miRTarBase - #MIRT006537


—
pre-miRNA Information
pre-miRNA hsa-mir-10a   
Genomic Coordinates chr17: 48579838 - 48579947
Synonyms MIRN10A, hsa-mir-10a, miRNA10A, mir-10a, MIR10A
Description Homo sapiens miR-10a stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-10a-5p
Sequence 22| UACCCUGUAGAUCCGAAUUUGUG |44
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30152819 13 COSMIC
COSN30458892 14 COSMIC
COSN23023008 15 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1333990950 2 dbSNP
rs770328167 3 dbSNP
rs1453440972 5 dbSNP
rs1391955925 7 dbSNP
rs1157653116 8 dbSNP
rs760091682 10 dbSNP
rs1161287321 12 dbSNP
rs369632753 13 dbSNP
rs985848773 14 dbSNP
rs772649724 18 dbSNP
rs529115879 22 dbSNP
rs375865628 23 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B6HZE2 miR-10a Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Muscle Reverse transcription-polymerase chain reaction
Gene Information
Gene Symbol TRA2B   
Synonyms Htra2-beta, PPP1R156, SFRS10, SRFS10, TRA2-BETA, TRAN2B
Description transformer 2 beta homolog
Transcript NM_004593   
Expression
Putative miRNA Targets on TRA2B
3'UTR of TRA2B
(miRNA target sites are highlighted)		 
>TRA2B|NM_004593|3'UTR
   1 AGCATGAAGACTTTCTGAAACCTGCCCTAGAGCTGGGATATTGTTTGTGGGCAATATTTTTTATTGTCTCTTGTTTAAAA
  81 AGTGAACAGTGCCTAGTGAAGTTAGGTGACTTTTACACCTTTTACGATGACTACTTTTGGTGGAGTTGAAATGCTGTTTT
 161 CATTCTGCATTTGTGTAGTTTGGTGCTTTGTTCCAAGTTAAGTGTTTTCAGAAAAGTATGTTTTGCATGTATTTTTTTAC
 241 AGTCTAAATTTTGACTGCTGAGAAGTTTCTATTGTACAAAACTTCATTTAAAAGGTTTTTCTACTGAATCCAGGGTATTC
 321 TGAAGATCGAAGCCTGTGTAAAATGCTACCAAATGGCAAAAAGCAACAATAAACAGTTTGATTTTTACTTTTCTTTCTAA
 401 CATATCAATGCTTAGCAGAACTATTCAGATTGTCAGTAGTAAATTTAAAGACAAATGCCCGTTTTCCTCCAGTCCATGAA
 481 ACATACCATACTTATATACCTGCAACTAAGTGTTTAAAATTATGCTCTGTAACTCTGTACTGCTAGTATTAGAACTAAAA
 561 ATCTTAAAATACAGCCAGTGCTTAATGCTTATATCAATGTGGATTTGTCGGCTTTTATGTAATCTGTAATATGTATAGCA
 641 GGAAATACGAAGAGTTACACAGTGTATGCCTTAAAAGGCTGTTTCTTAAAGGTGTTACAAGGGGATAATGGTATTTCAAC
 721 TAGTTATCAGCAAGTGACAATACATTCCACCACAAATACACTCTTGTTCTTCTAGCTTTTAGACTATATGAAAAAACCGG
 801 GTGCTTCAAAGTACATGATAAGGGAACACTATACCTGTCATGGATGAACTGAAGACTTTGCCTGTTCATTTTTTAAATAT
 881 TATTTTCAGGTCCTTTGCTTACCAAAGGAGGCCCAATTTCACTCAAATGTTTTGAGAACTGTGTTTAAATAAACGCAAAT
 961 GAAAAGAAAAATGTTGGTGCAGCTGTTCACAAAGAAGTGTTCTTGTTCTATTATAATTAGAGTTCTTCTGTAGTTTAATC
1041 GTTAGGGCAGTGTGTTCCTTGGGCTGAGGTGTATCTTTGCTATTTTGGGCTGGGTTGAGGGGGGGATGAATTTCTGTATT
1121 CCTGGAAAATTCAGAGTGCATAACTAGGTATTAGAGTGATCTCCATTTGGGGATGGAGTTACAGTAAATAACTAGACTGC
1201 GGGTACTTTAATACATGTTCTTATTATTTTGCATTTAAGTAATTTTCATGACCAATTGTAGGGATGTTGCTACAGGTGGG
1281 TTATTTTGTTGCCTTGCTAACCTTTATCGCATCTAGGTATTAGTATGTTTCAGGTACTTTGGGAAGAACTTTACATATAA
1361 TCTTTAGCAATGAAATGATGTAGAGTAACTTACCTTAGTTCAAATAGCTGTTTAAGTGGCAATGCCACGATCTGAATTGA
1441 ACCTAGGTGATCTTAGTCCACAGTTCTCTTGATCATGATGTCTCAAATCTGGGTACCTGGGTGATGGAAAATACCAGTAA
1521 TGGAGCATAGGCAGTATTGGCAGGTCTTAATTTGTAAAACTTACTGTCCAGGGTGTTTTCAGTGTTTGCCAACTTGTGGT
1601 AAATTAATATGCTTAGAGAACTACCCTTAGGTTTGTTTCTGATAAGCATGTGGAAACAACTTAGTATATGCCTGATGGGT
1681 TATTTCAAATTGTTCTCAATGAGTTTTGAAACAAGAATTTGTAGTATTTATATATAAAGTTGAGTTTTAGGGTGTGGTCC
1761 CAGAGGGGGTTGTGTTATGGATGGATACATTAAAGGCTGAGAAACCTGGTTTTATCGTGGTAGTATATACAGGCATCCTT
1841 TCCTGAAGTAACTACATTCTCCACCATTTTCTCCCCAACCAAACCTCTCCCCATCAGTTAACTGATGGCTTGCGAGTTCA
1921 CACTCCTGATAATCTCGAACATAACCCTCGGTTTCTATCCTAAAGCCTGAGTTTTAGCCCTTTAGTTGTGTAGCCATCCT
2001 TTATCCTGCTGATTGAAAGTTTCCTTTTTTAGGCTAGTTTGAGTTGTTTTCTGGCTTTTAGATTTGAAAGAATTTTAGCC
2081 ATTTGACATGGCTACAAAGAGTGTTAACAGGCAAAAGACTGAGGAAAATTTGGAATTTTACCAAGTTGAGATAGACTGAG
2161 AAGTAGTGAGACAAAGTGGTAGTCTTTTGATGTGCTGTAATGCTAGTCGCCAGTTTCATGAAAGGGAGGCAGCAGTTACC
2241 CGTAGGTAACCCCTAGGTAACTGCTGCCATGGGCAGCTGAATCAGACAAAAGCCATGGGAAAGGATAAATTTGAGTCTTA
2321 AAGTTACTGCCTCAAGGCAAAGGGACTTGGAGGCTTTTATATGCCAATACAAACAATCCATTTCTTATAGCTGTAGGGCT
2401 GAGACTACTAAAACCAAATGTAAAGTTCATTTGGAAGATTGCTAAGTTAAATAGTTTTATACTAGGCTTTTGTGAAACTT
2481 CTCAGGAAATCAACAGGGTCCCAGCAAGTGGAAATAAGGCTGTGTCAAAAGATTTGTAGACCTGGGAGCAGGGGTTTCCG
2561 ATCTCCTGGCCATGGATTGCCTGAGCTCCGCCGCCTGTCAGATCAGCAACAGCAGATTTTCATAGCAGGAATCCTATTGT
2641 GAAGTGCGCTTGAGAGGGATCTAGCTTGCACATTTCCTTATGGAAATCTAACTACATGTTAGAGAATGCTCAAGGTCTGC
2721 AATGTTTACATTGTTGCCCCTACATAAGGAATATATGCCTTAAGATAAAACTAATAGCTCTTAGCCCTCTTACACCATTG
2801 ACTAGGATTCCAATTCTGCAAGGCCCAGGAGGAGAAATTGAGAATTAGAAGTTTCACCGAGAAGAAATAAAAAGATTTGG
2881 TTTGCATTATCAAAATTTCTGTAAATTATATGGAAATTTTGAGGATGGATTAGGCTGGATTTATTAGCAGTGGACACGCC
2961 TCCAATATTCCTTCAGCATGCCATCTCAGTGGATTTTGATTGGCTCTTGTAGGATTGGACTTAATGCTAGCTTATGCCAA
3041 ATGTCATCAAAAAGCCAGAATGCTACTACAGTAATGTAAAGGATTATTGTATATAGTGTAAAGGATTATTATGTGTAATC
3121 TTTAATATATAATGTAAAGACTTAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gugUUUAAG---CC--UAGAUGUCCCAu 5'
             || |||   ||  ||| ||||||| 
Target 5' tgaAACTTCTCAGGAAATCAACAGGGTc 3'
 2473 - 2500 162.00 -13.60
2 
miRNA  3' gugUUUAAGC--CUAGA--UGUCCCAu 5'
             |||| ||  || :|  |||| || 
Target 5' aggAAATACGAAGAGTTACACAGTGTa 3'
 640 - 666 128.00 -7.70
3 
miRNA  3' gugUUUAAGC--CUAGA----UGUCCCau 5'
             |:|||:|  || ||    :|||||  
Target 5' aaaAGATTTGTAGACCTGGGAGCAGGGgt 3'
 2527 - 2555 124.00 -13.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30174013 9 COSMIC
COSN20074699 13 COSMIC
COSN30510560 27 COSMIC
COSN31553943 65 COSMIC
COSN31504699 71 COSMIC
COSN19569825 89 COSMIC
COSN30497627 100 COSMIC
COSN30143671 111 COSMIC
COSN30519139 120 COSMIC
COSN31496145 145 COSMIC
COSN7840442 181 COSMIC
COSN7840441 194 COSMIC
COSN30119933 211 COSMIC
COSN7840440 245 COSMIC
COSN30174124 260 COSMIC
COSN20315987 271 COSMIC
COSN17710682 276 COSMIC
COSN7840439 277 COSMIC
COSN28751430 312 COSMIC
COSN27135560 329 COSMIC
COSN31567851 385 COSMIC
COSN22889016 449 COSMIC
COSN23032313 457 COSMIC
COSN26194686 555 COSMIC
COSN26194685 561 COSMIC
COSN31530549 563 COSMIC
COSN193698 582 COSMIC
COSN31527995 793 COSMIC
COSN20099475 835 COSMIC
COSN23196975 862 COSMIC
COSN31552417 954 COSMIC
COSN22356779 1000 COSMIC
COSN31611229 1010 COSMIC
COSN8488846 1138 COSMIC
COSN5530450 1362 COSMIC
COSN21456782 1721 COSMIC
COSN21064645 1780 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1158028499 2 dbSNP
rs769428793 4 dbSNP
rs200781116 5 dbSNP
rs201581851 5 dbSNP
rs1427132502 10 dbSNP
rs781778452 11 dbSNP
rs1490548334 14 dbSNP
rs1268234157 15 dbSNP
rs1011028710 24 dbSNP
rs1007096188 27 dbSNP
rs893880534 32 dbSNP
rs755369754 33 dbSNP
rs999547382 36 dbSNP
rs751832963 41 dbSNP
rs1315682771 42 dbSNP
rs756137663 43 dbSNP
rs112068216 46 dbSNP
rs764085362 54 dbSNP
rs1052456128 59 dbSNP
rs773225268 67 dbSNP
rs1312174506 71 dbSNP
rs1333119332 88 dbSNP
rs1415384820 93 dbSNP
rs1443741941 99 dbSNP
rs1360617765 106 dbSNP
rs1156685794 111 dbSNP
rs1376138917 113 dbSNP
rs1399128616 115 dbSNP
rs1407571562 117 dbSNP
rs1282334488 118 dbSNP
rs996406465 119 dbSNP
rs1473603346 125 dbSNP
rs1415850343 126 dbSNP
rs762701471 128 dbSNP
rs1179818644 130 dbSNP
rs945933136 133 dbSNP
rs1804656 139 dbSNP
rs546937130 151 dbSNP
rs900708076 159 dbSNP
rs151178459 161 dbSNP
rs1196087617 168 dbSNP
rs564446866 169 dbSNP
rs936078927 172 dbSNP
rs1214111174 174 dbSNP
rs941813408 178 dbSNP
rs927331185 186 dbSNP
rs185813884 197 dbSNP
rs1446020613 200 dbSNP
rs980315486 202 dbSNP
rs907612113 203 dbSNP
rs1398963560 208 dbSNP
rs530964665 211 dbSNP
rs1440944261 212 dbSNP
rs563622912 218 dbSNP
rs971945529 219 dbSNP
rs1268335694 225 dbSNP
rs542359344 231 dbSNP
rs1341793010 239 dbSNP
rs984134981 240 dbSNP
rs1332015865 242 dbSNP
rs1257617169 254 dbSNP
rs1292206391 258 dbSNP
rs950963851 261 dbSNP
rs180800948 267 dbSNP
rs769279088 270 dbSNP
rs1381280704 271 dbSNP
rs928281065 271 dbSNP
rs1194409464 272 dbSNP
rs1375111911 274 dbSNP
rs759260857 282 dbSNP
rs962437811 285 dbSNP
rs969991243 290 dbSNP
rs1429729912 300 dbSNP
rs1327328268 303 dbSNP
rs190002696 306 dbSNP
rs1388564623 312 dbSNP
rs1018417209 320 dbSNP
rs1006736102 328 dbSNP
rs540117459 329 dbSNP
rs890982410 333 dbSNP
rs775949077 335 dbSNP
rs1277817846 336 dbSNP
rs1010192322 344 dbSNP
rs1335636272 350 dbSNP
rs1235283132 354 dbSNP
rs1321457947 356 dbSNP
rs761919094 357 dbSNP
rs572822105 377 dbSNP
rs1459085468 379 dbSNP
rs1488465880 384 dbSNP
rs1392297374 386 dbSNP
rs1264417665 388 dbSNP
rs548024781 393 dbSNP
rs955832448 396 dbSNP
rs1262108167 397 dbSNP
rs891683366 397 dbSNP
rs1031107446 399 dbSNP
rs1366168429 399 dbSNP
rs999578623 401 dbSNP
rs1159095875 402 dbSNP
rs1386973407 408 dbSNP
rs557657288 409 dbSNP
rs1185327657 411 dbSNP
rs1297346751 418 dbSNP
rs1356399586 418 dbSNP
rs539029948 430 dbSNP
rs1416825515 431 dbSNP
rs1475278217 434 dbSNP
rs1310803435 436 dbSNP
rs935964335 452 dbSNP
rs1210203142 455 dbSNP
rs1263023608 458 dbSNP
rs996867058 459 dbSNP
rs905962389 460 dbSNP
rs1221700952 461 dbSNP
rs1485817298 466 dbSNP
rs1323040140 474 dbSNP
