miRTarBase - #MIRT006946


—
pre-miRNA Information
pre-miRNA hsa-mir-148a   
Genomic Coordinates chr7: 25949919 - 25949986
Description Homo sapiens miR-148a stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-148a-3p
Sequence 44| UCAGUGCACUACAGAACUUUGU |65
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs772747528 2 dbSNP
rs1290582082 8 dbSNP
rs370090919 11 dbSNP
rs771952261 13 dbSNP
rs1249161151 16 dbSNP
rs748063984 19 dbSNP
rs774196394 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ACVR1   
Synonyms ACTRI, ACVR1A, ACVRLK2, ALK2, FOP, SKR1, TSRI
Description activin A receptor type 1
Transcript NM_001105   
Other Transcripts NM_001111067   
Expression
Putative miRNA Targets on ACVR1
3'UTR of ACVR1
(miRNA target sites are highlighted)		 
>ACVR1|NM_001105|3'UTR
   1 CATTTTCATAGTGTCAAGAAGGAAGATTTGACGTTGTTGTCATTGTCCAGCTGGGACCTAATGCTGGCCTGACTGGTTGT
  81 CAGAATGGAATCCATCTGTCTCCCTCCCCAAATGGCTGCTTTGACAAGGCAGACGTCGTACCCAGCCATGTGTTGGGGAG
 161 ACATCAAAACCACCCTAACCTCGCTCGATGACTGTGAACTGGGCATTTCACGAACTGTTCACACTGCAGAGACTAATGTT
 241 GGACAGACACTGTTGCAAAGGTAGGGACTGGAGGAACACAGAGAAATCCTAAAAGAGATCTGGGCATTAAGTCAGTGGCT
 321 TTGCATAGCTTTCACAAGTCTCCTAGACACTCCCCACGGGAAACTCAAGGAGGTGGTGAATTTTTAATCAGCAATATTGC
 401 CTGTGCTTCTCTTCTTTATTGCACTAGGAATTCTTTGCATTCCTTACTTGCACTGTTACTCTTAATTTTAAAGACCCAAC
 481 TTGCCAAAATGTTGGCTGCGTACTCCACTGGTCTGTCTTTGGATAATAGGAATTCAATTTGGCAAAACAAAATGTAATGT
 561 CAGACTTTGCTGCATTTTACACATGTGCTGATGTTTACAATGATGCCGAACATTAGGAATTGTTTATACACAACTTTGCA
 641 AATTATTTATTACTTGTGCACTTAGTAGTTTTTACAAAACTGCTTTGTGCATATGTTAAAGCTTATTTTTATGTGGTCTT
 721 ATGATTTTATTACAGAAATGTTTTTAACACTATACTCTAAAATGGACATTTTCTTTTATTATCAGTTAAAATCACATTTT
 801 AAGTGCTTCACATTTGTATGTGTGTAGACTGTAACTTTTTTTCAGTTCATATGCAGAACGTATTTAGCCATTACCCACGT
 881 GACACCACCGAATATATTACTGATTTAGAAGCAAAGATTTCAGTAGAATTTTAGTCCTGAACGCTACGGGGAAAATGCAT
 961 TTTCTTCAGAATTATCCATTACGTGCATTTAAACTCTGCCAGAAAAAAATAACTATTTTGTTTTAATCTACTTTTTGTAT
1041 TTAGTAGTTATTTGTATAAATTAAATAAACTGTTTTCAAGTCAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uguuucAAGACAU-CACGUGACu 5'
                |||  ||  ||||||| 
Target 5' tttgcaTTCCTTACTTGCACTGt 3'
 434 - 456 148.00 -9.70
2 
miRNA  3' uguuucAAGACAUCACGUGAcu 5'
                |||| || ||||||  
Target 5' cttctcTTCTTTATTGCACTag 3'
 406 - 427 144.00 -8.90
3 
miRNA  3' uguUUCAAGACAU------CACGUGAcu 5'
             || || | ||      |||||||  
Target 5' tgcAAATTATTTATTACTTGTGCACTta 3'
 637 - 664 133.00 -8.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
331687 45 ClinVar
331686 47 ClinVar
894786 137 ClinVar
331685 138 ClinVar
331684 152 ClinVar
893875 182 ClinVar
331683 183 ClinVar
331682 210 ClinVar
331681 250 ClinVar
331680 314 ClinVar
331679 358 ClinVar
331678 421 ClinVar
331677 500 ClinVar
331676 686 ClinVar
331675 711 ClinVar
893590 751 ClinVar
893589 752 ClinVar
331674 762 ClinVar
331673 791 ClinVar
331672 1037 ClinVar
COSN30120401 4 COSMIC
COSN30465976 21 COSMIC
COSN8607770 57 COSMIC
COSN19323090 78 COSMIC
COSN31587043 145 COSMIC
COSN30169329 146 COSMIC
COSN7111773 182 COSMIC
COSN31961730 186 COSMIC
COSN31566972 187 COSMIC
COSN31489485 266 COSMIC
COSN6199695 282 COSMIC
COSN31550447 315 COSMIC
COSN31532018 477 COSMIC
COSN31544610 500 COSMIC
COSN8607769 559 COSMIC
COSN31549388 608 COSMIC
COSN1801275 645 COSMIC
COSN28807717 686 COSMIC
COSN29378177 695 COSMIC
COSN31521861 835 COSMIC
COSN26720844 937 COSMIC
COSN31579567 983 COSMIC
COSN29478840 994 COSMIC
COSN31961729 1031 COSMIC
COSN27734587 1063 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1311812201 4 dbSNP
rs781127382 6 dbSNP
rs376866118 9 dbSNP
rs746945657 11 dbSNP
rs1253125514 15 dbSNP
rs1012967269 17 dbSNP
rs776697456 32 dbSNP
rs372186308 33 dbSNP
rs758395702 39 dbSNP
rs748669145 41 dbSNP
rs144706255 42 dbSNP
rs12936 45 dbSNP
rs55667327 47 dbSNP
rs111369903 52 dbSNP
rs1410642419 54 dbSNP
rs1182312694 60 dbSNP
rs1464590419 89 dbSNP
rs1328702875 93 dbSNP
rs561712664 94 dbSNP
rs1471416772 104 dbSNP
rs1302011891 111 dbSNP
rs1376762075 112 dbSNP
rs1245498605 113 dbSNP
rs898044003 126 dbSNP
rs1198519670 127 dbSNP
rs1296154267 132 dbSNP
rs1056734226 133 dbSNP
rs903012282 134 dbSNP
rs1462802482 135 dbSNP
rs540607379 137 dbSNP
rs2228948 138 dbSNP
rs779415845 143 dbSNP
rs1188664373 144 dbSNP
rs564603454 151 dbSNP
rs373670847 152 dbSNP
rs914999358 153 dbSNP
rs1477812889 155 dbSNP
rs1268798832 157 dbSNP
rs755441071 163 dbSNP
rs988177743 171 dbSNP
rs1430842849 173 dbSNP
rs915295515 174 dbSNP
rs753344437 175 dbSNP
rs111262123 182 dbSNP
rs113598201 183 dbSNP
rs963864762 186 dbSNP
rs1289292847 197 dbSNP
rs1273071191 200 dbSNP
rs886054987 210 dbSNP
rs1005393755 211 dbSNP
rs952077165 212 dbSNP
rs1371524297 224 dbSNP
rs1278101784 227 dbSNP
rs869132158 241 dbSNP
rs1210380846 242 dbSNP
rs886054986 250 dbSNP
rs1264428606 254 dbSNP
rs1488230122 256 dbSNP
rs370548182 260 dbSNP
rs1327470534 265 dbSNP
rs1432394455 270 dbSNP
rs1387488842 274 dbSNP
rs185021658 281 dbSNP
rs192640402 283 dbSNP
rs1401942494 286 dbSNP
rs755809571 287 dbSNP
rs993880693 289 dbSNP
rs1158994830 295 dbSNP
rs11537712 303 dbSNP
rs1359718928 313 dbSNP
rs140005003 314 dbSNP
rs1057102836 315 dbSNP
rs1346079431 316 dbSNP
rs750143912 320 dbSNP
rs552727071 325 dbSNP
rs1003783195 330 dbSNP
rs1274399875 347 dbSNP
rs1454956444 352 dbSNP
rs919514633 357 dbSNP
rs79598188 358 dbSNP
rs778388468 366 dbSNP
rs1287159282 371 dbSNP
rs1353376958 373 dbSNP
rs963552928 378 dbSNP
rs556674021 386 dbSNP
rs1464567066 391 dbSNP
rs1452705623 396 dbSNP
rs1248882903 411 dbSNP
rs1244519237 419 dbSNP
rs1012692605 420 dbSNP
rs761727358 421 dbSNP
rs774031962 433 dbSNP
rs1310574837 448 dbSNP
rs1276387143 457 dbSNP
rs1437522197 461 dbSNP
rs946892754 476 dbSNP
rs1218620492 487 dbSNP
rs1165257616 495 dbSNP
rs893516693 499 dbSNP
rs886054985 500 dbSNP
rs1322935276 501 dbSNP
rs1225924573 502 dbSNP
rs1363926340 507 dbSNP
rs1052216154 526 dbSNP
rs1289155959 529 dbSNP
rs764026690 534 dbSNP
rs1348256341 535 dbSNP
rs1444482508 536 dbSNP
rs1310210900 539 dbSNP
rs1376443325 544 dbSNP
rs1238354173 546 dbSNP
rs1317677313 547 dbSNP
rs1357635696 548 dbSNP
rs879007609 549 dbSNP
rs374226813 580 dbSNP
rs1288377086 582 dbSNP
rs1439003276 583 dbSNP
rs1198736045 594 dbSNP
rs1237131725 598 dbSNP
rs1456216819 600 dbSNP
rs1185198409 601 dbSNP
rs761891914 607 dbSNP
rs758573643 608 dbSNP
rs898189933 611 dbSNP
rs1472412178 613 dbSNP
rs1161338721 629 dbSNP
rs1432274859 638 dbSNP
rs1421606932 639 dbSNP
rs570500098 645 dbSNP
rs1467188382 656 dbSNP
rs552239569 657 dbSNP
rs1332964872 660 dbSNP
