB1A MOB kinase activator 1A 2 2
MIRT630436 KIF1C kinesin family member 1C 2 2
MIRT630475 DTD2 D-tyrosyl-tRNA deacylase 2 (putative) 2 2
MIRT630517 CDC73 cell division cycle 73 2 2
MIRT630809 XPNPEP3 X-prolyl aminopeptidase 3 2 2
MIRT630819 YTHDC1 YTH domain containing 1 2 2
MIRT630833 ZNF621 zinc finger protein 621 2 2
MIRT630913 ZMAT2 zinc finger matrin-type 2 2 2
MIRT631166 APTX aprataxin 2 2
MIRT631210 DENND6B DENN domain containing 6B 2 2
MIRT631569 TRAF3IP2 TRAF3 interacting protein 2 2 2
MIRT631648 C19orf35 PEAK family member 3 2 2
MIRT631698 C1QTNF6 C1q and TNF related 6 2 2
MIRT631755 MINOS1 mitochondrial inner membrane organizing system 1 2 2
MIRT631997 POPDC2 popeye domain containing 2 2 2
MIRT632015 TAF1B TATA-box binding protein associated factor, RNA polymerase I subunit B 2 2
MIRT632034 SPPL2A signal peptide peptidase like 2A 2 2
MIRT632219 YME1L1 YME1 like 1 ATPase 2 2
MIRT632351 STRN3 striatin 3 2 2
MIRT632358 SRRD SRR1 domain containing 2 2
MIRT632426 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 2
MIRT632456 SGTB small glutamine rich tetratricopeptide repeat containing beta 2 2
MIRT632493 RBM3 RNA binding motif (RNP1, RRM) protein 3 2 2
MIRT632631 PARP2 poly(ADP-ribose) polymerase 2 2 2
MIRT632637 OSMR oncostatin M receptor 2 2
MIRT632718 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT632753 MED28 mediator complex subunit 28 2 2
MIRT632761 MDM4 MDM4, p53 regulator 2 2
MIRT632841 IGF1 insulin like growth factor 1 3 2
MIRT633144 C4orf32 family with sequence similarity 241 member A 2 2
MIRT633162 C11orf84 chromosome 11 open reading frame 84 2 2
MIRT633256 ZNF581 zinc finger protein 581 2 2
MIRT633260 ZNF556 zinc finger protein 556 2 2
MIRT633305 LINC00346 long intergenic non-protein coding RNA 346 2 2
MIRT633327 PRPF6 pre-mRNA processing factor 6 2 2
MIRT633336 GRK4 G protein-coupled receptor kinase 4 2 2
MIRT633354 TFDP2 transcription factor Dp-2 2 2
MIRT633460 DSN1 DSN1 homolog, MIS12 kinetochore complex component 2 2
MIRT633498 ERO1L endoplasmic reticulum oxidoreductase 1 alpha 1 1
MIRT633534 PGBD5 piggyBac transposable element derived 5 2 2
MIRT633621 R3HDM2 R3H domain containing 2 2 2
MIRT633748 MCM9 minichromosome maintenance 9 homologous recombination repair factor 2 2
MIRT633874 ATP6V1A ATPase H+ transporting V1 subunit A 2 2
MIRT634001 SSR1 signal sequence receptor subunit 1 2 2
MIRT634106 ZNF8 zinc finger protein 8 2 2
MIRT634121 ZMYM1 zinc finger MYM-type containing 1 2 4
MIRT634135 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 2 2
MIRT634182 TXNDC16 thioredoxin domain containing 16 2 2
MIRT634205 TMEM192 transmembrane protein 192 2 2
MIRT634277 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT634308 SNTN sentan, cilia apical structure protein 2 2
MIRT634362 RASSF9 Ras association domain family member 9 2 2
MIRT634446 PDE7A phosphodiesterase 7A 2 2
MIRT634467 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 2
MIRT634482 OR7D2 olfactory receptor family 7 subfamily D member 2 2 2
MIRT634612 IKZF3 IKAROS family zinc finger 3 2 2