rs368221868 476 dbSNP
rs950147209 482 dbSNP
rs1422740567 486 dbSNP
rs1010852417 495 dbSNP
rs571227068 495 dbSNP
rs770553524 499 dbSNP
rs1006364495 501 dbSNP
rs1249739557 506 dbSNP
rs886574806 510 dbSNP
rs1436306321 512 dbSNP
rs541192176 512 dbSNP
rs929566767 513 dbSNP
rs1186608196 532 dbSNP
rs1378636903 537 dbSNP
rs1392578659 539 dbSNP
rs1309222979 540 dbSNP
rs958073214 549 dbSNP
rs1240017709 554 dbSNP
rs1044052052 558 dbSNP
rs34428887 570 dbSNP
rs1325253825 571 dbSNP
rs574934254 579 dbSNP
rs376533799 581 dbSNP
rs1350531991 583 dbSNP
rs1208384360 589 dbSNP
rs1351737847 597 dbSNP
rs556777783 609 dbSNP
rs551534684 610 dbSNP
rs1391097921 620 dbSNP
rs1212468569 624 dbSNP
rs1190937165 627 dbSNP
rs1452142271 630 dbSNP
rs1251956026 632 dbSNP
rs1358865331 635 dbSNP
rs1462669022 637 dbSNP
rs1300011688 640 dbSNP
rs1191461998 648 dbSNP
rs1017926585 649 dbSNP
rs1446063947 649 dbSNP
rs568528091 660 dbSNP
rs1249186711 662 dbSNP
rs985637913 662 dbSNP
rs978212058 666 dbSNP
rs547195081 668 dbSNP
rs535262671 678 dbSNP
rs1311297289 687 dbSNP
rs571146114 688 dbSNP
rs1342806852 695 dbSNP
rs1259539452 699 dbSNP
rs955144284 701 dbSNP
rs1456082929 703 dbSNP
rs954810506 703 dbSNP
rs1197389072 709 dbSNP
rs1253624153 710 dbSNP
rs1489416329 711 dbSNP
rs1189305011 717 dbSNP
rs1424170636 719 dbSNP
rs1029918741 720 dbSNP
rs552946656 727 dbSNP
rs965047851 730 dbSNP
rs1010035353 732 dbSNP
rs1397390629 745 dbSNP
rs769336597 746 dbSNP
rs1032902496 747 dbSNP
rs1434910410 757 dbSNP
rs1006389301 759 dbSNP
rs768979915 765 dbSNP
rs1300820357 766 dbSNP
rs1387619225 769 dbSNP
rs886646720 772 dbSNP
rs1216637413 773 dbSNP
rs1279707486 773 dbSNP
rs1000102064 774 dbSNP
rs1296524729 774 dbSNP
rs1315681381 776 dbSNP
rs1217546191 780 dbSNP
rs1273249443 784 dbSNP
rs1323472409 785 dbSNP
rs1219322852 786 dbSNP
rs1246005023 787 dbSNP
rs1442054390 788 dbSNP
rs1371749190 795 dbSNP
rs530927846 798 dbSNP
rs186428018 799 dbSNP
rs780500965 809 dbSNP
rs950210598 811 dbSNP
rs1261382562 812 dbSNP
rs374116917 813 dbSNP
rs1044512158 815 dbSNP
rs1403633409 818 dbSNP
rs1416008887 818 dbSNP
rs1164713668 822 dbSNP
rs1061425 828 dbSNP
rs1296727691 831 dbSNP
rs1433412454 831 dbSNP
rs1491364950 833 dbSNP
rs548349155 834 dbSNP
rs892774929 834 dbSNP
rs144598833 839 dbSNP
rs71694444 839 dbSNP
rs1226059361 840 dbSNP
rs1289062817 858 dbSNP
rs895863846 859 dbSNP
rs1047886689 860 dbSNP
rs748616105 860 dbSNP
rs143141787 864 dbSNP
rs934563486 867 dbSNP
rs920857800 875 dbSNP
rs986639582 877 dbSNP
rs933426310 882 dbSNP
rs770945612 892 dbSNP
rs1471855383 893 dbSNP
rs923398934 895 dbSNP
rs1247737240 901 dbSNP
rs746113857 903 dbSNP
rs975204812 905 dbSNP
rs1157271988 914 dbSNP
rs964685251 916 dbSNP
rs1016215224 920 dbSNP
rs865893620 921 dbSNP
rs973653866 947 dbSNP
rs950953954 950 dbSNP
rs1445259227 954 dbSNP
rs561702673 954 dbSNP
rs540015120 955 dbSNP
rs1344767639 959 dbSNP
rs910917213 960 dbSNP
rs1352740686 961 dbSNP
rs1295973930 962 dbSNP
rs3179834 966 dbSNP
rs907334083 967 dbSNP
rs1281078235 971 dbSNP
rs549688631 972 dbSNP
rs1209572441 978 dbSNP
rs1234148820 980 dbSNP
rs751678322 992 dbSNP
rs922325141 1002 dbSNP
rs763993579 1003 dbSNP
rs1454985106 1005 dbSNP
rs955889052 1006 dbSNP
rs1409253530 1010 dbSNP
rs529518311 1012 dbSNP
rs1403979452 1013 dbSNP
rs1412377064 1014 dbSNP
rs1332972876 1018 dbSNP
rs1400426392 1018 dbSNP
rs1360656504 1020 dbSNP
rs1448284200 1020 dbSNP
rs1376059688 1021 dbSNP
rs1233783617 1025 dbSNP
rs1310376401 1030 dbSNP
rs1032828894 1031 dbSNP
rs1218895266 1036 dbSNP
rs1000155967 1040 dbSNP
rs934594403 1041 dbSNP
rs766758300 1044 dbSNP
rs758350482 1045 dbSNP
rs903084476 1054 dbSNP
rs564029072 1058 dbSNP
rs1023392656 1061 dbSNP
rs1477879601 1067 dbSNP
rs1171658285 1075 dbSNP
rs1423818595 1078 dbSNP
rs1466796237 1079 dbSNP
rs1303808727 1080 dbSNP
rs1167904968 1082 dbSNP
rs1399527565 1086 dbSNP
rs1387251373 1087 dbSNP
rs1325400327 1088 dbSNP
rs749216715 1090 dbSNP
rs1435421573 1091 dbSNP
rs1279086269 1098 dbSNP
rs895905143 1099 dbSNP
rs564010169 1100 dbSNP
rs575083843 1101 dbSNP
rs755313864 1101 dbSNP
rs1263530168 1105 dbSNP
rs1422330714 1106 dbSNP
rs1478587824 1106 dbSNP
rs984736478 1106 dbSNP
rs1449613084 1107 dbSNP
rs1457925716 1108 dbSNP
rs1164947103 1114 dbSNP
rs899363658 1136 dbSNP
rs1026579284 1140 dbSNP
rs1357029790 1143 dbSNP
rs759310328 1144 dbSNP
rs1185705320 1147 dbSNP
rs1342666439 1163 dbSNP
rs556932270 1166 dbSNP
rs910765666 1170 dbSNP
rs1277758701 1177 dbSNP
rs1485305958 1179 dbSNP
rs6444088 1182 dbSNP
rs182136411 1183 dbSNP
rs1484795032 1187 dbSNP
rs1259163217 1189 dbSNP
rs1228078138 1192 dbSNP
rs1430099808 1196 dbSNP
rs533376476 1197 dbSNP
rs867985596 1200 dbSNP
rs190071546 1201 dbSNP
rs988585152 1204 dbSNP
rs535223321 1213 dbSNP
rs955774169 1214 dbSNP
rs1012708471 1222 dbSNP
rs1189017497 1223 dbSNP
rs1340426269 1223 dbSNP
rs925811806 1224 dbSNP
rs978582842 1226 dbSNP
rs1159067537 1229 dbSNP
rs1398121706 1229 dbSNP
rs139837042 1231 dbSNP
rs541157152 1235 dbSNP
rs1319452927 1243 dbSNP
rs1297829403 1248 dbSNP
rs1457504913 1252 dbSNP
rs1403094066 1253 dbSNP
rs1397925587 1254 dbSNP
rs146390625 1255 dbSNP
rs1014681716 1261 dbSNP
rs1162184996 1263 dbSNP
rs902823697 1270 dbSNP
rs960058499 1271 dbSNP
rs1026254140 1272 dbSNP
rs185223612 1279 dbSNP
rs1259854130 1288 dbSNP
rs899247484 1291 dbSNP
rs572699344 1299 dbSNP
rs1037837252 1301 dbSNP
rs1253424260 1305 dbSNP
rs755684494 1308 dbSNP
rs889380764 1309 dbSNP
rs1260861881 1310 dbSNP
rs1437593619 1319 dbSNP
rs1039929856 1333 dbSNP
rs1052053556 1336 dbSNP
rs933552289 1352 dbSNP
rs909316767 1355 dbSNP
rs1049104938 1356 dbSNP
rs1270043340 1358 dbSNP
rs1375323354 1365 dbSNP
rs929314749 1365 dbSNP
rs1302385232 1367 dbSNP
rs1312449791 1370 dbSNP
rs1355777754 1371 dbSNP
rs919214079 1379 dbSNP
rs1285276946 1381 dbSNP
rs1460492451 1382 dbSNP
rs559164579 1393 dbSNP
rs759848 1393 dbSNP
rs1456374223 1394 dbSNP
rs747756541 1396 dbSNP
rs1052765693 1405 dbSNP
rs972051796 1413 dbSNP
rs1267836398 1417 dbSNP
rs1434642896 1420 dbSNP
rs934408349 1422 dbSNP
rs1377216070 1428 dbSNP
rs991637916 1429 dbSNP
rs142204632 1430 dbSNP
rs957503047 1432 dbSNP
rs34765620 1433 dbSNP
rs1366943305 1435 dbSNP
rs998572599 1447 dbSNP
rs1323529982 1469 dbSNP
rs979019249 1471 dbSNP
rs772871679 1477 dbSNP
rs566148114 1479 dbSNP
rs1385391641 1481 dbSNP
rs992781627 1483 dbSNP
rs1322392458 1484 dbSNP
rs759847 1485 dbSNP
rs998142369 1489 dbSNP
rs1259396508 1491 dbSNP
rs1315488941 1506 dbSNP
rs528267054 1511 dbSNP
rs1164925499 1513 dbSNP
rs1460411922 1514 dbSNP
rs563942495 1515 dbSNP
rs181170080 1523 dbSNP
rs972000266 1526 dbSNP
rs1489343482 1527 dbSNP
rs148797555 1533 dbSNP
rs963450114 1537 dbSNP
rs1268522908 1541 dbSNP
rs1047919098 1545 dbSNP
rs563464179 1546 dbSNP
rs889315082 1554 dbSNP
rs1166126129 1555 dbSNP
rs1352053406 1563 dbSNP
rs1005351972 1564 dbSNP
rs888243919 1564 dbSNP
rs1030915674 1565 dbSNP
rs541794560 1571 dbSNP
rs1212082985 1572 dbSNP
rs929450748 1574 dbSNP
rs1213408530 1580 dbSNP
rs1046134499 1586 dbSNP
rs542424376 1587 dbSNP
rs1052770695 1592 dbSNP
rs1290716039 1597 dbSNP
rs916168466 1599 dbSNP
rs574392471 1605 dbSNP
rs934289321 1610 dbSNP
rs866641047 1616 dbSNP
rs1229642247 1620 dbSNP
rs957535228 1623 dbSNP
rs904285054 1627 dbSNP
rs1300792732 1658 dbSNP
rs1042840009 1662 dbSNP
rs1422556754 1663 dbSNP
rs1163464266 1682 dbSNP
rs977201786 1685 dbSNP
rs553103576 1688 dbSNP
rs1299663672 1691 dbSNP
rs1029353978 1695 dbSNP
rs948455077 1696 dbSNP
rs976840147 1699 dbSNP
rs573807358 1712 dbSNP
rs1369911973 1718 dbSNP
rs1314230032 1730 dbSNP
rs1169190008 1732 dbSNP
rs541133214 1734 dbSNP
rs1354161551 1738 dbSNP
rs1218430020 1742 dbSNP
rs1018154266 1746 dbSNP
rs1431374079 1747 dbSNP
rs1393101306 1750 dbSNP
rs1005384543 1756 dbSNP
rs1239251375 1762 dbSNP
rs1482290695 1762 dbSNP
rs888320764 1763 dbSNP
rs1171027467 1765 dbSNP
rs993061926 1766 dbSNP
rs938609048 1768 dbSNP
rs1247305362 1769 dbSNP
rs993628294 1770 dbSNP
rs1405408894 1771 dbSNP
rs751826552 1772 dbSNP
rs775658570 1773 dbSNP
rs1251700542 1778 dbSNP
rs1206576141 1780 dbSNP
rs1242126308 1781 dbSNP
rs1306777909 1788 dbSNP
rs1220059102 1805 dbSNP
rs1350277953 1805 dbSNP
rs1280932921 1815 dbSNP
rs963376983 1816 dbSNP
rs1016660929 1817 dbSNP
rs1239384564 1818 dbSNP
rs986273244 1821 dbSNP
rs1491182256 1822 dbSNP
rs536351381 1823 dbSNP
rs577476744 1823 dbSNP
rs953581090 1825 dbSNP
rs1426747248 1832 dbSNP
rs1467831282 1833 dbSNP
rs1175070748 1834 dbSNP
rs559208488 1837 dbSNP
rs1236219871 1841 dbSNP
rs997647982 1842 dbSNP
rs1334965652 1855 dbSNP
rs1436851291 1856 dbSNP
rs537709412 1856 dbSNP
rs1365740487 1858 dbSNP
rs770178948 1862 dbSNP
rs1223040578 1863 dbSNP
rs746284404 1864 dbSNP
rs570305131 1866 dbSNP
rs1258762151 1877 dbSNP
rs936229014 1877 dbSNP
rs544627270 1878 dbSNP