rs1336535283 662 dbSNP
rs1341397600 670 dbSNP
rs371191871 675 dbSNP
rs1282876896 678 dbSNP
rs12997 686 dbSNP
rs1041627116 687 dbSNP
rs1167024635 691 dbSNP
rs763630396 694 dbSNP
rs569061476 701 dbSNP
rs550878134 711 dbSNP
rs942556250 716 dbSNP
rs1256444301 718 dbSNP
rs1420473933 719 dbSNP
rs911151956 722 dbSNP
rs983928034 738 dbSNP
rs892994646 739 dbSNP
rs1236939230 746 dbSNP
rs1478139596 747 dbSNP
rs952596523 750 dbSNP
rs1028134399 752 dbSNP
rs1485927607 757 dbSNP
rs112908089 762 dbSNP
rs771038233 767 dbSNP
rs1174494909 768 dbSNP
rs1051731069 769 dbSNP
rs55910418 774 dbSNP
rs933326394 781 dbSNP
rs1332678746 782 dbSNP
rs1295821571 786 dbSNP
rs962342395 788 dbSNP
rs74392193 791 dbSNP
rs1401189851 793 dbSNP
rs1266711796 798 dbSNP
rs546726288 805 dbSNP
rs1003501531 818 dbSNP
rs972328613 831 dbSNP
rs905418943 842 dbSNP
rs549730791 843 dbSNP
rs1236387173 844 dbSNP
rs200167578 849 dbSNP
rs1283029438 853 dbSNP
rs1414866795 856 dbSNP
rs1488564860 859 dbSNP
rs909413916 860 dbSNP
rs1260981016 865 dbSNP
rs188849936 878 dbSNP
rs958443580 879 dbSNP
rs537875315 881 dbSNP
rs1011004860 889 dbSNP
rs773479227 890 dbSNP
rs967033112 895 dbSNP
rs1362898531 897 dbSNP
rs1420716073 898 dbSNP
rs1020139175 902 dbSNP
rs1011475453 906 dbSNP
rs1301430724 921 dbSNP
rs564435054 942 dbSNP
rs935134909 943 dbSNP
rs546234496 948 dbSNP
rs1413364678 951 dbSNP
rs1354102008 966 dbSNP
rs1323622409 968 dbSNP
rs1215633889 972 dbSNP
rs1188665319 978 dbSNP
rs370651066 982 dbSNP
rs183253908 983 dbSNP
rs1211715493 994 dbSNP
rs1259517200 998 dbSNP
rs1202999536 1008 dbSNP
rs563436073 1009 dbSNP
rs113986328 1010 dbSNP
rs1480284995 1012 dbSNP
rs1251621650 1013 dbSNP
rs1432801569 1015 dbSNP
rs772193844 1027 dbSNP
rs879138488 1029 dbSNP
rs886054984 1037 dbSNP
rs202170149 1051 dbSNP
rs942358423 1056 dbSNP
rs1196961230 1061 dbSNP
rs1382429481 1062 dbSNP
rs1206374316 1074 dbSNP
rs911120673 1082 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HeLa , A549
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... miR-148a directly targets human ACVR1 3' UTR. ...

- Song H; Wang Q; Wen J; Liu S; Gao X; Cheng et al., 2012, International journal of molecular sciences.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uguuucAAGACAU-CACGUGACu 5'
                |||  ||  ||||||| 
Target 5' uuugcaUUCCUUACUUGCACUGu 3'
 		1 - 23
Article - Song H; Wang Q; Wen J; Liu S; Gao X; Cheng et al.
- International journal of molecular sciences, 2012
Fibrodysplasia ossificans progressiva (FOP) is a rare congenital disorder of skeletal malformations and progressive extraskeletal ossification. There is still no effective treatment for FOP. All FOP individuals harbor conserved point mutations in ACVR1 gene that are thought to cause ACVR1 constitutive activation and activate BMP signal pathway. The constitutively active ACVR1 is also found to be able to cause endothelial-to-mesenchymal transition (EndMT) in endothelial cells, which may cause the formation of FOP lesions. MicroRNAs (miRNAs) play an essential role in regulating cell differentiation. Here, we verified that miR-148a directly targeted the 3' UTR of ACVR1 mRNA by reporter gene assays and mutational analysis at the miRNA binding sites, and inhibited ACVR1 both at the protein level and mRNA level. Further, we verified that miR-148a could inhibit the mRNA expression of the Inhibitor of DNA binding (Id) gene family thereby suppressing the BMP signaling pathway. This study suggests miR-148a is an important mediator of ACVR1, thus offering a new potential target for the development of therapeutic agents against FOP.
LinkOut: [PMID: 22408438]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions MHCC97H , SMMC7721
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... "A receptor type 1 (ACVR1) expression was significantly negatively correlated with miR-148a and was significantly differentially expressed in Cluster 1 and Cluster 2 (Fig. 3B). We validated this regulation by using a reporter gene assay in which the luciferase activity was decreased when cotransfection of MHCC97H cells with the pmirGLO-ACVR1 30UTR-Luc construct and an miR- 148a mimic (Fig. 3C). Consistent with this was our finding that many of the direct downstream targets of the Wnt signaling pathway (e.g. ...

- Li L; Liu Y; Guo Y; Liu B; Zhao Y; Li P; et al., 2015, Hepatology (Baltimore, Md.).

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uguuucaagacaucACGUGACu 5'
                        ||||||| 
Target 5' --------------UGCACUG- 3'
 		1 - 7
Article - Li L; Liu Y; Guo Y; Liu B; Zhao Y; Li P; et al.
- Hepatology (Baltimore, Md.), 2015
UNLABELLED: Hepatocellular carcinoma (HCC) is the fifth most common malignancy worldwide and the third most common cancer in Asia. HCC has heterogeneous etiologic and molecular profiles and a varied response to therapeutics. The high recurrence rate and curtailed survival in this cancer are attributed to its resistance to therapy. The ultimate goal is to develop a more effective personalized therapeutic strategy for HCC, but the first step is to develop a system for classifying the disease on the basis of molecular biomarkers. To that end, we performed mRNA and microRNA (miRNA) expression profiling in 100 HCC tissues. Clustering analysis of informative genes identified two robust subtypes, which were validated by an independent dataset. The subtype characterized by a cancer stem cell-like signature was clinically aggressive and associated with poor survival. Integrated analysis of miRNA and mRNA expression in this subtype showed that miR-148a was expressed at a significantly lower level in these tumors than in the other subtype. MiR-148a has been shown to directly suppress the expression of activin A receptor type 1 (ACVR1), a key receptor in the signaling pathway of the bone morphogenetic proteins (BMPs), which regulate many stem cell markers as well as the clinically important cytokine interleukin-8 (IL-8). Increased expression of ACVR1 and its downstream genes EPCAM, CD24, CD90, and IL-8 was associated with shorter survival in a larger cohort of 227 HCC cases. Introduction of miR-148a resulted in suppressed tumor phenotypes both in vitro and in vivo. CONCLUSION: We identified a clinically aggressive stem cell-like subtype of HCC that is characterized by an miR-148a-ACVR1-BMP-Wnt circuit. We propose that miR-148a may serve as a prognostic biomarker and therapeutic target for this subtype of HCC.