MIRT634627 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT635035 WWTR1 WW domain containing transcription regulator 1 2 2
MIRT635140 PLEKHA2 pleckstrin homology domain containing A2 2 2
MIRT635801 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT636093 ZFP30 ZFP30 zinc finger protein 2 2
MIRT636334 PI4K2B phosphatidylinositol 4-kinase type 2 beta 2 2
MIRT636711 ARSK arylsulfatase family member K 2 4
MIRT636762 C17orf75 chromosome 17 open reading frame 75 2 2
MIRT636840 MBOAT1 membrane bound O-acyltransferase domain containing 1 2 4
MIRT636938 CCDC122 coiled-coil domain containing 122 2 2
MIRT637028 SPTLC3 serine palmitoyltransferase long chain base subunit 3 2 2
MIRT637079 SELPLG selectin P ligand 2 2
MIRT637426 ZC3H12B zinc finger CCCH-type containing 12B 2 2
MIRT637959 NECAB3 N-terminal EF-hand calcium binding protein 3 2 2
MIRT638184 TLN1 talin 1 2 2
MIRT638344 RBMS2 RNA binding motif single stranded interacting protein 2 2 4
MIRT638571 IER5 immediate early response 5 2 2
MIRT638607 HINT1 histidine triad nucleotide binding protein 1 2 2
MIRT638657 GGCX gamma-glutamyl carboxylase 2 2
MIRT638768 EPB41 erythrocyte membrane protein band 4.1 2 2
MIRT638773 EMC7 ER membrane protein complex subunit 7 2 2
MIRT639018 AAK1 AP2 associated kinase 1 2 2
MIRT639091 ALDOA aldolase, fructose-bisphosphate A 2 2
MIRT639575 AVL9 AVL9 cell migration associated 2 2
MIRT639828 ZKSCAN1 zinc finger with KRAB and SCAN domains 1 2 2
MIRT640336 AP5B1 adaptor related protein complex 5 beta 1 subunit 2 2
MIRT640568 CPE carboxypeptidase E 2 2
MIRT641826 TSC22D2 TSC22 domain family member 2 2 2
MIRT642059 KCNK2 potassium two pore domain channel subfamily K member 2 2 2
MIRT643080 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643278 ZNF566 zinc finger protein 566 2 2
MIRT643443 LAX1 lymphocyte transmembrane adaptor 1 2 4
MIRT643866 COX20 COX20, cytochrome c oxidase assembly factor 2 2
MIRT645034 ATAD3C ATPase family, AAA domain containing 3C 2 2
MIRT645089 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT645155 NOL9 nucleolar protein 9 2 2
MIRT645990 ACP6 acid phosphatase 6, lysophosphatidic 2 2
MIRT646444 XRCC2 X-ray repair cross complementing 2 2 2
MIRT646505 FAM217B family with sequence similarity 217 member B 2 2
MIRT647713 NFX1 nuclear transcription factor, X-box binding 1 2 2
MIRT647978 PDE12 phosphodiesterase 12 2 2
MIRT648112 PTDSS2 phosphatidylserine synthase 2 2 2
MIRT649180 DNPEP aspartyl aminopeptidase 2 2
MIRT649311 IGSF6 immunoglobulin superfamily member 6 2 2
MIRT649384 TMEM19 transmembrane protein 19 2 2
MIRT649625 EHD2 EH domain containing 2 2 2
MIRT649716 TWSG1 twisted gastrulation BMP signaling modulator 1 2 2
MIRT649845 IRAK3 interleukin 1 receptor associated kinase 3 2 2
MIRT650369 MOCS3 molybdenum cofactor synthesis 3 2 2
MIRT651349 ZBTB8B zinc finger and BTB domain containing 8B 2 4
MIRT651388 ZBTB16 zinc finger and BTB domain containing 16 2 2
MIRT651610 WDFY2 WD repeat and FYVE domain containing 2 2 2
MIRT652860 TAB1 TGF-beta activated kinase 1 (MAP3K7) binding protein 1 2 2