rs977567758 1882 dbSNP
rs1452550634 1890 dbSNP
rs1201451953 1894 dbSNP
rs1001102522 1901 dbSNP
rs536626505 1913 dbSNP
rs144322186 1914 dbSNP
rs948531865 1920 dbSNP
rs1198113741 1926 dbSNP
rs976492461 1931 dbSNP
rs747037682 1934 dbSNP
rs964051311 1936 dbSNP
rs1166092543 1937 dbSNP
rs1017891719 1940 dbSNP
rs1174574918 1946 dbSNP
rs78333734 1947 dbSNP
rs547438578 1949 dbSNP
rs532479691 1950 dbSNP
rs1279022694 1952 dbSNP
rs1342464162 1952 dbSNP
rs919080155 1962 dbSNP
rs557881814 1964 dbSNP
rs1484331435 1967 dbSNP
rs1212058202 1969 dbSNP
rs1025458006 1976 dbSNP
rs994427847 1976 dbSNP
rs1484234549 1992 dbSNP
rs149617987 1994 dbSNP
rs1443398649 1999 dbSNP
rs758262584 2003 dbSNP
rs1014302855 2004 dbSNP
rs1190383198 2006 dbSNP
rs1372482853 2011 dbSNP
rs1473070107 2015 dbSNP
rs1164889748 2024 dbSNP
rs1363512386 2029 dbSNP
rs1423694676 2030 dbSNP
rs1299033365 2032 dbSNP
rs1362683898 2033 dbSNP
rs909251475 2034 dbSNP
rs1380656975 2035 dbSNP
rs1317698457 2042 dbSNP
rs534339497 2047 dbSNP
rs1341633031 2049 dbSNP
rs1247663213 2051 dbSNP
rs1203065758 2056 dbSNP
rs1359182665 2057 dbSNP
rs1327856625 2060 dbSNP
rs986504912 2079 dbSNP
rs953493937 2080 dbSNP
rs1286359648 2083 dbSNP
rs1486631310 2088 dbSNP
rs1230088717 2089 dbSNP
rs16860324 2094 dbSNP
rs976259320 2097 dbSNP
rs565787432 2100 dbSNP
rs1041944539 2102 dbSNP
rs376587267 2102 dbSNP
rs1336397167 2104 dbSNP
rs1382447834 2106 dbSNP
rs946212193 2106 dbSNP
rs1451854248 2108 dbSNP
rs922754302 2119 dbSNP
rs976946049 2120 dbSNP
rs538822368 2121 dbSNP
rs1397798763 2128 dbSNP
rs910918211 2131 dbSNP
rs1031155940 2132 dbSNP
rs1001156179 2141 dbSNP
rs968695780 2144 dbSNP
rs1160033650 2145 dbSNP
rs983735573 2146 dbSNP
rs1311876559 2148 dbSNP
rs1021298689 2149 dbSNP
rs1412229214 2150 dbSNP
rs4321562 2152 dbSNP
rs918517157 2156 dbSNP
rs972642945 2157 dbSNP
rs1345113078 2158 dbSNP
rs1205009855 2162 dbSNP
rs138202548 2163 dbSNP
rs1179066181 2168 dbSNP
rs1239810520 2176 dbSNP
rs536066295 2176 dbSNP
rs753628576 2180 dbSNP
rs1024807890 2181 dbSNP
rs188452392 2184 dbSNP
rs570216333 2187 dbSNP
rs1014782865 2189 dbSNP
rs1174340554 2190 dbSNP
rs184139931 2192 dbSNP
rs1034410132 2193 dbSNP
rs191276799 2199 dbSNP
rs79070107 2208 dbSNP
rs760435906 2213 dbSNP
rs1042361644 2219 dbSNP
rs1380985182 2220 dbSNP
rs1260667029 2224 dbSNP
rs1322162270 2226 dbSNP
rs941966906 2229 dbSNP
rs1376357344 2231 dbSNP
rs909085967 2233 dbSNP
rs1433109549 2235 dbSNP
rs1010483622 2239 dbSNP
rs186678596 2241 dbSNP
rs1041205948 2242 dbSNP
rs910991788 2242 dbSNP
rs532013230 2245 dbSNP
rs1458872514 2250 dbSNP
rs1173465371 2262 dbSNP
rs1353269161 2274 dbSNP
rs1348273065 2278 dbSNP
rs931944226 2284 dbSNP
rs1048106311 2286 dbSNP
rs565004230 2289 dbSNP
rs976187213 2296 dbSNP
rs543982081 2302 dbSNP
rs575983149 2311 dbSNP
rs930988954 2312 dbSNP
rs1416334006 2313 dbSNP
rs924138948 2317 dbSNP
rs918214260 2322 dbSNP
rs973100376 2323 dbSNP
rs1448458630 2325 dbSNP
rs1265846605 2327 dbSNP
rs767151351 2330 dbSNP
rs1248224241 2334 dbSNP
rs970663845 2344 dbSNP
rs1190163430 2349 dbSNP
rs184561393 2352 dbSNP
rs979561891 2353 dbSNP
rs1245630235 2358 dbSNP
rs533154867 2360 dbSNP
rs4686710 2367 dbSNP
rs1272166965 2368 dbSNP
rs1227360717 2372 dbSNP
rs1012488352 2373 dbSNP
rs1423066477 2374 dbSNP
rs958639396 2375 dbSNP
rs1306002579 2377 dbSNP
rs1035317006 2388 dbSNP
rs760974238 2389 dbSNP
rs572068210 2393 dbSNP
rs1365490835 2398 dbSNP
rs897547509 2405 dbSNP
rs775625996 2407 dbSNP
rs1000239069 2419 dbSNP
rs1437744433 2424 dbSNP
rs1352151076 2428 dbSNP
rs147075178 2433 dbSNP
rs1243495819 2437 dbSNP
rs1291393312 2439 dbSNP
rs1167306214 2443 dbSNP
rs1488725471 2444 dbSNP
rs968744205 2446 dbSNP
rs538674369 2450 dbSNP
rs770820831 2456 dbSNP
rs1429487663 2458 dbSNP
rs1006445966 2460 dbSNP
rs1182963041 2462 dbSNP
rs1020274753 2467 dbSNP
rs16860318 2473 dbSNP
rs1050798886 2478 dbSNP
rs749165836 2479 dbSNP
rs1041672045 2480 dbSNP
rs1007028394 2491 dbSNP
rs1431109121 2491 dbSNP
rs549902656 2493 dbSNP
rs901882895 2495 dbSNP
rs1040389780 2497 dbSNP
rs776998677 2510 dbSNP
rs935409680 2511 dbSNP
rs1489200853 2513 dbSNP
rs1384895772 2515 dbSNP
rs923981920 2516 dbSNP
rs1048135310 2519 dbSNP
rs773271412 2525 dbSNP
rs77281551 2530 dbSNP
rs114618495 2536 dbSNP
rs548422408 2541 dbSNP
rs1316417049 2542 dbSNP
rs960980862 2554 dbSNP
rs1035328336 2559 dbSNP
rs1300626391 2560 dbSNP
rs981036541 2563 dbSNP
rs961790527 2564 dbSNP
rs1471329370 2565 dbSNP
rs1219855011 2567 dbSNP
rs200593257 2568 dbSNP
rs1405342715 2572 dbSNP
rs1014600764 2575 dbSNP
rs193115152 2576 dbSNP
rs1408256786 2577 dbSNP
rs73175602 2584 dbSNP
rs547396650 2589 dbSNP
rs532181802 2590 dbSNP
rs564965542 2592 dbSNP
rs780781209 2593 dbSNP
rs1219928820 2595 dbSNP
rs867029454 2600 dbSNP
rs1020729123 2604 dbSNP
rs1321444724 2607 dbSNP
rs188550983 2610 dbSNP
rs1040402595 2611 dbSNP
rs935296605 2615 dbSNP
rs1434387723 2620 dbSNP
rs1230874296 2621 dbSNP
rs1409222758 2634 dbSNP
rs576534207 2636 dbSNP
rs1019875474 2637 dbSNP
rs142992079 2646 dbSNP
rs1430815937 2646 dbSNP
rs543270824 2647 dbSNP
rs183344663 2648 dbSNP
rs1326580403 2657 dbSNP
rs1353668224 2657 dbSNP
rs1198547731 2670 dbSNP
rs1044221781 2683 dbSNP
rs946818039 2684 dbSNP
rs1482826909 2686 dbSNP
rs916767458 2688 dbSNP
rs889992208 2692 dbSNP
rs1211158557 2701 dbSNP
rs1222981574 2702 dbSNP
rs1342064175 2709 dbSNP
rs1194483267 2713 dbSNP
rs77055012 2721 dbSNP
rs995247130 2722 dbSNP
rs1222784124 2726 dbSNP
rs1228266711 2730 dbSNP
rs1489675220 2732 dbSNP
rs1198050151 2737 dbSNP
rs1351683004 2740 dbSNP
rs1422076351 2743 dbSNP
rs1309837950 2744 dbSNP
rs1166038518 2748 dbSNP
rs1418546778 2753 dbSNP
rs1394633862 2755 dbSNP
rs538637719 2757 dbSNP
rs896920014 2759 dbSNP
rs1305262467 2774 dbSNP
rs1037159684 2775 dbSNP
rs939607084 2778 dbSNP
rs949087907 2780 dbSNP
rs896099953 2784 dbSNP
rs928194060 2788 dbSNP
rs981083921 2793 dbSNP
rs541074274 2801 dbSNP
rs1467268249 2802 dbSNP
rs1055083485 2803 dbSNP
rs1270065679 2805 dbSNP
rs1157796675 2813 dbSNP
rs1457663151 2816 dbSNP
rs937901642 2823 dbSNP
rs1414049650 2824 dbSNP
rs1185391715 2826 dbSNP
rs577661293 2832 dbSNP
rs1014526781 2834 dbSNP
rs1448164490 2835 dbSNP
rs1256678302 2838 dbSNP
rs984987908 2840 dbSNP
rs192025176 2844 dbSNP
rs1462843408 2846 dbSNP
rs1445080701 2848 dbSNP
rs1266273022 2855 dbSNP
rs1383664843 2856 dbSNP
rs755772548 2858 dbSNP
rs537960808 2859 dbSNP
rs1387246335 2866 dbSNP
rs187122656 2868 dbSNP
rs901780020 2877 dbSNP
rs1454961132 2878 dbSNP
rs1313331993 2881 dbSNP
rs1359110535 2889 dbSNP
rs989270442 2905 dbSNP
rs569795985 2908 dbSNP
rs999424753 2911 dbSNP
rs548104077 2919 dbSNP
rs138994557 2925 dbSNP
rs954283567 2929 dbSNP
rs1461690852 2935 dbSNP
rs779718282 2936 dbSNP
rs1185308007 2946 dbSNP
rs58388826 2951 dbSNP
rs72003092 2951 dbSNP
rs995644271 2954 dbSNP
rs897281280 2957 dbSNP
rs1043724057 2958 dbSNP
rs1457288575 2959 dbSNP
rs1011414548 2960 dbSNP
rs1386571244 2961 dbSNP
rs373472956 2962 dbSNP
rs750060215 2964 dbSNP
rs74542454 2965 dbSNP
rs1335247017 2968 dbSNP
rs1382504877 2970 dbSNP
rs1013748189 2972 dbSNP
rs1307338834 2976 dbSNP
rs1457349778 2977 dbSNP
rs1337141853 2979 dbSNP
rs1236307162 2986 dbSNP
rs182835373 2986 dbSNP
rs1368780535 2988 dbSNP
rs1323563698 2990 dbSNP
rs563413121 2992 dbSNP
rs1482841483 2993 dbSNP
rs939491065 3009 dbSNP
rs1417522672 3015 dbSNP
rs1430088475 3016 dbSNP
rs1481421202 3020 dbSNP
rs1174991628 3022 dbSNP
rs1054781159 3027 dbSNP
rs937934188 3031 dbSNP
rs1300235500 3035 dbSNP
rs767343847 3038 dbSNP
rs903791648 3039 dbSNP
rs1043637904 3041 dbSNP
rs1287253015 3043 dbSNP
rs1037271527 3048 dbSNP
rs532143295 3050 dbSNP
rs1281363973 3056 dbSNP
rs1311509988 3064 dbSNP
rs1208521556 3068 dbSNP
rs1053247221 3080 dbSNP
rs376257973 3080 dbSNP
rs944113476 3081 dbSNP
rs571268128 3082 dbSNP
rs1266359427 3086 dbSNP
rs912592397 3089 dbSNP
rs1269865608 3090 dbSNP
rs761355152 3093 dbSNP
rs1197338416 3094 dbSNP
rs1425135081 3098 dbSNP
rs140868850 3100 dbSNP
rs532363779 3103 dbSNP
rs1296397832 3104 dbSNP
rs1461736522 3109 dbSNP
rs1307093868 3111 dbSNP
rs746073690 3113 dbSNP
rs920184798 3113 dbSNP
rs1435448294 3115 dbSNP
rs1300708346 3117 dbSNP
rs1366238162 3118 dbSNP
rs984440320 3125 dbSNP
rs1305620617 3130 dbSNP
rs1327608775 3130 dbSNP
rs189663792 3133 dbSNP
rs1292843645 3134 dbSNP
rs1016167451 3138 dbSNP
rs1386105781 3142 dbSNP
rs1391328161 3144 dbSNP
rs1013363540 3148 dbSNP
rs921678420 3151 dbSNP
rs1427569705 3152 dbSNP
rs543745729 3158 dbSNP
rs960717209 3158 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HeLa
Location of target site 3'UTR
Tools used in this research miRBase Target Database , PicTar , TargetScan
Original Description (Extracted from the article) ... SFRS1- and SFRS10 -3'-UTRs as direct targets of miR-10a and -10b. ...