LinkOut: [PMID: 25271001]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.645 1.1e-3 0.756 5.8e-5 20 Click to see details
GSE28544 Breast cancer 0.592 1.2e-3 0.504 6.0e-3 24 Click to see details
GSE21687 Ependynoma primary tumors 0.367 1.4e-3 0.276 1.4e-2 64 Click to see details
GSE27834 Pluripotent stem cells -0.535 1.6e-2 -0.529 1.8e-2 16 Click to see details
GSE19350 CNS germ cell tumors 0.543 3.4e-2 0.149 3.2e-1 12 Click to see details
GSE19783 ER- ER- breast cancer 0.174 6.3e-2 0.083 2.3e-1 79 Click to see details
GSE42095 Differentiated embryonic stem cells 0.256 1.2e-1 0.000 5.0e-1 23 Click to see details
GSE19536 Breast cancer 0.113 1.3e-1 0.052 3.0e-1 100 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.412 1.4e-1 -0.500 8.5e-2 9 Click to see details
GSE17498 Multiple myeloma -0.171 1.5e-1 -0.088 2.9e-1 40 Click to see details
GSE14794 Lymphoblastoid cells -0.092 1.9e-1 -0.023 4.1e-1 90 Click to see details
GSE17306 Multiple myeloma -0.101 2.4e-1 -0.108 2.3e-1 49 Click to see details
GSE19783 ER+ ER+ breast cancer 0.136 2.8e-1 0.047 4.2e-1 20 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.117 2.9e-1 0.111 3.0e-1 25 Click to see details
GSE26953 Aortic valvular endothelial cells 0.115 3.0e-1 0.141 2.6e-1 24 Click to see details
GSE21849 B cell lymphoma -0.092 3.2e-1 0.269 7.9e-2 29 Click to see details
GSE32688 Pancreatic cancer 0.044 4.1e-1 -0.003 4.9e-1 32 Click to see details
GSE28260 Renal cortex and medulla 0.073 4.1e-1 0.132 3.3e-1 13 Click to see details
GSE21032 Prostate cancer 0.009 4.7e-1 0.003 4.9e-1 83 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.017 4.7e-1 -0.033 4.4e-1 25 Click to see details
GSE38226 Liver fibrosis 0.018 4.7e-1 0.031 4.5e-1 21 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PRAD -0.559 0 -0.630 0 50 Click to see details
LIHC -0.395 0 -0.192 0.09 49 Click to see details
STAD -0.464 0 -0.377 0.02 32 Click to see details
KICH -0.397 0.02 -0.472 0.01 25 Click to see details
HNSC 0.289 0.03 0.332 0.02 42 Click to see details
BLCA -0.356 0.07 -0.350 0.08 18 Click to see details
UCEC -0.314 0.1 -0.342 0.08 19 Click to see details
THCA -0.157 0.12 -0.189 0.08 59 Click to see details
CHOL -0.399 0.14 -0.400 0.14 9 Click to see details
CESC 0.788 0.21 0.500 0.33 3 Click to see details
KIRP 0.143 0.22 0.139 0.22 32 Click to see details
PAAD 0.554 0.22 0.400 0.3 4 Click to see details
LUAD 0.241 0.23 0.182 0.29 12 Click to see details
ESCA 0.192 0.29 0.345 0.15 11 Click to see details
COAD -0.206 0.31 -0.143 0.37 8 Click to see details
LUSC -0.037 0.41 -0.062 0.36 38 Click to see details
BRCA 0.003 0.49 0.028 0.4 84 Click to see details
KIRC -0.001 0.5 -0.028 0.41 68 Click to see details
PCPG 0.004 0.5 0.500 0.33 3 Click to see details
PCPG 0.004 0.5 0.500 0.33 3 Click to see details
PCPG 0.004 0.5 0.500 0.33 3 Click to see details
205 hsa-miR-148a-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000020 DNMT1 DNA methyltransferase 1 7 7
MIRT000297 HLA-G major histocompatibility complex, class I, G 2 1
MIRT000298 TGIF2 TGFB induced factor homeobox 2 3 2
MIRT000955 DNMT3B DNA methyltransferase 3 beta 5 2
MIRT003998 NR1I2 nuclear receptor subfamily 1 group I member 2 7 2
MIRT004504 RPS6KA5 ribosomal protein S6 kinase A5 4 1
MIRT005898 CCKBR cholecystokinin B receptor 4 3
MIRT006859 IRS1 insulin receptor substrate 1 2 1
MIRT006946 ACVR1 activin A receptor type 1 2 2
MIRT006975 BCL2 BCL2, apoptosis regulator 1 1
MIRT007017 TMED7 transmembrane p24 trafficking protein 7 1 1
MIRT025970 GPATCH8 G-patch domain containing 8 1 1
MIRT025971 TMEM14A transmembrane protein 14A 1 1
MIRT025972 ANP32A acidic nuclear phosphoprotein 32 family member A 1 1
MIRT025973 RAB1B RAB1B, member RAS oncogene family 1 1
MIRT025974 HSP90B1 heat shock protein 90 beta family member 1 1 1
MIRT025975 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT025976 CYCS cytochrome c, somatic 1 1
MIRT025977 ADARB1 adenosine deaminase, RNA specific B1 1 1
MIRT025978 CBX3 chromobox 3 1 1
MIRT025979 UQCRQ ubiquinol-cytochrome c reductase complex III subunit VII 1 1
MIRT025980 SPRY2 sprouty RTK signaling antagonist 2 1 1
MIRT025981 PAN3 PAN3 poly(A) specific ribonuclease subunit 1 1
MIRT025982 KANSL1 KAT8 regulatory NSL complex subunit 1 1 1
MIRT025983 GAS1 growth arrest specific 1 2 6
MIRT025984 PTPN4 protein tyrosine phosphatase, non-receptor type 4 1 1
MIRT025985 ZNF92 zinc finger protein 92 1 1
MIRT025986 RAB10 RAB10, member RAS oncogene family 1 1
MIRT025987 PAPD4 poly(A) RNA polymerase D4, non-canonical 2 3
MIRT025988 HCCS holocytochrome c synthase 1 1
MIRT025989 WAPAL WAPL cohesin release factor 1 1
MIRT025990 MPP5 membrane palmitoylated protein 5 1 1
MIRT025991 ZNF490 zinc finger protein 490 1 1
MIRT025992 RAB12 RAB12, member RAS oncogene family 2 3
MIRT025993 GNB5 G protein subunit beta 5 1 1
MIRT025994 SNAPIN SNAP associated protein 2 3
MIRT025995 PSMD9 proteasome 26S subunit, non-ATPase 9 1 1
MIRT025996 TRIM59 tripartite motif containing 59 1 1
MIRT025997 DYNLL2 dynein light chain LC8-type 2 1 1
MIRT025998 SECISBP2L SECIS binding protein 2 like 2 6
MIRT025999 LYSMD1 LysM domain containing 1 1 1
MIRT026000 PBXIP1 PBX homeobox interacting protein 1 2 2
MIRT026001 MTMR9 myotubularin related protein 9 1 1
MIRT026002 DNAJB4 DnaJ heat shock protein family (Hsp40) member B4 1 1
MIRT026003 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT026004 LBR lamin B receptor 1 1
MIRT026005 KIAA1549 KIAA1549 1 1
MIRT026006 DYRK1A dual specificity tyrosine phosphorylation regulated kinase 1A 1 1
MIRT026007 CDK19 cyclin dependent kinase 19 2 3
MIRT026008 RAB34 RAB34, member RAS oncogene family 2 3
MIRT026009 ARRDC3 arrestin domain containing 3 1 1
MIRT026010 PRNP prion protein 2 1
MIRT026011 HOXC8 homeobox C8 4 1
MIRT026012 TMEM9B TMEM9 domain family member B 1 1
MIRT026013 RASSF8 Ras association domain family member 8 1 1
MIRT026014 BTBD3 BTB domain containing 3 2 12
MIRT026015 TNRC6A trinucleotide repeat containing 6A 2 3
MIRT026016 SESTD1 SEC14 and spectrin domain containing 1 1 1
MIRT026017 CDC25B cell division cycle 25B 3 1
MIRT048023 MRPL45 mitochondrial ribosomal protein L45 1 1
MIRT048024 DENR density regulated re-initiation and release factor 1 1
MIRT048025 APPBP2 amyloid beta precursor protein binding protein 2 1 1
MIRT048026 SLC2A3 solute carrier family 2 member 3 1 1
MIRT048027 PTPN23 protein tyrosine phosphatase, non-receptor type 23 1 1
MIRT048028 VPS41 VPS41, HOPS complex subunit 1 1
MIRT048029 MSL3 MSL complex subunit 3 1 1
MIRT048030 AMELX amelogenin, X-linked 1 1
MIRT048031 OR2C3 olfactory receptor family 2 subfamily C member 3 1 1
MIRT048032 SLC25A3 solute carrier family 25 member 3 1 1
