miRTarBase - #MIRT006571


—
pre-miRNA Information
pre-miRNA hsa-mir-133a-1   
Genomic Coordinates chr18: 21825698 - 21825785
Synonyms MIRN133A1, MIR133A1
Description Homo sapiens miR-133a-1 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-133a-2   
Genomic Coordinates chr20: 62564912 - 62565013
Synonyms MIRN133A2, MIR133A2
Description Homo sapiens miR-133a-2 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-133a-3p
Sequence 53| UUUGGUCCCCUUCAACCAGCUG |74
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30104664 8 COSMIC
COSN30455205 8 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs369575411 9 dbSNP
rs746815210 11 dbSNP
rs1382873526 13 dbSNP
rs553267926 15 dbSNP
rs1172821195 16 dbSNP
rs182673735 19 dbSNP
rs781929120 20 dbSNP
rs1296628341 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B2TV7U miR-133a Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Plasma .
B2TV7U miR-133a Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Muscle Reverse transcription-polymerase chain reaction
B2TV7U miR-133a Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Plasma Real-time reverse transcription PCR
B2TV7U miR-133a Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Serum Real-time polymerase chain reaction
Gene Information
Gene Symbol PNP   
Synonyms NP, PRO1837, PUNP
Description purine nucleoside phosphorylase
Transcript NM_000270   
Expression
Putative miRNA Targets on PNP
3'UTR of PNP
(miRNA target sites are highlighted)		 
>PNP|NM_000270|3'UTR
   1 CCTGCCTTGGAGTCGTCTGGCATCTCCCACACAAGACCCAAGTAGCTGCTACCTTCTTTGGCCCCTTGCTGGAGTCATGT
  81 GCCTCTGTCCTTAGGTTGTAGCAGAAAGGAAAAGATTCCTGTCCTTCACCTTTCCCACTTTCTTCTACCAGACCCTTCTG
 161 GTGCCAGATCCTCTTCTCAAAGCTGGGATTACAGGTGTGAGCATAGTGAGACCTTGGCGCTACAAAATAAAGCTGTTCTC
 241 ATTCCTGTTCTTTCTTACACAAGAGCTGGAGCCCGTGCCCTACCACACATCTGTGGAGATGCCCAGGATTTGACTCGGGC
 321 CTTAGAACTTTGCATAGCAGCTGCTACTAGCTCTTTGAGATAATACATTCCGAGGGGCTCAGTTCTGCCTTATCTAAATC
 401 ACCAGAGACCAAACAAGGACTAATCCAATACCTCTTGGATTTTATTTAATGTCATAATGTTGTCAGAATAAAGAGAAAGA
 481 TGAAATAATTTCATTTTTTTGTGTAACTTGGTATGGGGCTGGGGCACAGACCAAGATTGACATGAAAGGATGTGAGATCG
 561 CATGTCTTGTGTGACTATCTGCTTCTCAGACAAGCAGTTAGGAACTGAGATGAGATAGTATGTGAGGGCAGCAAAGGATG
 641 AAGAAGGGCAAAATGATGAAAGGTGAGGTGGAAAGAGGTTATGAGATGGTAAAGAAAAGTTAACTTCTGGCACTTGATTG
 721 CCACTTCTGTCAGGCTGGTCCTGCCTCTCTCCCTTGCCTTCTGATTGTTTCATTTCCTGTTTATTTGATCATATCTGAAT
 801 TAGTTCACTGGTTAGCCTCTTCCTTAGTTCCCACTTCCTTACCAAAGCCCTAATTATATTTCCTCTTGTTTGCCTTTTCT
 881 CTCCTACTCTTCTCTAACATCTGCAGCCACACTCTCCATTCACTCCATGCTGACAAGGCAGTGGCAAACACTTTTCTCTG
 961 CTGCCAGCCACTCCACTGTTGACTGGATTGCTGCCAGCCCCAGGCAAACCTGTGAAGTTGTTTCATACTCTGCTTCTCTT
1041 TGAGTGCCTCCTTCTCTCCTTCCTCTTCCTTTCTGGGCTCCAGTCTTTCTCTTCACTTGTGCTTGTCAGAACCTCCCTGT
1121 GATACTGCCTCCAGGCATTTCCCCCATGTTGGCTCACCGCACTATTATCTTTGCTTATCAACTTGCATTCAGCTGGCTGG
