miRTarBase - #MIRT006659


—
pre-miRNA Information
pre-miRNA hsa-mir-132   
Genomic Coordinates chr17: 2049908 - 2050008
Description Homo sapiens miR-132 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-132-3p
Sequence 59| UAACAGUCUACAGCCAUGGUCG |80
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1211938237 4 dbSNP
rs1173831908 7 dbSNP
rs751170675 10 dbSNP
rs1392699403 15 dbSNP
rs1022001830 17 dbSNP
rs1431105016 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BNMH41 miR-132 Pharmacodynamic Biomarker (PDY) Clinical/Experimental Data Concentration Decrease Plasma Quantitative reverse transcription PCR
Gene Information
Gene Symbol HBEGF   
Synonyms DTR, DTS, DTSF, HEGFL
Description heparin binding EGF like growth factor
Transcript NM_001945   
Expression
Putative miRNA Targets on HBEGF
3'UTR of HBEGF
(miRNA target sites are highlighted)		 
>HBEGF|NM_001945|3'UTR
   1 GAGAGACTTGTGCTCAAGGAATCGGCTGGGGACTGCTACCTCTGAGAAGACACAAGGTGATTTCAGACTGCAGAGGGGAA
  81 AGACTTCCATCTAGTCACAAAGACTCCTTCGTCCCCAGTTGCCGTCTAGGATTGGGCCTCCCATAATTGCTTTGCCAAAA
 161 TACCAGAGCCTTCAAGTGCCAAACAGAGTATGTCCGATGGTATCTGGGTAAGAAGAAAGCAAAAGCAAGGGACCTTCATG
 241 CCCTTCTGATTCCCCTCCACCAAACCCCACTTCCCCTCATAAGTTTGTTTAAACACTTATCTTCTGGATTAGAATGCCGG
 321 TTAAATTCCATATGCTCCAGGATCTTTGACTGAAAAAAAAAAAGAAGAAGAAGAAGGAGAGCAAGAAGGAAAGATTTGTG
 401 AACTGGAAGAAAGCAACAAAGATTGAGAAGCCATGTACTCAAGTACCACCAAGGGATCTGCCATTGGGACCCTCCAGTGC
 481 TGGATTTGATGAGTTAACTGTGAAATACCACAAGCCTGAGAACTGAATTTTGGGACTTCTACCCAGATGGAAAAATAACA
 561 ACTATTTTTGTTGTTGTTGTTTGTAAATGCCTCTTAAATTATATATTTATTTTATTCTATGTATGTTAATTTATTTAGTT
 641 TTTAACAATCTAACAATAATATTTCAAGTGCCTAGACTGTTACTTTGGCAATTTCCTGGCCCTCCACTCCTCATCCCCAC
 721 AATCTGGCTTAGTGCCACCCACCTTTGCCACAAAGCTAGGATGGTTCTGTGACCCATCTGTAGTAATTTATTGTCTGTCT
 801 ACATTTCTGCAGATCTTCCGTGGTCAGAGTGCCACTGCGGGAGCTCTGTATGGTCAGGATGTAGGGGTTAACTTGGTCAG
 881 AGCCACTCTATGAGTTGGACTTCAGTCTTGCCTAGGCGATTTTGTCTACCATTTGTGTTTTGAAAGCCCAAGGTGCTGAT
 961 GTCAAAGTGTAACAGATATCAGTGTCTCCCCGTGTCCTCTCCCTGCCAAGTCTCAGAAGAGGTTGGGCTTCCATGCCTGT
1041 AGCTTTCCTGGTCCCTCACCCCCATGGCCCCAGGCCCACAGCGTGGGAACTCACTTTCCCTTGTGTCAAGACATTTCTCT
1121 AACTCCTGCCATTCTTCTGGTGCTACTCCATGCAGGGGTCAGTGCAGCAGAGGACAGTCTGGAGAAGGTATTAGCAAAGC
1201 AAAAGGCTGAGAAGGAACAGGGAACATTGGAGCTGACTGTTCTTGGTAACTGATTACCTGCCAATTGCTACCGAGAAGGT
1281 TGGAGGTGGGGAAGGCTTTGTATAATCCCACCCACCTCACCAAAACGATGAAGTTATGCTGTCATGGTCCTTTCTGGAAG
1361 TTTCTGGTGCCATTTCTGAACTGTTACAACTTGTATTTCCAAACCTGGTTCATATTTATACTTTGCAATCCAAATAAAGA
1441 TAACCCTTATTCCATAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gcuGGUAC-CGACAUCUGACAAu 5'
             :|| | ||  ||||||||| 
Target 5' attTCAAGTGC-CTAGACTGTTa 3'
 661 - 682 154.00 -13.10
2 
miRNA  3' gcUGGUACCGACAUCUGACAAu 5'
            | ||| |  |  ||||||| 
Target 5' ggAACATTGGAGCTGACTGTTc 3'
 1221 - 1242 152.00 -12.30
3 
miRNA  3' gcuggUA-CCGACAUCUGACAAu 5'
               || ||||| :||||| | 
Target 5' aaggaATCGGCTGGGGACTGCTa 3'
 16 - 38 133.00 -16.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN8491943 89 COSMIC
COSN28735248 142 COSMIC
COSN1308284 207 COSMIC
COSN31589954 532 COSMIC
COSN14815613 741 COSMIC
COSN31546028 744 COSMIC
COSN31522005 893 COSMIC
COSN31528959 897 COSMIC
COSN31579942 941 COSMIC
COSN30163271 1088 COSMIC
COSN30163057 1116 COSMIC
COSN22873256 1117 COSMIC
COSN30173501 1157 COSMIC
COSN31609159 1165 COSMIC
COSN31609726 1196 COSMIC
COSN31490712 1363 COSMIC
COSN28794794 1383 COSMIC
COSN31568719 1413 COSMIC
COSN24326157 1475 COSMIC
COSN31547834 1551 COSMIC
COSN14832190 1711 COSMIC
COSN26552000 1716 COSMIC
COSN31584606 1794 COSMIC
rs13385 1383 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs137862325 2 dbSNP
rs11465458 7 dbSNP
rs552184387 7 dbSNP
rs1186278431 8 dbSNP
rs1211485307 10 dbSNP
rs1336079275 12 dbSNP
rs1442494145 12 dbSNP
rs780078115 15 dbSNP
rs1282004511 19 dbSNP
rs745929006 23 dbSNP
rs138811385 24 dbSNP
rs1037787569 27 dbSNP
rs1258507367 38 dbSNP
rs942110934 40 dbSNP
rs1220190847 41 dbSNP
rs757237048 42 dbSNP
rs201635443 44 dbSNP
rs777741511 46 dbSNP
rs1197246638 49 dbSNP
rs566522792 51 dbSNP
rs1258013000 52 dbSNP
rs1458218638 55 dbSNP
rs907908411 56 dbSNP
rs1235933942 78 dbSNP
rs546200975 79 dbSNP
rs1472630841 97 dbSNP
rs774960564 105 dbSNP
rs1419827447 109 dbSNP
rs988627400 110 dbSNP
rs879237166 116 dbSNP
rs1047702061 117 dbSNP
rs1389530083 118 dbSNP
rs935845372 120 dbSNP
rs925743855 126 dbSNP
rs1279716279 128 dbSNP
rs1358181470 130 dbSNP
rs933605379 131 dbSNP
rs1357712340 137 dbSNP
rs1329703019 138 dbSNP
rs1328561738 141 dbSNP
rs1369727072 143 dbSNP
rs1319282469 147 dbSNP
rs1442250233 158 dbSNP
rs985231779 161 dbSNP
rs752758912 164 dbSNP
rs574038809 167 dbSNP
rs1211030559 169 dbSNP
rs923488632 179 dbSNP
rs1259916918 184 dbSNP
rs1487151390 187 dbSNP
rs1388482312 197 dbSNP
rs974946009 204 dbSNP
rs1192740510 205 dbSNP
rs1424238618 209 dbSNP
rs953905825 217 dbSNP
rs1170273028 219 dbSNP
rs1423797460 226 dbSNP
rs1029344151 231 dbSNP
rs1314253637 239 dbSNP
rs1157074622 240 dbSNP
rs1402451695 250 dbSNP
rs965202809 260 dbSNP
rs767920460 266 dbSNP
rs989264255 268 dbSNP
rs957763079 270 dbSNP
rs560425020 271 dbSNP
rs966308622 278 dbSNP
rs540576093 282 dbSNP
rs1015183878 287 dbSNP
rs970684843 290 dbSNP
rs1215579471 291 dbSNP
rs1250883863 306 dbSNP
rs1195215176 315 dbSNP
rs887957614 321 dbSNP
rs1247270904 324 dbSNP
rs1213055371 329 dbSNP
rs1448542549 331 dbSNP
rs1025269994 339 dbSNP
rs1028196463 340 dbSNP
rs1246058074 351 dbSNP
rs1478035964 357 dbSNP
rs1012161249 359 dbSNP
rs1001642447 364 dbSNP
rs1418755003 374 dbSNP
rs1158399966 376 dbSNP
rs182909648 386 dbSNP
rs1284604859 399 dbSNP
rs1218242114 400 dbSNP
rs1322078734 401 dbSNP
rs765798108 402 dbSNP
rs1441723954 405 dbSNP
rs1045738191 426 dbSNP
rs1343370232 445 dbSNP
rs1014189354 451 dbSNP
rs1306108793 457 dbSNP
rs1261562041 466 dbSNP
rs891752824 481 dbSNP
rs528118584 487 dbSNP