MIRT048033 APC APC, WNT signaling pathway regulator 1 1
MIRT048034 GOLIM4 golgi integral membrane protein 4 1 1
MIRT048035 MYCBP2 MYC binding protein 2, E3 ubiquitin protein ligase 1 1
MIRT048036 RPS17 ribosomal protein S17 1 1
MIRT048037 HSPA4 heat shock protein family A (Hsp70) member 4 1 1
MIRT048038 WDTC1 WD and tetratricopeptide repeats 1 1 1
MIRT048039 HMGB1 high mobility group box 1 1 1
MIRT048040 MAP3K4 mitogen-activated protein kinase kinase kinase 4 4 2
MIRT048041 USP38 ubiquitin specific peptidase 38 1 1
MIRT048042 NONO non-POU domain containing octamer binding 1 1
MIRT048043 CCNI cyclin I 1 1
MIRT048044 AURKB aurora kinase B 1 1
MIRT052917 MMP7 matrix metallopeptidase 7 4 1
MIRT053185 WNT10B Wnt family member 10B 4 1
MIRT053199 MYC MYC proto-oncogene, bHLH transcription factor 2 1
MIRT053475 CDKN1B cyclin dependent kinase inhibitor 1B 4 5
MIRT053477 SERPINE1 serpin family E member 1 3 1
MIRT053478 ITGB8 integrin subunit beta 8 5 3
MIRT053479 VAV2 vav guanine nucleotide exchange factor 2 3 1
MIRT053480 ITGA5 integrin subunit alpha 5 3 1
MIRT053483 ROCK1 Rho associated coiled-coil containing protein kinase 1 6 3
MIRT053518 RUNX3 runt related transcription factor 3 2 1
MIRT053560 SMAD2 SMAD family member 2 3 1
MIRT054115 UNKL unkempt family like zinc finger 1 1
MIRT054388 MET MET proto-oncogene, receptor tyrosine kinase 3 1
MIRT057492 CEP55 centrosomal protein 55 2 4
MIRT062708 MLEC malectin 2 4
MIRT084562 BCL2L11 BCL2 like 11 2 1
MIRT105304 VPS37A VPS37A, ESCRT-I subunit 2 2
MIRT130076 TXNIP thioredoxin interacting protein 4 4
MIRT138426 KIF2C kinesin family member 2C 2 2
MIRT152411 ARID3A AT-rich interaction domain 3A 2 2
MIRT155749 SIK1 salt inducible kinase 1 2 6
MIRT210293 ARL8B ADP ribosylation factor like GTPase 8B 2 2
MIRT218522 HLA-A major histocompatibility complex, class I, A 2 2
MIRT222270 CCT6A chaperonin containing TCP1 subunit 6A 2 2
MIRT270936 GPRC5A G protein-coupled receptor class C group 5 member A 2 2
MIRT280554 GLRX5 glutaredoxin 5 2 2
MIRT281136 PDIA3 protein disulfide isomerase family A member 3 3 1
MIRT296526 STX16 syntaxin 16 2 2
MIRT301572 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT347400 CEBPG CCAAT/enhancer binding protein gamma 2 2
MIRT382244 SH3PXD2A SH3 and PX domains 2A 2 2
MIRT399584 RBM38 RNA binding motif protein 38 2 2
MIRT437409 MAFB MAF bZIP transcription factor B 1 1
MIRT438088 ERRFI1 ERBB receptor feedback inhibitor 1 2 1
MIRT438751 S1PR1 sphingosine-1-phosphate receptor 1 3 3
MIRT438752 USP4 ubiquitin specific peptidase 4 3 1
MIRT453164 CNOT4 CCR4-NOT transcription complex subunit 4 2 6
MIRT456196 ZDHHC6 zinc finger DHHC-type containing 6 2 2
MIRT458103 TTLL1 tubulin tyrosine ligase like 1 2 2
MIRT459958 POC1A POC1 centriolar protein A 2 2
MIRT461329 MRPS27 mitochondrial ribosomal protein S27 2 2
MIRT462848 B4GALT7 beta-1,4-galactosyltransferase 7 2 2
MIRT463247 ZIC5 Zic family member 5 2 2
MIRT464041 WASL Wiskott-Aldrich syndrome like 2 2
MIRT466869 STX6 syntaxin 6 2 2
MIRT467697 SLC38A2 solute carrier family 38 member 2 2 4
MIRT468920 RPS6KA4 ribosomal protein S6 kinase A4 2 2
MIRT469506 RCC2 regulator of chromosome condensation 2 2 2
MIRT469815 RAB14 RAB14, member RAS oncogene family 2 2
MIRT470329 PPP6R1 protein phosphatase 6 regulatory subunit 1 2 2
MIRT473770 MAP3K9 mitogen-activated protein kinase kinase kinase 9 5 3
MIRT477363 EOGT EGF domain specific O-linked N-acetylglucosamine transferase 2 4
MIRT478215 DDX6 DEAD-box helicase 6 2 2
MIRT479812 CCNA2 cyclin A2 2 6
MIRT484939 ZFYVE26 zinc finger FYVE-type containing 26 2 4
MIRT485432 KLF6 Kruppel like factor 6 9 3
MIRT485645 DICER1 dicer 1, ribonuclease III 2 4
MIRT487938 HLA-C major histocompatibility complex, class I, C 3 2
MIRT488937 ETV7 ETS variant 7 2 2
MIRT492821 PATL1 PAT1 homolog 1, processing body mRNA decay factor 2 2
MIRT496749 PDIK1L PDLIM1 interacting kinase 1 like 2 2
MIRT497883 SLC12A7 solute carrier family 12 member 7 2 2
MIRT500918 STARD13 StAR related lipid transfer domain containing 13 2 4
MIRT503176 AGO2 argonaute 2, RISC catalytic component 2 4
MIRT505102 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 2 2
MIRT505256 UBE2D3 ubiquitin conjugating enzyme E2 D3 2 2
MIRT511220 LNPEP leucyl and cystinyl aminopeptidase 2 4
MIRT513209 RFT1 RFT1 homolog 2 2
MIRT513617 VPS37B VPS37B, ESCRT-I subunit 2 2
MIRT522804 KPNA4 karyopherin subunit alpha 4 2 4
MIRT525443 RBM23 RNA binding motif protein 23 2 2
MIRT530302 AKAP17A A-kinase anchoring protein 17A 2 2
MIRT531689 MYO3A myosin IIIA 2 2
MIRT537300 FZD5 frizzled class receptor 5 2 2
MIRT541199 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 2
MIRT544732 NDRG1 N-myc downstream regulated 1 2 2
MIRT549174 BMP3 bone morphogenetic protein 3 2 2
MIRT549231 BAZ2B bromodomain adjacent to zinc finger domain 2B 2 2
MIRT551864 ASB6 ankyrin repeat and SOCS box containing 6 2 2
MIRT559687 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT561658 RNF219 ring finger protein 219 2 2
MIRT561856 NPTX1 neuronal pentraxin 1 2 2
MIRT565733 SESN3 sestrin 3 2 2
MIRT566568 OTUD4 OTU deubiquitinase 4 2 2
MIRT567186 IGFBP5 insulin like growth factor binding protein 5 2 2
MIRT567834 DCUN1D3 defective in cullin neddylation 1 domain containing 3 2 2
MIRT574794 FAM104A family with sequence similarity 104 member A 2 2
MIRT576772 Tmem127 transmembrane protein 127 2 2
MIRT610545 WNT2B Wnt family member 2B 2 4
MIRT613042 FOXP1 forkhead box P1 2 2
MIRT615073 COLEC12 collectin subfamily member 12 2 2
MIRT617481 AP5B1 adaptor related protein complex 5 beta 1 subunit 2 2
MIRT622753 PHACTR2 phosphatase and actin regulator 2 2 2
MIRT625516 PPAPDC1A phospholipid phosphatase 4 2 2
MIRT628641 ABLIM1 actin binding LIM protein 1 2 2
MIRT630234 SORD sorbitol dehydrogenase 2 2
MIRT635946 PLA2G12A phospholipase A2 group XIIA 2 2
MIRT646776 IL23R interleukin 23 receptor 2 2
MIRT648163 CHRFAM7A CHRNA7 (exons 5-10) and FAM7A (exons A-E) fusion 2 2
MIRT653244 SOS2 SOS Ras/Rho guanine nucleotide exchange factor 2 5 2
MIRT661182 S1PR2 sphingosine-1-phosphate receptor 2 2 2
MIRT693234 KIAA0907 KIAA0907 2 4
MIRT693776 VGLL2 vestigial like family member 2 2 2
MIRT702589 JARID2 jumonji and AT-rich interaction domain containing 2 2 2
MIRT715175 DTX4 deltex E3 ubiquitin ligase 4 2 2
MIRT722871 FAM212B family with sequence similarity 212 member B 2 2
MIRT723139 YPEL1 yippee like 1 2 2
MIRT723186 OVOL1 ovo like transcriptional repressor 1 2 2
MIRT732353 WNT1 Wnt family member 1 3 1
MIRT732362 STAT3 signal transducer and activator of transcription 3 3 1
MIRT734547 HNRNPK heterogeneous nuclear ribonucleoprotein K 2 0
MIRT734935 CXCR4 C-X-C motif chemokine receptor 4 1 0
MIRT736034 ITGA9 integrin subunit alpha 9 3 0