1201 CATGTTTCAAAACCACACTGCCCTCCCAGGCCTGTGTGCCTTTTGAGAAAGACCAGTGCTGGATGAGCCTCTAGTAATGA
1281 CAACATTTTAGTTGTTAGTGGTATAATACGGAAGAGATATTTTGCACAGGCTGCTTTGGAGAACTTTCAAATTATCCTTT
1361 GTTTGGTAACTGACCTACTTAACTGCCCAATACAAAGAAAAAGCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gucgaccaacuuccCCUGGUUu 5'
                        ||||:|| 
Target 5' cagagaccaaacaaGGACTAAt 3'
 403 - 424 124.00 -8.05
2 
miRNA  3' gucgaccaacuucccCUGGUUu 5'
                         |||||| 
Target 5' tggggctggggcacaGACCAAg 3'
 514 - 535 120.00 -15.84
3 
miRNA  3' gucgaCCAACUUC-CCCUGGUUu 5'
               || |||||  ||:| || 
Target 5' gcaaaGGATGAAGAAGGGCAAAa 3'
 631 - 653 113.00 -13.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
881209 16 ClinVar
881210 79 ClinVar
881211 179 ClinVar
312737 214 ClinVar
312738 255 ClinVar
312739 275 ClinVar
881676 317 ClinVar
312740 318 ClinVar
312741 373 ClinVar
881677 373 ClinVar
312742 484 ClinVar
COSN31587234 5 COSMIC
COSN30151887 21 COSMIC
COSN20085279 34 COSMIC
COSN30512115 45 COSMIC
COSN30187487 61 COSMIC
COSN31480965 105 COSMIC
COSN28795066 118 COSMIC
COSN30511821 144 COSMIC
COSN31575497 174 COSMIC
COSN19462353 481 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs778150398 2 dbSNP
rs1177300031 3 dbSNP
rs931229423 5 dbSNP
rs1201647522 6 dbSNP
rs749760621 11 dbSNP
rs771220552 12 dbSNP
rs375289878 15 dbSNP
rs201497504 16 dbSNP
rs768488828 18 dbSNP
rs1280917149 31 dbSNP
rs776408969 32 dbSNP
rs761420050 33 dbSNP
rs367615281 38 dbSNP
rs371711940 39 dbSNP
rs1201723475 43 dbSNP
rs372200673 52 dbSNP
rs535741893 54 dbSNP
rs569036203 79 dbSNP
rs766791132 81 dbSNP
rs1329532404 98 dbSNP
rs772541140 101 dbSNP
rs1335086842 108 dbSNP
rs1332490675 109 dbSNP
rs866626659 115 dbSNP
rs902244094 119 dbSNP
rs999050537 122 dbSNP
rs566125117 130 dbSNP
rs754229427 135 dbSNP
rs754595756 140 dbSNP
rs764882608 143 dbSNP
rs1237370808 149 dbSNP
rs940627229 155 dbSNP
rs1199011314 159 dbSNP
rs1460746671 167 dbSNP
rs1036184563 169 dbSNP
rs1202175780 170 dbSNP
rs1261167230 170 dbSNP
rs1347907855 174 dbSNP
rs1278459556 175 dbSNP
rs76571622 179 dbSNP
rs1378696133 180 dbSNP
rs949202515 183 dbSNP
rs1404445019 193 dbSNP
rs1339189856 197 dbSNP
rs1045141311 211 dbSNP
rs1384280116 213 dbSNP
rs151283499 214 dbSNP
rs1455444776 219 dbSNP
rs987189241 220 dbSNP
rs912675762 224 dbSNP
rs111742618 226 dbSNP
rs1000846561 229 dbSNP
rs182309640 236 dbSNP
rs892708636 241 dbSNP
rs972582182 248 dbSNP
rs7785 255 dbSNP
rs1019775744 264 dbSNP
rs1355301390 266 dbSNP
rs1244794534 270 dbSNP
rs965475737 273 dbSNP
rs555762832 275 dbSNP
rs1449340472 276 dbSNP
rs139143167 281 dbSNP
rs112999633 282 dbSNP
rs1316908133 290 dbSNP
rs1421582089 297 dbSNP
rs1028668713 298 dbSNP
rs1163100436 305 dbSNP
rs1422991750 313 dbSNP
rs1383102239 317 dbSNP