rs1052975051 488 dbSNP
rs1452176001 491 dbSNP
rs4150237 500 dbSNP
rs774629817 501 dbSNP
rs1438569063 514 dbSNP
rs372817768 515 dbSNP
rs1178827092 531 dbSNP
rs1365191127 543 dbSNP
rs1455620512 563 dbSNP
rs1049997668 572 dbSNP
rs932449652 573 dbSNP
rs1462469756 574 dbSNP
rs4150238 579 dbSNP
rs976455632 582 dbSNP
rs1446137159 585 dbSNP
rs961025731 586 dbSNP
rs1337814474 597 dbSNP
rs1242338161 600 dbSNP
rs933283855 602 dbSNP
rs530508055 609 dbSNP
rs1256119415 610 dbSNP
rs563516210 612 dbSNP
rs908173392 615 dbSNP
rs1198746084 616 dbSNP
rs923550923 620 dbSNP
rs1185833728 623 dbSNP
rs1368205300 626 dbSNP
rs983721719 631 dbSNP
rs1389547373 640 dbSNP
rs541632821 641 dbSNP
rs574788635 646 dbSNP
rs1465156022 651 dbSNP
rs952370052 660 dbSNP
rs553263432 664 dbSNP
rs1039733490 668 dbSNP
rs1002096244 674 dbSNP
rs12656477 681 dbSNP
rs943626642 691 dbSNP
rs190745351 695 dbSNP
rs558196223 696 dbSNP
rs1024339796 700 dbSNP
rs11465459 705 dbSNP
rs1053026377 707 dbSNP
rs1000131839 710 dbSNP
rs1341881765 727 dbSNP
rs1294142218 728 dbSNP
rs75099866 729 dbSNP
rs77882464 730 dbSNP
rs1486170004 736 dbSNP
rs904426204 738 dbSNP
rs1049607342 741 dbSNP
rs11465460 741 dbSNP
rs1180279338 741 dbSNP
rs199837753 742 dbSNP
rs537986072 743 dbSNP
rs932475554 743 dbSNP
rs1040822347 744 dbSNP
rs939709923 744 dbSNP
rs577338769 747 dbSNP
rs1382661564 752 dbSNP
rs1012604452 754 dbSNP
rs1297673537 754 dbSNP
rs140276265 754 dbSNP
rs908224526 754 dbSNP
rs1349683145 767 dbSNP
rs1445831212 773 dbSNP
rs959262366 777 dbSNP
rs1377518975 786 dbSNP
rs374843737 789 dbSNP
rs1485760305 790 dbSNP
rs1187574267 800 dbSNP
rs1313701958 807 dbSNP
rs1264489607 813 dbSNP
rs558664342 819 dbSNP
rs1431455010 828 dbSNP
rs1016068280 836 dbSNP
rs984162696 841 dbSNP
rs952358172 842 dbSNP
rs768480408 846 dbSNP
rs1157100207 865 dbSNP
rs1359613490 866 dbSNP
rs1454122390 872 dbSNP
rs868816825 881 dbSNP
rs746918027 882 dbSNP
rs920825580 895 dbSNP
rs186345460 914 dbSNP
rs980335435 915 dbSNP
rs1303555406 919 dbSNP
rs867820205 927 dbSNP
rs1372698154 929 dbSNP
rs1237444936 932 dbSNP
rs570022918 935 dbSNP
rs1316632347 947 dbSNP
rs1216977858 950 dbSNP
rs1263010176 950 dbSNP
rs1420089083 954 dbSNP
rs1193060041 955 dbSNP
rs555146264 958 dbSNP
rs1253645605 959 dbSNP
rs146165506 967 dbSNP
rs536403592 968 dbSNP
rs1024388888 978 dbSNP
rs1407545431 981 dbSNP
rs780098072 991 dbSNP
rs1161104428 996 dbSNP
rs1348017569 1002 dbSNP
rs956096463 1003 dbSNP
rs1039023068 1005 dbSNP
rs1326523073 1016 dbSNP
rs1395984460 1025 dbSNP
rs943643255 1028 dbSNP
rs1482962072 1040 dbSNP
rs893371272 1041 dbSNP
rs1054644188 1044 dbSNP
rs1373682998 1051 dbSNP
rs565923593 1058 dbSNP
rs924769330 1068 dbSNP
rs1249997674 1082 dbSNP
rs978276905 1083 dbSNP
rs949149177 1084 dbSNP
rs917595369 1096 dbSNP
rs1308605637 1099 dbSNP
rs990475137 1103 dbSNP
rs1320312623 1120 dbSNP
rs1289723466 1135 dbSNP
rs1213566439 1157 dbSNP
rs1231594378 1170 dbSNP
rs1357447899 1177 dbSNP
rs959293786 1178 dbSNP
rs1016100774 1192 dbSNP
rs1232513583 1196 dbSNP
rs547727992 1197 dbSNP
rs1178702749 1206 dbSNP
rs1296268647 1209 dbSNP
rs1463268223 1215 dbSNP
rs532647980 1216 dbSNP
rs1028653158 1222 dbSNP
rs1163971777 1238 dbSNP
rs570150705 1244 dbSNP
rs1459474922 1245 dbSNP
rs1463596844 1247 dbSNP
rs551854584 1249 dbSNP
rs749327133 1256 dbSNP
rs998039597 1267 dbSNP
rs901909726 1274 dbSNP
rs1300744919 1276 dbSNP
rs1377339817 1277 dbSNP
rs1040873338 1287 dbSNP
rs1164946503 1294 dbSNP
rs1472078865 1295 dbSNP
rs778034898 1306 dbSNP
rs1007538457 1312 dbSNP
rs576280050 1319 dbSNP
rs530653154 1323 dbSNP
rs1438489578 1333 dbSNP
rs1206842425 1338 dbSNP
rs893402656 1343 dbSNP
rs1485190273 1360 dbSNP
rs4150239 1368 dbSNP
rs920889953 1369 dbSNP
rs1476825854 1376 dbSNP
rs934890147 1380 dbSNP
rs13385 1383 dbSNP
rs1045881139 1398 dbSNP
rs917428776 1410 dbSNP
rs1374532727 1411 dbSNP
rs1246708799 1413 dbSNP
rs369711855 1426 dbSNP
rs4150240 1431 dbSNP
rs917645266 1438 dbSNP
rs1273910457 1439 dbSNP
rs1398640496 1449 dbSNP
rs753020407 1452 dbSNP
rs1227813920 1456 dbSNP
rs1315351808 1459 dbSNP
rs770218599 1460 dbSNP
rs149641182 1462 dbSNP
rs1028283049 1463 dbSNP
rs908879509 1470 dbSNP
rs536541183 1472 dbSNP
rs984707224 1474 dbSNP
rs950623329 1475 dbSNP
rs1487201581 1484 dbSNP
rs767959523 1489 dbSNP
rs919109448 1503 dbSNP
rs1325185880 1508 dbSNP
rs4150241 1525 dbSNP
rs577174963 1526 dbSNP
rs1242643302 1528 dbSNP
rs1476099909 1530 dbSNP
rs1396547050 1544 dbSNP
rs1189016804 1546 dbSNP
rs1394067803 1571 dbSNP
rs4150242 1573 dbSNP
rs1004029658 1575 dbSNP
rs779521495 1583 dbSNP
rs1377610614 1586 dbSNP
rs1399327142 1589 dbSNP
rs1318183489 1599 dbSNP
rs751992761 1604 dbSNP
rs543403168 1619 dbSNP
rs768382808 1622 dbSNP
rs1017656706 1623 dbSNP
rs1007569605 1630 dbSNP
rs957389792 1649 dbSNP
rs1032996537 1650 dbSNP
rs931042878 1660 dbSNP
rs999130457 1666 dbSNP
rs903409588 1670 dbSNP
rs1282740737 1673 dbSNP
rs904876462 1676 dbSNP
rs372154250 1679 dbSNP
rs1204390960 1687 dbSNP
rs1284861921 1691 dbSNP
rs1046332143 1692 dbSNP
rs1196100035 1693 dbSNP
rs949002430 1703 dbSNP
rs1014389541 1704 dbSNP
rs7268 1711 dbSNP
rs1378113314 1712 dbSNP
rs1254099785 1713 dbSNP
rs1054840382 1724 dbSNP
rs992998325 1737 dbSNP
rs937755486 1740 dbSNP
rs1386276077 1741 dbSNP
rs1403004874 1743 dbSNP
rs554804173 1749 dbSNP
rs1393736624 1755 dbSNP
rs1441747498 1757 dbSNP
rs1803697 1758 dbSNP
rs908912039 1760 dbSNP
rs536340580 1764 dbSNP
rs1334269996 1780 dbSNP
rs1238018527 1789 dbSNP
rs1279971253 1792 dbSNP
rs1352601159 1805 dbSNP
rs924771932 1822 dbSNP
rs1272477559 1824 dbSNP
rs979259737 1832 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions CHO
Location of target site 3'UTR
Tools used in this research miRBase Target Database , PicTar , TargetScan
Original Description (Extracted from the article) ... MicroRNA-132 targets HB-EGF in mast cells ...