MIRT736105 PTEN phosphatase and tensin homolog 5 1
MIRT736114 IL15 interleukin 15 2 0
MIRT736501 AKT1 AKT serine/threonine kinase 1 1 0
MIRT737228 PCGEM1 PCGEM1, prostate-specific transcript (non-protein coding) 2 0
MIRT737363 UBAP2 ubiquitin associated protein 2 3 0
MIRT737364 FOXK2 forkhead box K2 3 0
MIRT755397 WNT10A Wnt family member 10A 2 1
MIRT755440 LDLR low density lipoprotein receptor 1 1
MIRT756258 CDK5R1 cyclin dependent kinase 5 regulatory subunit 1 3 1
MIRT756289 SLC7A11 solute carrier family 7 member 11 2 1
MIRT756402 CNTN4 contactin 4 2 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-148a Glucose NULL 5793 Microarray endothelial cells 24394957 2014 up-regulated
miR-148a Hydroxamic acid HDACi LAQ824 NULL NULL Microarray breast cancer cell line SKBr3 16452179 2006 down-regulated
miR-148a Curcumin NULL 969516 Microarray BxPC-3 human pancreatic carcinoma cell line 18347134 2008 down-regulated
miR-148a Bilobalide NULL 73581 Quantitative real-time PCR Human breast cancer MCF-7 cells 21796641 2011 up-regulated
miR-148a Bilobalide NULL 73581 Quantitative real-time PCR human colorectal adenocarcinoma Caco-2 21796641 2011 down-regulated
miR-148a Daidzein NULL 5281708 Quantitative real-time PCR Human breast cancer MCF-7 cells 21796641 2011 up-regulated
miR-148a Dexamethasone approved 5743 Quantitative real-time PCR human colorectal adenocarcinoma Caco-2 21796641 2011 down-regulated
miR-148a Paclitaxel approved 36314 Quantitative real-time PCR Human breast cancer MCF-7 cells 21796641 2011 up-regulated
miR-148a Vinblastine approved 13342 Quantitative real-time PCR Human breast cancer MCF-7 cells 21796641 2011 down-regulated
miR-148a Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-148a 5a-dihydrotestosterone (DHT) NULL 15 Quantitative real-time PCR LNCaP cells 22266859 2012 up-regulated
miR-148a Goserelin approved 47725 Microarray prostate 22674191 2012 up-regulated
miR-148a Celecoxib approved 2662 Microarray gastric cancer cells. 23001726 2013 up-regulated
miR-148a Ginsenoside Rh2 NULL 119307 Microarray NSCLC cell line A549 23152132 2013 up-regulated
miR-148a 17beta-estradiol (E2) approved 5757 Microarray rat breast 17700064 2007 up-regulated
miR-148a Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse liver 19270793 2009 up-regulated
miR-148a Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-148a Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (BGC823)
hsa-mir-148a Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer tissue
hsa-mir-148a Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer tissue
hsa-mir-148a Topotecan 60699 NSC609699 approved resistant cell line (W1)
hsa-mir-148a Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-mir-148a Androstenedione 6128 NSC9563 sensitive cell line (MCF-7)
hsa-mir-148a Androstenedione+Anastrozole resistant cell line (MCF-7)
hsa-mir-148a Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-148a Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-mir-148a Cisplatin 5460033 NSC119875 approved sensitive cell line (BGC-823)
hsa-miR-148a-3p (10,13-dimethyl-3-oxo-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-17-yl) 3-methylidene-2-oxo-6-oxabicyclo[3.1.0]hexane-1-carboxylate 495432 NSC654893 sensitive
hsa-miR-148a-3p (2,3-dihydroxyphenyl)-[1-[(4-fluorophenyl)methyl]-4-hydroxyindol-3-yl]methanone 42624812 NSC746053 sensitive
hsa-miR-148a-3p (2E)-2-[(2-methoxyphenyl)methylidene]-5-(morpholin-4-ylmethyl)cyclopentan-1-one;hydrochloride 6516827 NSC639520 sensitive
hsa-miR-148a-3p (3e)-3-[(3,4-dihydroxyphenyl)methylidene]-6-phenylchromen-4-one 45029091 NSC745449 sensitive
hsa-miR-148a-3p (3z,5z)-3,5-bis[(4-methoxyphenyl)methylidene]-1,1-dimethylpiperidin-1-ium-4-one;iodide 54608638 NSC634792 sensitive
hsa-miR-148a-3p (4r)-4-[(1r,4z,8e,10z,12s,15r,17r)-5,12-dimethyl-3-oxo-17-(2-phenylethoxy)-2,16-dioxabicyclo[13.3.1]nonadeca-4,8,10-trien-17-yl]-1,3-thiazolidin-2-one 46239554 NSC751494 resistant
hsa-miR-148a-3p (4z,5z)-1-[(e)-(2-hydroxyphenyl)methyleneamino]-3-phenyl-4,5-bis(phenylimino)imidazolidine-2-thione 135509182 NSC671409 resistant
hsa-miR-148a-3p (e)-1-(2,5-dihydroxyphenyl)ethene-2-isonitrile NSC632129 sensitive
hsa-miR-148a-3p (E)-1-(7-methoxy-3-methyl-4-oxido-1-oxoquinoxalin-1-ium-2-yl)-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 54612660 NSC741738 resistant
hsa-miR-148a-3p (e)-3-chloro-2-(3,4-dimethoxyphenyl)-3-(3,4-dipropoxyphenyl)prop-2-enal 3004402 NSC650594 sensitive
hsa-miR-148a-3p (e)-but-2-enedioic acid;1-(7,8,9,10-tetrahydrophenanthridin-6-yl)piperidin-4-amine 5471308 NSC710333 sensitive
hsa-miR-148a-3p (E)-but-2-enedioic acid;2-[4-tert-butyl-1-[(4-methylphenyl)methyl]cyclohexyl]oxy-N,N-dimethylethanamine 5351426 NSC670225 sensitive
hsa-miR-148a-3p .beta.-d-glucopyranose, 2,3-o-(diethylstannylene)- 16683462 NSC306911 sensitive
hsa-miR-148a-3p [(10R,13S,16E)-16-[[3-methoxy-4-(2-pyrrolidin-1-ylethoxy)phenyl]methylidene]-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 24203499 NSC728323 sensitive
hsa-miR-148a-3p [(3bR,9aS,11aS)-2-(2-hydroxy-5-oxo-2H-furan-3-yl)-3b,6,6,9a-tetramethyl-2,3,3a,4,5,5a,7,8,9,9b,10,11-dodecahydronaphtho[2,1-e][1]benzofuran-11a-yl]methyl acetate 378635 NSC661428 sensitive
hsa-miR-148a-3p [1,1,1,3,3,3-hexafluoro-2-(quinolin-2-ylmethyl)propan-2-yl] acetate 379602 NSC664303 sensitive
hsa-miR-148a-3p [2-(4-methoxyphenyl)-2-oxoethyl] (2R)-2-[(4-bromo-2-fluorobenzoyl)amino]-3-[[(2R)-2-[(4-bromo-2-fluorobenzoyl)amino]-3-[2-(4-methoxyphenyl)-2-oxoethoxy]-3-oxopropyl]diselanyl]propanoate 45029327 NSC746149 resistant
hsa-miR-148a-3p [4-[[2-(1h-indol-2-yl)-1,3-dioxolan-2-yl]methyl]-1-piperidyl]-phenyl-methanone 398268 NSC707982 sensitive
hsa-miR-148a-3p [7-fluoro-4-oxido-1-oxo-3-(trifluoromethyl)quinoxalin-1-ium-2-yl]-(furan-2-yl)methanone 23635646 NSC736443 sensitive
hsa-miR-148a-3p [acetyl(diphenyl)[?]yl] acetate 363302 NSC628121 sensitive
hsa-miR-148a-3p 1-((4-methylene-5-oxo-2-phenyltetrahydro-2-furanyl)methyl)dihydro-2,4(1h,3h)-pyrimidinedione 381497 NSC668253 sensitive
hsa-miR-148a-3p 1-(naphthalen-1-ylmethyl)-4-[1-(naphthalen-1-ylmethyl)piperidin-4-yl]piperidine 364095 NSC669995 sensitive
hsa-miR-148a-3p 1-[(1e)-2,3,3-trichloro-1-[chloro(nitro)methylene]allyl]piperidine 3004947 NSC665087 sensitive
hsa-miR-148a-3p 1-[(4-fluorophenyl)amino]-2,3-propanopyrido[1,2-a]benzimidazole-4-carbonitrile 395404 NSC699940 resistant
hsa-miR-148a-3p 1-cyclohexyl-3-[(e)-(6-methyl-2-pyridyl)methyleneamino]thiourea 9571907 NSC670782 sensitive
hsa-miR-148a-3p 12-(3,5-ditert-butyl-4-hydroxyphenyl)-1,4,7,10,13,16-hexaoxacyclooctadecane-2,9-dione 386885 NSC679743 resistant