- Meseguer S; Mudduluru G; Escamilla JM; et al., 2011, The Journal of biological chemistry.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' guguuuaaGCCUAGAUGUCCCAu 5'
                  :| |||  |||||| 
Target 5' uuuucuacUGAAUC--CAGGGUa 3'
 		13 - 33
Article - Meseguer S; Mudduluru G; Escamilla JM; et al.
- The Journal of biological chemistry, 2011
MicroRNAs (miRNAs) are an emerging class of non-coding endogenous RNAs involved in multiple cellular processes, including cell differentiation. Treatment with retinoic acid (RA) results in neural differentiation of neuroblastoma cells. We wanted to elucidate whether miRNAs contribute to the gene expression changes induced by RA in neuroblastoma cells and whether miRNA regulation is involved in the transduction of the RA signal. We show here that RA treatment of SH-SY5Y neuroblastoma cells results in profound changes in the expression pattern of miRNAs. Up to 42 different miRNA species significantly changed their expression (26 up-regulated and 16 down-regulated). Among them, the closely related miR-10a and -10b showed the most prominent expression changes. Induction of miR-10a and -10b by RA also could be detected in LA-N-1 neuroblastoma cells. Loss of function experiments demonstrated that miR-10a and -10b are essential mediators of RA-induced neuroblastoma differentiation and of the associated changes in migration, invasion, and in vivo metastasis. In addition, we found that the SR-family splicing factor SFRS1 (SF2/ASF) is a target for miR-10a -and -10b in HeLa and SH-SY5Y neuroblastoma cells. We show here that changes in miR-10a and -10b expression levels may regulate SFRS1-dependent alternative splicing and translational functions. Taken together, our results give support to the idea that miRNA regulation plays a key role in RA-induced neuroblastoma cell differentiation. The discovery of SFRS1 as direct target of miR-10a and -10b supports the emerging functional interaction between two post-transcriptional mechanisms, microRNAs and splicing, in the neuronal differentiation context.
LinkOut: [PMID: 21118818]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293
Disease 6434.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "HITS-CLIP data was present in GSM714642. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714642
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000453386.2 | 3UTR | AUUUUUAGUAGAGACAGGGUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.57 4.3e-3 0.774 3.1e-5 20 Click to see details
GSE28544 Breast cancer 0.395 2.8e-2 0.367 3.9e-2 24 Click to see details
GSE14794 Lymphoblastoid cells 0.181 4.4e-2 0.211 2.3e-2 90 Click to see details
GSE17498 Multiple myeloma -0.247 6.2e-2 -0.334 1.8e-2 40 Click to see details
GSE42095 Differentiated embryonic stem cells -0.32 6.8e-2 -0.512 6.3e-3 23 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.279 8.8e-2 0.305 6.9e-2 25 Click to see details
GSE21032 Prostate cancer 0.136 1.1e-1 0.190 4.3e-2 83 Click to see details
GSE21849 B cell lymphoma 0.209 1.4e-1 0.120 2.7e-1 29 Click to see details
GSE19783 ER+ ER+ breast cancer -0.244 1.5e-1 -0.371 5.4e-2 20 Click to see details
GSE28260 Renal cortex and medulla -0.307 1.5e-1 -0.308 1.5e-1 13 Click to see details
GSE19783 ER- ER- breast cancer -0.091 2.1e-1 -0.119 1.5e-1 79 Click to see details
GSE32688 Pancreatic cancer -0.14 2.2e-1 -0.277 6.2e-2 32 Click to see details
GSE38226 Liver fibrosis -0.157 2.5e-1 -0.119 3.0e-1 21 Click to see details
GSE27834 Pluripotent stem cells 0.18 2.5e-1 0.165 2.7e-1 16 Click to see details
GSE17306 Multiple myeloma 0.097 2.5e-1 0.118 2.1e-1 49 Click to see details
GSE19536 Breast cancer -0.063 2.7e-1 -0.059 2.8e-1 100 Click to see details
GSE19350 CNS germ cell tumors 0.197 2.7e-1 0.175 2.9e-1 12 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.22 3.0e-1 -0.048 4.6e-1 8 Click to see details
GSE26953 Aortic valvular endothelial cells 0.11 3.0e-1 -0.036 4.3e-1 24 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.072 3.7e-1 0.072 3.7e-1 25 Click to see details
GSE21687 Ependynoma primary tumors -0.025 4.2e-1 -0.129 1.5e-1 64 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KICH 0.489 0.01 0.515 0 25 Click to see details
ESCA -0.632 0.02 -0.591 0.03 11 Click to see details
LUAD -0.579 0.02 -0.399 0.1 12 Click to see details
CHOL 0.494 0.09 0.367 0.17 9 Click to see details
BRCA -0.148 0.09 -0.205 0.03 84 Click to see details
PAAD 0.765 0.12 0.400 0.3 4 Click to see details
THCA 0.149 0.13 0.217 0.05 59 Click to see details
BLCA -0.279 0.13 -0.160 0.26 18 Click to see details
KIRP 0.199 0.14 0.076 0.34 32 Click to see details
LIHC 0.136 0.18 0.074 0.31 49 Click to see details
PRAD -0.127 0.19 0.092 0.26 50 Click to see details
STAD -0.157 0.2 -0.191 0.15 32 Click to see details
COAD 0.314 0.22 0.286 0.25 8 Click to see details
KIRC 0.082 0.25 0.152 0.11 68 Click to see details
CESC -0.631 0.28 -0.500 0.33 3 Click to see details
LUSC 0.086 0.3 -0.005 0.49 38 Click to see details
HNSC -0.08 0.31 -0.060 0.35 42 Click to see details
UCEC 0.121 0.31 -0.019 0.47 19 Click to see details
PCPG 0.441 0.35 0.500 0.33 3 Click to see details
PCPG 0.441 0.35 0.500 0.33 3 Click to see details
PCPG 0.441 0.35 0.500 0.33 3 Click to see details
449 hsa-miR-10a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001140 HOXA1 homeobox A1 4 3
MIRT003896 USF2 upstream transcription factor 2, c-fos interacting 4 1
MIRT005454 NCOR2 nuclear receptor corepressor 2 3 1
MIRT005509 MAP3K7 mitogen-activated protein kinase kinase kinase 7 5 1
MIRT005510 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 7 2
MIRT006536 SRSF1 serine and arginine rich splicing factor 1 1 1
MIRT006537 TRA2B transformer 2 beta homolog 3 3
MIRT006972 EPHA4 EPH receptor A4 4 2
MIRT007021 CHL1 cell adhesion molecule L1 like 1 1
MIRT025588 GPR63 G protein-coupled receptor 63 1 1
MIRT025589 BCL2L13 BCL2 like 13 1 1
MIRT025590 CREB5 cAMP responsive element binding protein 5 1 1
MIRT025591 BIRC5 baculoviral IAP repeat containing 5 1 1
MIRT025592 OMA1 OMA1 zinc metallopeptidase 1 1
MIRT025593 IER3IP1 immediate early response 3 interacting protein 1 1 1
MIRT025594 RBM17 RNA binding motif protein 17 1 1
MIRT025595 NR1D2 nuclear receptor subfamily 1 group D member 2 1 1
MIRT025596 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT025597 SNX4 sorting nexin 4 2 4
MIRT025598 SERBP1 SERPINE1 mRNA binding protein 1 1 2
MIRT025599 LHFPL4 LHFPL tetraspan subfamily member 4 1 1
MIRT025600 NOP16 NOP16 nucleolar protein 1 1
MIRT025601 AJUBA ajuba LIM protein 1 1
MIRT025602 MAPK8 mitogen-activated protein kinase 8 1 1
MIRT025603 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT025604 TMEM101 transmembrane protein 101 2 4
MIRT025605 YES1 YES proto-oncogene 1, Src family tyrosine kinase 1 1
MIRT025606 DUSP3 dual specificity phosphatase 3 1 1
MIRT025607 PANX1 pannexin 1 1 1
MIRT025608 WEE1 WEE1 G2 checkpoint kinase 1 1
MIRT025609 TLE3 transducin like enhancer of split 3 1 1
MIRT025610 PDPK1 3-phosphoinositide dependent protein kinase 1 1 1
MIRT025611 CMPK1 cytidine/uridine monophosphate kinase 1 2 6
MIRT025612 NDUFB6 NADH:ubiquinone oxidoreductase subunit B6 1 1
MIRT025613 ARPC5 actin related protein 2/3 complex subunit 5 1 1
MIRT025614 PUM2 pumilio RNA binding family member 2 1 1
MIRT025615 GATAD2A GATA zinc finger domain containing 2A 1 1
MIRT025616 ACVR2A activin A receptor type 2A 2 2
MIRT025617 RBM12B RNA binding motif protein 12B 2 5
MIRT025618 THUMPD1 THUMP domain containing 1 1 2
MIRT025619 BLOC1S5 biogenesis of lysosomal organelles complex 1 subunit 5 1 1
MIRT025620 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT025621 XRN1 5'-3' exoribonuclease 1 1 1
MIRT025622 E2F7 E2F transcription factor 7 1 1
MIRT025623 LCA5 LCA5, lebercilin 1 1
MIRT025624 ELOVL2 ELOVL fatty acid elongase 2 1 1
MIRT025625 TFAP2C transcription factor AP-2 gamma 2 3
MIRT025626 TRIM2 tripartite motif containing 2 2 4
MIRT025627 HOXB3 homeobox B3 2 5
MIRT047505 FUS FUS RNA binding protein 1 1
MIRT047506 LMBR1L limb development membrane protein 1 like 1 1
MIRT047507 HSP90AA1 heat shock protein 90 alpha family class A member 1 1 1
MIRT047508 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT047509 EXTL3 exostosin like glycosyltransferase 3 1 1
MIRT047510 POLR2A RNA polymerase II subunit A 1 1
MIRT047511 RIOK2 RIO kinase 2 1 1
MIRT047512 C12orf76 chromosome 12 open reading frame 76 1 1
MIRT047513 CCDC151 coiled-coil domain containing 151 1 1
MIRT047514 FAT2 FAT atypical cadherin 2 1 1
MIRT047515 TPI1 triosephosphate isomerase 1 1 1
MIRT047516 BTAF1 B-TFIID TATA-box binding protein associated factor 1 1 1
MIRT047517 MSANTD1 Myb/SANT DNA binding domain containing 1 1 1
MIRT047518 PLA2G4A phospholipase A2 group IVA 1 1
MIRT047519 IGSF1 immunoglobulin superfamily member 1 1 1
MIRT047520 LEMD3 LEM domain containing 3 1 1
MIRT047521 E2F1 E2F transcription factor 1 1 1
MIRT047522 KIF3B kinesin family member 3B 1 1
MIRT047523 GBAS nipsnap homolog 2 1 1
MIRT047524 LIMA1 LIM domain and actin binding 1 1 1
MIRT047525 HSPA4 heat shock protein family A (Hsp70) member 4 1 1
MIRT047526 MRC2 mannose receptor C type 2 1 1
MIRT047527 TMEM106B transmembrane protein 106B 1 1
MIRT047528 ZFP30 ZFP30 zinc finger protein 1 1
MIRT047529 AMPD1 adenosine monophosphate deaminase 1 1 1
MIRT047530 SLC2A3 solute carrier family 2 member 3 1 1
MIRT047531 RPL15 ribosomal protein L15 1 1
MIRT047532 AGER advanced glycosylation end-product specific receptor 1 1
MIRT047533 CNTLN centlein 1 1
MIRT047534 C21orf59 chromosome 21 open reading frame 59 1 1
MIRT047535 SEPT9 septin 9 1 1
MIRT047536 COL6A2 collagen type VI alpha 2 chain 1 1