- Molnar V; Ersek B; Wiener Z; Tombol Z; et al., 2012, Cellular and molecular life sciences : CMLS.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gcuggUACCGACAUCUGACAAu 5'
               :|| |  ||||||||| 
Target 5' ---aaGUGCC--UAGACUGUUa 3'
 		1 - 17
Article - Molnar V; Ersek B; Wiener Z; Tombol Z; et al.
- Cellular and molecular life sciences : CMLS, 2012
MicroRNAs provide an additional layer in the regulation of gene expression acting as repressors with several targets at the posttranscriptional level. This study describes microRNA expression patterns during differentiation and activation of mast cells. The expression levels of 567 different mouse miRNAs were compared by microarray between c-Kit+ committed progenitors, mucosal mast cells, resting and IgE-crosslinked BMMCs in vitro. The strongest upregulation of miR-132 upon IgE-mediated activation was validated in human cord blood-derived mast cells as well. HB-EGF growth factor also upregulated upon activation and was ranked high by more prediction algorithms. Co-transfection of miR-132 mimicking precursor and the 3'UTR of human Hbegf-containing luciferase vector proves that the predicted binding site is functional. In line with this, neutralization of miR-132 by anti-miR inhibitor leads to sustained production of HB-EGF protein in activated mast cells. Our data provide a novel example for negative regulation of a growth factor by an upregulated miRNA.
LinkOut: [PMID: 21853268]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK 293E cells
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... Two pro-survival proteinsVheparin-binding epidermal growth factor and TALIN2---were con茂卢聛rmed as direct targets of miR-132. ...

- Formosa A; Lena AM; Markert EK; Cortelli S; et al., 2013, Oncogene.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gcugguaccgacauCUGACAAu 5'
                        ||||||| 
Target 5' --------------GACUGUU- 3'
 		1 - 7
Article - Formosa A; Lena AM; Markert EK; Cortelli S; et al.
- Oncogene, 2013
Silencing of microRNAs (miRNAs) by promoter CpG island methylation may be an important mechanism in prostate carcinogenesis. To screen for epigenetically silenced miRNAs in prostate cancer (PCa), we treated prostate normal epithelial and carcinoma cells with 5-aza-2'-deoxycytidine (AZA) and subsequently examined expression changes of 650 miRNAs by megaplex stemloop reverse transcription-quantitative PCR. After applying a selection strategy, we analyzed the methylation status of CpG islands upstream to a subset of miRNAs by methylation-specific PCR. The CpG islands of miR-18b, miR-132, miR-34b/c, miR-148a, miR-450a and miR-542-3p showed methylation patterns congruent with their expression modulations in response to AZA. Methylation analysis of these CpG islands in a panel of 50 human prostate carcinoma specimens and 24 normal controls revealed miR-132 to be methylated in 42% of human cancer cases in a manner positively correlated to total Gleason score and tumor stage. Expression analysis of miR-132 in our tissue panel confirmed its downregulation in methylated tumors. Re-expression of miR-132 in PC3 cells induced cell detachment followed by cell death (anoikis). Two pro-survival proteins-heparin-binding epidermal growth factor and TALIN2-were confirmed as direct targets of miR-132. The results of this study point to miR-132 as a methylation-silenced miRNA with an antimetastatic role in PCa controlling cellular adhesion.
LinkOut: [PMID: 22310291]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.823 7.1e-7 0.623 7.5e-4 23 Click to see details
GSE38226 Liver fibrosis 0.718 1.2e-4 0.826 2.0e-6 21 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.776 7.0e-3 -0.850 1.9e-3 9 Click to see details
GSE28544 Breast cancer -0.408 2.4e-2 -0.398 2.7e-2 24 Click to see details
GSE28260 Renal cortex and medulla 0.542 2.8e-2 0.473 5.1e-2 13 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.365 5.7e-2 0.296 1.0e-1 20 Click to see details
GSE19536 Breast cancer -0.13 9.9e-2 -0.064 2.6e-1 100 Click to see details
GSE21849 B cell lymphoma 0.234 1.1e-1 0.209 1.4e-1 29 Click to see details
GSE17306 Multiple myeloma 0.155 1.4e-1 0.242 4.7e-2 49 Click to see details
GSE14794 Lymphoblastoid cells -0.107 1.6e-1 -0.140 9.4e-2 90 Click to see details
GSE17498 Multiple myeloma -0.144 1.9e-1 0.167 1.5e-1 40 Click to see details
GSE19783 ER+ ER+ breast cancer -0.178 2.3e-1 -0.205 1.9e-1 20 Click to see details
GSE27834 Pluripotent stem cells 0.19 2.4e-1 0.153 2.9e-1 16 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.145 2.4e-1 -0.003 4.9e-1 25 Click to see details
GSE32688 Pancreatic cancer 0.114 2.7e-1 0.082 3.3e-1 32 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.118 2.9e-1 0.000 5.0e-1 25 Click to see details
GSE21032 Prostate cancer 0.056 3.1e-1 0.034 3.8e-1 83 Click to see details
GSE19350 CNS germ cell tumors -0.146 3.3e-1 -0.252 2.1e-1 12 Click to see details
GSE21687 Ependynoma primary tumors -0.048 3.5e-1 0.017 4.5e-1 64 Click to see details
GSE19783 ER- ER- breast cancer -0.034 3.8e-1 0.037 3.7e-1 79 Click to see details
GSE26953 Aortic valvular endothelial cells -0.016 4.7e-1 0.038 4.3e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC 0.478 0 0.455 0 49 Click to see details
BLCA 0.556 0.01 0.517 0.01 18 Click to see details
COAD 0.721 0.02 0.667 0.04 8 Click to see details
KICH 0.396 0.03 0.348 0.04 25 Click to see details
LUSC 0.272 0.05 0.319 0.03 38 Click to see details
THCA 0.168 0.1 0.164 0.11 59 Click to see details
BRCA -0.133 0.11 -0.083 0.23 84 Click to see details
ESCA 0.353 0.14 0.073 0.42 11 Click to see details
STAD 0.189 0.15 0.062 0.37 32 Click to see details
PRAD 0.14 0.17 0.111 0.22 50 Click to see details
PCPG -0.858 0.17 -0.500 0.33 3 Click to see details
UCEC 0.183 0.23 0.042 0.43 19 Click to see details
LUAD 0.207 0.26 0.238 0.23 12 Click to see details
PAAD 0.379 0.31 0.400 0.3 4 Click to see details
HNSC 0.076 0.32 0.105 0.25 42 Click to see details
CESC -0.45 0.35 -0.500 0.33 3 Click to see details
CHOL 0.147 0.35 0.133 0.37 9 Click to see details
KIRP -0.064 0.36 -0.112 0.27 32 Click to see details
KIRC 0.026 0.42 0.038 0.38 68 Click to see details
KIRC 0.026 0.42 0.038 0.38 68 Click to see details
KIRC 0.026 0.42 0.038 0.38 68 Click to see details
247 hsa-miR-132-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000333 SIRT1 sirtuin 1 4 1
MIRT000334 MECP2 methyl-CpG binding protein 2 1 1
MIRT000601 CDKN1A cyclin dependent kinase inhibitor 1A 4 1
MIRT002329 RFX4 regulatory factor X4 1 1
MIRT003926 ARHGAP32 Rho GTPase activating protein 32 4 3
MIRT006503 RB1 RB transcriptional corepressor 1 5 1
MIRT006628 Mecp2 methyl CpG binding protein 2 4 1
MIRT006659 HBEGF heparin binding EGF like growth factor 4 3
MIRT007010 RASA1 RAS p21 protein activator 1 1 1
MIRT007166 CRK CRK proto-oncogene, adaptor protein 2 2
MIRT007167 TJAP1 tight junction associated protein 1 3 3