hsa-miR-148a-3p 14,22-dioxa-6,30,36-triazahexacyclo[29.2.2.22,5.116,20.08,13.023,28]octatriaconta-1(34),2(38),3,5(37),6,8,10,12,16(36),17,19,23,25,27,29,31(35),32-heptadecaene 388224 NSC682817 resistant
hsa-miR-148a-3p 17-methyl-13,14,17-triazatetracyclo[8.7.0.02,7.011,16]heptadeca-1(10),2,4,6,8,11(16),14-heptaen-12-one 403909 NSC719502 resistant
hsa-miR-148a-3p 2-(2-naphthyl)-4-phenyl-5,7-dihydropyrido[3,2-d][1]benzazepin-6-one 388200 NSC682768 resistant
hsa-miR-148a-3p 2-(2-naphthyl)-5,7-dimethyl-1,8-naphthyridin-4(1h)-one 5468909 NSC679021 sensitive
hsa-miR-148a-3p 2-(2,4-dichlorobenzyl)-3,5,6-trimethyl-2h-indazole-7-carbonitrile 367590 NSC637422 resistant
hsa-miR-148a-3p 2-(3-chlorophenyl)-4-phenyl-5,7-dihydropyrido[3,2-d][1]benzazepin-6-one 389012 NSC684480 resistant
hsa-miR-148a-3p 2-(3-chlorophenyl)-4-phenyl-5,7-dihydropyrido[3,2-d][1]benzazepine-6-thione 4998423 NSC684481 resistant
hsa-miR-148a-3p 2-(3-methylbutylsulfanyl)naphthalene-1,4-dione 315743 NSC241494 sensitive
hsa-miR-148a-3p 2-(3-phenyl-4,5-bis(phenylimino)-1,3-thiazolidin-2-ylidene)malononitrile 383253 NSC671367 sensitive
hsa-miR-148a-3p 2-(3,5-di-tert-butyl-4-methoxybenzyl)cyclopent-4-ene-1,3-dione 403662 NSC718730 sensitive
hsa-miR-148a-3p 2-(4-isothiocyanatophenyl)sulfanylacetic acid 345648 NSC403376 sensitive
hsa-miR-148a-3p 2-(6-ethenyl-4-hydroxy-6-methyl-3-methylidene-2-oxo-4,5,7,7a-tetrahydro-3aH-1-benzofuran-7-yl)prop-2-enal 495207 NSC645991 sensitive
hsa-miR-148a-3p 2-[(dimethylamino)methyl]-1-(2-nitrophenyl)prop-2-en-1-one 411522 NSC34821 sensitive
hsa-miR-148a-3p 2-[(dimethylamino)methyl]-1-(2,5-dimethylphenyl)prop-2-en-1-one 436059 NSC382001 sensitive
hsa-miR-148a-3p 2-[(dimethylamino)methyl]cyclopentan-1-one 244760 NSC621888 sensitive
hsa-miR-148a-3p 2-[(z)-2-(benzenesulfonyl)-2-(5-nitrofuran-2-yl)ethenyl]-5-nitrofuran 6072945 NSC291049 sensitive
hsa-miR-148a-3p 2-[(Z)-2-[3-[3-methoxy-5-(trifluoromethyl)phenyl]-1,2,4-triazol-1-yl]ethenyl]-1,3,4-oxadiazole 57524026 NSC757569 sensitive
hsa-miR-148a-3p 2-[5-[4-[5-[4-(6-morpholin-4-yl-1H-benzimidazol-2-yl)phenoxy]pentyl]piperazin-1-yl]pentyl]benzo[de]isoquinoline-1,3-dione 44219118 NSC743432 sensitive
hsa-miR-148a-3p 2-acetamido-6-methyl-8-hydroxy-1,4-naphthaquinone 377214 NSC658450 sensitive
hsa-miR-148a-3p 2-amino-6-[4-[[4,6-bis(4-chloroanilino)-1,3,5-triazin-2-yl]amino]phenyl]-4-(4-methoxyphenyl)pyridine-3-carbonitrile 45028694 NSC743853 sensitive
hsa-miR-148a-3p 2-nitro-1-phenylpropan-1-ol 226118 NSC16258 sensitive
hsa-miR-148a-3p 2,3-bis(naphthalen-2-ylsulfanyl)naphthalene-1,4-dione 312602 NSC222722 sensitive
hsa-miR-148a-3p 2,5,9,12-tetrathiabicyclo[11.4.0]heptadeca-1(13),14,16-triene-15,16-dicarbonitrile 387185 NSC680721 resistant
hsa-miR-148a-3p 2,6-bis(4-morpholinylmethyl)cyclohexanone,dihydrochloride NSC38535 sensitive
hsa-miR-148a-3p 2,6-bis[(dimethylamino)methyl]cyclohexan-1-one;hydrochloride 358899 NSC619042 sensitive
hsa-miR-148a-3p 3-(3-chloro-4-methoxyphenyl)-N-[2-(dimethylamino)ethyl]-4-pyridin-4-ylpyrazole-1-carboxamide 60147896 NSC752885 resistant
hsa-miR-148a-3p 3-(4-chlorophenyl)-6-(5-nitrofuran-2-yl)-7H-[1,2,4]triazolo[3,4-b][1,3,4]thiadiazine 364212 NSC629974 sensitive
hsa-miR-148a-3p 3-[2-[(3,5-dichlorophenyl)amino]thiazol-4-yl]chromen-2-one 395985 NSC701109 resistant
hsa-miR-148a-3p 3-[2-[[5-[(4-bromophenyl)diazenyl]-2-hydroxyphenyl]-phenylsulfanylmethyl]hydrazinyl]-3-oxo-n-phenylpropanamide 377943 NSC659611 sensitive
hsa-miR-148a-3p 3-bromo-1-oxo-2-phenylthiochromen-4-one 5472015 NSC715997 sensitive
hsa-miR-148a-3p 3-chloro-4-methyl-7-((2-methyl-4-methylene-5-oxotetrahydro-2-furanyl)methoxy)-2h-chromen-2-one 381507 NSC668263 sensitive
hsa-miR-148a-3p 3-deazaneplanocin, hydrochloride 358176 NSC617989 sensitive
hsa-miR-148a-3p 4-(1-(4-aminophenyl)-3,4-diphenyl-1h-1.lambda.~4~-thien-1-yl)phenylamine 392992 NSC694234 resistant
hsa-miR-148a-3p 4-(2-(((6-bromo-1,3-benzodioxol-5-yl)methyl)amino)ethyl)phenol 290548 NSC154572 sensitive
hsa-miR-148a-3p 4-(2-azidophenothiazin-10-yl)-N,N-dimethylbutan-1-amine;oxalic acid 385933 NSC677395 sensitive
hsa-miR-148a-3p 4-[3-(4-chlorophenyl)-5-(2,5-dimethoxyphenyl)pyrazol-1-yl]benzenesulfonamide 24204421 NSC731805 sensitive
hsa-miR-148a-3p 4-amino-2-(4-chloroanilino)-5-(4-chlorobenzoyl)-n-phenyl-1h-pyrrole-3-carbothioamide 5472776 NSC721531 resistant
hsa-miR-148a-3p 4-amino-3,5-dichloro-n-(3-(4-(2-methoxyphenyl)-1-piperazinyl)propyl)benzamide 379857 NSC664993 sensitive
hsa-miR-148a-3p 4-morpholinecarbodithioic acid, antimony complex NSC625498 sensitive
hsa-miR-148a-3p 5-[2-(4-methoxyphenyl)ethyl]-1,2,3-dimethoxy benzene NSC631356 sensitive
hsa-miR-148a-3p 5,6,11,12-tetramethyl-5,5a,6,11,11a,12-hexahydroquinoxalino[2,3-b]quinoxaline 365519 NSC633207 sensitive
hsa-miR-148a-3p 5,7-dihydroquinolino[3,2-d][1]benzazepine-6-thione 3005168 NSC679092 resistant
hsa-miR-148a-3p 6-(3-azidopropyl)-2,3-dimethoxy-5,11-dioxoindeno[1,2-c]isoquinoline-9-carbonitrile 17755511 NSC734749 resistant
hsa-miR-148a-3p 7-chloro-5-hydroxy-2-methoxy-2,4-dimethyl-1H-benzo[e][1]benzofuran-6,9-dione 359534 NSC620517 sensitive
hsa-miR-148a-3p 7-hydroxystaurosporine 5351376 NSC638646 resistant
hsa-miR-148a-3p 8-{[(3as)-2-methylhexahydro-1h-pyrrolo[1,2-c][1,3,2]diazaphosphol-1-yl]oxy}quinoline 402496 NSC716522 sensitive
hsa-miR-148a-3p 8-fluoro-11-methyl-1h-benzo[a]carbazole-1,4(11h)-dione 381772 NSC668844 sensitive
hsa-miR-148a-3p 8b-hydroxy-9b,10b-epoxyverrucarin a 5351311 NSC328166 sensitive
hsa-miR-148a-3p 9-chlorobenzo[c]quinolizin-11-ium-6-amine;chloride 386894 NSC679796 sensitive
hsa-miR-148a-3p 9-isobutyl-6-(((2-methyl-1-naphthyl)methyl)thio)-9h-purin-2-amine 244996 NSC56452 sensitive
hsa-miR-148a-3p 9h-purine, 2-amino-6-(2,4-dichlorobenzylthio)-9-isobutyl- 240896 NSC47786 sensitive
hsa-miR-148a-3p Ab01327238-02 6892730 NSC670969 sensitive
hsa-miR-148a-3p Acetamide, n-(2-mercaptoethyl)-, benzoate (6ci, 7ci) 281604 NSC134459 sensitive
hsa-miR-148a-3p Aj-131/36477019 384476 NSC674278 resistant
hsa-miR-148a-3p Aspiculamycin hcl 5458423 NSC200692 resistant
hsa-miR-148a-3p Auranofin 6333901 NSC321521 sensitive
hsa-miR-148a-3p Baccharin 5358645 NSC269757 sensitive
hsa-miR-148a-3p Benzene, 1,1'-[(1,3-butadiene-1,4-diyl)sulfonyl]bis 5468033 NSC662781 sensitive
hsa-miR-148a-3p Caracemide 54747 NSC253272 sensitive
hsa-miR-148a-3p Cbmicro_021216 812842 NSC707055 sensitive
hsa-miR-148a-3p Chimaphilin 101211 NSC400245 sensitive
hsa-miR-148a-3p Cis-amminedichloro(4-methoxyphenethylamine)platinum(ii) 498559 NSC631306 sensitive
hsa-miR-148a-3p Compactin 2854 NSC281245 resistant
hsa-miR-148a-3p Copper;(ne,3z)-n-[1-(6-methylpyridazin-3-yl)ethylidene]-3-azabicyclo[3.2.2]nonane-3-carbohydrazonothioate 9578854 NSC633271 sensitive
hsa-miR-148a-3p Cyanocycline a 100158 NSC349644 sensitive