rs747293719 318 dbSNP
rs1473027469 332 dbSNP
rs1241433416 334 dbSNP
rs374918316 336 dbSNP
rs540948092 348 dbSNP
rs1191020134 349 dbSNP
rs949102483 352 dbSNP
rs1263287892 362 dbSNP
rs1221210520 366 dbSNP
rs1356863032 367 dbSNP
rs1046081803 372 dbSNP
rs149943917 373 dbSNP
rs557920251 378 dbSNP
rs1268934600 380 dbSNP
rs1402404491 382 dbSNP
rs1341150641 393 dbSNP
rs1049700 395 dbSNP
rs1395745044 397 dbSNP
rs999272678 399 dbSNP
rs1327790635 400 dbSNP
rs1031845614 406 dbSNP
rs908899578 412 dbSNP
rs893273286 415 dbSNP
rs1166027647 422 dbSNP
rs1478773545 425 dbSNP
rs577756245 428 dbSNP
rs1198024375 429 dbSNP
rs1439444859 447 dbSNP
rs1489664402 455 dbSNP
rs1298812640 465 dbSNP
rs1327799487 476 dbSNP
rs940610030 479 dbSNP
rs186060210 484 dbSNP
rs1028598605 486 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Nohata N; Hanazawa T; Kikkawa N; Sakurai D; et al.
- International journal of oncology, 2011
Based on our microRNA (miRNA) expression signature analysis of maxillary sinus squamous cell carcinoma (MSSCC), we found that miR-1 and miR-133a were significantly reduced in tumor tissues. Quantitative real-time RT-PCR revealed that the expression levels of miR-1 and miR-133a were significantly downregulated in clinical MSSCC tumor tissues compared with normal tissues. We focused on the functional significance of miR-1 and miR-133a in cancer cells and identification of the novel cancer networks regulated by these miRNAs in MSSCC. Restoration of downregulated miRNAs (miR-1 or miR-133a) in cancer cells revealed that both miRNAs significantly inhibited cancer cell proliferation and induced cell apoptosis. Molecular target identification of these miRNAs showed that transgelin 2 (TAGLN2) and purine nucleoside phosphorylase (PNP) were regulated by miR-1 and miR-133a. Both TAGLN2 and PNP mRNA expression levels were significantly upregulated in clinical MSSCC tumor tissues. Silencing studies of target genes demonstrated that both genes inhibited cancer cell proliferation. The identification of novel miR-1/miR-133a-regulated cancer pathways could provide new insights into potential molecular mechanisms of MSSCC oncogenesis.
LinkOut: [PMID: 21701775]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions PC3 , DU145
Location of target site 3'UTR
Tools used in this research miRBase Target Database , TargetScan
Original Description (Extracted from the article) ... PNP as a target of post-transcriptional repression by miR-1 and miR-133a ...

- Kojima S; Chiyomaru T; Kawakami K; Yoshino et al., 2012, British journal of cancer.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gucgaccaacuucccCUGGUUu 5'
                         |||||| 
Target 5' aucuaaaucaccagaGACCAAa 3'
 		1 - 22
Article - Kojima S; Chiyomaru T; Kawakami K; Yoshino et al.