MIRT047537 MLNR motilin receptor 1 1
MIRT047538 RTKN2 rhotekin 2 1 1
MIRT047539 OAZ1 ornithine decarboxylase antizyme 1 1 1
MIRT047540 CSNK2A1 casein kinase 2 alpha 1 2 3
MIRT047541 AQP12B aquaporin 12B 1 1
MIRT047542 AGBL2 ATP/GTP binding protein like 2 1 1
MIRT047543 GOLGA8A golgin A8 family member A 1 1
MIRT047544 CPED1 cadherin like and PC-esterase domain containing 1 1 1
MIRT047545 HSPA8 heat shock protein family A (Hsp70) member 8 1 1
MIRT047546 SLC41A3 solute carrier family 41 member 3 1 1
MIRT047547 KXD1 KxDL motif containing 1 1 1
MIRT047548 RELN reelin 1 1
MIRT047549 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 1 1
MIRT047550 PTPRT protein tyrosine phosphatase, receptor type T 1 1
MIRT047551 ZC3H18 zinc finger CCCH-type containing 18 1 1
MIRT047552 CYP8B1 cytochrome P450 family 8 subfamily B member 1 1 1
MIRT047553 COL4A3 collagen type IV alpha 3 chain 1 1
MIRT047554 PFAS phosphoribosylformylglycinamidine synthase 1 1
MIRT047555 MSL3 MSL complex subunit 3 1 1
MIRT047556 TTC7A tetratricopeptide repeat domain 7A 1 1
MIRT047557 COX7B cytochrome c oxidase subunit 7B 1 1
MIRT047558 ZNF318 zinc finger protein 318 1 1
MIRT047559 ACAA1 acetyl-CoA acyltransferase 1 1 1
MIRT047560 IPCEF1 interaction protein for cytohesin exchange factors 1 1 1
MIRT047561 SCAP SREBF chaperone 1 1
MIRT047562 KCTD11 potassium channel tetramerization domain containing 11 2 11
MIRT047563 RIOK3 RIO kinase 3 1 1
MIRT047564 C5 complement C5 1 1
MIRT047565 GLB1L3 galactosidase beta 1 like 3 1 1
MIRT047566 PAPD5 poly(A) RNA polymerase D5, non-canonical 1 1
MIRT047567 RNF123 ring finger protein 123 1 1
MIRT047568 ZNF629 zinc finger protein 629 1 1
MIRT047569 AMMECR1L AMMECR1 like 1 1
MIRT047570 KLHL6 kelch like family member 6 1 1
MIRT047571 SYMPK symplekin 1 1
MIRT047572 NCSTN nicastrin 1 1
MIRT047573 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 1
MIRT047574 SREBF1 sterol regulatory element binding transcription factor 1 1 1
MIRT047575 HIVEP3 human immunodeficiency virus type I enhancer binding protein 3 1 1
MIRT047576 RAB18 RAB18, member RAS oncogene family 1 1
MIRT047577 CUL3 cullin 3 1 1
MIRT047578 MTF2 metal response element binding transcription factor 2 1 1
MIRT047579 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT047580 NUP37 nucleoporin 37 1 1
MIRT047581 GPR98 adhesion G protein-coupled receptor V1 1 1
MIRT047582 RUNDC3B RUN domain containing 3B 1 1
MIRT047583 KIF21A kinesin family member 21A 1 1
MIRT047584 FEM1B fem-1 homolog B 1 1
MIRT047585 RABL6 RAB, member RAS oncogene family like 6 1 1
MIRT047586 PLA2G4F phospholipase A2 group IVF 1 1
MIRT047587 SNTB2 syntrophin beta 2 1 1
MIRT047588 NUB1 negative regulator of ubiquitin like proteins 1 1 1
MIRT047589 MTR 5-methyltetrahydrofolate-homocysteine methyltransferase 1 1
MIRT047590 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT047591 C11orf63 chromosome 11 open reading frame 63 1 1
MIRT047592 ABCB7 ATP binding cassette subfamily B member 7 1 1
MIRT047593 CHRNA5 cholinergic receptor nicotinic alpha 5 subunit 1 1
MIRT047594 RPS9 ribosomal protein S9 1 1
MIRT047595 DDX42 DEAD-box helicase 42 1 1
MIRT047596 XPO7 exportin 7 1 1
MIRT047597 PYGL glycogen phosphorylase L 1 1
MIRT047598 TGFB3 transforming growth factor beta 3 1 1
MIRT047599 ARHGAP19 Rho GTPase activating protein 19 1 1
MIRT047600 PHB2 prohibitin 2 1 1
MIRT047601 ALDH1A2 aldehyde dehydrogenase 1 family member A2 1 1
MIRT047602 SLC3A2 solute carrier family 3 member 2 1 1
MIRT047603 POLR2H RNA polymerase II subunit H 1 1
MIRT047604 TAF15 TATA-box binding protein associated factor 15 1 1
MIRT047605 MOB3C MOB kinase activator 3C 1 1
MIRT047606 MBD1 methyl-CpG binding domain protein 1 1 1
MIRT047607 HSPA1B heat shock protein family A (Hsp70) member 1B 1 1
MIRT047608 INTS2 integrator complex subunit 2 1 1
MIRT047609 MYEF2 myelin expression factor 2 1 1
MIRT047610 PANK2 pantothenate kinase 2 1 1
MIRT047611 EMB embigin 1 1
MIRT047612 HK1 hexokinase 1 1 1
MIRT047613 UBE2Z ubiquitin conjugating enzyme E2 Z 1 1
MIRT047614 STT3A STT3A, catalytic subunit of the oligosaccharyltransferase complex 1 1
MIRT047615 HOXA3 homeobox A3 1 1
MIRT047616 NT5DC1 5'-nucleotidase domain containing 1 1 1
MIRT047617 YOD1 YOD1 deubiquitinase 1 1
MIRT047618 APRT adenine phosphoribosyltransferase 1 1
MIRT047619 C2CD2 C2 calcium dependent domain containing 2 1 1
MIRT047620 SHBG sex hormone binding globulin 1 1
MIRT047621 PPP1R12A protein phosphatase 1 regulatory subunit 12A 1 1
MIRT047622 SCD stearoyl-CoA desaturase 1 1
MIRT047623 BCKDK branched chain ketoacid dehydrogenase kinase 1 1
MIRT047624 ETS1 ETS proto-oncogene 1, transcription factor 1 1
MIRT047625 GTF3C2 general transcription factor IIIC subunit 2 1 1
MIRT047626 NOP2 NOP2 nucleolar protein 1 1
MIRT047627 RPS29 ribosomal protein S29 1 1
MIRT047628 LAMC1 laminin subunit gamma 1 1 1
MIRT047629 GNAL G protein subunit alpha L 1 1
MIRT047630 KIAA1147 KIAA1147 1 1
MIRT047631 NACC2 NACC family member 2 1 1
MIRT047632 TMEM179B transmembrane protein 179B 1 1
MIRT047633 ARF3 ADP ribosylation factor 3 1 1
MIRT047634 MCPH1 microcephalin 1 1 1
MIRT047635 ARMCX3 armadillo repeat containing, X-linked 3 1 1
MIRT047636 UBN2 ubinuclein 2 1 1
MIRT047637 ANO6 anoctamin 6 1 1
MIRT047638 NEK7 NIMA related kinase 7 1 1
MIRT047639 EIF4H eukaryotic translation initiation factor 4H 1 1
MIRT047640 MED1 mediator complex subunit 1 1 1
MIRT047641 PTPRG protein tyrosine phosphatase, receptor type G 1 1
MIRT047642 ERMN ermin 1 1
MIRT047643 LYPD6 LY6/PLAUR domain containing 6 1 1
MIRT047644 SLC25A5 solute carrier family 25 member 5 1 1
MIRT047645 EPB41L2 erythrocyte membrane protein band 4.1 like 2 1 1
MIRT047646 ARFGEF1 ADP ribosylation factor guanine nucleotide exchange factor 1 1 1
MIRT047647 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT047648 NTMT1 N-terminal Xaa-Pro-Lys N-methyltransferase 1 1 1
MIRT047649 KLHL23 kelch like family member 23 1 1
MIRT047650 FGFR1 fibroblast growth factor receptor 1 1 1
MIRT047651 HOXD13 homeobox D13 1 1
MIRT047652 CHFR checkpoint with forkhead and ring finger domains 1 1
MIRT047653 ZNF592 zinc finger protein 592 1 1
MIRT047654 EIF1AD eukaryotic translation initiation factor 1A domain containing 1 1
MIRT047655 RRP1B ribosomal RNA processing 1B 1 1
MIRT047656 UHRF1 ubiquitin like with PHD and ring finger domains 1 1 1
MIRT047657 SORD sorbitol dehydrogenase 1 1
MIRT047658 PPM1G protein phosphatase, Mg2+/Mn2+ dependent 1G 1 1
MIRT047659 SF3B3 splicing factor 3b subunit 3 1 1
MIRT047660 PRPF8 pre-mRNA processing factor 8 1 1
MIRT047661 PRDX2 peroxiredoxin 2 1 1
MIRT047662 HNRNPF heterogeneous nuclear ribonucleoprotein F 1 1
MIRT047663 AMPD2 adenosine monophosphate deaminase 2 1 1
MIRT047664 CAB39L calcium binding protein 39 like 1 1
MIRT047665 ATP5F1 ATP synthase, H+ transporting, mitochondrial Fo complex subunit B1 1 1
MIRT047666 PARL presenilin associated rhomboid like 1 1
MIRT047667 ERLIN1 ER lipid raft associated 1 1 1
MIRT047668 MARS methionyl-tRNA synthetase 1 1
MIRT047669 TRPM7 transient receptor potential cation channel subfamily M member 7 1 1
MIRT047670 DLG4 discs large MAGUK scaffold protein 4 1 1
MIRT047671 WDR74 WD repeat domain 74 1 1
MIRT047672 PWP1 PWP1 homolog, endonuclein 1 1
MIRT047673 RPRD1A regulation of nuclear pre-mRNA domain containing 1A 1 1
MIRT047674 NAP1L1 nucleosome assembly protein 1 like 1 1 1
MIRT047675 CTNND1 catenin delta 1 1 1
MIRT047676 IQCB1 IQ motif containing B1 1 1
MIRT047677 EIF1 eukaryotic translation initiation factor 1 1 1
MIRT047678 CDK19 cyclin dependent kinase 19 1 1
MIRT047679 LRP3 LDL receptor related protein 3 1 1
MIRT047680 UBE2D2 ubiquitin conjugating enzyme E2 D2 1 1
MIRT047681 GEMIN5 gem nuclear organelle associated protein 5 1 1
MIRT047682 GORASP2 golgi reassembly stacking protein 2 1 1
MIRT047683 DDX54 DEAD-box helicase 54 1 1
MIRT047684 CARHSP1 calcium regulated heat stable protein 1 1 1
MIRT047685 FAM168A family with sequence similarity 168 member A 1 1
MIRT047686 SF3B4 splicing factor 3b subunit 4 1 1
MIRT047687 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 1 1
MIRT047688 PLEKHB2 pleckstrin homology domain containing B2 1 1
MIRT047689 LRFN1 leucine rich repeat and fibronectin type III domain containing 1 1 1
MIRT047690 KIAA0100 KIAA0100 1 1
MIRT047691 DVL1 dishevelled segment polarity protein 1 1 1
MIRT047692 NOMO1 NODAL modulator 1 1 1
MIRT047693 MIS12 MIS12, kinetochore complex component 1 1
MIRT047694 GLOD4 glyoxalase domain containing 4 1 1
MIRT047695 USP11 ubiquitin specific peptidase 11 1 1
MIRT047696 UBE3C ubiquitin protein ligase E3C 1 1
MIRT047697 NT5DC3 5'-nucleotidase domain containing 3 1 1
MIRT047698 SPARC secreted protein acidic and cysteine rich 1 1
MIRT047699 SLC26A2 solute carrier family 26 member 2 1 1
MIRT047700 MED12 mediator complex subunit 12 1 1
MIRT047701 FAM219B family with sequence similarity 219 member B 1 1
MIRT047702 GOSR2 golgi SNAP receptor complex member 2 1 1
MIRT047703 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT047704 PIAS3 protein inhibitor of activated STAT 3 1 1
MIRT047705 ASB1 ankyrin repeat and SOCS box containing 1 1 1
MIRT047706 COL4A2 collagen type IV alpha 2 chain 1 1
MIRT047707 NUP205 nucleoporin 205 1 1
MIRT047708 POLR3A RNA polymerase III subunit A 1 1
MIRT047709 ATG3 autophagy related 3 1 1
MIRT047710 COPA coatomer protein complex subunit alpha 1 1
MIRT047711 CD59 CD59 molecule (CD59 blood group) 1 1
MIRT047712 TENM3 teneurin transmembrane protein 3 1 1
MIRT047713 TUBA1A tubulin alpha 1a 1 1
MIRT047714 LSS lanosterol synthase 1 1
MIRT047715 FASN fatty acid synthase 4 1
MIRT047716 PSMD13 proteasome 26S subunit, non-ATPase 13 1 1