MIRT007253 TLN2 talin 2 1 2
MIRT021716 ARL6IP6 ADP ribosylation factor like GTPase 6 interacting protein 6 1 1
MIRT021717 COX8C cytochrome c oxidase subunit 8C 1 1
MIRT021718 PIP5K1A phosphatidylinositol-4-phosphate 5-kinase type 1 alpha 1 1
MIRT021719 CDH3 cadherin 3 1 1
MIRT021720 LOXL1 lysyl oxidase like 1 1 1
MIRT021721 TNFRSF17 TNF receptor superfamily member 17 1 1
MIRT021722 ADH1A alcohol dehydrogenase 1A (class I), alpha polypeptide 1 1
MIRT021723 KCTD4 potassium channel tetramerization domain containing 4 1 1
MIRT021724 PROSC pyridoxal phosphate binding protein 1 1
MIRT021725 WNT3A Wnt family member 3A 1 1
MIRT021726 KCNJ9 potassium voltage-gated channel subfamily J member 9 1 1
MIRT021727 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 1 1
MIRT021728 KIR3DL1 killer cell immunoglobulin like receptor, three Ig domains and long cytoplasmic tail 1 1 1
MIRT021729 ARF6 ADP ribosylation factor 6 1 1
MIRT021730 PLSCR1 phospholipid scramblase 1 1 1
MIRT021731 CSTF2T cleavage stimulation factor subunit 2 tau variant 1 1
MIRT021732 TAF15 TATA-box binding protein associated factor 15 1 1
MIRT021733 NR1D2 nuclear receptor subfamily 1 group D member 2 1 1
MIRT021734 EPHA4 EPH receptor A4 1 1
MIRT021735 RTEL1-TNFRSF6B RTEL1-TNFRSF6B readthrough (NMD candidate) 1 1
MIRT021736 MUC17 mucin 17, cell surface associated 1 1
MIRT021737 CA1 carbonic anhydrase 1 1 1
MIRT021738 S100A1 S100 calcium binding protein A1 1 1
MIRT021739 FKBP10 FK506 binding protein 10 1 1
MIRT021740 PLA2G4C phospholipase A2 group IVC 1 1
MIRT021741 GSTCD glutathione S-transferase C-terminal domain containing 1 1
MIRT021742 LIG4 DNA ligase 4 1 1
MIRT021743 POLK DNA polymerase kappa 1 1
MIRT021744 STMN1 stathmin 1 1 1
MIRT021745 DMGDH dimethylglycine dehydrogenase 1 1
MIRT021746 MLLT10 MLLT10, histone lysine methyltransferase DOT1L cofactor 1 1
MIRT021747 TRIM36 tripartite motif containing 36 1 1
MIRT021748 EOGT EGF domain specific O-linked N-acetylglucosamine transferase 1 1
MIRT021749 ANKRD28 ankyrin repeat domain 28 1 1
MIRT021750 GCNT1 glucosaminyl (N-acetyl) transferase 1, core 2 1 1
MIRT021751 PTPLAD1 3-hydroxyacyl-CoA dehydratase 3 1 1
MIRT021752 SSR3 signal sequence receptor subunit 3 1 1
MIRT021753 KBTBD3 kelch repeat and BTB domain containing 3 1 1
MIRT021754 SYT14 synaptotagmin 14 1 1
MIRT021755 MAP1B microtubule associated protein 1B 1 1
MIRT021756 YKT6 YKT6 v-SNARE homolog 1 1
MIRT021757 CD55 CD55 molecule (Cromer blood group) 1 1
MIRT021758 AASDHPPT aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase 1 1
MIRT021759 UBE2W ubiquitin conjugating enzyme E2 W 1 1
MIRT021760 GBAS nipsnap homolog 2 1 1
MIRT021761 TMEM47 transmembrane protein 47 1 1
MIRT021762 BNIP2 BCL2 interacting protein 2 1 1
MIRT021763 ZNF652 zinc finger protein 652 1 1
MIRT021764 FAM199X family with sequence similarity 199, X-linked 1 1
MIRT021765 FAM81A family with sequence similarity 81 member A 1 1
MIRT021766 CHRNA5 cholinergic receptor nicotinic alpha 5 subunit 1 1
MIRT021767 FRY FRY microtubule binding protein 1 1
MIRT021768 PTGS2 prostaglandin-endoperoxide synthase 2 1 1
MIRT021769 TUSC2 tumor suppressor candidate 2 1 1
MIRT021770 OSBPL8 oxysterol binding protein like 8 1 1
MIRT021771 CTDSPL2 CTD small phosphatase like 2 1 1
MIRT021772 MEF2A myocyte enhancer factor 2A 1 1
MIRT021773 PSMD12 proteasome 26S subunit, non-ATPase 12 1 1
MIRT021774 SPAST spastin 1 1
MIRT021775 ATP6V0E1 ATPase H+ transporting V0 subunit e1 1 1
MIRT021776 PRSS22 protease, serine 22 1 1
MIRT021777 SH3BGRL SH3 domain binding glutamate rich protein like 1 1
MIRT021778 KRT6C keratin 6C 1 1
MIRT021779 CST9L cystatin 9 like 1 1
MIRT021780 EBPL emopamil binding protein like 1 1
MIRT021781 SYNE3 spectrin repeat containing nuclear envelope family member 3 1 1
MIRT021782 FAM221B family with sequence similarity 221 member B 1 1
MIRT021783 GATA3 GATA binding protein 3 1 1
MIRT021784 EMILIN3 elastin microfibril interfacer 3 1 1
MIRT021785 ARL13B ADP ribosylation factor like GTPase 13B 1 1
MIRT021786 CYP26A1 cytochrome P450 family 26 subfamily A member 1 1 1
MIRT021787 SAMSN1 SAM domain, SH3 domain and nuclear localization signals 1 1 1
MIRT021788 GNL3L G protein nucleolar 3 like 1 1
MIRT021789 ETNK2 ethanolamine kinase 2 1 1
MIRT021790 DEPDC7 DEP domain containing 7 1 1
MIRT021791 FGF22 fibroblast growth factor 22 1 1
MIRT021792 FUT1 fucosyltransferase 1 (H blood group) 1 1
MIRT021793 KRTAP4-11 keratin associated protein 4-11 1 1
MIRT021794 SEC61A1 Sec61 translocon alpha 1 subunit 1 1
MIRT021795 CR2 complement C3d receptor 2 1 1
MIRT021796 MMP13 matrix metallopeptidase 13 1 1
MIRT021797 SYNDIG1L synapse differentiation inducing 1 like 1 1
MIRT021798 TFPI tissue factor pathway inhibitor 1 1
MIRT021799 RNF128 ring finger protein 128, E3 ubiquitin protein ligase 1 1
MIRT021800 SFXN2 sideroflexin 2 1 1
MIRT021801 PSMA2 proteasome subunit alpha 2 3 5
MIRT021802 FABP7 fatty acid binding protein 7 1 1
MIRT021803 CNTNAP1 contactin associated protein 1 1 1
MIRT021804 FBN3 fibrillin 3 1 1
MIRT021805 KIR3DL2 killer cell immunoglobulin like receptor, three Ig domains and long cytoplasmic tail 2 1 1
MIRT021806 LFNG LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase 1 1
MIRT021807 B3GAT1 beta-1,3-glucuronyltransferase 1 1 1
MIRT021808 ARR3 arrestin 3 1 1
MIRT021809 GK glycerol kinase 1 1
MIRT021810 SMN1 survival of motor neuron 1, telomeric 1 1
MIRT021811 ALK ALK receptor tyrosine kinase 1 1
MIRT021812 PRX periaxin 1 1
MIRT021813 CYP2E1 cytochrome P450 family 2 subfamily E member 1 1 1
MIRT021814 ADAMTSL1 ADAMTS like 1 1 1
MIRT021815 NCS1 neuronal calcium sensor 1 1 1
MIRT021816 CFTR cystic fibrosis transmembrane conductance regulator 1 1
MIRT021817 OAS2 2'-5'-oligoadenylate synthetase 2 1 1
MIRT021818 C8orf33 chromosome 8 open reading frame 33 1 1
MIRT021819 FAT4 FAT atypical cadherin 4 1 1
MIRT021820 GPR115 adhesion G protein-coupled receptor F4 1 1
MIRT021821 ZDHHC2 zinc finger DHHC-type containing 2 1 1
MIRT021822 INTS8 integrator complex subunit 8 1 1
MIRT021823 IMPA1 inositol monophosphatase 1 1 1
MIRT021824 FAT3 FAT atypical cadherin 3 1 1
MIRT021825 VPS13D vacuolar protein sorting 13 homolog D 1 1
MIRT021826 DOCK10 dedicator of cytokinesis 10 1 1
MIRT021827 LCA5 LCA5, lebercilin 1 1
MIRT021828 ARL14EP ADP ribosylation factor like GTPase 14 effector protein 1 1
MIRT021829 MTMR10 myotubularin related protein 10 1 1
MIRT021830 TRIM23 tripartite motif containing 23 1 1
MIRT021831 CHL1 cell adhesion molecule L1 like 1 1
MIRT021832 NDUFB10 NADH:ubiquinone oxidoreductase subunit B10 1 1
MIRT021833 NBN nibrin 1 1
MIRT021834 THBS1 thrombospondin 1 1 1
MIRT021835 GJE1 gap junction protein epsilon 1 1 1
MIRT021836 SNX7 sorting nexin 7 1 1
MIRT021837 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT021838 CASP7 caspase 7 1 1
MIRT021839 ECT2 epithelial cell transforming 2 1 1
MIRT021840 EXOC5 exocyst complex component 5 1 1
MIRT021841 CD164 CD164 molecule 1 1