- British journal of cancer, 2012
BACKGROUND: Our recent analyses of miRNA expression signatures showed that miR-1 and miR-133a were significantly reduced in several types of cancer. Interestingly, miR-1 and miR-133a are located on the same chromosomal locus in the human genome. We examined the functional significance of miR-1 and miR-133a in prostate cancer (PCa) cells and identified the novel molecular targets regulated by both miR-1 and miR-133a. METHODS AND RESULTS: The expression levels of miR-1 and miR-133a were significantly downregulated in PCa compared with non-PCa tissues. Restoration of miR-1 or miR-133a in PC3 and DU145 cells revealed significant inhibition of proliferation, migration, and invasion. Molecular target identification by genome-wide gene expression analysis and luciferase reporter assay showed that purine nucleoside phosphorylase (PNP) was directly regulated by both miRNAs. Silencing of the PNP gene inhibited proliferation, migration, and invasion in both PC3 and DU145 cells. Immunohistochemistry detected positive staining of PNP in PCa specimens. CONCLUSIONS: Downregulation of miR-1 and miR-133a was a frequent event in PCa and both function as tumour suppressors. The PNP is a novel target gene of both miRNAs and potentially functions as an oncogene. Therefore, identification of novel molecular networks regulated by miRNAs may provide new insights into the underlying causes of PCa oncogenesis.
LinkOut: [PMID: 22068816]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
UCEC 0.726 0 0.247 0.15 19 Click to see details
STAD -0.477 0 -0.587 0 32 Click to see details
BLCA -0.506 0.02 -0.311 0.1 18 Click to see details
PRAD -0.288 0.02 -0.197 0.09 50 Click to see details
LUSC 0.256 0.06 0.320 0.03 38 Click to see details
KICH -0.283 0.09 -0.077 0.36 24 Click to see details
BRCA -0.146 0.1 -0.028 0.4 77 Click to see details
ESCA -0.368 0.13 -0.391 0.12 11 Click to see details
LIHC 0.137 0.17 0.114 0.22 49 Click to see details
KIRP 0.15 0.21 0.099 0.3 30 Click to see details
PCPG 0.746 0.23 0.500 0.33 3 Click to see details
COAD -0.245 0.28 -0.286 0.25 8 Click to see details
CESC 0.639 0.28 0.500 0.33 3 Click to see details
CHOL 0.203 0.3 0.000 0.5 9 Click to see details
THCA 0.047 0.36 0.037 0.39 59 Click to see details
HNSC -0.055 0.36 0.039 0.4 42 Click to see details
KIRC 0.037 0.38 0.043 0.36 67 Click to see details
PAAD -0.14 0.43 -0.200 0.4 4 Click to see details
LUAD -0.043 0.45 0.063 0.42 12 Click to see details
LUAD -0.043 0.45 0.063 0.42 12 Click to see details
LUAD -0.043 0.45 0.063 0.42 12 Click to see details
122 hsa-miR-133a-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000325 RHOA ras homolog family member A 1 2
MIRT000327 CDC42 cell division cycle 42 4 2
MIRT000328 ERG ERG, ETS transcription factor 1 1
MIRT000329 HCN4 hyperpolarization activated cyclic nucleotide gated potassium channel 4 2 1
MIRT000330 UCP2 uncoupling protein 2 2 2
MIRT000331 KRT7 keratin 7 2 2
MIRT001203 CACNA1C calcium voltage-gated channel subunit alpha1 C 3 1
MIRT001204 HCN2 hyperpolarization activated cyclic nucleotide gated potassium and sodium channel 2 4 2
MIRT001816 PKM pyruvate kinase, muscle 1 1
MIRT001986 CASP9 caspase 9 3 3
MIRT002925 KCNQ1 potassium voltage-gated channel subfamily Q member 1 4 1
MIRT003542 FSCN1 fascin actin-bundling protein 1 5 4
MIRT004831 KCNH2 potassium voltage-gated channel subfamily H member 2 4 1
MIRT005604 TAGLN2 transgelin 2 5 4
MIRT005813 LASP1 LIM and SH3 protein 1 3 2
MIRT006571 PNP purine nucleoside phosphorylase 4 2