MIRT653271 SNAP29 synaptosome associated protein 29 2 2
MIRT653829 SHROOM3 shroom family member 3 2 2
MIRT654023 SAMD5 sterile alpha motif domain containing 5 2 2
MIRT654435 RASGRP3 RAS guanyl releasing protein 3 2 2
MIRT654489 RAD54L2 RAD54 like 2 2 2
MIRT654642 PTAFR platelet activating factor receptor 2 2
MIRT654712 PRR13 proline rich 13 2 2
MIRT655096 PHLDA3 pleckstrin homology like domain family A member 3 2 2
MIRT655326 PCYOX1 prenylcysteine oxidase 1 2 2
MIRT655669 NUP43 nucleoporin 43 2 2
MIRT655933 NDUFA4P1 NDUFA4, mitochondrial complex associated pseudogene 1 2 2
MIRT657725 GPC4 glypican 4 2 2
MIRT658423 FAM177A1 family with sequence similarity 177 member A1 2 4
MIRT658703 EMC2 ER membrane protein complex subunit 2 2 2
MIRT658849 DUSP19 dual specificity phosphatase 19 2 2
MIRT658887 DRAXIN dorsal inhibitory axon guidance protein 2 2
MIRT659312 CSTF1 cleavage stimulation factor subunit 1 2 2
MIRT660234 BMP7 bone morphogenetic protein 7 2 2
MIRT661035 HIATL2 major facilitator superfamily domain containing 14C 2 2
MIRT661045 RABAC1 Rab acceptor 1 2 2
MIRT661236 ARL17B ADP ribosylation factor like GTPase 17B 2 2
MIRT661400 OLR1 oxidized low density lipoprotein receptor 1 2 2
MIRT661501 EIF1AD eukaryotic translation initiation factor 1A domain containing 2 2
MIRT661659 ZNF623 zinc finger protein 623 2 2
MIRT661872 PDLIM5 PDZ and LIM domain 5 2 2
MIRT662783 CNNM3 cyclin and CBS domain divalent metal cation transport mediator 3 2 2
MIRT663096 THEM4 thioesterase superfamily member 4 2 2
MIRT663668 TMEM216 transmembrane protein 216 2 2
MIRT663971 ZNF786 zinc finger protein 786 2 2
MIRT664170 APOBEC3F apolipoprotein B mRNA editing enzyme catalytic subunit 3F 2 2
MIRT664664 HEXA hexosaminidase subunit alpha 2 2
MIRT664692 DBF4 DBF4 zinc finger 2 2
MIRT664759 MESDC2 mesoderm development LRP chaperone 2 2
MIRT664772 LIAS lipoic acid synthetase 2 2
MIRT664862 SLC19A3 solute carrier family 19 member 3 2 2
MIRT665091 CRIPT CXXC repeat containing interactor of PDZ3 domain 2 2
MIRT665197 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 2 2
MIRT665344 YES1 YES proto-oncogene 1, Src family tyrosine kinase 2 2
MIRT665357 XKR4 XK related 4 2 2
MIRT665426 WDR55 WD repeat domain 55 2 2
MIRT665452 WDR17 WD repeat domain 17 2 2
MIRT665774 TMEM236 transmembrane protein 236 2 2
MIRT665902 TBCCD1 TBCC domain containing 1 2 2
MIRT666256 SLC33A1 solute carrier family 33 member 1 2 2
MIRT666709 RBL1 RB transcriptional corepressor like 1 2 2
MIRT667207 NIPAL1 NIPA like domain containing 1 2 2
MIRT667223 NFE2L1 nuclear factor, erythroid 2 like 1 2 2
MIRT667333 MTHFD1L methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1 like 2 2
MIRT667586 LONRF2 LON peptidase N-terminal domain and ring finger 2 2 2
MIRT667729 KIAA1456 KIAA1456 2 2
MIRT667907 ING1 inhibitor of growth family member 1 2 2
MIRT667960 HEYL hes related family bHLH transcription factor with YRPW motif-like 2 2
MIRT668074 GMPS guanine monophosphate synthase 2 2