hsa-miR-148a-3p Cycloalkannin 133408 NSC301457 sensitive
hsa-miR-148a-3p Cyclopentanone, 2,5-bis[(trimethylamino)methyl]-, iodide 360925 NSC623639 sensitive
hsa-miR-148a-3p Cytembena 23663958 NSC104801 sensitive
hsa-miR-148a-3p D.b.t.c. 12688 NSC2604 sensitive
hsa-miR-148a-3p Dasatinib 3062316 NSC732517 approved resistant
hsa-miR-148a-3p Dibutyl(bis((3-(2-fluorophenyl)acryloyl)oxy))stannane 16683204 NSC643860 sensitive
hsa-miR-148a-3p Dichloroallyl lawsone 277767 NSC126771 sensitive
hsa-miR-148a-3p Dichlorodipropyltin 93562 NSC92618 sensitive
hsa-miR-148a-3p Dichloroiron;(NE,1E)-N-(1-pyridin-2-ylethylidene)azepane-1-carbohydrazonothioate 9578789 NSC338304 sensitive
hsa-miR-148a-3p Diethyl 2-[[4-(3-phenylquinoxalin-2-yl)oxybenzoyl]amino]pentanedioate 390812 NSC688814 resistant
hsa-miR-148a-3p Diketocoriolin b 294475 NSC163027 sensitive
hsa-miR-148a-3p Enhydrin a 5359029 NSC294601 sensitive
hsa-miR-148a-3p Entinostat 4261 NSC706995 sensitive
hsa-miR-148a-3p Ethanone, 1-(2-pyrimidinyl)-, (2-benzoxazolyl)hydrazone 9572051 NSC693639 sensitive
hsa-miR-148a-3p Ethyl 3-[[5-[(e)-3-methoxy-3-oxoprop-1-enyl]-1h-imidazol-4-yl]diazenyl]benzoate 135436270 NSC716679 sensitive
hsa-miR-148a-3p Ethyl 3-benzyl-2-methyl-4,5-dioxobenzo[e]indole-1-carboxylate 406008 NSC723888 sensitive
hsa-miR-148a-3p Ethyl 7-(3,4-difluorophenyl)-10-methylsulfanyl-2-thia-5,7,9,11-tetrazatricyclo[6.3.1.04,12]dodeca-1(11),3,8(12),9-tetraene-3-carboxylate 399952 NSC711104 resistant
hsa-miR-148a-3p Gold(1+), bis(trimethylphosphine)-, chloride 6333886 NSC313985 sensitive
hsa-miR-148a-3p Gtpl8141 44478401 NSC752203 resistant
hsa-miR-148a-3p Gw410563a 10425574 NSC756225 resistant
hsa-miR-148a-3p Gw559768x 9927432 NSC756251 resistant
hsa-miR-148a-3p Gw612286x 9822610 NSC756278 resistant
hsa-miR-148a-3p Gw643971x 135778715 NSC756297 resistant
hsa-miR-148a-3p Insariotoxin 6711181 NSC138780 sensitive
hsa-miR-148a-3p Isodonol 317640 NSC250682 sensitive
hsa-miR-148a-3p J7x181m78y 395460 NSC700023 resistant
hsa-miR-148a-3p Ldn-211904 46175113 NSC751644 resistant
hsa-miR-148a-3p Ls-123342 5469111 NSC683328 sensitive
hsa-miR-148a-3p Methyl 1-[[N-[(3-methoxycarbonyl-5-methylpyrazol-1-yl)methyl]anilino]methyl]-5-methylpyrazole-3-carboxylate 404564 NSC720860 sensitive
hsa-miR-148a-3p Methyl 2-[(2e)-2-[(2,6-dichlorophenyl)methylidene]hydrazinyl]-5-(3,4,5-trimethoxyphenyl)-1h-pyrrole-3-carboxylate 45029264 NSC745940 resistant
hsa-miR-148a-3p Methyl N-[(E)-1-pyridin-2-ylethylideneamino]carbamodithioate 5947235 NSC251190 sensitive
hsa-miR-148a-3p Methylene blue 6099 NSC617593 approved sensitive
hsa-miR-148a-3p N'-[1-(1-benzothiophen-2-yl)cyclohexyl]-n-methylpropane-1,3-diamine;(e)-but-2-enedioic acid 54611499 NSC708074 sensitive
hsa-miR-148a-3p N-(((2-methoxy-5-(trifluoromethyl)anilino)carbonyl)oxy)butanimidoyl chloride 9556202 NSC672059 sensitive
hsa-miR-148a-3p N-(2-((((4-methoxyphenyl)diazenyl)carbonyl)amino)-4-methylpentanoyl)phenylalanine 386436 NSC678404 sensitive
hsa-miR-148a-3p N-(2,5-dimethylphenyl)-2-(3-oxo-4H-1,4-benzothiazin-2-yl)acetamide 366111 NSC634398 resistant
hsa-miR-148a-3p N-(3-chloro-1,4-dioxonaphthalen-2-yl)-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1H-2-benzofuran-1-yl)butanamide 369463 NSC641233 sensitive
hsa-miR-148a-3p N-(4-methoxyphenyl)-3-[4-[(4-methylphenyl)diazenyl]-3,5-diphenylpyrazol-1-yl]-3-oxopropanamide 367846 NSC637921 resistant
hsa-miR-148a-3p N-[(1E)-1-(1-hydroxypyridin-2-ylidene)ethyl]iminoazepane-1-carbothioamide 5369124 NSC351075 sensitive
hsa-miR-148a-3p N-[(e)-(5-chloro-2-hydroxyphenyl)methylideneamino]-2-[[2-(trifluoromethyl)pyridin-4-yl]amino]benzamide 135968273 NSC747459 sensitive
hsa-miR-148a-3p N-[2-(1H-indol-3-yl)ethyl]-1,1-dioxo-2-(3-propan-2-yloxyphenyl)-4H-pyrido[4,3-e][1,2,4]thiadiazin-3-imine 135426715 NSC710895 sensitive
hsa-miR-148a-3p N-[4-[2-(2,4-dinitrophenyl)-3-(3-ethoxy-4-hydroxyphenyl)-3,4-dihydropyrazol-5-yl]phenyl]-2-methyl-5-nitrobenzenesulfonamide 402369 NSC716281 resistant
hsa-miR-148a-3p N-[4-[hydroxy(methyl)amino]-6-(propylamino)-1,3,5-triazin-2-yl]-n-methylhydroxylamine 45029482 NSC746928 sensitive
hsa-miR-148a-3p N,N'-bis(3-aminopropyl)-N,N'-dibenzylbutane-1,4-diamine;2,2,2-trifluoroacetic acid 389631 NSC685976 resistant
hsa-miR-148a-3p N,N-dimethyl-4-[(Z)-(6-methylindolo[1,2-b]indazol-6-ium-11-ylidene)methyl]aniline;trifluoromethanesulfonate 5471987 NSC715775 sensitive
hsa-miR-148a-3p Navan 941650 NSC108165 sensitive
hsa-miR-148a-3p Neuro_000327 16683203 NSC643859 sensitive
hsa-miR-148a-3p NSC600301 NSC600301 sensitive
hsa-miR-148a-3p NSC607281 NSC607281 sensitive
hsa-miR-148a-3p NSC621335 NSC621335 sensitive
hsa-miR-148a-3p NSC621339 NSC621339 sensitive
hsa-miR-148a-3p NSC625496 NSC625496 sensitive
hsa-miR-148a-3p NSC641052 NSC641052 sensitive
hsa-miR-148a-3p NSC716032 NSC716032 sensitive
hsa-miR-148a-3p Oridonin (thiol adduct of) 432952 NSC319730 sensitive
hsa-miR-148a-3p Oxin 1923 NSC2039 approved sensitive
hsa-miR-148a-3p Phenol, 4,4'-(5,5'-biisoxazole-3,3'-diyl)bis- 386651 NSC679108 sensitive
hsa-miR-148a-3p Physalin f 433531 NSC661115 sensitive
hsa-miR-148a-3p Pmp (van) 72508 NSC1906 sensitive
hsa-miR-148a-3p Pyrazino[1,2-a]benzimidazole, 1,3-diphenyl- 384474 NSC674276 resistant
hsa-miR-148a-3p Quinolin-8-yl 6-(chloromethyl)-2-oxo-2h-chromene-3-carboxylate 402508 NSC716535 sensitive
hsa-miR-148a-3p Sergeolide,desacetyl 125729 NSC364170 sensitive
hsa-miR-148a-3p Staurosporine 5459111 NSC618487 resistant
hsa-miR-148a-3p Stk386853 5291187 NSC65628 sensitive
hsa-miR-148a-3p Streptovaricin b 135443622 NSC156215 sensitive
hsa-miR-148a-3p Tetraplatin 13920603 NSC363812 sensitive
hsa-miR-148a-3p Trimethyl-[(1-oxo-3,4-dihydro-2H-naphthalen-2-yl)methyl]azanium;iodide 375929 NSC656280 sensitive
hsa-miR-148a-3p U-22265 265952 NSC102810 sensitive
hsa-miR-148a-3p Ver a 5351232 NSC126728 sensitive
hsa-miR-148a-3p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-148a-3p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-148a-3p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (PC-3)
hsa-miR-148a-3p Imatinib 5291 NSC743414 approved sensitive High Myelogenous Leukemia cell line (MYL)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Squamous Cell Carcinoma cell line (KYSE410)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Adenocarcinoma cell line (OE19)
hsa-miR-148a-3p Fluorouracil 3385 NSC19893 approved sensitive Low Adenocarcinoma cell line (OE19)