MIRT006680 MSN moesin 2 1
MIRT007032 EGFR epidermal growth factor receptor 3 5
MIRT007088 VKORC1 vitamin K epoxide reductase complex subunit 1 1 1
MIRT007383 PRDM16 PR/SET domain 16 1 2
MIRT021693 TPM1 tropomyosin 1 1 1
MIRT021695 FBN1 fibrillin 1 1 1
MIRT021696 FAM120C family with sequence similarity 120C 1 1
MIRT021697 BCAN brevican 1 1
MIRT021698 TCTEX1D2 Tctex1 domain containing 2 1 1
MIRT021699 ARL6IP1 ADP ribosylation factor like GTPase 6 interacting protein 1 1 1
MIRT021700 RFT1 RFT1 homolog 1 1
MIRT021701 SENP1 SUMO1/sentrin specific peptidase 1 1 1
MIRT021702 SMIM14 small integral membrane protein 14 1 1
MIRT021703 PRELID1 PRELI domain containing 1 1 1
MIRT021704 CNN2 calponin 2 3 3
MIRT021705 ARPC5 actin related protein 2/3 complex subunit 5 4 2
MIRT021706 FTL ferritin light chain 2 2
MIRT021707 CERS2 ceramide synthase 2 1 1
MIRT021708 SEC61B Sec61 translocon beta subunit 1 1
MIRT021709 PLEKHA3 pleckstrin homology domain containing A3 1 1
MIRT021710 EGFL7 EGF like domain multiple 7 1 1
MIRT021711 VEGFA vascular endothelial growth factor A 1 1
MIRT021712 PIK3R2 phosphoinositide-3-kinase regulatory subunit 2 1 1
MIRT021713 RGS3 regulator of G protein signaling 3 1 1
MIRT021714 COL1A1 collagen type I alpha 1 chain 4 1
MIRT021715 GSTP1 glutathione S-transferase pi 1 2 1
MIRT035537 SP1 Sp1 transcription factor 2 2
MIRT035579 KLF15 Kruppel like factor 15 1 1
MIRT045837 NR4A2 nuclear receptor subfamily 4 group A member 2 1 1
MIRT052647 BCL2L1 BCL2 like 1 4 2
MIRT052648 MCL1 MCL1, BCL2 family apoptosis regulator 4 2
MIRT053333 RFFL ring finger and FYVE like domain containing E3 ubiquitin protein ligase 4 1
MIRT054310 IGF1R insulin like growth factor 1 receptor 3 2
MIRT055599 FAM160B1 family with sequence similarity 160 member B1 2 2
MIRT081957 UBA2 ubiquitin like modifier activating enzyme 2 4 1
MIRT437400 MMP14 matrix metallopeptidase 14 3 1
MIRT437953 ANXA2 annexin A2 4 1
MIRT437954 SNX30 sorting nexin family member 30 4 1
MIRT437955 SGMS2 sphingomyelin synthase 2 4 1
MIRT438719 PDLIM5 PDZ and LIM domain 5 3 1
MIRT452802 PACS2 phosphofurin acidic cluster sorting protein 2 2 2
MIRT462823 BCL3 B-cell CLL/lymphoma 3 2 2
MIRT468494 SESN2 sestrin 2 2 2
MIRT477714 EFHD2 EF-hand domain family member D2 2 2
MIRT483852 EMID1 EMI domain containing 1 2 2
MIRT490039 PRRT2 proline rich transmembrane protein 2 2 2
MIRT491349 CDKN1A cyclin dependent kinase inhibitor 1A 2 4
MIRT504443 MC2R melanocortin 2 receptor 2 2
MIRT505701 SESN3 sestrin 3 2 2
MIRT513521 RHOQ ras homolog family member Q 2 4
MIRT517423 HIST2H2AC histone cluster 2 H2A family member c 2 2
MIRT526599 DCAKD dephospho-CoA kinase domain containing 2 2
MIRT528904 THBS2 thrombospondin 2 2 2
MIRT533060 ZBTB37 zinc finger and BTB domain containing 37 2 2
MIRT534126 SNX33 sorting nexin 33 2 2
MIRT534700 RNF103-CHMP3 RNF103-CHMP3 readthrough 2 4
MIRT535732 MYPN myopalladin 2 2
MIRT538529 CHMP3 charged multivesicular body protein 3 2 4
MIRT550878 IBA57 IBA57 homolog, iron-sulfur cluster assembly 2 2
MIRT551260 PSMG1 proteasome assembly chaperone 1 2 2
MIRT551981 UGT2B10 UDP glucuronosyltransferase family 2 member B10 2 2
MIRT553866 SYAP1 synapse associated protein 1 2 2
MIRT558810 CDK5R1 cyclin dependent kinase 5 regulatory subunit 1 2 2
MIRT559367 ATP13A3 ATPase 13A3 2 2
MIRT560941 ZFP28 ZFP28 zinc finger protein 2 2
MIRT565461 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 2 2
MIRT566234 PTMA prothymosin, alpha 2 2
MIRT568217 C11orf24 chromosome 11 open reading frame 24 2 2
MIRT608912 NCDN neurochondrin 2 6