MIRT047717 ZNF618 zinc finger protein 618 1 1
MIRT047718 TSPAN33 tetraspanin 33 1 1
MIRT047719 KANK1 KN motif and ankyrin repeat domains 1 1 1
MIRT047720 ADPRHL2 ADP-ribosylhydrolase like 2 1 1
MIRT047721 DPYSL2 dihydropyrimidinase like 2 1 1
MIRT047722 SUPT6H SPT6 homolog, histone chaperone 1 1
MIRT047723 B3GNT5 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5 1 1
MIRT047724 ACTG1 actin gamma 1 3 2
MIRT047725 PLSCR1 phospholipid scramblase 1 1 1
MIRT047726 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT047727 SFPQ splicing factor proline and glutamine rich 1 1
MIRT047728 VDAC1 voltage dependent anion channel 1 1 1
MIRT047729 ADCY9 adenylate cyclase 9 1 1
MIRT047730 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT047731 ABCG2 ATP binding cassette subfamily G member 2 (Junior blood group) 1 1
MIRT047732 SLC25A13 solute carrier family 25 member 13 1 1
MIRT047733 IGSF9B immunoglobulin superfamily member 9B 1 1
MIRT047734 ESPL1 extra spindle pole bodies like 1, separase 1 1
MIRT047735 MCU mitochondrial calcium uniporter 1 1
MIRT047736 CDK8 cyclin dependent kinase 8 1 1
MIRT047737 CEP128 centrosomal protein 128 1 1
MIRT047738 TRAPPC12 trafficking protein particle complex 12 1 1
MIRT047739 SYNJ1 synaptojanin 1 1 1
MIRT047740 NOB1 NIN1/PSMD8 binding protein 1 homolog 1 1
MIRT047741 AP5S1 adaptor related protein complex 5 sigma 1 subunit 1 1
MIRT047742 RNF213 ring finger protein 213 1 1
MIRT047743 PSMB1 proteasome subunit beta 1 1 1
MIRT047744 BCR BCR, RhoGEF and GTPase activating protein 1 1
MIRT047745 PABPC1 poly(A) binding protein cytoplasmic 1 1 1
MIRT047746 NPTX1 neuronal pentraxin 1 1 1
MIRT047747 PRRC2C proline rich coiled-coil 2C 1 1
MIRT047748 PABPC3 poly(A) binding protein cytoplasmic 3 1 1
MIRT047749 NF2 neurofibromin 2 1 1
MIRT047750 RALBP1 ralA binding protein 1 1 1
MIRT047751 EHD4 EH domain containing 4 1 1
MIRT047752 RLIM ring finger protein, LIM domain interacting 1 1
MIRT076413 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 2 2
MIRT084600 BCL2L11 BCL2 like 11 3 5
MIRT093335 RAPGEF2 Rap guanine nucleotide exchange factor 2 2 2
MIRT097757 ARSK arylsulfatase family member K 2 2
MIRT099597 ID4 inhibitor of DNA binding 4, HLH protein 2 6
MIRT249192 RAP2A RAP2A, member of RAS oncogene family 2 1
MIRT299201 CSRNP3 cysteine and serine rich nuclear protein 3 2 2
MIRT437577 ZFAND5 zinc finger AN1-type containing 5 2 1
MIRT437578 CNST consortin, connexin sorting protein 2 1
MIRT437579 TIAM1 T-cell lymphoma invasion and metastasis 1 2 1
MIRT438258 PTEN phosphatase and tensin homolog 2 2
MIRT438408 PIK3CG phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma 3 1
MIRT448051 SFRP1 secreted frizzled related protein 1 2 2
MIRT459965 POC1A POC1 centriolar protein A 2 2
MIRT466175 TMED5 transmembrane p24 trafficking protein 5 2 2
MIRT470412 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 2
MIRT475883 H3F3C H3 histone family member 3C 2 10
MIRT475919 H3F3B H3 histone family member 3B 2 8
MIRT493173 MKNK2 MAP kinase interacting serine/threonine kinase 2 2 2
MIRT497272 GRK6 G protein-coupled receptor kinase 6 2 2
MIRT507101 GPCPD1 glycerophosphocholine phosphodiesterase 1 2 2
MIRT508100 ANKRD33B ankyrin repeat domain 33B 2 4
MIRT508628 PLA2G2C phospholipase A2 group IIC 2 2
MIRT510735 SON SON DNA binding protein 2 6
MIRT513973 CNOT6 CCR4-NOT transcription complex subunit 6 2 2
MIRT514262 S1PR2 sphingosine-1-phosphate receptor 2 2 2
MIRT514577 MAPKAPK5 mitogen-activated protein kinase-activated protein kinase 5 2 4
MIRT515044 EBNA1BP2 EBNA1 binding protein 2 2 2
MIRT515692 TFPI tissue factor pathway inhibitor 2 2
MIRT515752 ONECUT3 one cut homeobox 3 2 2
MIRT517389 METTL7A methyltransferase like 7A 2 2
MIRT519732 ZNF460 zinc finger protein 460 2 2
MIRT520247 USP9X ubiquitin specific peptidase 9, X-linked 2 4
MIRT520270 URGCP upregulator of cell proliferation 2 2
MIRT522213 NR2C2 nuclear receptor subfamily 2 group C member 2 2 6
MIRT523700 FHL2 four and a half LIM domains 2 2 4
MIRT523978 DVL3 dishevelled segment polarity protein 3 2 2
MIRT525569 MTRNR2L7 MT-RNR2-like 7 2 6
MIRT525619 MTRNR2L3 MT-RNR2-like 3 2 4
MIRT530223 UGDH UDP-glucose 6-dehydrogenase 2 2
MIRT530549 SYNPO synaptopodin 2 2
MIRT531041 ZNF502 zinc finger protein 502 2 2
MIRT532579 GSS glutathione synthetase 2 2
MIRT534840 RAB15 RAB15, member RAS oncogene family 2 2
MIRT535793 MTRNR2L11 MT-RNR2-like 11 2 6
MIRT535811 MTRNR2L10 MT-RNR2-like 10 2 4
MIRT536818 HMGN2 high mobility group nucleosomal binding domain 2 2 2
MIRT539894 IRGQ immunity related GTPase Q 2 2
MIRT540209 ARHGAP18 Rho GTPase activating protein 18 2 2
MIRT540951 SLC25A43 solute carrier family 25 member 43 2 2
MIRT541937 ORC1 origin recognition complex subunit 1 2 4
MIRT542195 FUT1 fucosyltransferase 1 (H blood group) 2 6
MIRT542374 PAICS phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase 2 2
MIRT542508 WDR13 WD repeat domain 13 2 2
MIRT542575 ZNF280B zinc finger protein 280B 2 2
MIRT542714 RPS15A ribosomal protein S15a 2 2
MIRT546705 RORA RAR related orphan receptor A 5 4
MIRT549929 NDUFB5 NADH:ubiquinone oxidoreductase subunit B5 2 2
MIRT550162 ZNF223 zinc finger protein 223 2 4
MIRT558566 CRLF3 cytokine receptor like factor 3 2 4
MIRT560945 TPM4 tropomyosin 4 2 4
MIRT574848 CADM1 cell adhesion molecule 1 2 2
MIRT575176 Atg9a autophagy related 9A 2 2
MIRT576664 Fam216a family with sequence similarity 216, member A 2 2
MIRT609434 MTX3 metaxin 3 2 2
MIRT612162 TCF15 transcription factor 15 2 2
MIRT617414 API5 apoptosis inhibitor 5 2 2
MIRT617469 CCS copper chaperone for superoxide dismutase 2 2
MIRT618780 HLA-E major histocompatibility complex, class I, E 2 2
MIRT618835 PHF20 PHD finger protein 20 2 2
MIRT619339 RNF2 ring finger protein 2 2 2
MIRT625244 C6orf89 chromosome 6 open reading frame 89 2 2
MIRT626439 CHDH choline dehydrogenase 2 2
MIRT634929 CHMP1B charged multivesicular body protein 1B 2 2
MIRT635875 SLC11A2 solute carrier family 11 member 2 2 2
MIRT636235 SLC24A4 solute carrier family 24 member 4 2 2
MIRT636641 CHAF1B chromatin assembly factor 1 subunit B 2 2
MIRT640545 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT648661 ALKBH4 alkB homolog 4, lysine demethylase 2 2
MIRT650186 LILRA2 leukocyte immunoglobulin like receptor A2 2 2
MIRT650790 GSR glutathione-disulfide reductase 2 2
MIRT652027 TTYH3 tweety family member 3 2 2
MIRT652517 TMEM109 transmembrane protein 109 2 2
MIRT661940 MAVS mitochondrial antiviral signaling protein 2 2
MIRT661951 FAHD1 fumarylacetoacetate hydrolase domain containing 1 2 2
MIRT662020 ZNF445 zinc finger protein 445 2 2
MIRT664015 LOH12CR1 BLOC-1 related complex subunit 5 2 2
MIRT664059 KIAA1551 KIAA1551 2 2
MIRT666872 POU2F2 POU class 2 homeobox 2 2 2
MIRT669168 CCNG1 cyclin G1 2 2
MIRT673243 KLHDC8A kelch domain containing 8A 2 2
MIRT680410 SFT2D2 SFT2 domain containing 2 2 2
MIRT680484 ATP1B4 ATPase Na+/K+ transporting family member beta 4 2 2
MIRT683577 CARD8 caspase recruitment domain family member 8 2 2
MIRT684398 MCTS1 MCTS1, re-initiation and release factor 2 2
MIRT684558 ZNF708 zinc finger protein 708 2 2
MIRT685421 ACAD8 acyl-CoA dehydrogenase family member 8 2 2
MIRT686050 SLC5A5 solute carrier family 5 member 5 2 2
MIRT687955 HHIP hedgehog interacting protein 2 2
MIRT688181 FRRS1 ferric chelate reductase 1 2 2
MIRT688303 FAM208A family with sequence similarity 208 member A 2 2
MIRT688900 C1GALT1 core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase 1 2 2
MIRT689205 ZNF574 zinc finger protein 574 2 2
MIRT689917 ACOT13 acyl-CoA thioesterase 13 2 2
MIRT692931 EXOSC2 exosome component 2 2 2
MIRT693632 CENPL centromere protein L 2 2
MIRT694762 FZD2 frizzled class receptor 2 2 2
MIRT695373 PHAX phosphorylated adaptor for RNA export 2 2
MIRT696630 WDR77 WD repeat domain 77 2 2
MIRT696690 APOC3 apolipoprotein C3 2 2
MIRT697367 ZNF394 zinc finger protein 394 2 2
MIRT697611 XIAP X-linked inhibitor of apoptosis 2 2
MIRT697737 USP6NL USP6 N-terminal like 2 2
MIRT697788 UBXN7 UBX domain protein 7 2 2
MIRT698361 TMEM127 transmembrane protein 127 2 2
MIRT704519 CNKSR3 CNKSR family member 3 2 2
MIRT704600 CLN8 CLN8, transmembrane ER and ERGIC protein 2 2
MIRT705849 AHCY adenosylhomocysteinase 2 2
MIRT707093 TIMM50 translocase of inner mitochondrial membrane 50 2 2
MIRT707154 C17orf105 chromosome 17 open reading frame 105 2 2
MIRT707243 H6PD hexose-6-phosphate dehydrogenase/glucose 1-dehydrogenase 2 2
MIRT707356 XPNPEP3 X-prolyl aminopeptidase 3 2 2
MIRT707459 PPFIBP1 PPFIA binding protein 1 2 2
MIRT707503 AXL AXL receptor tyrosine kinase 2 2
MIRT707647 CRIPT CXXC repeat containing interactor of PDZ3 domain 2 2
MIRT707703 FAM118A family with sequence similarity 118 member A 2 2
MIRT707714 CDC6 cell division cycle 6 2 2
MIRT707825 TMEM170A transmembrane protein 170A 2 2
MIRT707966 PDK3 pyruvate dehydrogenase kinase 3 2 2
MIRT708006 NUDT4 nudix hydrolase 4 2 2
MIRT708035 MRPS14 mitochondrial ribosomal protein S14 2 2
MIRT708073 LIX1L limb and CNS expressed 1 like 2 2
MIRT708131 GK5 glycerol kinase 5 (putative) 2 2
MIRT708200 ANP32E acidic nuclear phosphoprotein 32 family member E 2 2
MIRT708210 AHSA2 activator of HSP90 ATPase homolog 2 2 2
MIRT708940 CRY2 cryptochrome circadian clock 2 2 2
MIRT709199 SAPCD2 suppressor APC domain containing 2 2 2
MIRT714403 FBXO31 F-box protein 31 2 2
MIRT714629 KIAA1143 KIAA1143 2 2
MIRT720741 ELOVL7 ELOVL fatty acid elongase 7 2 2
MIRT720894 CSGALNACT1 chondroitin sulfate N-acetylgalactosaminyltransferase 1 2 2
MIRT723335 DGAT1 diacylglycerol O-acyltransferase 1 2 2
MIRT724452 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT731180 SERPINE1 serpin family E member 1 3 1