hsa-miR-148a-3p Fluorouracil 3385 NSC19893 approved sensitive Low Squamous Cell Carcinoma cell line (KYSE410)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved resistant Low Squamous Cell Carcinoma cell line (SCC-11)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved sensitive High Pan-Cancer cell line (NCI-H460, NCI-H522, NCI-H322M, HOP62, A549, EKVX, MALME-3M, NCI-H226, HT-29, HCT-116, SE-620, HCT-15, HCC2998, COLO205, HS-578T, NCI/ADR-RES, OVCAR8, OVCAR4, ACHN, SN-12C, 786-O, CAKI-1, UO-31, TK-10, A498, SK-MEL-28, UACC-257, M14, UACC-62, SK
hsa-miR-148a-3p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-148a-3p Vincristine 5978 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-148a-3p Doxorubicin 31703 NSC123127 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-148a-3p Chemotherapy sensitive High Epithelial Ovarian Cancer tissue
hsa-miR-148a-3p Docetaxel 148124 NSC628503 approved sensitive High Prostate Cancer cell line (22Rv1, DU-145, PC-3,22Rv1RD, DU-145RD, PC-3RD)
hsa-miR-148a-3p Docetaxel 148124 NSC628503 approved sensitive High Prostate Cancer cell line (PC-3)
hsa-miR-148a-3p Gefitinib 123631 NSC715055 approved resistant High Lung Adenocarcinoma cell line (A549)
hsa-miR-148a-3p Doxorubicin 31703 NSC123127 approved sensitive High Hepatocellular Carcinoma tissue and cell line (HepG2)
hsa-miR-148a-3p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR20
hsa-miR-148a-3p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-148a-3p Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-148a-3p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Ductal Adenocarcinoma cell line (PANC-1, MIA-PaCa-2)
hsa-miR-148a-3p Aromatase Inhibitor resistant Low Breast Cancer cell line (MCF-7)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved resistant High Gallbladder Cancer cell line (GBC-SD, NOZ)
hsa-miR-148a-3p Tamoxifen 2733525 NSC180973 approved sensitive Low ER-Positive Breast Cancer cell line (MCF-7)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Renal Cell Cancer cell line (Caki)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Gastric Cancer cell line (BGC823, SGC7901)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Esophageal Squamous Cell Carcinoma cell line (KYSE-70, KYSE-140, KYSE-180, KYSE-270, KYSE-410, KYSE-520)
hsa-miR-148a-3p Fluorouracil 3385 NSC19893 approved sensitive Low Esophageal Squamous Cell Carcinoma cell line (KYSE-70, KYSE-140, KYSE-180, KYSE-270, KYSE-410, KYSE-520)
hsa-miR-148a-3p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7C)
hsa-miR-148a-3p Doxorubicin 31703 NSC123127 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Esophageal Adenocarcinoma cell line (MCF-7, MDA-MB-231)
hsa-miR-148a-3p Fluorouracil 3385 NSC19893 approved sensitive Low Esophageal Adenocarcinoma cell line (MCF-7, MDA-MB-231)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved resistant Low Prostate Cancer cell line (VCaP-R)
hsa-miR-148a-3p Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (WM266) (2uM)
hsa-miR-148a-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (WM266) (2uM)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Colorectal Cancer cell line (SW480)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer cell line (SKVO3ip1, HeyA8)
hsa-miR-148a-3p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7, MCF-7-CC, MCF-7-TT, MCF-7-21)
hsa-miR-148a-3p Vincristine 5978 approved sensitive High Diffuse Large B-Cell Lymphoma cell line (DB, NU-DHL-1, NU-DUL-1, MC-116, SU-DHL-5, FARAGE, HBL-1, OCI-Ly3, OCI-Ly7, OCI-Ly19, RIVA, SU DHL-8, U2932)
hsa-miR-148a-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1, PANC-1)
hsa-miR-148a-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-148a-3p Bromocriptine 31101 NSC169774 approved sensitive Low Prolactinoma tissue
hsa-miR-148a-3p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-miR-148a-3p Cyclophosphamide 2907 NSC26271 approved resistant High Diffuse Large B-Cell Lymphoma cell line (DB, NU-DHL-1, NU-DUL-1, MC-116, SU-DHL-4, SU-DHL-5, FARAGE, HBL-1, OCI-Ly3, OCI-Ly7, OCI-Ly8, OCI-Ly19, RIVA, SU-DHL-8, U2932)
hsa-miR-148a-3p Vincristine 5978 approved sensitive High Diffuse Large B-Cell Lymphoma cell line (DB, NU-DHL-1, NU-DUL-1, MC-116, SU-DHL-4, SU-DHL-5, FARAGE, HBL-1, OCI-Ly3, OCI-Ly7, OCI-Ly8, OCI-Ly19, RIVA, SU-DHL-8, U2932)
hsa-miR-148a-3p Gefitinib 123631 NSC715055 approved sensitive High Non-Small Cell Lung Cancer cell line (HCC827)
hsa-miR-148a-3p Rhamnetin 5281691 NSC19802 sensitive Low Hepatocellular Carcinoma cell line (MHCC97-H, HepG2)
hsa-miR-148a-3p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer cell line (HeLa, SiHa)
hsa-miR-148a-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-148a-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (A375)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (total RNA)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (cytosolic RNA)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (mitochondrial RNA)
hsa-miR-148a-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved resistant cell line
hsa-miR-148a-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-148a-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM11)
hsa-miR-148a-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-148a-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-148a-3p Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-148a-3p Ribavirin+Pegylated IFNa-2b sensitive tissue (chronic hepatitis C)
hsa-miR-148a-3p Exemestane 60198 NSC713563 approved sensitive cell line (MCF-7)
hsa-miR-148a-3p Testosterone+Exemestane sensitive cell line (MCF-7)
hsa-miR-148a-3p Testosterone+Letrozole sensitive cell line (MCF-7)
hsa-miR-148a-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-miR-148a-3p Fluorouracil 3385 NSC19893 approved sensitive cell line (HCT15)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-148a-3p 4-Hydroxytamoxifen+Tamoxifen sensitive cell line (LY2)
hsa-miR-148a-3p Ethanol+Tamoxifen sensitive cell line (LY2)
hsa-miR-148a-3p Pegylated interferon alpha+Ribavirin sensitive tissue (chronic hepatitis C)
hsa-miR-148a-3p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-148a-3p Tamoxifen 2733525 NSC180973 approved sensitive cell line (TamR1)
hsa-miR-148a-3p Gemcitabine 60750 NSC613327 approved resistant cell line (MDA-231)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR20)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-148a-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-148a-3p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-148a-3p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR3)
hsa-miR-148a-3p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (H23)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (H460)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-148a-3p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved resistant cell line (OVSAHO)

Error report submission