MIRT613229 CCDC39 coiled-coil domain containing 39 2 2
MIRT623563 ITPKB inositol-trisphosphate 3-kinase B 2 2
MIRT637224 TMEM59 transmembrane protein 59 2 2
MIRT641669 CCNI cyclin I 2 2
MIRT644440 ALDOC aldolase, fructose-bisphosphate C 2 2
MIRT644755 TXNRD3NB thioredoxin reductase 3 neighbor 2 2
MIRT646711 PDE1A phosphodiesterase 1A 2 2
MIRT647577 RBMXL1 RNA binding motif protein, X-linked like 1 2 2
MIRT647760 RNF168 ring finger protein 168 2 2
MIRT649267 C17orf64 chromosome 17 open reading frame 64 2 2
MIRT651238 ZMAT4 zinc finger matrin-type 4 2 2
MIRT652146 TRIM71 tripartite motif containing 71 2 2
MIRT657168 IP6K1 inositol hexakisphosphate kinase 1 2 2
MIRT668302 FOSL2 FOS like 2, AP-1 transcription factor subunit 2 2
MIRT687546 MLEC malectin 2 2
MIRT690857 PLEKHG2 pleckstrin homology and RhoGEF domain containing G2 2 2
MIRT697060 PSMC4 proteasome 26S subunit, ATPase 4 2 2
MIRT699725 SERPINH1 serpin family H member 1 2 2
MIRT700858 PER2 period circadian clock 2 2 2
MIRT705068 C4orf29 abhydrolase domain containing 18 2 2
MIRT709496 ANGPT4 angiopoietin 4 2 2
MIRT713925 PIGR polymeric immunoglobulin receptor 2 2
MIRT716058 SFTPB surfactant protein B 2 2
MIRT716724 APOL6 apolipoprotein L6 2 2
MIRT721677 CMTM4 CKLF like MARVEL transmembrane domain containing 4 2 2
MIRT723379 NFAM1 NFAT activating protein with ITAM motif 1 2 2
MIRT731340 IGF1 insulin like growth factor 1 1 1
MIRT731591 ZEB1 zinc finger E-box binding homeobox 1 1 1
MIRT732526 PTBP1 polypyrimidine tract binding protein 1 2 0
MIRT732527 KDM5C lysine demethylase 5C 2 0
MIRT732589 BCL2 BCL2, apoptosis regulator 2 0
MIRT732590 CASP3 caspase 3 2 0
MIRT733594 PPP2CA protein phosphatase 2 catalytic subunit alpha 3 0
MIRT735355 MB myoglobin 1 0
MIRT735744 CDCA8 cell division cycle associated 8 3 0
MIRT736984 SET SET nuclear proto-oncogene 1 0
MIRT737550 TGFB1 transforming growth factor beta 1 4 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-133a Catechin approved 9064 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-133a Proanthocyanin NULL 108065 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-133a Sulfonyl-hydrazone-1 (SHZ) NULL NULL Quantitative real-time PCR Murine broblast-derived Induced pluripotent stem cells 21445862 2011 up-regulated
miR-133a Atorvastatin approved 60823 Quantitative real-time PCR Cardiomyocyte 23860036 2013 down-regualted
miR-133a Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 down-regulated
miR-133a Glucose NULL 5793 Microarray endothelial cells 24394957 2014 up-regulated
miR-133a Benzene NULL 241 MiRNA PCR array white blood cell 24780745 2014 down-regulated
miR-133a Benzene NULL 241 MiRNA PCR array blood mononuclear cells 24780745 2014 down-regulated
miR-133a Ibandronate approved 60852 Quantitative real-time PCR Periodontal ligament stem cells (PDLSCs) 21108928 2011 down-regulated
miR-133a 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-133a Temozolomide approved 5394 Quantitative real-time PCR glioblastoma cells. 22722712 2012 up-regulated
miR-133a Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 down-regulated
miR-133a Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 up-regulated
miR-133a Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 down-regulated
miR-133a 5-Fluorouracil approved 3385 Quantitative real-time PCR colon cancer cells 17702597 2007 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-133a-3p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-133a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-133a-3p Doxorubicin 31703 NSC123127 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-133a-3p Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (H358, H1993)