MIRT021842 STAU1 staufen double-stranded RNA binding protein 1 1 1
MIRT021843 ANKRD29 ankyrin repeat domain 29 1 1
MIRT021844 CCSER2 coiled-coil serine rich protein 2 1 1
MIRT021845 RTN4 reticulon 4 1 1
MIRT021846 MDFIC MyoD family inhibitor domain containing 1 1
MIRT021847 ZNF236 zinc finger protein 236 1 1
MIRT021848 SDF2 stromal cell derived factor 2 1 1
MIRT021849 SPRED1 sprouty related EVH1 domain containing 1 1 1
MIRT021850 CMTM3 CKLF like MARVEL transmembrane domain containing 3 1 1
MIRT021851 MAP3K3 mitogen-activated protein kinase kinase kinase 3 1 1
MIRT021852 ACTR2 ARP2 actin related protein 2 homolog 1 1
MIRT021853 NAP1L1 nucleosome assembly protein 1 like 1 1 1
MIRT021854 FBXO28 F-box protein 28 1 1
MIRT021855 LGR4 leucine rich repeat containing G protein-coupled receptor 4 1 1
MIRT021856 ZNF148 zinc finger protein 148 1 1
MIRT021857 TBC1D9 TBC1 domain family member 9 1 1
MIRT021858 VDAC2 voltage dependent anion channel 2 1 1
MIRT021859 CC2D1B coiled-coil and C2 domain containing 1B 1 1
MIRT021860 MUC13 mucin 13, cell surface associated 1 1
MIRT021861 TSPAN6 tetraspanin 6 1 1
MIRT021862 GTF2H1 general transcription factor IIH subunit 1 1 1
MIRT021863 CALU calumenin 1 1
MIRT021864 CAMSAP2 calmodulin regulated spectrin associated protein family member 2 1 1
MIRT021865 CCNA2 cyclin A2 2 1
MIRT021866 CCNB1 cyclin B1 2 1
MIRT045838 PARP10 poly(ADP-ribose) polymerase family member 10 1 1
MIRT045839 RPL7 ribosomal protein L7 1 1
MIRT045840 FOXO1 forkhead box O1 4 2
MIRT045841 GNB2L1 receptor for activated C kinase 1 1 1
MIRT045842 CSTF3 cleavage stimulation factor subunit 3 1 1
MIRT045843 RPSA ribosomal protein SA 1 1
MIRT045844 ANXA2 annexin A2 1 1
MIRT045845 NCKAP1 NCK associated protein 1 1 1
MIRT045846 RPS5 ribosomal protein S5 1 1
MIRT045847 IRAK1 interleukin 1 receptor associated kinase 1 1 1
MIRT045848 PDLIM7 PDZ and LIM domain 7 1 1
MIRT054502 BDNF brain derived neurotrophic factor 2 1
MIRT054835 HN1 Jupiter microtubule associated homolog 1 4 1
MIRT054836 KLHL11 kelch like family member 11 4 1
MIRT054837 MAPK1 mitogen-activated protein kinase 1 4 1
MIRT054894 SOX5 SRY-box 5 2 1
MIRT091255 FXR1 FMR1 autosomal homolog 1 2 4
MIRT100367 HSPA1B heat shock protein family A (Hsp70) member 1B 2 2
MIRT106174 RRS1 ribosome biogenesis regulator homolog 2 2
MIRT149855 LDLR low density lipoprotein receptor 2 2
MIRT217679 ASF1A anti-silencing function 1A histone chaperone 2 2
MIRT259587 EIF2S3 eukaryotic translation initiation factor 2 subunit gamma 2 2
MIRT289307 TNRC6C trinucleotide repeat containing 6C 2 2
MIRT368374 ARID2 AT-rich interaction domain 2 2 2
MIRT438882 IRAK4 interleukin 1 receptor associated kinase 4 1 1
MIRT442189 HOOK3 hook microtubule tethering protein 3 2 2
MIRT449483 STAG1 stromal antigen 1 2 2
MIRT453131 HOXC4 homeobox C4 2 2
MIRT455372 KDM5C lysine demethylase 5C 2 2
MIRT455526 C6orf106 chromosome 6 open reading frame 106 2 2
MIRT458882 PFAS phosphoribosylformylglycinamidine synthase 2 2
MIRT464180 VMP1 vacuole membrane protein 1 2 21
MIRT467690 SLC38A2 solute carrier family 38 member 2 2 4
MIRT476656 FZD6 frizzled class receptor 6 2 4
MIRT477439 EML4 echinoderm microtubule associated protein like 4 2 4
MIRT479294 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT485291 PLAGL2 PLAG1 like zinc finger 2 2 2
MIRT495258 BMPER BMP binding endothelial regulator 2 2
MIRT497153 PRDM15 PR/SET domain 15 2 2
MIRT500830 TCEB1 elongin C 2 2
MIRT506948 HS3ST3B1 heparan sulfate-glucosamine 3-sulfotransferase 3B1 2 4
MIRT507623 CRTC1 CREB regulated transcription coactivator 1 2 2
MIRT508137 AMD1 adenosylmethionine decarboxylase 1 2 2
MIRT526271 CCDC169 coiled-coil domain containing 169 2 2
MIRT526867 PARP11 poly(ADP-ribose) polymerase family member 11 2 2
MIRT532420 ART4 ADP-ribosyltransferase 4 (Dombrock blood group) 2 2
MIRT532508 TWISTNB TWIST neighbor 2 4
MIRT534833 RAB18 RAB18, member RAS oncogene family 2 2
MIRT542577 ZNF280B zinc finger protein 280B 2 2
MIRT546160 TSPAN12 tetraspanin 12 2 2
MIRT547255 NUP50 nucleoporin 50 2 4
MIRT547614 LIFR LIF receptor alpha 2 2
MIRT547705 KPNA1 karyopherin subunit alpha 1 2 4
MIRT549141 BRWD1 bromodomain and WD repeat domain containing 1 2 2
MIRT549455 ACSL4 acyl-CoA synthetase long chain family member 4 2 2
MIRT551640 TRUB1 TruB pseudouridine synthase family member 1 2 4
MIRT554985 RAB5B RAB5B, member RAS oncogene family 2 2
MIRT555924 OCLN occludin 5 4
MIRT557610 GNB1 G protein subunit beta 1 2 2
MIRT571512 ZNF711 zinc finger protein 711 2 2
MIRT572928 PRAMEF1 PRAME family member 1 2 2
MIRT573617 ZNF724P zinc finger protein 724 2 2
MIRT574924 Vmp1 vacuole membrane protein 1 2 12
MIRT614465 ALKBH4 alkB homolog 4, lysine demethylase 2 2
MIRT623025 OLFML2A olfactomedin like 2A 2 2
MIRT639080 CD226 CD226 molecule 2 2
MIRT642134 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT653734 SLC25A32 solute carrier family 25 member 32 2 2
MIRT655167 PHF20L1 PHD finger protein 20 like 1 2 2
MIRT680989 DCAF17 DDB1 and CUL4 associated factor 17 2 2
MIRT681564 UBXN2A UBX domain protein 2A 2 2
MIRT696294 IER3IP1 immediate early response 3 interacting protein 1 2 2
MIRT697724 USP8 ubiquitin specific peptidase 8 2 2
MIRT703296 GID4 GID complex subunit 4 homolog 2 2
MIRT718422 CALN1 calneuron 1 2 2
MIRT719460 APBA1 amyloid beta precursor protein binding family A member 1 2 2
MIRT731713 EGFR epidermal growth factor receptor 3 1
MIRT731714 RAF1 Raf-1 proto-oncogene, serine/threonine kinase 3 1
MIRT732779 ZEB2 zinc finger E-box binding homeobox 2 2 0
MIRT732980 GSK3B glycogen synthase kinase 3 beta 3 0
MIRT734466 HDAC3 histone deacetylase 3 2 0
MIRT734880 FOXO3 forkhead box O3 3 0
MIRT735319 SNHG16 small nucleolar RNA host gene 16 2 0
MIRT755706 BNC2 basonuclin 2 1 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-132 5-aza-2'-deoxycytidine (5-Aza-CdR) + 4-phenylbutyric acid (PBA) NULL NULL Microarray T24 human bladder cancer cells 16766263 2006 up-regulated
miR-132 5-Fluorouracil approved 3385 Quantitative real-time PCR colon cancer cells 17702597 2007 up-regulated
miR-132 Gemcitabine approved 60750 Microarray ovarian cancer 19237188 2009 down-regulated
miR-132 Vorinostat (SAHA) approved 5311 Microarray A549 human non-small cell lung cancer cells 19513533 2009 up-regulated
miR-132 Morphine approved 5288826 Microarray human monocyte-derived macrophages (h-mdms) infection with HIV-1 20564181 2010 up-regulated
miR-132 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-132 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-132 Comfrey NULL 6440495 Microarray rat liver 21370286 2011 up-regulated
miR-132 Luteolin NULL 5280445 Quantitative real-time PCR PC12 cells 22916239 2012 up-regulated
miR-132 ACTH approved 16132265 Quantitative real-time PCR adrenals and granulosa cells 24205079 2014 up-regulated
miR-132 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-132 Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CP20)