MIRT668086 GMEB1 glucocorticoid modulatory element binding protein 1 2 2
MIRT668476 EXOSC2 exosome component 2 2 2
MIRT668507 ESYT2 extended synaptotagmin 2 2 2
MIRT668539 ERGIC1 endoplasmic reticulum-golgi intermediate compartment 1 2 2
MIRT668639 DYNLL2 dynein light chain LC8-type 2 2 2
MIRT669319 C12orf49 chromosome 12 open reading frame 49 2 2
MIRT669521 APOOL apolipoprotein O like 2 2
MIRT669875 RAET1E retinoic acid early transcript 1E 2 2
MIRT669902 KIAA0754 KIAA0754 2 4
MIRT669986 SSR3 signal sequence receptor subunit 3 2 2
MIRT670217 BAZ2B bromodomain adjacent to zinc finger domain 2B 2 2
MIRT670223 WIZ widely interspaced zinc finger motifs 2 2
MIRT670255 ZKSCAN3 zinc finger with KRAB and SCAN domains 3 2 2
MIRT670306 TAF8 TATA-box binding protein associated factor 8 2 2
MIRT670318 CEP57L1 centrosomal protein 57 like 1 2 2
MIRT670394 KCNK5 potassium two pore domain channel subfamily K member 5 2 2
MIRT670428 ELP2 elongator acetyltransferase complex subunit 2 2 2
MIRT670437 REPS2 RALBP1 associated Eps domain containing 2 2 2
MIRT670442 SYNRG synergin gamma 2 2
MIRT670469 TMEM105 transmembrane protein 105 2 2
MIRT670504 LYRM4 LYR motif containing 4 2 2
MIRT670512 ZSCAN22 zinc finger and SCAN domain containing 22 2 2
MIRT670528 SLC9A7 solute carrier family 9 member A7 2 2
MIRT670554 SHISA2 shisa family member 2 2 2
MIRT670638 BVES blood vessel epicardial substance 2 2
MIRT670656 STX4 syntaxin 4 2 2
MIRT670685 SUGT1 SGT1 homolog, MIS12 kinetochore complex assembly cochaperone 2 4
MIRT670703 SLC16A13 solute carrier family 16 member 13 2 2
MIRT670744 HOOK3 hook microtubule tethering protein 3 2 2
MIRT670798 UHRF1BP1L UHRF1 binding protein 1 like 2 2
MIRT670812 NICN1 nicolin 1 2 2
MIRT670843 SFT2D2 SFT2 domain containing 2 2 2
MIRT670976 MED17 mediator complex subunit 17 2 2
MIRT670996 PTGIS prostaglandin I2 synthase 2 2
MIRT671013 RBM22 RNA binding motif protein 22 2 2
MIRT671034 PCDHB2 protocadherin beta 2 2 2
MIRT671040 SS18 SS18, nBAF chromatin remodeling complex subunit 2 2
MIRT671092 DNAJC3 DnaJ heat shock protein family (Hsp40) member C3 2 2
MIRT671168 MAPKAPK5 mitogen-activated protein kinase-activated protein kinase 5 2 2
MIRT671222 CLSTN1 calsyntenin 1 2 2
MIRT671247 TMEM41B transmembrane protein 41B 2 2
MIRT671251 ATP6V0E1 ATPase H+ transporting V0 subunit e1 2 2
MIRT671287 RPL37A ribosomal protein L37a 2 2
MIRT671447 DNA2 DNA replication helicase/nuclease 2 2 4
MIRT671467 AGPAT6 glycerol-3-phosphate acyltransferase 4 2 2
MIRT671574 FOSL2 FOS like 2, AP-1 transcription factor subunit 2 2
MIRT671595 CBY3 chibby family member 3 2 2
MIRT671598 RILPL1 Rab interacting lysosomal protein like 1 2 2
MIRT671609 C6orf25 megakaryocyte and platelet inhibitory receptor G6b 2 2
MIRT671637 FBXO36 F-box protein 36 2 2
MIRT671721 PMPCA peptidase, mitochondrial processing alpha subunit 2 2
MIRT671766 PLA2G4A phospholipase A2 group IVA 2 2
MIRT671821 TRPM6 transient receptor potential cation channel subfamily M member 6 2 2
MIRT671831 STIL STIL, centriolar assembly protein 2 2
MIRT671853 APOL2 apolipoprotein L2 2 2