MIRT732377 GP1BA glycoprotein Ib platelet alpha subunit 2 1
MIRT733585 SDC1 syndecan 1 3 0
MIRT734393 ARNTL aryl hydrocarbon receptor nuclear translocator like 3 0
MIRT735361 BDNF brain derived neurotrophic factor 4 0
MIRT735799 MAP2K6 mitogen-activated protein kinase kinase 6 3 0
MIRT735868 KRAS KRAS proto-oncogene, GTPase 1 0
MIRT736834 SKA1 spindle and kinetochore associated complex subunit 1 3 0
MIRT737248 LEF1-AS1 LEF1 antisense RNA 1 2 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-10a RAR-alpha antagonist Ro-41-5253 NULL NULL Northern blot pancreatic cancer 19747919 2009 down-regulated
miR-10a 5-Fluorouracil approved 3385 Microarray HCT-8 colon cancer cell line 19956872 2010 down-regulated
miR-10a Oxaliplatin (L-OHP) approved 5310940 Microarray HCT-116 colon cancer cell line 19956872 2010 down-regulated
miR-10a Mistletoe lectin-I NULL NULL Microarray colorectal cancer cells HT-29 cells 20955366 2011 down-regulated
miR-10a Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-10a All-trans-retinoic acid (ATRA) approved 444795 Microarray acute myeloid leukemia (AML) cell line HL-60 21518431 2011 down-regulated
miR-10a Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-10a All-trans-retinoic acid (ATRA) approved 444795 Quantitative real-time PCR regulatory T cells (T(reg) cells) 22544395 2012 up-regulated
miR-10a Glucocorticoid NULL NULL Quantitative real-time PCR Eosinophilic esophagitis 22815788 2012 up-regulated
miR-10a Glucocorticoid NULL NULL TaqMan low-density array Eosinophilic esophagitis 22815788 2012 up-regulated
miR-10a Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-10a Ethanol NULL 702 Microarray fetal mouse brains 19091803 2009 up-regulated
miR-10a Ethanol NULL 702 Northern blot fetal mouse brains 19091803 2009 up-regulated
miR-10a Ethanol NULL 702 Quantitative real-time PCR fetal mouse brains 19091803 2009 up-regulated
miR-10a Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 down-regulated
miR-10a Longevinex NULL NULL Quantitative real-time PCR ischemia/reperfusion [I/R] rat model 21203465 2011 down-regulated
miR-10a Longevinex NULL NULL Quantitative real-time PCR normal heart 21203465 2011 up-regulated
miR-10a Resveratrol NULL 445154 Quantitative real-time PCR ischemia/reperfusion [I/R] rat model 21203465 2011 down-regulated
miR-10a Resveratrol NULL 445154 Quantitative real-time PCR normal heart 21203465 2011 up-regulated
miR-10a Aristolochic acid NULL 2236 Microarray kidney 25106556 2014 up-regualted
miR-10a Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-10a-5p Hydroxycamptothecin (HCPT) NULL 97226 Microarray human Tenon's fibroblasts (HTFs) 24681041 2014 down-regulated
miR-10a-5p Comfrey NULL 6440495 Microarray rat liver 21370286 2011 down-regulated
miR-10a-5p Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miR-10a-5p Propranolol approved 4946 Quantitative real-time PCR heart 22847192 2012 up-regulated
miR-10a-5p Acarbose Approved 444254 Microarray diabetic rats cells 24260283 2014 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-10a Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-mir-10a Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-10a Paclitaxel 36314 NSC125973 approved sensitive cell line (W1)
hsa-mir-10a Cisplatin 5460033 NSC119875 approved resistant cell line (W1)
hsa-mir-10a Methotrexate 126941 NSC740 approved sensitive cell line (W1)
hsa-mir-10a Topotecan 60699 NSC609699 approved sensitive cell line (W1)
hsa-mir-10a Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-mir-10a Androstenedione 6128 NSC9563 resistant cell line (MCF-7)
hsa-mir-10a Tamoxifen 2733525 NSC180973 approved sensitive tissue (ER-positive breast cancer)
hsa-mir-10a Fluorouracil 3385 NSC19893 approved sensitive cell line (OE19)
hsa-mir-10a Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-mir-10a Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-mir-10a Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)
hsa-miR-10a-5p (2E,5Z)-2-[(5-acetyl-4-methyl-1,3-thiazol-2-yl)hydrazinylidene]-5-[(2-methoxyphenyl)methylidene]-1,3-thiazolidin-4-one 135472679 NSC658292 resistant
hsa-miR-10a-5p (3aR)-7-[3-[4-[3-[[(3aR)-8-methoxy-10-oxo-2,3,3a,10a-tetrahydro-1H-cyclopenta[c][1]benzazepin-7-yl]oxy]propyl]piperazin-1-yl]propoxy]-8-methoxy-2,3,3a,10a-tetrahydro-1H-cyclopenta[c][1]benzazepin-10-one 24202913 NSC726262 resistant
hsa-miR-10a-5p (4z,6z)-4,6-dibenzylidene-2,2-dimethyl-1,3-dioxan-5-one 5387558 NSC624512 resistant
hsa-miR-10a-5p (5e)-5-benzylidene-3-(2,4,5-trichlorophenyl)-2-(3,4,5-trimethoxyphenyl)-1,3-thiazolidin-4-one 5470506 NSC702355 resistant
hsa-miR-10a-5p (6e,7r,8r,8as)-8-methyl-6-[(2r)-2-methylhexylidene]-8-phenylmethoxy-1,2,3,5,7,8a-hexahydroindolizin-7-ol 5470307 NSC699382 resistant
hsa-miR-10a-5p (8S,9S,10R,11S,13S,14S,17S)-11-hydroxy-10,13-dimethyl-17-(2-phenyl-1,3-thiazol-4-yl)-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-3-one 261360 NSC93354 resistant
hsa-miR-10a-5p (e)-1-(3,5-ditert-butyl-4-hydroxyphenyl)-3-[4-(diethylamino)phenyl]prop-2-en-1-one 5471159 NSC709103 resistant
hsa-miR-10a-5p (e)-1-[3-[(4,6-dianilino-1,3,5-triazin-2-yl)amino]phenyl]-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 45028636 NSC743530 resistant
hsa-miR-10a-5p (e)-2-methyl-1-[2-(2-methyl-1h-indol-3-yl)indolin-1-yl]but-2-en-1-one 5388204 NSC633484 resistant
hsa-miR-10a-5p [(1s,2s,3r,4s,7r,9s,10s,12r,15s)-4,12-diacetyloxy-15-[(2r,3s)-3-(cyclohexanecarbonylamino)-3-cyclohexyl-2-hydroxypropanoyl]oxy-1,9-dihydroxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10 383477 NSC671869 resistant
hsa-miR-10a-5p [(3S,10R,13S,16E)-16-[[3-methoxy-4-(2-piperidin-1-ylethoxy)phenyl]methylidene]-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 24203176 NSC727082 sensitive
hsa-miR-10a-5p [(3s,8r,10r,13s,17e)-10,13-dimethyl-17-(phenylcarbamoyloxyimino)-1,2,3,4,7,8,9,11,12,14,15,16-dodecahydrocyclopenta[a]phenanthren-3-yl] n-phenylcarbamate 9569960 NSC629229 sensitive
hsa-miR-10a-5p [(7S,9E,11S,12R,13S,14R,15R,16R,17S,18S,19E,21Z)-26-[(E)-[(2,4-dinitrophenyl)hydrazinylidene]methyl]-2,15,17,27,29-pentahydroxy-11-methoxy-3,7,12,14,16,18,22-heptamethyl-6,23-dioxo-8,30-dioxa-24-azatetracyclo[23.3.1.14,7.05,28]triaconta-1(29),2,4,9,19,21, 135483937 NSC144126 resistant
hsa-miR-10a-5p [(8R,10S,13R)-7,12-diacetyloxy-17-[5,5-bis(4-chlorophenyl)pent-4-en-2-yl]-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 376380 NSC657282 resistant
hsa-miR-10a-5p [3,4,5-triacetyloxy-6-[3-cyano-4-(furan-2-yl)-2-oxo-6-phenylpyridin-1-yl]oxan-2-yl]methyl acetate 368873 NSC640212 resistant
hsa-miR-10a-5p [3,4,5-triacetyloxy-6-[3-phenyl-2,4-bis(sulfanylidene)quinazolin-1-yl]oxan-2-yl]methyl acetate 368629 NSC639741 resistant
hsa-miR-10a-5p [4-[[dimethyl(octadecyl)azaniumyl]methyl]phenyl]methyl-dimethyl-octadecylazanium;bromide 361976 NSC625458 resistant
hsa-miR-10a-5p [6-[(E)-(carbamothioylhydrazinylidene)methyl]pyridin-3-yl] acetate 9555726 NSC144055 resistant
hsa-miR-10a-5p 1-(dimethylamino)-4-methyl-4H-pyrido[3,4-g]quinoline-5,10-dione 388892 NSC684118 sensitive
hsa-miR-10a-5p 1-[(2S)-3-[[2,7-di(piperidin-1-yl)-2,3,4a,5,7,7a-hexahydrofuro[3,4-b][1,4]dioxin-3-yl]oxy]oxolan-2-yl]piperidine 253322 NSC76150 resistant
hsa-miR-10a-5p 1-[3-(3,4-dimethoxyphenyl)-2-(2,4-dinitrophenyl)-3,4-dihydropyrazol-5-yl]naphthalen-2-ol 390439 NSC687793 resistant
hsa-miR-10a-5p 1-[7-methyl-8-(3,4,5-trimethoxyphenyl)-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-6-yl]piperazine 384846 NSC675364 resistant
hsa-miR-10a-5p 10,16-bis[2-(dimethylamino)ethyl]-1,9,10,16-tetrazapentacyclo[9.6.2.02,7.08,19.014,18]nonadeca-2,4,6,8,11(19),12,14(18)-heptaene-15,17-dione 399629 NSC710546 sensitive
hsa-miR-10a-5p 1h-pyrimido[4,5-b]quinoline-2,4-dithione 5472868 NSC722222 resistant
hsa-miR-10a-5p 2-(11h-indolo[3,2-c]quinolin-6-ylamino)ethanol NSC736606 sensitive
hsa-miR-10a-5p 2-(2-chlorophenyl)-5,7-dihydroxy-8-(3-hydroxy-1-methylpiperidin-4-yl)chromen-4-one 5466794 NSC642740 resistant
hsa-miR-10a-5p 2-trans-n-buten-1-yl-estradiol 5468334 NSC669229 resistant
hsa-miR-10a-5p 2,5-diphenyl-1h-[1,2,4]triazino[4,3-a]quinoxaline 399102 NSC709518 resistant
hsa-miR-10a-5p 3-(((cyclohexylamino)carbonyl)oxy)-4-methyl-1,3-thiazole-2(3h)-thione 372703 NSC648263 resistant
hsa-miR-10a-5p 3-[4-(7-chloroquinolin-4-yl)oxy-3-methoxyphenyl]-5-phenyl-3,4-dihydropyrazole-2-carbaldehyde 155810020 NSC762559 resistant
hsa-miR-10a-5p 3,3,4,4,4-pentachloro-1-phenylbutan-1-one 405828 NSC723515 sensitive
hsa-miR-10a-5p 4-[[(5s,8ar)-9-(4-hydroxy-3,5-dimethoxyphenyl)-8-oxo-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[5,6-f][1,3]benzodioxol-5-yl]amino]benzoic acid 374328 NSC651852 resistant
hsa-miR-10a-5p 4-appt 5995211 NSC195327 resistant
hsa-miR-10a-5p 4-methyl-3-[4-[2-[4-(4-methyl-5-sulfanylidene-1h-1,2,4-triazol-3-yl)phenyl]iminohydrazinyl]phenyl]-1h-1,2,4-triazole-5-thione 5472009 NSC715974 resistant
hsa-miR-10a-5p 4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1H-2-benzofuran-1-yl)-N-[3-(trifluoromethyl)phenyl]butanamide 369471 NSC641241 resistant
hsa-miR-10a-5p 5'-chloro-2'-methoxy-3-nitrosalicylanilide 186169 NSC79459 resistant
hsa-miR-10a-5p 5,6-dimethoxy-9-(methylthio)furo[3',4':4,5]cyclopenta[1,2,3-ij]isoquinoline 363754 NSC628946 resistant
hsa-miR-10a-5p 5,6,7-trimethoxy-N-(4H-pyrazolo[1,5-a]indol-2-yl)-1H-indole-2-carboxamide 404173 NSC720326 resistant
hsa-miR-10a-5p 6-(chloromethyl)-2-oxo-N-pentylchromene-3-carboxamide 402500 NSC716526 sensitive
hsa-miR-10a-5p 6-methoxy-1h-pyrazolo[3,4-b]quinoxalin-3-amine 395806 NSC700694 resistant
hsa-miR-10a-5p 6,7-diacetoxyisoflavan 353129 NSC600289 resistant