hsa-mir-132 Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-mir-132 Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-mir-132 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-mir-132 Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-132 Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-mir-132 Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-132-3p (1Z)-2-anilino-N-[(5-carbamoyl-1H-imidazol-4-yl)amino]-2-oxoethanimidoyl cyanide 5466279 NSC683605 resistant
hsa-miR-132-3p (2Z)-2-(tert-butylhydrazinylidene)-N-(3-chloro-1,4-dioxonaphthalen-2-yl)-3-(3,7,12-trioxo-4H-naphtho[2,3-h]quinoxalin-2-yl)propanamide 5479912 NSC649574 resistant
hsa-miR-132-3p (7-acetamido-2-acetyloxy-1-methoxy-10-methylsulfanyl-9-oxo-6,7-dihydro-5H-benzo[a]heptalen-3-yl) acetate 435732 NSC374980 sensitive
hsa-miR-132-3p (e)-1-(benzenesulfonyl)-3-(2-phenyl-1h-indol-3-yl)prop-2-en-1-one 54613416 NSC749193 sensitive
hsa-miR-132-3p (E)-3-[3,5-bis(trifluoromethyl)phenyl]sulfanyl-1-(4-chlorophenyl)prop-2-en-1-one 6181983 NSC735169 resistant
hsa-miR-132-3p (Z)-3-[5-[3,5-bis(trifluoromethyl)phenyl]furan-2-yl]prop-2-enenitrile 5468615 NSC672868 sensitive
hsa-miR-132-3p (z)-6-(2-(pyridin-2-ylmethylene)hydrazinyl)-9h-purine 60147744 NSC752329 resistant
hsa-miR-132-3p [(5s,8ar,9r)-9-(4-hydroxy-3,5-dimethoxyphenyl)-8-oxo-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[5,6-f][1,3]benzodioxol-5-yl] 3-aminobenzoate NSC642276 sensitive
hsa-miR-132-3p [3,4,5-triacetyloxy-6-(3-cyano-6-phenyl-2-sulfanyl-4-thiophen-2-yl-4h-pyridin-1-yl)oxan-2-yl]methyl acetate 381303 NSC667740 sensitive
hsa-miR-132-3p 1-(2-thiazoylazo)-2-naphthol 93572 NSC139021 resistant
hsa-miR-132-3p 1-(4-methoxyphenyl)-3-[(z)-1-[6-[(z)-n-[(4-methoxyphenyl)carbamothioylamino]-c-methylcarbonimidoyl]pyridin-2-yl]ethylideneamino]thiourea 6375828 NSC668486 resistant
hsa-miR-132-3p 1-(6,7-dichloro-1-(4-chlorophenyl)-1h-pyrazolo[3,4-b]quinoxalin-3-yl)-1,2,3,4-butanetetrol 365567 NSC633362 sensitive
hsa-miR-132-3p 1-(acetyloxy)-2-(2-(1-(acetyloxy)-1h-benzimidazol-2-yl)phenyl)-1h-benzimidazole 355531 NSC609356 sensitive
hsa-miR-132-3p 1-[2-(4-nitrophenyl)-2-oxoethyl]-4-pentylpyridin-1-ium bromide 24181037 NSC4290 sensitive
hsa-miR-132-3p 10-nitrosophenanthren-9-ol 95223 NSC48526 sensitive
hsa-miR-132-3p 12-imino-4,10,14,20-tetrazapentacyclo[11.7.0.03,11.04,9.014,19]icosa-1(13),3(11),9,19-tetraen-2-one 46861729 NSC753790 sensitive
hsa-miR-132-3p 15-benzyl-9-pyridin-3-yl-15-azatetracyclo[8.6.1.02,7.014,17]heptadeca-1(16),2,4,6,10(17),11,13-heptaen-8-one 57409953 NSC762458 sensitive
hsa-miR-132-3p 2-((5-methyl-3-isoxazolyl)amino)-4-((5-methyl-3-isoxazolyl)imino)-1(4h)-naphthalenone 373420 NSC649750 sensitive
hsa-miR-132-3p 2-(3-chloropropyloxy)naphthazarin 378771 NSC661941 sensitive
hsa-miR-132-3p 2-(4-methylphenyl)-5-phenyl-1h-[1,2,4]triazino[4,3-a]quinoxaline 399104 NSC709520 resistant
hsa-miR-132-3p 2-(6-benzoyl-1h-benzimidazol-2-yl)-3,4,5,6-tetrachloro-n-(furan-2-yl)benzamide 402231 NSC716122 sensitive
hsa-miR-132-3p 2-(diethylamino)ethyl (E)-3-(4-methoxyphenyl)-2-(3,4,5-trimethoxyphenyl)prop-2-enoate 5388753 NSC638408 sensitive
hsa-miR-132-3p 2-(furan-2-yl)-5-phenyl-1h-pyrazolo[1,5-a]pyrimidin-7-one 342597 NSC379651 sensitive
hsa-miR-132-3p 2-[(e)-[[1-(4-chlorophenyl)-3-methylpyrazolo[3,4-d]pyrimidin-4-yl]hydrazinylidene]methyl]phenol 136040127 NSC753018 resistant
hsa-miR-132-3p 2-[(z)-6-[2-(trifluoromethyl)phenyl]hex-3-en-1,5-diynyl]aniline 24203959 NSC730269 sensitive
hsa-miR-132-3p 2-amino-4-cyclopropyl-6-(4-fluorophenyl)cyclohexa-2,4-diene-1,1,3-tricarbonitrile 400138 NSC711632 sensitive
hsa-miR-132-3p 2-amino-9-chloro-3,5-bis(4-chlorophenyl)pyrimido[4,5-c]quinolin-1-one 16126264 NSC741296 resistant
hsa-miR-132-3p 2-amino-N-[4-chloro-2-(1H-pyrrole-2-carbonyl)phenyl]acetamide 284708 NSC140873 sensitive
hsa-miR-132-3p 2-bromo-1-[6-(2-bromopyridin-1-ium-1-yl)naphthalen-2-yl]pyridin-1-ium;bromide 54608313 NSC129757 resistant
hsa-miR-132-3p 2-methoxy-5h-pyrido[3,2:4,5]pyrrolo[3,2-c]cinnoline 54613488 NSC749296 resistant
hsa-miR-132-3p 2-methylthieno[3,2-f][1]benzothiole-4,8-dione 375901 NSC656238 sensitive
hsa-miR-132-3p 2-nitro-3-phenylspiro[cyclopropane-1,9'-fluorene] 282082 NSC135168 sensitive
hsa-miR-132-3p 2-oxo-n-(pyridin-4-yl)-2-(1-tosyl-1h-indol-3-yl)acetamide 155814544 NSC758357 sensitive
hsa-miR-132-3p 2,3,10,11-tetramethoxy-5,6-dihydroisoquinolino[2,1-b]isoquinolin-8-one 392605 NSC693145 resistant
hsa-miR-132-3p 2,5,11-trimethyl-9-phenoxy-6h-pyrido[4,3-b]carbazol-2-ium;acetate 10431819 NSC650269 sensitive
hsa-miR-132-3p 2,6-bis[1-(3-ethylthioureidoimino)ethyl]pyridine 6393657 NSC668337 resistant
hsa-miR-132-3p 3-(3,5-dibromo-4-methoxyphenyl)-2-(3-pyridinyl)acrylonitrile 5467796 NSC659319 sensitive
hsa-miR-132-3p 3-(3,5-dichlorophenyl)-2-(2-pyridinyl)acrylonitrile 5467799 NSC659323 sensitive
hsa-miR-132-3p 3-[(2,3-dimethoxyphenyl)methyl]-7,8-dimethoxy-5-methylsulfanyl-2,5-dihydro-1H-3-benzazepin-4-one 359177 NSC619859 sensitive
hsa-miR-132-3p 3-[(E)-[(4-nitrophenyl)hydrazinylidene]methyl]-1H-benzo[g]quinoxaline-2,5,10-trione 135436193 NSC713198 sensitive
hsa-miR-132-3p 3-[(Z)-[1-(3,4,5-trimethoxyphenyl)pyrido[3,4-b]indol-3-ylidene]methyl]-1H-indol-2-ol 155808310 NSC761816 sensitive
hsa-miR-132-3p 3-[(Z)-[1-(3,5-dimethoxyphenyl)pyrido[3,4-b]indol-3-ylidene]methyl]-5-methoxy-1H-indol-2-ol 155813091 NSC761832 sensitive
hsa-miR-132-3p 3-[[3-(furan-2-carbonyl)-2-sulfanylideneimidazolidin-1-yl]methylidene]pentane-2,4-dione 24203787 NSC729519 resistant
hsa-miR-132-3p 3-[5-(4-amino-2,6-dibromophenyl)-1,3,4-oxadiazol-2-yl]-1-(1H-benzimidazol-2-yl)propan-1-one 71451481 NSC761980 sensitive
hsa-miR-132-3p 3-[6-(2,5-dioxo-4,4-diphenylimidazolidin-1-yl)hexyl]-5,5-diphenylimidazolidine-2,4-dione 343242 NSC382386 sensitive
hsa-miR-132-3p 3-amino-N-(2-fluorophenyl)-5-oxo-7,8-dihydro-6H-thieno[2,3-b]quinoline-2-carboxamide 1856915 NSC754567 sensitive
hsa-miR-132-3p 4-(4,7-dimethoxy-1,3-benzodioxol-5-yl)-5-(4-methoxyphenyl)-2H-triazole 73334660 NSC763198 sensitive
hsa-miR-132-3p 4-[(13R)-13-hydroxy-13-[(2S,5S)-5-[(2S,5S)-5-[1-hydroxy-13-[(2S)-2-methyl-5-oxo-2H-furan-4-yl]tridecyl]oxolan-2-yl]oxolan-2-yl]tridecyl]-2-methyl-2H-furan-5-one 374064 NSC651320 sensitive
hsa-miR-132-3p 4-[(2Z)-2-[1-amino-3-(methylamino)-1,3-bis(sulfanylidene)propan-2-ylidene]hydrazinyl]-1H-imidazole-5-carboxamide 5466293 NSC684046 resistant
hsa-miR-132-3p 4-[(e)-(9-ethylcarbazol-3-yl)azo]benzonitrile 394667 NSC698269 sensitive
hsa-miR-132-3p 4-[(E)-2-(3,4,5-trimethoxyphenyl)ethenyl]quinoline 6285127 NSC87197 sensitive
hsa-miR-132-3p 4-[(E)-2-piperidin-1-ylethenyl]benzo[g]quinoline-5,10-dione 5781544 NSC642968 sensitive
hsa-miR-132-3p 4-[[(Z)-N-benzamido-C-[4-[bis(2-cyanoethyl)amino]-2-methylphenyl]carbonimidoyl]diazenyl]benzoic acid 135493923 NSC681974 sensitive
hsa-miR-132-3p 4-[2-[2-(4-carbamimidoylanilino)ethoxy]ethylamino]benzenecarboximidamide;hydrochloride 24206088 NSC740025 sensitive