MIRT671888 MOB3A MOB kinase activator 3A 2 2
MIRT671912 PCDHB11 protocadherin beta 11 2 2
MIRT671922 PLEKHS1 pleckstrin homology domain containing S1 2 4
MIRT672028 ZNF70 zinc finger protein 70 2 2
MIRT672085 AEN apoptosis enhancing nuclease 2 2
MIRT672121 ATP6V0A2 ATPase H+ transporting V0 subunit a2 2 2
MIRT672148 PLEKHH1 pleckstrin homology, MyTH4 and FERM domain containing H1 2 2
MIRT672168 FANCF Fanconi anemia complementation group F 2 2
MIRT672205 ZNF490 zinc finger protein 490 2 2
MIRT672214 DCAF7 DDB1 and CUL4 associated factor 7 2 2
MIRT672249 SIK2 salt inducible kinase 2 2 2
MIRT672357 VPS8 VPS8, CORVET complex subunit 2 2
MIRT672365 PDE11A phosphodiesterase 11A 2 2
MIRT672455 POU2F3 POU class 2 homeobox 3 2 2
MIRT672519 CRX cone-rod homeobox 2 2
MIRT672544 BRMS1L breast cancer metastasis-suppressor 1 like 2 2
MIRT672617 IGF2R insulin like growth factor 2 receptor 2 2
MIRT672722 S1PR2 sphingosine-1-phosphate receptor 2 2 2
MIRT672724 KIF18B kinesin family member 18B 2 2
MIRT672826 GJD3 gap junction protein delta 3 2 2
MIRT672879 ZSCAN29 zinc finger and SCAN domain containing 29 2 2
MIRT672944 AKAP5 A-kinase anchoring protein 5 2 2
MIRT673004 TAF1 TATA-box binding protein associated factor 1 2 2
MIRT673027 RBBP4 RB binding protein 4, chromatin remodeling factor 2 2
MIRT673038 SGPL1 sphingosine-1-phosphate lyase 1 2 2
MIRT673070 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT673383 ZNF124 zinc finger protein 124 2 2
MIRT673414 RBBP9 RB binding protein 9, serine hydrolase 2 2
MIRT673420 RNF24 ring finger protein 24 2 2
MIRT673425 APAF1 apoptotic peptidase activating factor 1 2 2
MIRT673481 GTF3C6 general transcription factor IIIC subunit 6 2 2
MIRT673622 VCPIP1 valosin containing protein interacting protein 1 2 2
MIRT673629 PPM1D protein phosphatase, Mg2+/Mn2+ dependent 1D 2 2
MIRT673675 NUDCD2 NudC domain containing 2 2 2
MIRT673686 NDUFA7 NADH:ubiquinone oxidoreductase subunit A7 2 2
MIRT673709 SLU7 SLU7 homolog, splicing factor 2 2
MIRT673735 TCF23 transcription factor 23 2 2
MIRT673786 CDKAL1 CDK5 regulatory subunit associated protein 1 like 1 2 2
MIRT673797 MALL mal, T-cell differentiation protein like 2 2
MIRT673816 DARS aspartyl-tRNA synthetase 2 2
MIRT673969 INMT indolethylamine N-methyltransferase 2 2
MIRT674025 ANKRD9 ankyrin repeat domain 9 2 2
MIRT674257 ZNF284 zinc finger protein 284 2 2
MIRT674319 POLR1B RNA polymerase I subunit B 2 2
MIRT674456 ULK2 unc-51 like autophagy activating kinase 2 2 2
MIRT674549 GREB1 growth regulation by estrogen in breast cancer 1 2 2
MIRT674571 KIF3A kinesin family member 3A 2 2
MIRT674621 TRUB2 TruB pseudouridine synthase family member 2 2 2
MIRT674624 HECTD3 HECT domain E3 ubiquitin protein ligase 3 2 2
MIRT674837 GLRX2 glutaredoxin 2 2 2
MIRT674859 GINM1 glycoprotein integral membrane 1 2 2
MIRT674947 PEX2 peroxisomal biogenesis factor 2 2 2
MIRT675004 PPTC7 PTC7 protein phosphatase homolog 2 2
MIRT675028 SNX1 sorting nexin 1 2 2
MIRT675151 NDRG1 N-myc downstream regulated 1 2 2