hsa-miR-133a-3p Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (H1155, H358, H1993)
hsa-miR-133a-3p Sunitinib 5329102 NSC750690 approved resistant High Metastatic Renal Cell Carcinoma tissue and cell line (Caki-2)
hsa-miR-133a-3p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-miR-133a-3p Paclitaxel 36314 NSC125973 approved resistant Low Esophageal Squamous Cell Carcinoma tissue
hsa-miR-133a-3p Doxorubicin 31703 NSC123127 approved sensitive Low Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-133a-3p Doxorubicin 31703 NSC123127 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-133a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-133a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-133a-3p Fluorouracil 3385 NSC19893 approved sensitive Low Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-133a-3p Fluorouracil 3385 NSC19893 approved sensitive Low Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-133a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Head And Neck Squamous Cell Carcinoma cell line (Hep-2, NP69)
hsa-miR-133a-3p Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer tissue
hsa-miR-133a-3p Doxorubicin 31703 NSC123127 approved sensitive High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-133a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Urothelial Bladder Cancer cell line (T24)
hsa-miR-133a-3p Gemcitabine 60750 NSC613327 approved sensitive Low Urothelial Bladder Cancer cell line (T24)
hsa-miR-133a-3p Paclitaxel 36314 NSC125973 approved resistant Low Prostate Cancer cell line (PC-3-R)
hsa-miR-133a-3p Fluorouracil 3385 NSC19893 approved sensitive Low Nasopharyngeal Cancer cell line (HONE1, SUNE1)
hsa-miR-133a-3p Fluorouracil 3385 NSC19893 approved resistant High Gastric Cancer cell line (MGC-803)
hsa-miR-133a-3p Bromocriptine 31101 NSC169774 approved resistant Low Prolactinoma tissue
hsa-miR-133a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-133a-3p Gefitinib 123631 NSC715055 approved sensitive Low Non-Small Cell Lung Cancer cell line (PC-9)
hsa-miR-133a-3p Doxorubicin 31703 NSC123127 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-miR-133a-3p Paclitaxel 36314 NSC125973 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-miR-133a-3p Etoposide 36462 NSC141540 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-miR-133a-3p Vinorelbine 44424639 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-miR-133a-3p Vincristine 5978 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-miR-133a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer cell line (SKOV3, A2780)
hsa-miR-133a-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-133a-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-133a-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-133a-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-133a-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-133a-3p Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-miR-133a-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-133a-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-133a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-133a-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-133a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-133a-3p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine sensitive cell line (Bats-72)

Error report submission