hsa-miR-132-3p 4-[4-(diethylamino)benzenecarboximidoyl]-n,n-dimethylaniline;hydrochloride NSC33566 sensitive
hsa-miR-132-3p 4-[4,6-bis(methylsulfanyl)pyrazolo[3,4-d]pyrimidin-1-yl]-7-chloroquinoline 24203467 NSC728188 sensitive
hsa-miR-132-3p 4-methylsulfanyl-N-[(3,4,5-trimethoxyphenyl)methyl]aniline 373808 NSC650772 sensitive
hsa-miR-132-3p 4-methylthio-n-(3,4,5-trimethoxybenzyl)aniline 373808 NSC650771 sensitive
hsa-miR-132-3p 4,5-bis(4-methoxyphenyl)-1h-imidazol-2(5h)-one 231112 NSC26692 sensitive
hsa-miR-132-3p 5-[2-(3-hydroxy-4-methoxyphenyl)ethynyl]-6-(3,4,5-trimethoxyphenyl)pyran-2-one 45028148 NSC741289 sensitive
hsa-miR-132-3p 5-bromo-3h-triazolo[4,5-d]pyrimidin-7-ol 135440019 NSC680827 resistant
hsa-miR-132-3p 5-hydroxy-10-methoxy-1-methylbenzo[g]quinolin-4(1h)-one 406554 NSC724702 sensitive
hsa-miR-132-3p 5-methylphenanthroline 72791 NSC4272 resistant
hsa-miR-132-3p 5,10-dimethoxybenzo[g]quinolin-2(1h)-one 54612875 NSC750104 sensitive
hsa-miR-132-3p 6-butyl-12-methyl-5,6-dihydrobenzimidazolo[2,1-a]isoquinolin-7-ium-3,10-diol;6-butyl-12-methyl-5,6-dihydrobenzimidazolo[2,1-a]isoquinolin-12-ium-3,9-diol;diiodide 403475 NSC718370 sensitive
hsa-miR-132-3p 7-[(1-hydroxy-1-phenylpropan-2-yl)amino]quinoline-5,8-dione 386231 NSC677949 sensitive
hsa-miR-132-3p 7-[(3,4-dimethoxyphenyl)methyl]-6-phenyl-4,5-dihydropyrrolo[3,4-g][1,2]benzoxazole 60148271 NSC754077 sensitive
hsa-miR-132-3p 8-azadenosine 251928 NSC72961 resistant
hsa-miR-132-3p 9-methyl-2-[4-(4-phenylpiperazin-1-yl)butyl]-3,4-dihydropyrido[3,4-b]indol-1-one 365677 NSC633530 sensitive
hsa-miR-132-3p Acetonitrile;carbon monoxide;dibromoosmium;triphenylphosphane 498712 NSC634761 resistant
hsa-miR-132-3p Antineoplastic-642316 369949 NSC642316 sensitive
hsa-miR-132-3p B1a8bpf5u8 72574 NSC84167 sensitive
hsa-miR-132-3p Benzo[g]quinoxaline-5,10-dione, 5,10-dihydro-2,3-dimethyl- 353644 NSC602617 sensitive
hsa-miR-132-3p Benzyl 4-[(3,6-dioxocyclohexa-1,4-dien-1-yl)methylamino]benzoate 386492 NSC678636 resistant
hsa-miR-132-3p Bindschedler's green 73516 NSC7811 sensitive
hsa-miR-132-3p Chlorotriethyltin 13820 NSC5283 sensitive
hsa-miR-132-3p Chrome black t 3246023 NSC7223 resistant
hsa-miR-132-3p Cinnoline, 4-nitro-, 1-oxide 100397 NSC294846 resistant
hsa-miR-132-3p Dezaguanine 55710 NSC261726 resistant
hsa-miR-132-3p Diethoxybis(1,4-naphthochinone-2-olato)titanium(iv) 368297 NSC638842 sensitive
hsa-miR-132-3p Dimethyl 1-[(z)-2-[(z)-1,4-dimethoxy-1,4-dioxobut-2-en-2-yl]sulfanyl-1,2-bis(4-methoxyphenyl)ethenyl]pyrazole-3,4-dicarboxylate 5471659 NSC712735 resistant
hsa-miR-132-3p Erlotinib 176870 NSC718781 approved resistant
hsa-miR-132-3p Ethanol, 2-[4-(2,2':6',2"-terpyridin-4'-yl)phenoxy]- 368990 NSC640499 resistant
hsa-miR-132-3p Ethanone, 1-(2-pyrimidinyl)-, (2-benzoxazolyl)hydrazone 9572051 NSC693639 resistant
hsa-miR-132-3p Ethaverine hydrochloride 5702159 NSC757818 sensitive
hsa-miR-132-3p Fluorene, 9-bromo-2,4,7-trichloro- 248608 NSC65921 sensitive
hsa-miR-132-3p Gardenin b 96539 NSC79093 sensitive
hsa-miR-132-3p Gw693881a 44571452 NSC756316 resistant
hsa-miR-132-3p Hedamycin 98033 NSC70929 sensitive
hsa-miR-132-3p Hymenialdisine 135413546 NSC607173 resistant
hsa-miR-132-3p Ls-94160 135408599 NSC52426 resistant
hsa-miR-132-3p Megxp0_000612 5386961 NSC618932 resistant
hsa-miR-132-3p Methyl (1s,10r)-6-methyl-10-nonyl-7,9,12-triazatricyclo[6.3.1.04,12]dodeca-5,8-diene-5-carboxylate 401693 NSC715423 sensitive
hsa-miR-132-3p Methyl (2e)-2-[(1r,7r,10s,12r)-14-acetamido-7,14-dimethyl-4-oxo-6-azatetracyclo[8.3.1.02,6.07,12]tetradec-2-en-5-ylidene]acetate 5470606 NSC703547 resistant
hsa-miR-132-3p Methyl 2-(4,6-dimethyl-3-oxospiro[1h-indene-2,5'-3,4-dihydropyrazole]-4'-yl)benzoate 386181 NSC677803 sensitive
hsa-miR-132-3p Methyl 2-[[4,6-bis[hydroxy(methyl)amino]-1,3,5-triazin-2-yl]amino]acetate 45029484 NSC746930 resistant
hsa-miR-132-3p Methyl 2-[2-[3-hydroxy-3-(2-methoxy-2-oxo-ethyl)indol-2-yl]-1h-indol-3-yl]acetate 392215 NSC692348 resistant
hsa-miR-132-3p Methyl 4-[3-(2-thienyl)quinoxalin-2-yl]oxybenzoate 388002 NSC682365 sensitive
hsa-miR-132-3p Methyl 6-[[(3S,4aR,6aR,6bS,8R,8aR,12aS,14aR,14bR)-8a-[3-[4-[3,4-dihydroxy-4-(hydroxymethyl)oxolan-2-yl]oxy-3-hydroxy-6-methyl-5-(3,4,5-trihydroxyoxan-2-yl)oxyoxan-2-yl]oxy-4,5-dihydroxyoxan-2-yl]oxycarbonyl-8-hydroxy-4,4,6a,6b,11,11,14b-heptamethyl-1,2,3, 385536 NSC676794 sensitive
hsa-miR-132-3p Methyl n-[6-(methoxycarbonylamino)pyren-1-yl]carbamate;methyl n-[8-(methoxycarbonylamino)pyren-1-yl]carbamate NSC33092 sensitive
hsa-miR-132-3p Michler's thione 71045 NSC30656 sensitive
hsa-miR-132-3p Miltefosin c 3599 NSC605583 resistant
hsa-miR-132-3p Mitomycin c,methylamine fr. streptomyces caespitosus 213803 NSC329086 sensitive
hsa-miR-132-3p N'-(4-chlorobenzoyl)-n-[(e)-1-(2-hydroxyphenyl)ethylideneamino]-n'-(4-methylphenyl)propanediamide 135499196 NSC644474 resistant
hsa-miR-132-3p N-(1,3-benzothiazol-2-yl)-2-phenyl-7-(3,4,5-trimethoxyphenyl)pyrazolo[1,5-a]pyrimidine-5-carboxamide 71624130 NSC763635 sensitive
hsa-miR-132-3p N-(2,3-dimethyl-7-nitroquinolin-4-yl)-N',N'-dimethylpropane-1,3-diamine;hydrochloride 372712 NSC648273 sensitive
hsa-miR-132-3p N-(4-aziridinylbutyl)-1,3-diaminopropane 160395 NSC658397 resistant
hsa-miR-132-3p N-(6-methyl-1,3-benzothiazol-2-yl)-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1h-2-benzofuran-1-yl)butanamide 369455 NSC641225 sensitive
hsa-miR-132-3p N-[(e)-(2,4-dihydroxyphenyl)methylideneamino]-3-[[2-(trifluoromethyl)pyridin-4-yl]amino]benzamide 135968269 NSC748262 resistant
hsa-miR-132-3p N-[(E)-(2,4-dihydroxyphenyl)methylideneamino]-8-ethoxy-4-hydroxy-1-oxo-6-phenyl-2H-2,7-naphthyridine-3-carboxamide 135968282 NSC747284 resistant
hsa-miR-132-3p N-[(e)-(5-chloro-2-hydroxyphenyl)methylideneamino]-2-[[2-(trifluoromethyl)pyridin-4-yl]amino]benzamide 135968273 NSC747459 resistant
hsa-miR-132-3p N-[(e)-[4-(diethylamino)-2-hydroxyphenyl]methylideneamino]-2-[[2-(trifluoromethyl)pyridin-4-yl]amino]benzamide 135968272 NSC747458 resistant
hsa-miR-132-3p N-[(e)-[4-(diethylamino)-2-hydroxyphenyl]methylideneamino]-4-[[2-(trifluoromethyl)pyridin-4-yl]amino]benzamide 135968274 NSC747460 resistant
hsa-miR-132-3p N-[(E)-1-(6-methylpyridin-2-yl)ethylideneamino]-3-azabicyclo[3.2.2]nonane-3-carbothioamide 5464837 NSC335789 resistant
hsa-miR-132-3p N-[(Z)-[[4-[bis(2-cyanoethyl)amino]-2-methylphenyl]-[(4-methoxyphenyl)diazenyl]methylidene]amino]benzamide 135493921 NSC681972 sensitive
hsa-miR-132-3p N-[2-(hydrazinecarbonyl)-4-nitrophenyl]adamantane-1-carboxamide 5472393 NSC718359 resistant
hsa-miR-132-3p N-[3-[2-[(7-chloroquinolin-4-yl)amino]ethyl-ethylamino]propyl]-2-[7-(dimethylamino)-2-oxochromen-4-yl]acetamide 49856402 NSC754328 sensitive
hsa-miR-132-3p N-[4-[(2-methoxy-11-oxo-6a,7,8,9-tetrahydropyrrolo[2,1-c][1,4]benzodiazepin-3-yl)oxy]butyl]-1h-indole-2-carboxamide 20826874 NSC726365 resistant