MIRT675209 TTC9C tetratricopeptide repeat domain 9C 2 2
MIRT675427 CLEC7A C-type lectin domain containing 7A 2 2
MIRT675450 SRP19 signal recognition particle 19 2 2
MIRT675483 SLC1A2 solute carrier family 1 member 2 2 4
MIRT675508 HSD17B12 hydroxysteroid 17-beta dehydrogenase 12 2 2
MIRT675656 COL8A1 collagen type VIII alpha 1 chain 2 2
MIRT675709 EMC3 ER membrane protein complex subunit 3 2 2
MIRT675759 RDH10 retinol dehydrogenase 10 2 2
MIRT675872 ATP1B4 ATPase Na+/K+ transporting family member beta 4 2 2
MIRT675920 CYP51A1 cytochrome P450 family 51 subfamily A member 1 2 2
MIRT675934 RAP2B RAP2B, member of RAS oncogene family 2 2
MIRT675945 NAV1 neuron navigator 1 2 2
MIRT676053 ATL3 atlastin GTPase 3 2 2
MIRT676277 ZNF260 zinc finger protein 260 2 2
MIRT676414 MRO maestro 2 2
MIRT676635 CDH7 cadherin 7 2 2
MIRT676822 TNFSF15 TNF superfamily member 15 2 2
MIRT676866 ZNF451 zinc finger protein 451 2 2
MIRT676985 ZNF708 zinc finger protein 708 2 2
MIRT677031 ZNF107 zinc finger protein 107 2 2
MIRT677310 CPSF2 cleavage and polyadenylation specific factor 2 2 2
MIRT677401 PCNP PEST proteolytic signal containing nuclear protein 2 2
MIRT677430 PDF peptide deformylase, mitochondrial 2 2
MIRT677587 GATA6 GATA binding protein 6 2 2
MIRT677977 ITGB3 integrin subunit beta 3 2 2
MIRT678135 KLLN killin, p53-regulated DNA replication inhibitor 2 2
MIRT678390 TMEM239 transmembrane protein 239 2 2
MIRT678398 MYPN myopalladin 2 2
MIRT678593 ANAPC16 anaphase promoting complex subunit 16 2 2
MIRT678675 SCUBE3 signal peptide, CUB domain and EGF like domain containing 3 2 2
MIRT679058 RMDN1 regulator of microtubule dynamics 1 2 2
MIRT679472 RHOF ras homolog family member F, filopodia associated 2 2
MIRT679591 HUS1 HUS1 checkpoint clamp component 2 2
MIRT680041 OSBPL2 oxysterol binding protein like 2 2 2
MIRT680163 ZDHHC20 zinc finger DHHC-type containing 20 2 2
MIRT680290 AKIP1 A-kinase interacting protein 1 2 2
MIRT680342 ZNF281 zinc finger protein 281 2 2
MIRT681090 GSTO2 glutathione S-transferase omega 2 2 2
MIRT686602 TMEM70 transmembrane protein 70 2 2
MIRT687128 QPCTL glutaminyl-peptide cyclotransferase like 2 2
MIRT687298 OTUD7B OTU deubiquitinase 7B 2 2
MIRT689577 NUDT7 nudix hydrolase 7 2 2
MIRT689820 HIST1H2BJ histone cluster 1 H2B family member j 2 2
MIRT695082 ZNF17 zinc finger protein 17 2 2
MIRT696483 COX6B1 cytochrome c oxidase subunit 6B1 2 2
MIRT697374 ZNF286B zinc finger protein 286B 2 2
MIRT698752 STK4 serine/threonine kinase 4 2 4
MIRT699564 SIT1 signaling threshold regulating transmembrane adaptor 1 2 2
MIRT700607 PRKCA protein kinase C alpha 2 2
MIRT703925 EPG5 ectopic P-granules autophagy protein 5 homolog 2 2
MIRT704352 DBR1 debranching RNA lariats 1 2 2
MIRT705787 ALDH6A1 aldehyde dehydrogenase 6 family member A1 2 2
MIRT705927 ADAM17 ADAM metallopeptidase domain 17 2 2
MIRT710028 POLL DNA polymerase lambda 2 2
MIRT710253 LRRC10 leucine rich repeat containing 10 2 2
MIRT711298 ACOX1 acyl-CoA oxidase 1 2 2
MIRT711504 ESCO1 establishment of sister chromatid cohesion N-acetyltransferase 1 2 2