hsa-miR-10a-5p 8-[(4-tert-butylphenoxy)methyl]-1,3-dimethyl-7H-purine-2,6-dione 235292 NSC36525 resistant
hsa-miR-10a-5p 8455ab 1549990 NSC24189 resistant
hsa-miR-10a-5p 8b-hydroxy-9b,10b-epoxyverrucarin a 5351311 NSC328166 resistant
hsa-miR-10a-5p Antibiotic p 168 5477807 NSC356885 resistant
hsa-miR-10a-5p Antineoplastic-656904 376224 NSC656904 resistant
hsa-miR-10a-5p Aquatris(1,3-diphenylpropane-1,3-dionato)neodymium(iii) 24202395 NSC647040 resistant
hsa-miR-10a-5p Bas100 monohydrate 45028404 NSC742554 resistant
hsa-miR-10a-5p Berberine iodide 72350 NSC150446 resistant
hsa-miR-10a-5p Bindschedler's green 73516 NSC7811 resistant
hsa-miR-10a-5p Bisarylpurine 45028308 NSC742146 resistant
hsa-miR-10a-5p Bisarylpurine 45028308 NSC742146 resistant
hsa-miR-10a-5p C4, carbonyl, ethyl prodigiosine 135540855 NSC742416 resistant
hsa-miR-10a-5p Cgp 57380 11644425 NSC741567 sensitive
hsa-miR-10a-5p Cinerubin a hcl 5458466 NSC243022 sensitive
hsa-miR-10a-5p Cis-dichlorobis(4-methoxyphenethylamine)platinum(ii) 498558 NSC631305 resistant
hsa-miR-10a-5p Cis-difluorobis(1-phenylhexane-1,3-dionato)titanium(iv) NSC637220 resistant
hsa-miR-10a-5p Cyano-[4-[[[3-(trifluoromethyl)phenyl]methylamino]carbamoyl]pyridin-1-ium-1-yl]boron 6334922 NSC698276 resistant
hsa-miR-10a-5p Cytembena 23663958 NSC104801 resistant
hsa-miR-10a-5p Cytovaricin 5477715 NSC349622 resistant
hsa-miR-10a-5p Diethyl 2-[[4-[[[3-ethoxycarbonyl-7-(trifluoromethyl)quinoxalin-2-yl]amino]methyl]benzoyl]amino]pentanedioate 390810 NSC688812 resistant
hsa-miR-10a-5p Diisopropoxybis(1,4-naphthochinone-2-olato)titanium(iv) 368058 NSC638383 resistant
hsa-miR-10a-5p Echinomycin 3197 NSC526417 resistant
hsa-miR-10a-5p Ethyl 2-((4-(2-methyl-4-oxo-3(4h)-quinazolinyl)phenyl)hydrazono)-3-oxobutanoate 135494007 NSC691084 resistant
hsa-miR-10a-5p Ethyl 2-((4-(6-bromo-2-methyl-4-oxo-3(4h)-quinazolinyl)phenyl)hydrazono)-3-oxobutanoate 135494008 NSC691085 resistant
hsa-miR-10a-5p Ethyl 5-amino-4-(3,4-dihydro-2h-1,5-benzodioxepin-7-ylamino)-2-methylsulfanylthieno[2,3-d]pyrimidine-6-carboxylate 399955 NSC711107 resistant
hsa-miR-10a-5p From combretum caffrum plant 5386397 NSC609397 resistant
hsa-miR-10a-5p Kuc100204 378309 NSC660313 resistant
hsa-miR-10a-5p Lddhtajmmdseme-okkqscsosa-n 6712634 NSC702655 sensitive
hsa-miR-10a-5p Ls-77867 395636 NSC700418 resistant
hsa-miR-10a-5p Methyl (1s,10r)-6-methyl-10-nonyl-7,9,12-triazatricyclo[6.3.1.04,12]dodeca-5,8-diene-5-carboxylate 401693 NSC715423 resistant
hsa-miR-10a-5p Methyl 3-butylsulfanyl-2-[[(e)-3-(6-methyl-2,4-dioxo-1h-pyrimidin-5-yl)prop-2-enoyl]amino]propanoate 5383838 NSC201241 resistant
hsa-miR-10a-5p Mggh 5351153 NSC32946 resistant
hsa-miR-10a-5p N-[2-chloro-5-(trifluoromethyl)phenyl]-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1h-2-benzofuran-1-yl)butanamide 369469 NSC641239 resistant
hsa-miR-10a-5p N-[3-bromo-6-oxo-1-(4-phenylpiperidin-1-yl)-4,5-dihydrocyclopenta[c]thiophen-4-yl]-2,2,2-trifluoroacetamide 378804 NSC662123 resistant
hsa-miR-10a-5p NSC657492 NSC657492 sensitive
hsa-miR-10a-5p NSC751830 NSC751830 sensitive
hsa-miR-10a-5p Plumericin 5281545 NSC112152 resistant
hsa-miR-10a-5p Propan-2-yl (1r,9s,12e)-3,4,6-trimethoxy-11-[(4-methoxyphenyl)methyl]-5-methyl-10-oxo-12-[(2,4,5-trimethoxy-3-methylphenyl)methylidene]-11,13-diazatricyclo[7.3.1.02,7]trideca-2(7),3,5-triene-13-carbox 6330789 NSC622075 resistant
hsa-miR-10a-5p Resorufin 69462 NSC12097 resistant
hsa-miR-10a-5p Rhamnazin 5320945 NSC678106 resistant
hsa-miR-10a-5p Roridin a, 8-hydroxy-9b,10b-epoxy- 5458716 NSC327993 resistant
hsa-miR-10a-5p Sb-236687 17892742 NSC756422 sensitive
hsa-miR-10a-5p Sergeolide,desacetyl 125729 NSC364170 resistant
hsa-miR-10a-5p Sodium;4-[[(5s,8ar)-9-(4-hydroxy-3,5-dimethoxyphenyl)-8-oxo-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[5,6-f][1,3]benzodioxol-5-yl]amino]benzoic acid 54612576 NSC651853 resistant
hsa-miR-10a-5p Tert-butyl n-[6-[2-[(2-amino-2-oxoethyl)carbamoyl]pyrrolidin-1-yl]-5-(9h-fluoren-9-ylmethoxycarbonylamino)-6-oxohexyl]carbamate 383818 NSC672434 sensitive
hsa-miR-10a-5p Tetra(isobutenyl)antimony bromide NSC651199 resistant
hsa-miR-10a-5p Tributylgermyl 2-acetoxy-2-phenyl-acetate 16683233 NSC645575 resistant
hsa-miR-10a-5p Verrucarin a 9,10-epoxide 5358836 NSC283445 sensitive
hsa-miR-10a-5p Z28714792 2671841 NSC746248 resistant
hsa-miR-10a-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-10a-5p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-10a-5p Verapamil 2520 NSC272366 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-10a-5p Imatinib 5291 NSC743414 approved resistant High Myelogenous Leukemia cell line (MYL)
hsa-miR-10a-5p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7, LY2)
hsa-miR-10a-5p Cyclopamine 442972 NSC734950 sensitive Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Esophageal Squamous Cell Carcinoma tissue and cell line (TE1, TE5, TE8, TE9, TE10, TE11, TE13)
hsa-miR-10a-5p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (PaCa-2)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer tissue
hsa-miR-10a-5p Vinorelbine 44424639 approved resistant High Non-Small Cell Lung Cancer tissue
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (H358, H1993)
hsa-miR-10a-5p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-miR-10a-5p Cytarabine 6253 NSC287459 approved sensitive Low Acute Myeloid Leukemia tissue and cell line (KG-1a, Kasumi-1, K562, OCI-AML3)
hsa-miR-10a-5p Doxorubicin 31703 NSC123127 approved resistant High Gastric Cancer cell line (SGC7901)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-10a-5p Doxorubicin 31703 NSC123127 approved resistant Low Acute Myeloid Leukemia tissue and cell line (HL-60)
hsa-miR-10a-5p Sorafenib 216239 NSC747971 approved resistant Low Hepatocellular Carcinoma cell line (HepG2, Huh-7)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-10a-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Small Cell Lung Cancer cell line (H446)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive High Pancreatic Cancer cell line (BxPC-3)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-miR-10a-5p Gefitinib 123631 NSC715055 approved sensitive High Non-Small Cell Lung Cancer cell line (HCC827)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-10a-5p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia tissue
hsa-miR-10a-5p Temozolomide 5394 NSC362856 approved resistant Low Glioblastoma cell line (U87)
hsa-miR-10a-5p Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-10a-5p Fluorouracil 3385 NSC19893 approved sensitive High Colorectal Cancer cell line (HT-29)
hsa-miR-10a-5p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-10a-5p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-miR-10a-5p Oxaliplatin 6857599 NSC266046 approved resistant Low Colorectal Cancer cell line (SW480, HCT-116)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant Low Non-Small Cell Lung Cancer cell line (A549, H1299)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved sensitive High Ovarian Cancer cell line (W1)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved sensitive High Endometrial Serous Carcinoma cell line (USPC1)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive Low Hepatocellular Carcinoma cell line (Huh-7)
hsa-miR-10a-5p Gefitinib 123631 NSC715055 approved sensitive Low Esophageal Squamous Cell Carcinoma cell line (TE1, KYSE450)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer cell line (SKOV3ip1, HeyA8)
hsa-miR-10a-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer tissue
hsa-miR-10a-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-10a-5p Temozolomide 5394 NSC362856 approved resistant High Glioblastoma cell line (A172)
hsa-miR-10a-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-10a-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-10a-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (A375)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (mitochondrial RNA)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (cytosolic RNA)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (total RNA)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-10a-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (HeyA8)
hsa-miR-10a-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM17)
hsa-miR-10a-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-10a-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (HS578T)
hsa-miR-10a-5p Tamoxifen 2733525 NSC180973 approved resistant cell line (LCC2)
hsa-miR-10a-5p Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-miR-10a-5p Ribavirin+Pegylated IFNa-2b resistant tissue (chronic hepatitis C)
hsa-miR-10a-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-10a-5p 4-Hydroxytamoxifen+Tamoxifen resistant cell line (LY2)
hsa-miR-10a-5p Ethanol+Tamoxifen resistant cell line (LY2)
hsa-miR-10a-5p Methotrexate 126941 NSC740 approved sensitive cell line (HT29)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-10a-5p Pegylated interferon alpha+Ribavirin resistant tissue (chronic hepatitis C)
hsa-miR-10a-5p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (IGROV-1)
hsa-miR-10a-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-10a-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-10a-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)
hsa-miR-10a-5p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (H460)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-10a-5p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine resistant cell line (Bats-72)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (TOV-112D)

Error report submission