hsa-miR-132-3p N-[4-[hydroxy(methyl)amino]-6-(propylamino)-1,3,5-triazin-2-yl]-n-methylhydroxylamine 45029482 NSC746928 resistant
hsa-miR-132-3p Naphth[2,3-d]oxazol-9-one, 2-methyl-4-(phenylimino)- 160386 NSC650573 sensitive
hsa-miR-132-3p Naphthalene-1,2-dione, 1,2-dihydro-4-[(3-pyridinyl)amino]- 367787 NSC637729 sensitive
hsa-miR-132-3p Neuro_000310 368991 NSC640500 resistant
hsa-miR-132-3p Pan (van) 6825 NSC5332 resistant
hsa-miR-132-3p Questiomycin a 72725 NSC94945 sensitive
hsa-miR-132-3p Resorufin 69462 NSC12097 sensitive
hsa-miR-132-3p S-(3,5-dioxo-2h-1,2,4-triazin-6-yl) phenazine-1-carbothioate 403975 NSC719923 sensitive
hsa-miR-132-3p Toddalin 5351594 NSC76023 sensitive
hsa-miR-132-3p Tributylgermyl 3-oxo-3-phenyl-propanoate 16683249 NSC653557 sensitive
hsa-miR-132-3p Tributyrin 6050 NSC661583 resistant
hsa-miR-132-3p Tris(1,10-phenanthroline)lanthanum(iii)-trithiocyanate 24202211 NSC632737 resistant
hsa-miR-132-3p Tris(1,10-phenanthroline)neodymium(iii)-trithiocyanate 24202207 NSC632730 resistant
hsa-miR-132-3p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-132-3p Doxorubicin 31703 NSC123127 approved resistant High Ovarian Cancer cell line (OV19, TOV21G, TOV112D, FUOV1, C13, OV2008, A2780CP, A2780S, IGROV1, T8, OVCAR5, IMCC3, A2008, OVCAR3, SKOV3, IOSER)
hsa-miR-132-3p Verapamil 2520 NSC272366 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-132-3p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-132-3p Cisplatin 5460033 NSC119875 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-132-3p Temozolomide 5394 NSC362856 approved resistant High Glioblastoma cell line (U251MG, U251R, U87MG, M059K, M059J)
hsa-miR-132-3p Imatinib 5291 NSC743414 approved resistant High Myelogenous Leukemia cell line (MYL)
hsa-miR-132-3p 10-Hydroxycamptothecin 97226 NSC107124 resistant High Gastric Cancer cell line (BGC823, SGC-7901, MGC-803, HGC-27, NCI-N87, AGS)
hsa-miR-132-3p Paroxetine 43815 approved sensitive High Normal lymphoblastoid cell line
hsa-miR-132-3p Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (H358, H1993)
hsa-miR-132-3p Chemotherapy resistant High Osteosarcoma tissue
hsa-miR-132-3p Fluorouracil 3385 NSC19893 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-132-3p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-132-3p Gefitinib 123631 NSC715055 approved resistant High Lung Adenocarcinoma cell line (A549)
hsa-miR-132-3p Plx-4720 24180719 NSC757438 resistant High Thyroid Cancer cell line (8505c, BCPAP)
hsa-miR-132-3p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-132-3p Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-132-3p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-miR-132-3p Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (TAMR1)
hsa-miR-132-3p Cisplatin 5460033 NSC119875 approved resistant Low Gastric Cancer cell line (MKN45, MKN28)
hsa-miR-132-3p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-132-3p Temozolomide 5394 NSC362856 approved resistant Low Glioblastoma cell line (U87MG)
hsa-miR-132-3p Cisplatin 5460033 NSC119875 approved sensitive Low Nasopharyngeal Cancer cell line (CNE2)
hsa-miR-132-3p Doxorubicin 31703 NSC123127 approved resistant Low Breast Cancer tissue and cell line (MCF-7)
hsa-miR-132-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-132-3p Panobinostat 6918837 NSC761190 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-132-3p Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (2uM)
hsa-miR-132-3p Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (200nM)
hsa-miR-132-3p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-miR-132-3p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (500nM)
hsa-miR-132-3p Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (500nM)
hsa-miR-132-3p Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-miR-132-3p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (2uM)
hsa-miR-132-3p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (200nM)
hsa-miR-132-3p Gefitinib 123631 NSC715055 approved resistant High Non-Small Cell Lung Cancer tissue
hsa-miR-132-3p Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer cell line (SKVO3ip1, HeyA8)
hsa-miR-132-3p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-miR-132-3p Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-miR-132-3p Cetuximab + Folfox(Fluorouracil + Leucovorin + Oxaliplatin) resistant High Metastatic Colorectal Cancer tissue
hsa-miR-132-3p Trastuzumab resistant High Breast Cancer cell line (MDA‐MB‐231, SKBR3, HEK‐293T)
hsa-miR-132-3p Fluorouracil 3385 NSC19893 approved resistant High Gastric Cancer cell line (MGC-803)
hsa-miR-132-3p Cisplatin 5460033 NSC119875 approved sensitive Low Oral Cancer cell line (CAL-27)
hsa-miR-132-3p Sorafenib 216239 NSC747971 approved sensitive Low Hepatocellular Carcinoma cell line (MHCC97)
hsa-miR-132-3p Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer cell line (SKOV3ip1, HeyA8)
hsa-miR-132-3p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CP20)
hsa-miR-132-3p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CIS)
hsa-miR-132-3p Etoposide 36462 NSC141540 approved sensitive Low Breast Cancer cell line
hsa-miR-132-3p Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-132-3p Antiepileptic Drug sensitive High Pediatric Epilepsy tissue
hsa-miR-132-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)
hsa-miR-132-3p Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-132-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-132-3p Paclitaxel 36314 NSC125973 approved resistant cell line (HeyA8)
hsa-miR-132-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM17)
hsa-miR-132-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-132-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-132-3p Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-132-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-132-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-miR-132-3p Ribavirin+Pegylated IFNa-2b resistant tissue (chronic hepatitis C)
hsa-miR-132-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-132-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-132-3p Fluorouracil 3385 NSC19893 approved resistant cell line (HCT15)
hsa-miR-132-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-132-3p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-132-3p Sunitinib 5329102 NSC750690 approved sensitive tissue (CardA)
hsa-miR-132-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-132-3p Tamoxifen 2733525 NSC180973 approved resistant cell line (TamR1)
hsa-miR-132-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-132-3p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-132-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-132-3p Cetuximab resistant tissue (colorectal carcinoma)
hsa-miR-132-3p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine sensitive cell line (Bats-72)
hsa-miR-132-3p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide sensitive cell line (Bads-200)

Error report submission