MIRT711640 LIPG lipase G, endothelial type 2 2
MIRT716157 RBM48 RNA binding motif protein 48 2 2
MIRT719195 CASP10 caspase 10 2 2
MIRT720517 KIAA0101 PCNA clamp associated factor 2 2
MIRT722377 KAZALD1 Kazal type serine peptidase inhibitor domain 1 2 2
MIRT723133 YPEL1 yippee like 1 2 2
MIRT725288 NT5C1A 5'-nucleotidase, cytosolic IA 2 2
MIRT725568 CPT1A carnitine palmitoyltransferase 1A 2 2
MIRT731610 NCAN neurocan 3 1
MIRT731966 COPS5 COP9 signalosome subunit 5 1 1
MIRT732350 PRKCH protein kinase C eta 3 1
MIRT732608 ANGPT2 angiopoietin 2 1 0
MIRT734983 CTSD cathepsin D 2 0
MIRT735161 MRTFA megakaryoblastic leukemia (translocation) 1 2 0
MIRT735403 INS insulin 1 0
MIRT735405 TG thyroglobulin 1 0
MIRT735565 PIK3R3 phosphoinositide-3-kinase regulatory subunit 3 3 0
MIRT736027 HPCA hippocalcin 3 0
MIRT736577 LAMB3 laminin subunit beta 3 3 0
MIRT736787 CDX2 caudal type homeobox 2 1 0
MIRT755891 BPNT1 3'(2'), 5'-bisphosphate nucleotidase 1 3 1
MIRT756090 GAD1 glutamate decarboxylase 1 2 1
MIRT756091 CYTOR cytoskeleton regulator RNA 1 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-24 Cyclosporin A(CsA) approved 5284373 Quantitative real-time PCR human trophoblast (HT) cells 24453045 2014 up-regulated
miR-24 Curcumin NULL 969516 Microarray BxPC-3 human pancreatic carcinoma cell line 18347134 2008 up-regulated
miR-24 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray Pancreatic Cancer PANC-1 cells 19407485 2009 up-regulated
miR-24 5-aza-2'-deoxycytidine (5-Aza-CdR) + trichostatin A(TSA) NULL NULL Microarray Pancreatic Cancer PANC-1 cells 19407485 2009 up-regulated
miR-24 Trichostatin A (TSA) NULL 444732 Microarray Pancreatic Cancer PANC-1 cells 19407485 2009 up-regulated
miR-24 5-Fluorouracil approved 3385 Microarray HCT-8 colon cancer cell line 19956872 2010 down-regulated
miR-24 Bio-Oss NULL NULL Microarray osteoblast-like cell line (MG63) 20224834 2010 down-regulated
miR-24 Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-24 5-Fluorouracil approved 3385 Microarray NCI-60 cell-line 21159603 2011 down-regulated
miR-24 Floxuridine (FdU) approved 5790 Microarray NCI-60 cell-line 21159603 2011 down-regulated
miR-24 Irinotecan approved 60838 Microarray NCI-60 cell-line 21159603 2011 down-regulated
miR-24 Topotecan approved 60700 Microarray NCI-60 cell-line 21159603 2011 down-regulated
miR-24 Arsenic trioxide approved 14888 Microarray HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-24 Arsenic trioxide approved 14888 Quantitative real-time PCR HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-24 5-Fluorouracil approved 3385 Microarray MCF-7 breast cancer cells 21506117 2011 down-regulated
miR-24 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-24 Olea europaea leaf extract NULL NULL Quantitative real-time PCR glioblastoma cells. 22722712 2012 down-regulated
miR-24 Temozolomide approved 5394 Quantitative real-time PCR glioblastoma cells. 22722712 2012 down-regulated
miR-24 5-aminoimidazole-4-carboxamide-1-β-d-ribofuranoside (AICAR) NULL 16078949